Title:
KALLIKREIN 7 MODULATORS
Kind Code:
A1


Abstract:
The present invention relates to the crystal structure of the serine protease kallikrein 7 and to the use of this crystal structure in drug discovery. The present invention also relates to compounds binding specifically to this active site of kallikrein 7.



Inventors:
Flohr, Stefanie (Basel, CH)
Randl, Stefan Andreas (Basel, CH)
Ostermann, Nils (Basel, CH)
Hassiepen, Ulrich (Basel, CH)
Berst, Frederic (Basel, CH)
Bodendorf, Ursula (Basel, CH)
Gerhartz, Bernd (Basel, CH)
Marzinzik, Andreas (Basel, CH)
Ehrhardt, Claus (Basel, CH)
Meingassner, Josef Gottfried (Vienna, AT)
Application Number:
13/649089
Publication Date:
01/31/2013
Filing Date:
10/10/2012
Assignee:
NOVARTIS AG (Basel, CH)
Primary Class:
Other Classes:
435/188, 435/219, 514/235.5, 514/254.01, 514/307, 514/326, 514/330, 514/339, 514/343, 514/412, 514/422, 514/423, 544/141, 544/372, 546/146, 546/208, 546/226, 546/276.7, 546/277.1, 546/278.1, 546/279.1, 548/515, 548/517, 548/525, 548/538, 703/1, 435/7.8
International Classes:
C07D207/16; A61K31/40; A61K31/4025; A61K31/403; A61K31/4439; A61K31/445; A61K31/454; A61K31/472; A61K31/496; A61K31/5377; A61K49/00; A61P1/00; A61P1/18; A61P17/00; A61P17/02; A61P17/04; A61P17/06; A61P17/10; A61P29/00; A61P35/00; C07D209/52; C07D211/60; C07D217/26; C07D401/12; C07D403/12; C07D405/12; C07D409/12; C07D413/12; C12N9/50; C12N9/96; G01N21/64; G01N33/53; G06F17/50
View Patent Images:



Primary Examiner:
COUGHLIN, MATTHEW P
Attorney, Agent or Firm:
NOVARTIS INSTITUTES FOR BIOMEDICAL RESEARCH, INC. (Cambridge, MA, US)
Claims:
1. A crystal of human kallikrein 7 comprising the binding pocket having a three-dimensional structure characterized by the structure coordinates of Table 3.

2. The crystal of claim 1 further comprising a co-crystallised ligand.

3. A computer readable medium comprising data storage material encoded with computer readable data wherein said data comprises the structure coordinates of a crystal according to claim 1.

4. Use of a crystal according to any one of claim 1 or 2, for the generation of crystal structure data.

5. A method of identifying a ligand that binds to kallikrein 7 comprising the steps of: (i) generating a three dimensional structure data using the crystal structure data of claim 1 to select and/or design a potential ligand that binds to kallikrein 7, and (ii) identifying among the potential ligand selected in step (i), those ligands that bind to kallikrein 7 in an in vitro, in vivo or cell-based assay.

6. A modulator of kallikrein 7 characterised in that it binds in the binding pocket having a three-dimensional structure characterized by the structure coordinates of Table 3.

7. A modulator of kallikrein 7 as defined in claim 6 characterised in that it is a compound of formula embedded image Or a salt thereof wherein R1 is hydrogen, cyano, (C1-8)alkyl, (C2-8)alkenyl, (C2-8)alkynyl, halogen, (C1-8)alkylamino, (C1-8)alkylamino(C1-8)alkyl, (C1-8)alkoxy, halo(C1-8)alkyl, X is CH═CH, NH, N═CH, O or S, Y is a group of formula embedded image wherein the N-containing ring system is optionally annelated with (C3-8)cycloalkyl, (C8-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S, n is 1, 2 or 3, R2 is (C1-8)alkyl, (C1-8)alkylamino, (C1-8)alkylamino(C1-8)alkyl, di(C1-8)alkylamino(C1-8)alkyl, halo(C1-8)alkyl, (C1-8)alkoxy, (C1-8)alkoxy(C1-8)alkyl, or (CH2)m-Z, wherein Z is unsubstituted or substituted (C3-8)cycloalkyl, (C8-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, Si; and m is 0, 1 or 2, R3 is hydrogen, (C1-8)alkyl, (C1-8)alkoxy, (C8-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S.

8. A compound according to claim 7, wherein R1 is hydrogen, ethynyl, chloro or bromo, X is CH═CH or S, Y is a group of formula (II), wherein the N-containing ring system is optionally annelated with cyclopropyl, cyclopentyl or phenyl, n is 1 or 2, R2 is (C1-8)alkyl, (C1-4alkylamino, di(C1-4)alkylamino(C1-4)alkyl, (C1-4)alkoxy, (C1-4)alkoxy(C1-4)alkyl or a group (CH2)m-Z, wherein Z is unsubstituted cyclohexyl, unsubstituted phenyl, phenyl substituted by (C1-4)alkoxy, phenyl substituted by heterocyclyl having 6 ring members and 1 or 2 heteroatoms selected from N, O, or unsubstituted or substituted heterocyclyl having 6 ring members and 1 or 2 heteroatoms selected from N, 0; m is 1 or 2, R3 is hydrogen or (C1-4)alkoxy.

9. A compound of claim 7, wherein Y is a group of formula (II), wherein the N-containing ring system is optionally annelated with cyclopropyl, cyclopentyl or phenyl, R2 is methyl, dimethylaminoethyl, methoxyethyl, or a group (CH2)m-Z, wherein Z is unsubstituted cyclohexyl, unsubstituted phenyl, phenyl substituted by methoxy, piperazinyl or morpholinyl; pyridinyl, piperidinyl, tetrahydrofuranyl, unsubstituted piperazinyl or piperazinyl substituted by methyl or phenyl, and m, n, R1, R3 and X are as defined above.

10. A compound of claim 7 in the form of a salt.

11. A compound of claim 7 for use as a pharmaceutical.

12. A pharmaceutical composition comprising a compound of claim 7 in association with at least one pharmaceutical excipient.

13. A method of treating disorders mediated by kallikrein-7 activity, which treatment comprises administering to a subject in need of such treatment an effective amount of a compound of claim 7.

14. 14-15. (canceled)

16. The method of claim 14 wherein said disorder which is mediated by kallikrein-7 activity is selected from the group consisting of inflammatory and/or hyperpoliferative and pruritic skin diseases such as keloids, hypertrophic scars, acne, atopic dermatitis, psoriasis, pustular psoriasis, rosacea, Netherton's syndrome or other pruritic dermatoses such as prurigo nodularis, unspecified itch of the elderly as well as other diseases with epithelial barrier dysfunction such as aged skin, inflammatory bowel disease and Crohn's disease, as well as pancreatitis, or of cancer, in particular ovarian cancer.

Description:

FIELD OF THE INVENTION

The present invention relates to the crystal structure of the serine protease kallikrein 7 and to the use of this crystal structure in drug discovery. The present invention also relates to compounds binding specifically to this active site of kallikrein 7.

BACKGROUND OF THE INVENTION

Kallikrein 7 is a S1 serine protease of the kallikrein gene family displaying a chymotrypsin like activity. Human kallikrein 7 (hK7, KLK7 or stratum corneum chymotryptic enzyme (SCCE), Swissprot P49862) is mainly expressed in the skin and appears to play an important role in skin physiology (1, 2, 3). hK7 is involved in the degradation of the intercellular cohesive structure in cornified squamous epithelia in the process of desquamation. The desquamation process is well regulated and delicately balanced with the de novo production of corneocytes to maintain a constant thickness of the stratum corneum. In this regard, hK7 is reported to be able to cleave the corneodesmosomal proteins corneodesmosin and desmocollin 1 (4, 5, 6). In addition, recently it has been shown that the two lipid processing enzymes β-glucocerebrosidase and acidic sphingomyelinase can be degraded by hK7 (7). Both lipid processing enzymes are co-secreted with their substrates glucosylceramides and sphingomyelin and process these polar lipid precursors into their more non-polar products e.g. ceramides, which are subsequently incorporated into the extracellular lamellar membranes. The lamellar membrane architecture is critical for a functional skin barrier. Finally, hK7 has been shown to activate the pro-inflammatory cytokine Pro-interleukin-1β (IL-1β) (8) and to (in)activate cathelicidines (hCAP18) which regulate an important defense mechanism to prevent infections against a wide variety of microbial pathogens (34).

Recent studies link an increased activity of hK7 to inflammatory skin diseases like atopic dermatitis, psoriasis or Netherton's syndrome. An increased hK7 activity might lead to an uncontrolled degradation of corneodesmosomes resulting in a miss-regulated desquamation, an enhanced degradation of lipid processing enzymes resulting in a disturbed lamellar membrane architecture or an uncontrolled (in)activation of the pro-inflammatory cytokine IL-1β or the cathilicidin hCAP18. The net result could lead to an impaired skin barrier function and inflammation (see also WO-A-2004/108139).

The hK7 activity is controlled on several levels. Various factors might be responsible for an increased hK7 activity in inflammatory skin diseases. Firstly, the amount of protease being expressed might be influenced by genetic factors. Such a genetic link, a polymorphism in the 3′-UTR in the hK7 gene, was recently described (9). The authors hypothesis that the described 4 base pair insertion in the 3′-UTR of the kallikrein 7 gene stabilizes the hK7 mRNA and results in an overexpression of hK7. Secondly, since hK7 is secreted via lamellar bodies to the stratum corneum extracellular space as zymogen and it is not able to autoactivate, it needs to be activated by another protease e.g. kallikrein 5 (5). Uncontrolled activity of such an activating enzyme might result in an overactivation of hK7. Thirdly, activated hK7 can be inhibited by natural inhibitors like LEKTI, ALP or elafin (10, 11). The decreased expression or the lack of such inhibitors might result in an enhanced activity of hK7. Recently it was found, that mutations in the spink5 gene, coding for LEKTI, are causative for Netherton's syndrome (12) and a single point mutation in the gene is linked to atopic dermatitis (13, 14). Finally, another level of controlling the activity of hK7 is the pH. hK7 has a neutral to slightly alkaline pH optimum (2) and there is a pH gradient from neutral to acidic from the innermost to the outermost layers in the skin. Environmental factors like soap might result in a pH increase in the outermost layers of the stratum corneum towards the pH optimum of hK7 thereby increasing the hK7 activity.

The hypothesis that an increased activity of hK7 is linked to inflammatory skin diseases is supported by the following studies: Firstly, Netherton's syndrome patients show a phenotype dependent increase in serine protease activity, a decrease in corneodesmosomes, a decrease in the lipid processing enzymes (3-glucocerebrosidase and acidic sphingomyelinase, and an impaired barrier function (15, 16). Secondly, a transgenic mice overexpressing human kallikrein 7 shows a skin phenotype similar to that found in patients with atopic dermatitis (17, 18, 19). Thirdly, in the skin of atopic dermatitis and psoriasis patients elevated levels of hK7 were described (17, 20).

Therefore, hK7 is considered to be a potential target for the treatment of inflammatory skin diseases like atopic dermatitis, psoriasis or Netherton's syndrome and there is a need for specific modulators (agonists or inhibitors) thereof.

In order to fulfill this need, the present inventors have developed methods for cloning, expression, purification and crystallization of hK7, and have been able to obtain for the first time the structure of human kallikrein 7 at a very high resolution.

This structure of human kallikrein 7 at a very high resolution has allowed for the identification of the active site of the enzyme, and compounds binding specifically to said active site of kallikrein 7.

SUMMARY OF THE INVENTION

In order to fulfill the needs identified herein-above, the present inventors have developed methods for cloning, expression, purification and crystallization of hK7, and have been able to obtain for the first time the structure of human kallikrein 7 at a very high resolution. The obtained structure of human kallikrein 7 at a very high resolution has allowed to identify the active site of the enzyme and compounds binding specifically to said active site of kallikrein 7. The present inventors have furthermore been able to confirm that these compounds have a modulatory effect on kallikrein 7.

The present invention thus pertains to a crystal of human kallikrein 7 comprising the binding pocket having a three-dimensional structure characterized by the structure coordinates of Table 3 below. This crystal can also comprise a co-crystallised ligand.

The present invention also pertains to a computer readable medium comprising data storage material encoded with computer readable data wherein said data comprises the structure coordinates of a crystal according to the invention, and to the use of this crystal for the generation of crystal structure data.

Another embodiment of the present invention is a method of identifying a ligand that binds to kallikrein 7, this method comprising the steps of (i) using the three dimensional structure data generated according to the invention to select and/or design a potential ligand that binds to kallikrein 7, and (ii) identifying among the potential ligand selected in step (i), those ligands that bind to kallikrein 7 in an in vitro, in vivo or cell-based assay.

Yet another embodiment of the present invention relates to a modulator of kallikrein 7 characterised in that it binds in the binding pocket having a three-dimensional structure characterized by the structure coordinates of Table 3. This modulator of kallikrein 7 can be a compound of formula

embedded image

wherein

    • R1 is hydrogen, cyano, (C1-8)alkyl, (C2-8)alkenyl, (C2-8)alkynyl, halogen, (C1-8)alkylamino, (C1-8)alkylamino(C1-8)alkyl, (C1-8)alkoxy, halo(C1-8)alkyl,
    • X is CH═CH, NH, N═CH, O or S,
    • Y is a group of formula

embedded image

    • wherein
      • the N-containing ring system is optionally annelated with (C3-8)cycloalkyl, (C8-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S,
      • n is 1, 2 or 3,
      • R2 is
        • (C1-8)alkyl, (C1-8)alkylamino, (C1-8)alkylamino(C1-8)alkyl, di(C1-8)alkylamino(C1-8)alkyl, halo(C1-8)alkyl, (C1-8)alkoxy, (C1-8)alkoxy(C1-8)alkyl, or
        • (CH2)m-Z, wherein Z is unsubstituted or substituted (C3-8)cycloalkyl, (C6-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S and m is 0, 1 or 2,
      • R3 is hydrogen, (C1-8)alkyl, (C1-8)alkoxy, (C6-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S.

In particular, this modulator can be a compound, wherein

    • R1 is hydrogen, ethynyl, chloro or bromo,
    • X is CH═CH or S,
    • Y is a group of formula (II), wherein
      • the N-containing ring system is optionally annelated with cyclopropyl, cyclopentyl or phenyl,
      • n is 1 or 2,
      • R2 is (C1-8)alkyl, (C1-4)alkylamino, di(C1-4)alkylamino(C1-4)alkyl, (C1-4)alkoxy, (C1-4)alkoxy(C1-4)alkyl or
      • a group (CH2)m-Z, wherein Z is unsubstituted cyclohexyl, unsubstituted phenyl, phenyl substituted by (C1-4)alkoxy, phenyl substituted by heterocyclyl having 6 ring members and 1 or 2 heteroatoms selected from N, O, or
      • unsubstituted or substituted heterocyclyl having 6 ring members and 1 or 2 heteroatoms selected from N, O;
    • m is 1 or 2,
    • R3 is hydrogen or (C1-4)alkoxy.

In another embodiment of such a modulator, Y can be a group of formula (II), wherein

    • the N-containing ring system is optionally annelated with cyclopropyl, cyclopentyl or phenyl,
    • R2 is methyl, dimethylaminoethyl, methoxyethyl, or
    • a group (CH2)m-Z, wherein Z is unsubstituted cyclohexyl, unsubstituted phenyl, phenyl substituted by methoxy, piperazinyl or morpholinyl;
    • pyridinyl, piperidinyl, tetrahydrofuranyl, unsubstituted piperazinyl or piperazinyl substituted by methyl or phenyl,

and m, n, R1, R3 and X are as defined above.

The compounds of the invention can be in the form of a salt and/or for use as a pharmaceutical. The present invention hence also relates to a pharmaceutical composition comprising a compound as described herein-above in association with at least one pharmaceutical excipient, and to a method of treating disorders mediated by kallikrein-7 activity, which treatment comprises administering to a subject in need of such treatment an effective amount of a compound of the invention.

According to the present invention, a disorder which is mediated by kallikrein-7 activity can be selected from the group consisting of inflammatory and/or hyperpoliferative and pruritic skin diseases such as keloids, hypertrophic scars, acne, atopic dermatitis, psoriasis, pustular psoriasis, rosacea, Netherton's syndrome or other pruritic dermatoses such as prurigo nodularis, unspecified itch of the elderly as well as other diseases with epithelial barrier dysfunction such as aged skin, inflammatory bowel disease and Crohn's disease, as well as pancreatitis, or of cancer, in particular ovarian cancer.

DETAILED DESCRIPTION OF THE INVENTION

List of abbreviations
AbbreviationDescription
DMSOdimethylsulfoxide
hK7human kallikrein 7
UTRuntranslated region
LEKTIlympho-epithelial Kazal-type related inhibitor
Spink5serine protease inhibitor Kazal-type 5
ALPantileukoprotease
HPLChigh performance liquid chromatography
GluHClglucosamine hydrochloride
pro-hK7pro-human kallikrein 7
PEGpolyethylene glycol
SDSsodium dodecyl sulfate
Tristris-(hydroxymethyl)-amino methane
IPTGisopropyl-β-D-thiogalactoside
GSHGlutathion or γ-L-Glutamyl-L-cysteinylglycin
GSSHoxidized form of glutathion
EDTAethylenediaminetetraacitic acid
DMSOdimethylsulfoxide
HClhydrochloric acid
SLSSwiss Light Source
a.u.asymmetric unit
DTTD,L-dithiothreitol

Kallikrein 7 is a S1 serine protease of the kallikrein gene family displaying a chymotrypsin like activity. Human kallikrein 7 (hK7, KLK7 or stratum corneum chymotryptic enzyme (SCCE), Swissprot P49862) plays an important role in skin physiology (1, 2, 3).

The present invention provides a crystal of human kallikrein 7 comprising the binding pocket having a three-dimensional structure characterized by the structure coordinates of Table 3 below. The present invention also provides to a computer readable medium comprising data storage material encoded with computer readable data wherein said data comprises the structure coordinates of a crystal according to the invention, and the use of this crystal for the generation of crystal structure data. Moreover, the present invention provides a method of identifying a ligand that binds to kallikrein 7, this method comprising the steps of (i) using the three dimensional structure data generated according to the invention to select and/or design a potential ligand that binds to kallikrein 7, and (ii) identifying among the potential ligand selected in step (i), those ligands that bind to kallikrein 7 in an in vitro, in vivo or cell-based assay. Modulator of kallikrein 7 according to the present invention are characterised in that it binds in the binding pocket having a three-dimensional structure characterized by the structure coordinates of Table 3 and can be a compound of formula

embedded image

wherein

    • R1 is hydrogen, cyano, (C1-8)alkyl, (C2-8)alkenyl, (C2-8)alkynyl, halogen, (C1-8)alkylamino, (C1-8)alkylamino(C1-8)alkyl, (C1-8)alkoxy, halo(C1-8)alkyl,
    • X is CH═CH, NH, N═CH, O or S,
    • Y is a group of formula

embedded image

    • wherein
      • the N-containing ring system is optionally annelated with (C3-8)cycloalkyl, (C6-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S,
      • n is 1, 2 or 3,
      • R2 is
        • (C1-8)alkyl, (C1-8)alkylamino, (C1-8)alkylamino(C1-8)alkyl, di(C1-8)alkylamino(C1-8)alkyl, halo(C1-8)alkyl, (C1-8)alkoxy, (C1-8)alkoxy(C1-8)alkyl, or
        • (CH2)m-Z, wherein Z is unsubstituted or substituted (C3-8)cycloalkyl, (C8-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S and m is 0, 1 or 2,
      • R3 is hydrogen, (C1-8)alkyl, (C1-8)alkoxy, (C6-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S.

The crystals according to the invention preferably belong to the orthorhombic space group P212121 (triclinic). The crystals have 1 molecule per asymmetric unit.

Depending on the conditions used for crystallization, the parameters characterising the unit cell may vary with a limited range, at least within the range of the resolution. The resolution of the X-ray crystallography is typically≦5 Angstroms and by means of the purification method described therein, it is possible to provide crystals of such high internal order that a resolution of ≦2 Å can be achieved.

The term “unit cell” refers to the basic shape block. The entire volume of a crystal may be constructed by regular assembly of such blocks. Each unit cell comprises a complete representation of the unit of pattern, the repetition of which builds up the crystal.

The term “space group” according to the invention refers to the arrangement of symmetry elements of a crystal.

The term “structure coordinates” or “atomic coordinates” refers to mathematical coordinates derived from the mathematical equations related to the pattern obtained on diffraction of a monochromatic beam of X-rays by the atoms (scattering centers) of a crystal comprising hK7. The diffraction data are used to calculate an electron density map of the repeating unit of the crystal. The electron density maps are used to establish the positions of the individual atoms within the unit cell of the crystal. The structure coordinates of hK7 can be found in Table 3.

A “fragment” of Kallikrein 7 comprises more than 50% consecutive amino acids of the sequence of the Kallikrein 7.

As used herein, a “homologue” of that sequence shares at least 70% identity, preferably 80% identity, more preferably 90%, and even more preferably 95% identity with the corresponding sequence when performing optimal alignment. Optimal alignment of sequences for determining a comparison window may be conducted by the local homology algorithm of Smith and Waterman (J. Theor. Biol., 91 (2) pgs. 370-380 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. Miol. Biol., 48(3) pgs. 443-453 (1972), by the search for similarity via the method of Pearson and Lipman, PNAS, USA, 85(5) pgs. 2444-2448 (1988) or by computerized implementations of these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetic Computer Group, 575, Science Drive, Madison, Wis.).

The best alignment (i.e., resulting in the highest percentage of identity over the comparison window) generated by the various methods is selected for determining percentage identity.

The terms “ligand” or “modulator”, which are used interchangeably herein, refers to a molecule or group of molecules that bind to one or more specific sites of Kallikrein 7. A ligand according to the invention can be an agonist or an antagonist. In addition, ligands according to the invention are preferably low molecular weight molecules.

The term “low molecular weight molecules” according to the invention refers to preferably organic compounds generally having a molecular weight less than about 1000, more preferably less than about 500.

More preferably, said ligand inhibits kallikrein 7 biological activity. A compound is considered as an kallikrein 7 inhibitor if it has an IC50 ranging from 0.001 nM to 1.0 μM.

Preferred modulators are organic compounds, e.g. 1,2-dicarboxylic acid amides of an N-containing ring system, such as e.g. pyrrolidine, e.g. which are antagonists of Kallikrein-7 activity.

In one aspect the present invention is a compound of formula

embedded image

wherein
R1 is hydrogen, cyano, alkyl, alkenyl, alkynyl, halogen, alkylamino, alkylaminoalkyl, alkoxy, haloalkyl,

X is CH═CH, NH, N═CH, O or S,

Y is a group of formula

embedded image

wherein

    • the N-containing ring system is optionally annelated with cycloalkyl, aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S,
    • n is 1, 2 or 3,
    • R2 is
      • alkyl, alkylamino, alkylaminoalkyl, dialkylaminoalkyl, haloalkyl, alkoxy, alkoxyalkyl, or
      • (CH2)m-Z, wherein Z is unsubstituted or substituted cycloalkyl, aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S and m is 0, 1 or 2,
    • R3 is hydrogen, alkyl, alkoxy, aryl or heterocyclyl having 5 to 6 ring members and 1 to 4 heteroatoms selected from N, O, S.

Any group (substituent) defined herein may comprise 1 to 18 carbon atoms, for example

    • alkyl e.g. includes (C1-12)alkyl, such as (C1-4)alkyl, e.g. methyl, ethyl, propyl, isopropyl, n-butyl, tert-butyl, sec-butyl, n-pentyl, neopentyl, n-hexyl;
      • alkenyl e.g. includes (C2-12)alkenyl, such as ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, alkadienes and the like;
      • alkynyl e.g. includes (C2-12)alkynyl, such as ethynyl;
      • cycloalkyl e.g. includes (C3-12)cycloalkyl, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl;
      • alkoxy e.g. includes (C1-12)alkoxy, such as methoxy, ethoxy;
      • aryl includes (C6-18)aryl, e.g. phenyl, naphtyl;
      • aliphatic heterocyclyl and armoatic heterocyclyl;
      • heterocyclyl having 1 to 4 heteroatoms selected from N, O, S; such as heterocyclyl
        having
    • 1 to 2 heteroatoms selected from N, O, e.g. including
    • pyridinyl, e.g. pyridin-3-yl, pyridin-4-yl;
    • piperidinyl, e.g. piperidin-4-yl;
    • piperazinyl, e.g. piperazin-1-yl;
    • morpholinyl, e.g. morpholin-4-yl;
    • tetrahydrofuranyl, e.g. tetrahydrofuran-2-yl;
    • halogen includes F, Cl, Br, I, such as chloro, bromo;

Any group defined herein may be unsubstituted or substituted, e.g. one or morefold.

Substituents include e.g. methyl, methoxy, ethynyl, chloro, bromo.

Alkyl, alkenyl, alkynyl, aryl and heterocyclyl include unsubstituted or substituted alkyl, aryl or heterocyclyl, e.g. substituted by groups which are conventional in organic chemistry.

In one aspect the present invention is a compound of formula (I) as defined above, wherein

R1 is hydrogen, cyano, (C2-8)alkenyl, (C2-8)alkynyl or halogen

X is CH═CH, NH, N═CH, O or S,

Y is a group of formula

embedded image

wherein

    • the N-containing ring system is optionally annelated with (C3-8)cycloalkyl, (C6-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 2 heteroatoms selected from N, O, S,
    • n is 1, 2 or 3,
    • R2 is
      • (C1-8)alkyl, (C1-8)alkylamino, (C1-8)alkylamino(C1-8)alkyl, di(C1-8)alkylamino(C1-8)alkyl, (C1-8)alkoxy, (C1-8)alkoxy(C1-8)alkyl, or
      • (CH2)m-Z, wherein Z is unsubstituted or substituted (C3-8)cycloalkyl, (C8-18)aryl or heterocyclyl having 5 to 6 ring members and 1 to 2 heteroatoms selected from N, O, S and m is 1 or 2,
    • R3 is hydrogen, (C1-8)alkyl or (C1-8)alkoxy.

In one aspect the present invention is a compound of formula (I), wherein

    • R1 is hydrogen, ethynyl, chloro or bromo,
    • X is CH═CH or S,
    • Y is a group of formula (II), wherein
      • the N-containing ring system is optionally annelated with cyclopropyl, cyclopentyl or phenyl,
      • n is 1 or 2,
      • R2 is (C1-8)alkyl, (C1-4)alkylamino, di(C1-4)alkylamino(C1-4)alkyl, (C1-4)alkoxy, (C1-4)alkoxy(C1-4)alkyl or
      • a group (CH2)m-Z, wherein Z is unsubstituted cyclohexyl, unsubstituted phenyl, phenyl substituted by (C1-4)alkoxy, phenyl substituted by heterocyclyl having 6 ring members and 1 or 2 heteroatoms selected from N, O, or unsubstituted or substituted heterocyclyl having 6 ring members and 1 or 2 heteroatoms selected from N, O;
      • m is 1 or 2,
      • R3 is hydrogen or (C1-4)alkoxy.

In one aspect the present invention is a compound of formula (I) and Y is a group of formula (II), wherein

    • the N-containing ring system is optionally annelated with cyclopropyl, cyclopentyl or phenyl,
    • R2 is methyl, dimethylaminoethyl, methoxyethyl, or
    • a group (CH2)m-Z, wherein Z is unsubstituted cyclohexyl, unsubstituted phenyl, phenyl substituted by methoxy, piperazinyl or morpholinyl; pyridinyl, piperidinyl, tetrahydrofuranyl, unsubstituted piperazinyl or piperazinyl substituted by methyl or phenyl,
    • and m, n, R1, R3 and X are as defined above.

In one aspect the present invention is a compound of formula (I), wherein

X is CH═CH,

R1 is ethynyl or chloro,
Y is a group of formula (II), wherein
n is 1,
R3 is hydrogen,
R2 is methyl, methoxyethyl, dimethylaminoethyl, pyridin-3-ylmethyl, pyridin-4-ylmethyl, pyridin-3-yl-ethyl, pyridin-4-yl-ethyl, 6-methoxy-pyridin-3-ylmethyl, (4-methoxy-phenyl)-ethyl, (4-methyl-piperazin-1-yl)-ethyl, (4-benzyl-piperazin-1-yl)-ethyl, 4-(4-methyl-piperazin-1-yl)-benzyl, 1-methyl-piperidin-4-ylmethyl, 2-(4-morpholin-4-ylmethyl)-benzyl.

In one aspect the present invention is a compound of formula (I), wherein

X is CH═CH,

R1 is hydrogen,
Y is a group of formula (II), wherein
The N-containing ring system is optionally annelated with phenyl,
R3 is hydrogen or phenyl,
n is 1 or 2,
R2 is benzyl, phenethyl, cyclohexylmethyl, (4-methoxy-phenyl)-ethyl, 3-methyl-butyl, tetrahydrofuran-2-ylmethyl.

In one aspect the present invention is a compound of formula (I), wherein

X is CH═CH,

R1 is ethynyl,
Y is a group of formula (II), wherein
The N-containing ring system is optionally annelated with cyclopropyl, cyclopentyl, phenyl,
R3 is hydrogen,
n is 1,
R2 is pyridin-3-ylmethyl.

In one aspect the present invention is a compound of formula (I), wherein

X is CH═CH

R1 is ethynyl,
Y is a group of formula (II), wherein
R3 is methoxy,
n is 1,
R2 is pyridin-3-ylmethyl.

In one aspect the present invention is a compound of formula (I), wherein

X is CH═CH

R1 is ethynyl,
Y is a group of formula (II), wherein
R3 is hydrogen,
n is 2,
R2 is pyridin-3-ylmethyl.

In one aspect the present invention is a compound of formula (I), wherein

X is S

R1 is chloro or bromo,
Y is a group of formula (II), wherein
R3 is hydrogen,
n is 1,
R2 is (4-methoxy-phenyl)-ethyl.

In a compound of formula I each single defined substitutent may be a preferred substituent, e.g. independently of each other substitutent defined.

In another aspect the present invention provides a compound of formula I, selected from the group consisting of

  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(2-pyridin-3-yl-ethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 2-[(2-dimethylamino-ethyl)-amide] 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(2-pyridin-4-yl-ethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(6-methoxy-pyridin-3-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(1-methyl-piperidin-4-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[4-(4-methyl-piperazin-1-yl)-benzylamide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-(4-morpholin-4-ylmethyl-benzylamide),
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-methylamide,
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 2-{[2-(4-benzyl-piperazin-1-yl)-ethyl]amide} 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(2-methoxy-ethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-3-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-4-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-{[2-(4-methyl-piperazin-1-yl)-ethyl]-amide},
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(6-chloro-naphthalen-1-ylmethyl)-amide] 2-{[2-(4-methoxy-phenyl)-ethyl]-amide},
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-chloro-naphthalen-1-ylmethyl)-amide] 2-{[2-(4-methoxy-phenyl)-ethyl]-amide},
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(5-bromo-benzo[b]thiophen-3-ylmethyl)-amide] 2-{[2-(4-methoxy-phenyl)-ethyl]-amide},
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(5-chloro-benzo[b]thiophen-3-ylmethyl)-amide] 2-{[2-(4-methoxy-phenyl)-ethyl]-amide},
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-{[2-(4-methoxy-phenyl)-ethyl]-amide},
  • (2S,4R)-4-Methoxy-pyrrolidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-3-ylmethyl)-amide],
  • (S)-Piperidine-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-3-ylmethyl)-amide],
  • (S)-Hexahydro-cyclopenta[c]pyrrole-1,2-dicarboxylic acid 2-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 1-[(pyridin-3-ylmethyl)-amide],
  • (S)-2,3-Dihydro-indole-1,2-dicarboxylic acid 1-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-3-ylmethyl)-amide],
  • (S)-1,3-Dihydro-isoindole-1,2-dicarboxylic acid 2-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 1-[(pyridin-3-ylmethyl)-amide],
  • (1R,2S,5S)-3-Aza-bicyclo[3.1.0]hexane-2,3-dicarboxylic acid 3-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-3-ylmethyl)-amide],
  • (1S,2S,5R)-3-Aza-bicyclo[3.1.0]hexane-2,3-dicarboxylic acid 3-[(7-ethynyl-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-3-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(naphthalen-1-ylmethylyamide] 2-(phenethyl-amide),
  • (2S,4S)-4-Phenyl-pyrrolidine-1,2-dicarboxylic acid 1-[(naphthalen-1-ylmethyl)-amide] 2-(phenethyl-amide),
  • (2S,4R)-4-Phenyl-pyrrolidine-1,2-dicarboxylic acid 1-[(naphthalen-1-ylmethyl)-amide] 2-(phenethyl-amide),
  • (S)-3,4-Dihydro-1H-isoquinoline-2,3-dicarboxylic acid 2-[(naphthalen-1-ylmethylyamide] 3-(phenethyl-amide),
  • (S)-Piperidine-1,2-dicarboxylic acid 1-[(naphthalen-1-ylmethyl)-amide] 2-(phenethyl-amide),
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 2-{[2-(4-methoxy-phenyl)-ethyl]-amide} 1-[(naphthalen-1-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 2-benzylamide 1-[(naphthalen-1-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 2-cyclohexylmethyl-amide 1-[(naphthalen-1-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 2-[(3-methyl-butyl)-amide] 1-[(naphthalen-1-ylmethyl)-amide],
  • (S)-Pyrrolidine-1,2-dicarboxylic acid 1-[(naphthalen-1-ylmethyl)-amide] 2-[(tetrahydro-furan-2-ylmethyl)-amide],
  • (1S,2S,5R)-3-aza-bicyclo[3.1.0]hexane-2,3-dicarboxylic acid 3-[(7-chloro-naphthalen-1-ylmethyl)-amide] 2-[(pyridin-3-ylmethyl)-amide], and
  • (1S,2S,5R)-3-aza-bicyclo[3.1.0]hexane-2,3-dicarboxylic acid 3-[(7-chloro-naphthalen-1-ylmethyl)-amide] 2-{[2-(4-methoxy-phenyl)-ethyl]-amide}.

The chemical names of the compounds of the present invention as indicated herein are copied from ISIS, version 2.5 (AutoNom 2000 Name).

Compounds provided by the present invention are hereinafter designated as “compound(s) of (according to) the present invention”. A compound of the present invention includes a compound in any form, e.g. in free form, in the form of a salt, in the form of a solvate and in the form of a salt and a solvate.

In another aspect the present invention provides a compound of the present invention in the form of a salt.

Such salts include preferably pharmaceutically acceptable salts, although pharmaceutically unacceptable salts are included, e.g. for preparation/isolation/purification purposes.

A compound of the present invention in free form may be converted into a corresponding compound in the form of a salt; and vice versa. A compound of the present invention in free form or in the form of a salt and in the form of a solvate may be converted into a corresponding compound in free form or in the form of a salt in non-solvated form; and vice versa.

A compound of the present invention may exist in the form of isomers and mixtures thereof; e.g. optical isomers, diastereoisomers, cis/trans conformers. A compound of the present invention may e.g. contain asymmetric carbon atoms and may thus exist in the form of enantiomers or diastereoisomers and mixtures thereof, e.g. racemates. A compound of the present invention may be present in the (R)-, (S)- or (R,S)-configuration preferably in the (R)- or (S)-configuration regarding specified positions in the compound of the present invention.

A compound provided by the present invention may be in the (R)- and in the (S)-configuration, e.g. including mixtures thereof, in a compound of formula I, and is preferably in the (R)- or in the (S)-configuration.

Isomeric mixtures may be separated as appropriate, e.g. according, e.g. analogously, to a method as conventional, to obtain pure isomers. The present invention includes a compound of the present invention in any isomeric form and in any isomeric mixture.

The present invention also includes tautomers of a compound of the present invention, where tautomers can exist.

In another aspect the present invention provides a process for the production of a compound of the present invention, e.g. of formula I, comprising the steps

A. Reacting a Compound of Formula

embedded image

wherein R1 and R3 are as defined above, with a compound of formula


R2—NH2 (IV)

wherein R2 is as defined above, under appropriate conditions, e.g. in the presence of N-(3-dimethylamino-propyl)-N-carbodiimide-HCl, N,N-diisopropylethylamine, CH2Cl2, trifluoroacetic acid, acetonitril, at appropriate temperatures, e.g. room temperature, for an appropriate time, e.g. over night; OR

B) Reacting a Compound of Formula

embedded image

wherein R2, R3 and n are as defined above, with a compound of formula

embedded image

wherein R1 and X are as defined above, under appropriate conditions, e.g. in the presence of 4-nitrophenylchloroformate, pyridine, N,N-diisopropylethylamine, CH2Cl2, at appropriate temperatures, e.g. room temperature, for an appropriate time, e.g. over night; and isolating a compound of formula I obtained from the reaction mixture.

In an intermediate of formulae (III), (IV), (V) or (VI) (starting materials), functional groups, if present, optionally may be in protected form or in the form of a salt, if a salt-forming group is present. Protecting groups, optionally present, may be removed at an appropriate stage, e.g. according, e.g. analogously, to a method as conventional

A compound of formula I thus obtained may be converted into another compound of formula I, e.g. or a compound of formula I obtained in free form may be converted into a salt of a compound of formula I and vice versa.

Intermediates (starting materials) of formulae (III), (IV), (V) or (VI) are known or may be prepared according, e.g. analogously, to a method as conventional or as specified herein.

Any compound described herein, e.g. a compound of the present invention and intermediates of formulae (III), (IV), (V) or (VI) may be prepared as appropriate, e.g. according, e.g. analogously, to a method as conventional, e.g. or as specified herein.

The compounds of the present invention, e.g. including a compound of formula I, exhibit pharmacological activity and are therefore useful as pharmaceuticals. E.g., the compounds of the present invention are found to inhibit Kallikrein-7 activity.

Compounds of the present invention have IC50 values between 1 nM and 10 μM e.g. determined in the following assay:

Materials and Buffers

The fluorescence-quenched substrate Ac-Glu-Asp(EDANS)-Lys-Pro-Ile-Leu-PhêArg-Leu-Gly-Lys(DABCYL)-Glu-NH2 (where ̂ indicates the scissile bond, identified by MS analysis) is purchased from Biosyntan (Berlin, Germany) and kept as a 5 mM stock solution in DMSO at −20° C. All other chemicals are of analytical grade.

Enzymatic reactions are conducted in 50 mM sodium citrate buffer at pH 5.6 containing 150 mM NaCl and 0.05% (w/v) CHAPS.

All protein and peptide containing solutions are handled in siliconized tubes (Life Systems Design, Merenschwand, Switzerland). The compound solutions as well as the enzyme and the substrate solutions are transferred to the 384-well plates (black Cliniplate; cat. no. 95040020 Labsystems Oy, Finland) by means of a CyBi-Well 96-channel pipettor (CyBio AG, Jena, Germany).

Instrumentation for FI measurements

For fluorescence intensity (FI) measurements an Ultra Evolution reader (TECAN, Maennedorf, Switzerland) is used. The instrument is equipped with a combination of a 350 nm (20 nm bandwidth) and a 500 nm (25 nm bandwidth) bandpath filter for fluorescence excitation and emission acquisition, respectively. To increase the signal:background ratio, an appropriate dichroic mirror is employed. The optical filters and the dichroic mirror are purchased from TECAN. The fluorophores in each well are excited by three flashes per measurement.

Determination of IC50 Values

For the determination of IC50 values the assay is performed at room temperature in 384-well plates. All final assay volumes were 30 μl. Test compounds are dissolved in 90% (v/v) DMSO/water and diluted in water (containing 0.05% (w/v) CHAPS) to 3-times the desired assay concentration. The 11 final compound concentrations are: 0.3 nM, 1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, 1 μM, 3 μM, 10 μM and 30 μM. For each assay, 10 μl water/CHAPS (±test compound) are added per well, followed by 10 μl protease solution (diluted with 1.5× assay buffer). The protease concentration in final assay solution is 0.2 nM (according to the enzyme concentrations determined by the Bradford method). After 1 hour of incubation at room temperature, the reaction is started by addition of 10 μl substrate solution (substrate dissolved in 1.5× assay buffer, final concentration was 2 μM). The effect of the compound on the enzymatic activity is obtained from the linear progress curves and determined from two readings, the first one taken directly after the addition of substrate and the second one after 1 hour. The IC50 value is calculated from the plot of percentage of inhibition vs. inhibitor concentration using non-linear regression analysis software (XLfit, Vers. 4.0; ID Business Solution Ltd., Guildford, Surrey, UK).

The compounds of the present invention show activity in that ASSAY and are therefore indicated for the treatment of disorders (diseases) mediated by Kallikrein-7 activity. IC50 values for compounds of the present invention are in the range of below 10 μM, preferably below 10 nM, e.g. the compound of example 36 has an IC50 value of 3 nM.

Disorders, e.g. including diseases, mediated by Kallikrein-7 activity and which are prone to be successfully treated with Kallikrein-7 antagonists, e.g. with compounds of the present invention, include disorders, wherein the activity of Kallikrein-7 play a causal or contributory role, e.g. diseases involved with epithelial dysfunction such as inflammatory and/or hyperproliferative and pruritic skin diseases like e.g. atopic dermatitis, psoriasis, Netherton syndrome or other pruritic dermatoses such as prurigo nodularis, unspecified itch as well as other diseases with epithelial barrier dysfunction such as inflammatory bowel disease or Crohn's disease.

In another aspect the present invention provides

    • a compound of the present invention for use as a pharmaceutical,
    • the use of a compound of the present invention as a pharmaceutical,
    • the use of a compound of the present invention for the manufacture of a medicament, e.g. for the treatment of disorders mediated by Kallikrein-7 activity.

For pharmaceutical use one or more compounds of the present invention may be used, e.g. one, or a combination of two or more compounds of the present invention, preferably one compound of the present invention is used.

A compound of the present invention may be used as a pharmaceutical in the form of a pharmaceutical composition.

In another aspect the present invention provides a pharmaceutical composition comprising a compound of the present invention in association with at least one pharmaceutically acceptable excipient, e.g. appropriate carrier and/or diluent, e.g. including fillers, binders, disintegrants, flow conditioners, lubricants, sugars or sweeteners, fragrances, preservatives, stabilizers, wetting agents and/or emulsifiers, solubilizers, salts for regulating osmotic pressure and/or buffers.

In another aspect the present invention provides

    • a pharmaceutical composition of the present invention for use of treating disorders which are mediated by Kallikrein-7 activity.
    • the use of a pharmaceutical composition of the present invention for treating disorders which are mediated by Kallikrein-7 activity.

In a further aspect the present invention provides a method of treating disorders which are mediated by Kallikrein-7 activity, e.g. including disorders as specified above, which treatment comprises administering to a subject in need of such treatment an effective amount of a compound of the present invention; e.g. in the form of a pharmaceutical composition.

In another aspect the present invention provides

    • a compound of the present invention for the manufacture of a medicament,
    • the use of a compound of the present invention for the manufacture of a medicament, e.g. a pharmaceutical composition, for the treatment of disorders, which are mediated by Kallikrein-7 activity, e.g. for the treatment of skin diseases like e.g. atopic dermatitis, psoriasis, Netherton syndrome or other pruritic dermatoses such as prurigo nodularis, unspecified itch.

Treatment includes treatment and prophylaxis (prevention). Treatment can be by local or systemic application such as e.g. creams, ointments or suppositories or by oral, sc or iv application, respecitvely.

For such treatment, the appropriate dosage will, of course, vary depending upon, for example, the chemical nature and the pharmakokinetic data of a compound of the present invention used, the individual host, the mode of administration and the nature and severity of the conditions being treated. However, in general, for satisfactory results in larger mammals, for example humans, an indicated daily dosage includes a range

    • from about 0.001 g to about 1.5 g, such as 0.001 g to 1.5 g;
    • from about 0.01 mg/kg body weight to about 20 mg/kg body weight, such as 0.01 mg/kg body weight to 20 mg/kg body weight,
      for example administered in divided doses up to four times a day.

A compound of the present invention may be administered to larger mammals, for example humans, by similar modes of administration than conventionally used with other mediators, e.g. low molecular weight inhibitors, of Kallikrein-7 activity.

A compound of the present invention may be administered by any conventional route, for example enterally, e.g. including nasal, buccal, rectal, oral, administration; parenterally, e.g. including intravenous, intraarterial, intramuscular, intracardiac, subcutanous, intraosseous infusion, transdermal (diffusion through the intact skin), transmucosal (diffusion through a mucous membrane), inhalational administration; topically; e.g. including epicutaneous, intranasal, intratracheal administration; intraperitoneal (infusion or injection into the peritoneal cavity); epidural (peridural) (injection or infusion into the epidural space); intrathecal (injection or infusion into the cerebrospinal fluid); intravitreal (administration via the eye); e.g. in form of coated or uncoated tablets, capsules, (injectable) solutions, infusion solutions, solid solutions, suspensions, dispersions, solid dispersions; e.g. in the form of ampoules, vials, in the form of creams, gels, pastes, inhaler powder, foams, tinctures, lip sticks, drops, sprays, or in the form of suppositories. Preferably a compound of the present invention is applied topically.

For topical use, e.g. including administration to the eye, satisfactory results may be obtained with local administration of a 0.5-10%, such as 1-3% concentration of active substance several times daily, e.g. 2 to 5 times daily.

The compounds of the present invention may be administered in the form of a pharmaceutically acceptable salt, or in free form; optionally in the form of a solvate. A compound of the present invention in the form of a salt and/or in the form of a solvate exhibit the same order of activity as a compound of the present invention in free form.

A compound of the present invention may be used for any method or use as described herein alone or in combination with one or more, at least one, other, second drug substance.

In another aspect the present invention provides

    • A combination of a compound of the present invention with at least one second drug substance;
    • A pharmaceutical combination comprising a compound of the present invention in combination with at least one second drug substance;
    • A pharmaceutical composition comprising a compound of the present invention in combination with at least one second drug substance and one or more pharmaceutically acceptable excipient(s);
    • A compound of the present invention in combination with at least one second drug substance, e.g. in the form of a pharmaceutical combination or composition, for use in any method as defined herein, e.g.
      • A combination, a pharmaceutical combination or a pharmaceutical composition, comprising a compound of the present invention and at least one second drug substance for use as a pharmaceutical;
    • The use as a pharmaceutical of a compound of the present invention in combination with at least one second drug substance, e.g. in the form of a pharmaceutical combination or composition;
    • The use of a compound of the present invention for the manufacture of a medicament for use in combination with a second drug substance
    • A method for treating disorders mediated by Kallikrein-7 activity in a subject in need thereof, comprising co-administering, concomitantly or in sequence, a therapeutically effective amount of a compound of the present invention and at least one second drug substance, e.g. in the form of a pharmaceutical combination or composition;
    • A compound of the present invention in combination with at least one second drug substance, e.g. in the form of a pharmaceutical combination or composition, for use in the preparation of a medicament for use in disorders mediated by Kallikrein-7 activity.

Combinations include fixed combinations, in which a compound of the present invention and at least one second drug substance are in the same formulation; kits, in which a compound of the present invention and at least one second drug substance in separate formulations are provided in the same package, e.g. with instruction for co-administration; and free combinations in which a compound of the present invention and at least one second drug substance are packaged separately, but instruction for concomitant or sequential administration are given.

In another aspect the present invention provides

    • A pharmaceutical package comprising a first drug substance which is a compound of the present invention and at least one second drug substance, beside instructions for combined administration;
    • A pharmaceutical package comprising a compound of the present invention beside instructions for combined administration with at least one second drug substance;
    • A pharmaceutical package comprising at least one second drug substance beside instructions for combined administration with a compound of the present invention.

Treatment with combinations according to the present invention may provide improvements compared with single treatment.

In another aspect the present invention provides

    • A pharmaceutical combination comprising an amount of a compound of the present invention and an amount of a second drug substance, wherein the amounts are appropriate to produce a synergistic therapeutic effect;
    • A method for improving the therapeutic utility of a compound of the present invention comprising co-administering, e.g. concomitantly or in sequence, of a therapeutically effective amount of a compound of the present invention and a second drug substance.
    • A method for improving the therapeutic utility of a second drug substance comprising co-administering, e.g. concomitantly or in sequence, of a therapeutically effective amount of a compound of the present invention and a second drug substance.

A combination of the present invention and a second drug substance as a combination partner may be administered by any conventional route, for example as set out above for a compound of the present invention. A second drug may be administered in dosages as appropriate, e.g. in dosage ranges which are similar to those used for single treatment, or, e.g. in case of synergy, even below conventional dosage ranges.

Pharmaceutical compositions according to the present invention may be manufactured according, e.g. analogously, to a method as conventional, e.g. by mixing, granulating, coating, dissolving or lyophilizing processes. Unit dosage forms may contain, for example, from about 0.1 mg to about 1500 mg, such as 1 mg to about 1000 mg.

Pharmaceutical compositions comprising a combination of the present invention and pharmaceutical compositions comprising a second drug as described herein, may be provided as appropriate, e.g. according, e.g. analogously, to a method as conventional, or as described herein for a pharmaceutical composition of the present invention.

By the term “second drug substance” is meant an anti-inflammatory, immunomodulatory drug, anticancer drug, anesthetic drug or chemotherapeutic drug. A “second drug substance” can also be a compound having Kallikrein-7 activity, but not being a compound of the present invention.

If the compounds of the present invention are administered in combination with other drugs dosages of the co-administered second drug will of course vary depending on the type of co-drug employed, on the specific drug employed, on the condition being treated, as in case of a compound of the present invention. In general dosages similar than those as provided by the second drug supplier may be appropriate

In the following Examples all temperatures indicated are in degree Celsius (°).

The following abbreviations are also used:

  • aq. aqueous
  • Ac2O acetic anhydride
  • AcOH acetic acid
  • CH2Cl2 dichloromethane
  • DCE 1,2-dichloroethane
  • DIPEA N,N-diisopropylethylamine
  • DMA N,N-dimethylacetamide
  • EtOAc ethylacetate
  • HATU O-(7-azabenzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium hexafluorophosphate
  • NMP N-methylpyrrolidinone
  • rt room temperature
  • TFA trifluoroacetic acid
  • THF tetrahydrofuran
  • TLC thin layer chromatography
  • TMOF trimethylorthoformate

A kallikrein 7 inhibitor can also be a “peptide” or a “peptide derivative”, which terms are intended to embrace a “peptidomimetic” or “peptide analogue” which complement the three-dimensional structure of the binding pocket of kallikrein 7 or can be designed with improved physical or chemical properties to bind with the three-dimensional binding pocket of the kallikrein 7 as provided in the present invention.

The term “mutant” refers to a mutated sequence by deletion, insertion or preferably replacement of one or more selected amino acids, provided that such mutant sequence shares at least 90% identity, more preferably 95%, and even more preferably 99% identity with the corresponding fragment sequence when performing optimal alignment. Methods for the preparation of protein mutants are commonly known in the art. For example, kallikrein 7 mutants may be prepared by expression of kallikrein 7 DNA previously modified in its coding region by oligonucleotide directed mutagenesis.

As used herein, the term “binding pocket” refers to the region of kallikrein 7 that, as a result of its shape and physico-chemical properties favorably associates with another chemical entity or compound and is defined in by the coordinates of Table 3.

The kallikrein 7 protein to be used for crystallization may be biologically active or inactive. Such ability may be determined by morphological, biochemical or viability analysis well-known in the art.

Expression of recombinant kallikrein 7 or fragment thereof is achievable in eukaryotic or prokaryotic systems or in vitro expression systems.

According to a preferred embodiment, kallikrein 7 is bound to at least one ligand at any step prior to crystallization.

Kallikrein 7 may be expressed as a fusion protein, e.g. a glutathione-5-transferase (GST) or histidine-tagged fusion protein. If desired, the fusion partner is removed before crystallization.

For carrying out the step of crystallization of the method for making a crystal, various methods can be used including vapour diffusion, dialysis or batch crystallization according to methods known in the art (“Crystallization of Biological Macromolecules”, A. McPherson, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA).

In vapour diffusion crystallization, a small volume (i.e., a few microliters) of protein solution is mixed with a solution containing a precipitant. This mixed volume is suspended over a well containing a small amount, i.e. about 1 ml, of precipitant. Vapour diffusion from the drop to the well will result in crystal formation in the drop.

The dialysis method of crystallization utilizes a semipermeable size-exclusion membrane that retains the protein but allows small molecules (i.e. buffers and precipitants) to diffuse in and out. In dialysis, rather than concentrating the protein and the precipitant by evaporation, the precipitant is allowed to slowly diffuse through the membrane and reduce the solubility of the protein while keeping the protein concentration fixed.

The batch method generally involves the slow addition of a precipitant to an aqueous solution of protein until the solution just becomes turbid, at this point the container can be sealed and left undisturbed for a period of time until crystallization occurs. In the batch technique the precipitant and the target molecule solution are simply mixed. Supersaturation is achieved directly rather than by diffusion. Often the batch technique is performed under oil. The oil prevents evaporation and extremely small drops can be used. For this, the term “microbatch” is used. A modification of this technique is not to use paraffin oil (which prevents evaporation completely) but rather use silicone oil or a mixture of silicone and paraffin oils so that a slow evaporation is possible.

The claimed invention can encompass any and all methods of crystallization. One skilled in the art can choose any of such methods and vary the parameters such that the chosen method results in the desired crystals.

One preferred method of crystallization of kallikrein 7 involves mixing a kallikrein 7 solution with a “reservoir buffer”. For crystal formation, the concentration of the precipitating agent in the mixture has to be increased, e.g. by addition of precipitating agent, for example by titration, or by allowing the concentration of precipitating agent to balance by diffusion between the crystallization buffer and a reservoir buffer (not necessarily the same as the original reservoir buffer). Under suitable conditions such diffusion of precipitating agent occurs along the gradient of precipitating agent, e.g. from the reservoir buffer having a higher concentration of precipitating agent into the crystallization buffer having a lower concentration of precipitating agent. Diffusion may be achieved e.g. by vapour diffusion techniques allowing diffusion of water in the common gas phase. Known techniques are e.g. vapour diffusion methods, such as the “hanging drop” or the “sitting drop” method. In the vapour diffusion method a drop of crystallization buffer containing the protein is hanging above or sitting beside a much larger pool of reservoir buffer. Alternatively, the balancing of the precipitating agent can be achieved through a semipermeable membrane that separates the crystallization buffer from the reservoir buffer and prevents dilution of the protein into the reservoir buffer.

Formation of kallikrein 7 can be achieved under various conditions which are essentially determined by the following parameters: pH, presence of salts and additives, precipitating agent, protein concentration and temperature. The pH may range, for example, from about 4.0 to 9.0.

In another specific embodiment, the invention relates to a method for making a co-crystal of kallikrein 7 in complex with a ligand.

The crystal form of kallikrein 7 crystal may also be used for exchanging the ligand by soaking compounds of interest, for example, for compound optimization, or for the discovery of novel scaffolds in fragment based screening approaches.

Structure coordinates of a crystalline composition of this invention may be stored in a machine-readable form on a machine-readable storage medium, e.g. a computer hard drive, diskette, DAT tape, etc., for display as a three-dimensional shape or for other uses involving computer-assisted manipulation of, or computation based on, the structural coordinates or the three-dimensional structures they define. For example, data defining the three dimensional structure of a protein of the kallikrein family, or portions or structurally similar homologues of such proteins, may be stored in a machine-readable storage medium, and may be displayed as a graphical three-dimensional representation of the protein structure, typically using a computer capable of reading the data from said storage medium and programmed with instructions for creating the representation from such data.

According to the present invention, a three-dimensional kallikrein 7 model is obtainable from a kallikrein 7 crystal comprising the kallikrein 7, fragment or homologue thereof.

The present invention also relates to a computer readable medium having stored a model of the kallikrein 7 crystal structure. In a preferred embodiment, said model is built from all or a selected portion of it, of the atomic coordinates of Table 3 derived from the X-ray diffraction data.

By “selected portion”, it is meant the structure coordinates of at least 10 consecutive amino acids shown in Table 3 and preferably at least 50 amino acids, and more preferably at least 100 consecutive amino acids.

The knowledge obtained from the three-dimensional model of kallikrein 7 can be used in various ways. For example, it can be used to identify chemical entities, for example, small organic and bioorganic molecules such as peptidomimetics and synthetic organic molecules that bind to kallikrein 7 and preferably block or prevent a kallikrein 7-mediated or associated process or event, or that act as kallikrein δ agonists. Furthermore, this information can be used to design and prepare kallikrein 7 mutants, e.g. mutants with altered catalytic activity, model the three-dimensional structure and solve the crystal structure of proteins, such as kallikrein 7 homologues, kallikrein 7 mutants or kallikrein 7 co-complexes, involving e.g. molecular replacement or homology modeling.

The term “molecular replacement” refers to a method that involves generating a preliminary structural model of a crystal whose structural coordinates are unknown, by orienting and positioning a molecule whose structural coordinates are known, e.g., the kallikrein 7 coordinates within the unit cell of the unknown crystal, so as to best account for the observed diffraction pattern of the unknown crystal. Phases can then be calculated from this model, and combined with the observed amplitudes to give an approximated Fourier synthesis of the structure whose coordinates are unknown. This in turn can be subject to any of the several forms of refinement to provide a final accurate structure of the unknown crystal. Using the structural coordinates provided by this invention, molecular replacement may be used to determine the structural coordinates of a crystalline co complex, unknown ligand, mutant, or homolog, or of a different crystalline form of kallikrein 7. Additionally, the claimed crystal and its coordinates may be used to determine the structural coordinates of a chemical entity that associates with kallikrein 7.

“Homology modeling” according to the invention involves constructing a model of an unknown structure using structural coordinates of one or more related proteins, protein domains and/or one subdomains such as kallikrein 7. Homology modeling may be conducted by fitting common or homologous portions of the protein or peptide whose three dimensional structure is to be solved to the three dimensional structure of homologous structural elements. Homology modeling can include rebuilding part or all of a three dimensional structure with replace of amino acids or other components by those of the related structure to be solved.

Based on the three-dimensional structure of kallikrein 7 as provided in the present invention and using the atomic coordinates of Table 3, or a selected portion of it, the effects of site-specific mutations can be predicted. More specifically, the structural information provided herein permits the identification of desirable sites for amino acid modification, particularly amino acid mutation resulting in substitutional, insertional or deletional variants. Such variants may be designed to have special properties, particularly properties distinct from wild-type kallikrein 7, such as altered catalytic activity. Substitutions, deletions and insertions may be combined to arrive at a desired variant. Such variants can be prepared by methods well-known in the art, e.g. starting from wild-type kallikrein 7 or by de novo synthesis.

The kallikrein 7 structural information provided herein is useful for the design of ligands which are capable of selectively interacting with kallikrein 7, but not other proteases other than Kallikrein 7, and thereby specifically modulating the biological activity of kallikrein 7 and not other kallikrein 7 proteases.

Chemical entities that have a surface that mimics the accessible surface of the binding pocket of kallikrein 7 can be constructed by those skilled in the art. By way of example, the skilled artisan can screen three-dimensional structural databases of compounds to identify those compounds that position appropriate functional groups in similar three dimensional structural arrangement, then build combinatorial chemistry libraries around such chemical entities to identify those with high affinity to the binding pocket of kallikrein 7.

In a specific embodiment of the invention, a cell-based assay is designed to identify ligands which inhibit the biological activity of kallikrein 7.

Ligands, such as small molecular weight compounds can be identified from screening compound databases or libraries and using a computational means to form a fitting operation to a binding site on the kallikrein 7. The three dimensional structure of kallikrein 7 as provided in the present invention by the structure coordinates of Table 3 or a selected portion of it, can be used together with various docking programs.

The potential inhibitory or binding effect of a chemical entity on kallikrein 7 may be analyzed prior to its actual synthesis and testing by the use of computer-modeling techniques. If the theoretical structure of the given chemical entity suggests insufficient interaction and association between it and Kallikrein 7, the need for synthesis and testing of the chemical entity is obviated. However, if computer modeling indicates a strong interaction, the molecule may then be synthesized and tested for its ability to bind to kallikrein 7. Thus, expensive and time-consuming synthesis of inoperative compounds may be avoided.

This “in silico” analysis may begin by visual inspection of, for example, the binding pocket on a computer screen based on the structural coordinates of Table 3 in whole or in part. Selected fragments or chemical entities may then be positioned in a variety of orientations, or “docked,” within the binding pocket of kallikrein 7. Docking may be accomplished using software such as Quanta and SYBYL, followed by energy minimization and molecular dynamics with standard molecular mechanics force fields, such as CHARMM and AMBER. Specialized computer programs may be of use for selecting interesting fragments or chemical entities. These programs include, for example, GRID, available from Oxford University, Oxford, UK; 5 MCSS or CATALYST, available from Molecular Simulations, Burlington, Mass.; AUTODOCK, available from Scripps Research Institute, La Jolla, Calif.; DOCK, available from University of California, San Francisco, Calif., and XSITE, available from University College of London, UK.

Preferred is a method for designing a kallikrein 7 inhibitor which interacts at the substrate binding site of kallikrein 7 or any other binding sites. One approach enabled by this invention is the use of the structure coordinates of kallikrein 7 to design chemical entities that bind to or associate with Kallikrein 7 and alter the physical properties of the chemical entities in different ways. Thus, properties such as, for example, solubility, affinity, specificity, potency, on/off rates, or other binding characteristics may all be altered and/or maximized. One may design desired chemical entities by probing a kallikrein 7 comprising the binding pocket of the invention with a library of different entities to determine optimal sites for interaction between candidate chemical entities and kallikrein 7. For example, high-resolution X-ray diffraction data collected from crystals saturated with solvent allows the determination of where each type of solvent molecule adheres. Small molecules that bind tightly to those sites can then be designed and synthesized and tested for the desired activity. Once the desired activity is obtained, the molecules can be further altered to maximize desirable properties.

Once a compound has been designed or selected by the above methods, the efficiency with which that compound may bind to kallikrein 7 may be tested and modified for the maximum desired characteristic(s) using computational or experimental evaluation. Various parameters can be maximized depending on the desired result. These include, but are not limited to, specificity, affinity, on/off rates, hydrophobicity, solubility, and other characteristics readily identifiable by the skilled artisan.

In a preferred embodiment, the structure coordinates of Table 3 of kallikrein 7 is used in the above computer-based design step.

The invention further relates to a method for selecting a ligand that binds to kallikrein 7, comprising:

a. co-crystallizing or incubating a candidate compound or mix of compounds with kallikrein 7 under appropriate conditions,
b. determining by X-ray or NMR methods the amino acids of kallikrein 7 which interacts with the candidate compound,
c. selecting the compound which interacts at least with one or more amino acids of the binding pocket.

For carrying out step b., mapping of the binding site of ligand is usually performed by recording NMR spectra with and without the candidate compound, and identifying those resonances of the protein that are affected by ligand binding. This requires assignment of the protein resonance prior to the analysis, or comparison with the pattern of chemical shift changes that occur upon binding of ligands with known binding sites. Alternatively, competition experiments using said ligands with known binding sites can yield equivalent information.

The present invention further provides methods to design novel ligands of kallikrein 7, using fragment linking approaches. Compounds binding to different binding regions of Kallikrein 7 are first selected. The ligands are linked together based on the spatial orientation, so that the designed novel compounds fits within the two binding sites.

The invention thus relates to a method to design ligands to kallikrein 7, wherein said method comprises:

a. providing a first ligand that binds to one or more amino acids of a first binding region of kallikrein 7,

b. providing a second ligand that binds to one or more amino acids of a second binding region of Kallikrein 7, and,

c. linking said first ligand to said second ligand to design a ligand that binds to the first and second binding pockets of kallikrein 7.

The selection of an appropriate linking group is made by maintaining the spatial orientation of the ligands to one another and to kallikrein 7 based upon principles of bond angle and bond length information well known in the organic chemical art.

In addition, antagonists of kallikrein 7 can be used to treat patients, or for the manufacture of a medicament to treat, for inflammatory and/or hyperpoliferative and pruritic skin diseases such as keloids, hypertrophic scars, acne, atopic dermatitis, psoriasis, pustular psoriasis, rosacea, Netherton's syndrome or other pruritic dermatoses such as prurigo nodularis, unspecified itch of the elderly as well as other diseases with epithelial barrier dysfunction such as aged skin, inflammatory bowel disease and Crohn's disease, as well as pancreatitis, or of cancer, in particular ovarian cancer.

The following examples serve to illustrate the present invention but should not be construed as a limitation thereof. The invention particularly relates to the specific embodiments described in these examples.

EXAMPLES

Cloning

To prevent autocleavage of hK7, the autocleavage site at position Tyr180 (numbering according to Swiss-Prot entry P49862) has been mutated to Arg by site-directed mutagenesis according to the standard protocol using pET24_His-Pro-EK-KLK7(aa37-253) as template (QuickChange site-directed mutagenesis kit; Stratagene; mutagenesis primer: 5′ GACTGCACGAAGGTTCGCAAGGACTTACTGGAAAATTCCATGC). Cloning of vector pET24_His-Pro-EK-KLK7(aa37-253) has been in a manner usual in the art. The final vector was named pET24c-His-ProKLK7-Enterok-KLK7(aa37-253)_Y180R.

Expression and Purification

E. coli strain BL21(DE3) harboring the expression plasmid for pro-hK7 was cultivated at 37 C in LB medium containing 34 μg/ml chloramphenicol and 30 μg/ml kanamycin. Induction was started with 0.4 mM IPTG at an OD600 of 1.0 for 4 hours at 37° C. Subsequently, the cells were harvested by centrifugation. All purification steps were done at 4 C, unless stated otherwise. Cells from 10 liter E. coli cell culture (25 g cell pellet) were resuspended in 200 ml 50 mM Tris/HCl buffer, pH 8.0 containing 1 mM MgCl2 and stored at −20° C. overnight. After thawing, 1 μl Benzonase (ROCHE) was added and the sample was incubated for 10 min at 37° C. The cells were ruptured by sonication (4 times 20 seconds at 70% amplitude; Branson Digital Sonifier W-450D) and the homogenate was centrifuged at 7000 g for 15 min. The inclusion body-containing pellet was washed three times with 50 mM Tris pH 8.0 buffer containing 25% sucrose, 1% Triton 100 and 1 μl Benzonase and finally two times with H2O containing 1 mM MgCl2. The inclusion bodies were further purified by HPLC using a reverse phase column. For this, the inclusion bodies were dissolved in 6 M GuHCl (10 mg/ml) and 100 mM DTT and applied to a GE Source RPC column (Fine line 35S) equilibrated with 0.1% TFA and 10% acetonitrile. The protein was eluted by an increasing acetonitrile concentration from 10-100%. Fractions containing the protease were pooled and lyophilized. The dried protein was diluted to a final concentration of 50 μg/ml in 50 mM Tris/HCl pH 8.0 buffer (10° C. cold) containing 2 M urea, 500 mM NaCl, 10 mM CaCl2, 0.1 M NH4Cl, 1 mM EDTA, 1.25 mM GSH and 0.5 mM GSSG. Subsequently, the sample was dialyzed against 10 mM Tris pH 8.0 buffer and loaded on a Q-sepharose column (50 ml). The protein was eluted by an increasing salt concentration from 0-0.5 M NaCl and fractions containing pro-hK7 were pooled and concentrated to approx. 5 ml. Subsequently, the sample was activated by the addition of enterokinase (1:100) for 24 h at 8° C. Finally, hK7 was applied to a size exclusion chromatography column (Superdex 75, HiLoad 26/60, Amersham) equilibrated with 50 mM Tris, 100 mM NaCl, pH 8 at a flow rate of 2.5 ml/min. For crystallization trials the protein buffer was exchanged by dialysis against 50 mM sodium acetate at pH 5.6 and 100 mM sodium chloride and the protein was stored at 4° C.

Crystallization

hK7 was concentrated to 24.6 mg/ml and crystallized at 20° C. by the vapor diffusion method in hanging drops. 0.5 μl protein solution containing 50 mM sodium acetate at pH 5.6, 100 mM sodium chloride, 2 mM inhibitor and 1.8% (v/v) DMSO was mixed with 0.5 μl reservoir solution composed of 35% (w/v) PEG 3350, 200 mM calcium chloride and 100 mM sodium acetate at pH 4.8. The drops were equilibrated against 1 ml of the reservoir solution. Diffracting quality crystals appeared within 1-3 days.

Data Collection

For X-ray data collection a crystal was flash frozen in liquid nitrogen without additional cryo-protectant. The X-ray diffraction data were collected from a single crystal for the hK7-inhibitor complex at 95 K at the beamline X10SA of the Swiss Light Source with a MAR225 mosaic CCD detector at a wavelength of 0.9799 Å. For the crystals of hK7 in complex with inhibitors, 299 or 300 images were collected, with 0.5° oscillation each. The exposure time was between 0.5 s and 1 s per image. The crystal-to-detector distance was between 100 mm and 120 mm. The raw diffraction data were processed and scaled with the HKL program suite version 1.98.0 (21) or with XDS/XSCALE (22) using the APRV (23) interface. The crystal data and data collection statistics are summarized in Table 1.

TABLE 1
Data collection statistics
ModulatorCompound 1
X-ray sourceSLS/X10SA
date of data collection23.03.2006
Wavelength (Å)0.979908
DetectorMARCCD 225
Temperature (K)100
Number of crystals1
Space groupP212121
Unit cell dimensions: a, b, c (Å)42.61, 60.34, 80.63
Number of monomers/a.u.1
Packing coefficient (Å 3/Da)2.1
Solvent content (%)41.5
Resolution range (Å)33.5-1.1
Number of observations312326
Number of unique reflections81660
Overall
Data redundancy3.8
Data completeness (%)96.0%
< custom-character  /σ (I)>34.7
Rmerge0.087
Highest resolution shell
Resolution range1.14-1.10 Å
Completeness for shell73.9%
< custom-character  /σ (I)>2.2
Rmerge for shell0.334
Rmerge = Σ|Io − <I>|/Σ<I>

Structure Determination and Structure Refinement

The hK7 structure in complex with compound 1 was solved by molecular replacement with the program MOLREP version 9.2.10 (24), using the coordinates of human kallikrein 1 (pdb code 1SPJ, refined to 1.7 Å resolution (25)) as a search model. With a high resolution data cut-off of 4.0 Å an unambiguous solution was found in space group P212121 with one protein-modulator complex in the asymmetric unit (correlation coefficient of 0.34, R-factor of 0.48). An initial refinement cycle was applied using the rigid-body, simulated-annealing and bindividual refinement protocols of the program CNX version 2005 (26) and a high resolution data cut-off of 1.5 Å. The hK7 structure was build and refined by alternating cycles of manual model (re)building using the program O version 9 (27) and automated refinement using the minimize and bindividual protocols of the program CNX version 2005. Subsequently, the resolution was extended to 1.2 Å, 209 water molecules were added using the water-pick protocol of the program CNX version 2005 and finally the modulator was added. Anisotropic displacement parameters were included for the final refinement cylces at 1.2 Å resolution using the adp protocol of CNX 2005. The refinement target was the maximum likelihood function with the parameters described by Engh and Huber (28) using amplitudes. Cross validation was used throughout the refinement process, using 9.8% of the reflections which were excluded from the refinement. The quality of the final model was assessed with the programs CNX 2005 and PROCHECK (29). The refinement statistics are summarized in Table 2.

TABLE 2
Refinement statistics
InhibitorCompound 1
Data used in refinement
resolution range33.5-1.2
intensity cutoff (Sigma(F))0.0
number of reflections (working/test set)58820/6415
completeness (working + test set)89.5%
test set 9.8%
Fit to data used in refinement
overall Rcryst0.181
overall Rfree0.197
Fit in the highest resolution bin
resolution range1.28-1.20
bin completeness (working + test set)99.5%
bin Rcryst0.182
bin Rfree0.195
Number of non-hydrogen atoms
protein atoms1785
inhibitor atoms 32
waters 209
Overall B value from Wilson plot12.52
Overall mean B value16.42
protein atoms17.52
inhibitor atoms14.82
water molecules27.92
Cross-validated estimated coordinate error
from Luzzati plot0.13
from σA0.01
Rms deviations from ideal values
bond lengths0.018
bond angles 1.7°
dihedral angles21.5°
improper angles 1.3°
Ramachandran plot
residues in most favorable regions90.6%
residues in additional allowed regions 9.4%
Rcryst = Σ|Fo − Fc|/ΣFo

219 of the 224 amino acids could be traced in the high quality electron density map. Amino acids 166RKDLL170 (amino acid numbering according to the chymotrypsinogen numbering scheme (30) is used throughout the document unless stated otherwise) lack electron density and were not included into the final structures. The arginine residue of this disordered loop is mutated in the construct used for crystallization (according to Swiss-Prot numbering entry P49862 this residue is Tyr180). The wild type tyrosine residue was prone to autocatalytic cleavage, which is not the case for the arginine mutant as was demonstrated by MS analysis.

As expected, six disulfide bonds were found between residues Cys22-Cys157, Cys42-Cys58, Cys129-Cys232, Cys136-Cys201, Cys168-Cys182 and Cys191-Cys220 and cis-peptide bonds were build for amino acids Pro147 and Pro219. Due to the high resolution of the structure the side chains of amino acids 30, 38, 39, 49, 50, 84, 90, 110, 138, 153, 161, 164, 187, 192 and 200 were build in two conformations

Structure of hK7

The structure of hK7 resembles the overall architecture of hK1, hK6 and hK8 (25, 31, 32) and follows the classical chymotrypsin like fold, composed of two β-barrels and a C-terminal α-helix. The active site, including the catalytic triad composed of His57, Asp102 and Ser195 is located at the interface of the two 6-barrels.

Similar to hK5 and hK6 and in contrast to hK1, hK7 lacks the so called kallikrein loop. The kallikrein loop is an insertion of up to 11 amino acid residues between Thr96 and Gln97 characteristic for some of the kallikreins, especially the classical ones. It protrudes over the non-primed binding site like a lid. hK7 has no amino acid insertion in this region and is indistinguishable in length compared to trypsin or chymotrypsin.

Despite the overall structural similarity to other kallikreins, the S1 pocket of hK7 differs from the trypsin-like specificity of e.g. hK1, hK5, hK6 and hK8 in that the polar Asn189 replaces the negatively charged Asp at the bottom of the pocket and the hydrophobic Ala190 substitutes the polar Ser/Thr residues. These specific structural features of the S1 pocket are well in agreement with the observed chymotrypsin-like specificity of hK7 with a preference for medium to large sized S1 residues with a polar tip. hK7 has a preferred specificity for Tyr over Ala, Met and Phe in P1 (1, 33).

A disordered loop is located at the far end of the S3/S4 substrate binding pocket. In other S1 serine proteases complexed with inhibitors binding from S1 to S3, the homologous loop is ordered and folds back forming part of the S3/S4 binding pocket, thereby contributing to inhibitor binding. Therefore, it might be possible that this part of the kallikrein 7 structure gets ordered upon binding of inhibitors that occupy the S3/S4 pockets. In addition, due to the autocleavage after the tyrosine residue of this loop during purification, this tyrosine has been replaced by an arginine residue, which might also influence the conformation of this loop.

Our modulators bind to the active site of kallikrein 7 adopting an unexpected binding mode spanning from S1 towards the primed binding site.

For compound 1 the naphthyl and methoxyphenyl moieties bind to the S1 and S2′ pockets, respectively. The central pyrrolidine ring binds to the S1′ pocket and induces a conformational change of the His57 side chain, thereby disturbing the catalytic triad composed of His57, Asp102 and Ser195. Upon inhibitor binding, the His57 side chain swings towards the S2 pocket (rotation around chi1 by 120° and around chi2 by 90° compared to the structure of hK6 pdb code 1 L2E) and forms together with the disulfide bond between Cys42 and Cys58 a hydrophobic pocket occupied by the pyrrolidine ring of the inhibitor. The carbonyl oxygen atom of the inhibitor's urea moiety occupies the oxyanion hole and is in H-bonding distance to the backbone nitrogen atoms of Gly193 and Ser195. One urea nitrogen atom makes water mediated interactions to the side chain of His57 and the backbone carbonyl group of Ser214. The inhibitor amide nitrogen atom interacts with the backbone carbonyl oxygen atom of His41. The methoxyphenyl moiety is in Van-der-Waals distance to Val149 and Phe151 with the phenyl ring making an edge-to-face interaction to the side chain of Phe151.

Within the crystal environment a symmetry related hK7 molecule packs in close proximity to the active site of hK7. As previously mentioned, the modulator binding induces a movement of the catalytic His57 side chain. One nitrogen atom of this displaced His57 side chain is in H-bonding distance to the backbone carbonyl group of Phe151 of the symmetry related molecule. In addition, the primed site moieties of the modulators are in contact with the side chains of Pro21 and Asp154 of the same symmetry related molecule. Therefore, an influence on the binding modes of the modulators by the crystal contacts cannot be totally excluded. However, the crystal contact does not prevent binding of different prime site scaffolds in different prime site pockets.

TABLE 3
Three-dimensional structure of the new binding pocket of kallikrein 7
CRYST142.61160.34380.63390.0090.0090.00P 21 21 214
ORIGX11.0000000.0000000.0000000.00000
ORIGX20.0000001.0000000.0000000.00000
ORIGX30.0000000.0000001.0000000.00000
SCALE10.0234680.0000000.0000000.00000
SCALE20.0000000.0165720.0000000.00000
SCALE30.0000000.0000000.0124020.00000
ATOM1CBILEA 165.07712.74632.1161.0010.74AC
ANISOU1CBILEA 16135711771385910AC
SIGUIJ1CBILEA 16221818999999999999999999AC
ATOM2CG2ILEA 164.41412.70330.7171.0011.43AC
ANISOU2CG2ILEA 161373147413907−20AC
SIGUIJ2CG2ILEA 16221313999999852999999AC
ATOM3CG1ILEA 165.64611.35132.5381.0010.15AC
ANISOU3CG1ILEA 16129811671395−13−40AC
SIGUIJ3CG1ILEA 16151111999999999999999999AC
ATOM4CD1ILEA 166.59010.68931.5601.0010.76AC
ANISOU4CD1ILEA 16134612381417295−1AC
SIGUIJ4CD1ILEA 16152210999999999999999999AC
ATOM5CILEA 165.55215.20631.7871.0010.91AC
ANISOU5CILEA 161183109214404−108−3AC
SIGUIJ5CILEA 1612159999999999999999999AC
ATOM6OILEA 164.77415.76732.5321.0010.79AO
ANISOU6OILEA 1612861171150763−57−6AO
SIGUIJ6OILEA 1610022157289AO
ATOM7NILEA 166.69813.96633.5891.009.90AN
ANISOU7NILEA 161283106412825901AN
SIGUIJ7NILEA 1610022166290AN
ATOM8CAILEA 166.16913.84732.1841.0010.55AC
ANISOU8CAILEA 16128311141281810−1AC
SIGUIJ8CAILEA 161413210265989999999AC
ATOM9NILEA 175.92615.67130.5851.0011.18AN
ANISOU9NILEA 17144611531477562−2AN
SIGUIJ9NILEA 1710022166290AN
ATOM10CAILEA 175.41716.95230.0641.0012.10AC
ANISOU10CAILEA 1714501172161857−648AC
SIGUIJ10CAILEA 1789121561511999999AC
ATOM11CBILEA 176.52917.73529.3501.0012.26AC
ANISOU11CBILEA 1715371234178748559AC
SIGUIJ11CBILEA 1788101806999999AC
ATOM12CG2ILEA 175.94119.11928.8721.0012.53AC
ANISOU12CG2ILEA 17189313041900189215AC
SIGUIJ12CG2ILEA 17888191617999999AC
ATOM13CG1ILEA 177.75017.95730.2631.0012.96AC
ANISOU13CG1ILEA 171634164319210−58−1AC
SIGUIJ13CG1ILEA 17877197676999999AC
ATOM14CD1ILEA 177.42618.71231.5381.0013.60AC
ANISOU14CD1ILEA 171963165619294421AC
SIGUIJ14CD1ILEA 17876201676999999AC
ATOM15CILEA 174.31316.68729.0371.0012.56AC
ANISOU15CILEA 1714021257158632−210AC
SIGUIJ15CILEA 17875204659988023AC
ATOM16OILEA 174.51615.88928.1221.0012.36AO
ANISOU16OILEA 1714971275159149−51AO
SIGUIJ16OILEA 1710022157289AO
ATOM17NASPA 183.15017.34329.2321.0013.27AN
ANISOU17NASPA 1814161360168589−34−3AN
SIGUIJ17NASPA 1810022166290AN
ATOM18CAASPA 182.00717.34928.2911.0014.05AC
ANISOU18CAASPA 1815441613189746−21260AC
SIGUIJ18CAASPA 18774206638855653AC
ATOM19CBASPA 182.38617.91826.9131.0015.58AC
ANISOU19CBASPA 1822631479192668−18−3AC
SIGUIJ19CBASPA 18774208617754615AC
ATOM20CGASPA 181.15118.25126.0551.0016.60AC
ANISOU20CGASPA 18233318381991172−63−25AC
SIGUIJ20CGASPA 18773209596674948AC
ATOM21OD1ASPA 180.11218.57726.6281.0018.23AO
ANISOU21OD1ASPA 182635411921339453051AO
SIGUIJ21OD1ASPA 1810022157289AO
ATOM22OD2ASPA 181.23318.18524.8291.0017.67AO
ANISOU22OD2ASPA 18238931561991483−53−40AO
SIGUIJ22OD2ASPA 1810022157289AO
ATOM23CASPA 181.40315.96428.1301.0014.19AC
ANISOU23CASPA 18158816411795−3−25−1AC
SIGUIJ23CASPA 18773210576610513AC
ATOM24OASPA 180.89515.60627.0451.0014.18AO
ANISOU24OASPA 18173019571807−162−32−33AO
SIGUIJ24OASPA 1810022157289AO
ATOM25NGLYA 191.41615.20929.2321.0014.20AN
ANISOU25NGLYA 19151216121803−41−23−6AN
SIGUIJ25NGLYA 1910022166290AN
ATOM26CAGLYA 190.67613.95429.2601.0014.43AC
ANISOU26CAGLYA 19147015902177−13−30AC
SIGUIJ26CAGLYA 1977216213113262AC
ATOM27CGLYA 19−0.61514.05330.0481.0014.46AC
ANISOU27CGLYA 19132515801798−38−240−26AC
SIGUIJ27CGLYA 19782156150913262AC
ATOM28OGLYA 19−1.22815.14030.1401.0015.36AO
ANISOU28OGLYA 191457160333681340−1AO
SIGUIJ28OGLYA 1910022157289AO
ATOM29NALAA 20−1.03912.93130.6041.0014.61AN
ANISOU29NALAA 201411158219896−732AN
SIGUIJ29NALAA 2010022166290AN
ATOM30CAALAA 20−2.33012.84331.2981.0014.42AC
ANISOU30CAALAA 2014261559202628−545AC
SIGUIJ30CAALAA 20782180123213262AC
ATOM31CBALAA 20−3.44412.54930.2911.0015.24AC
ANISOU31CBALAA 20160325782199−195−182−43AC
SIGUIJ31CBALAA 20791191106813262AC
ATOM32CALAA 20−2.21511.69332.2561.0014.43AC
ANISOU32CALAA 201227154919827713−2AC
SIGUIJ32CALAA 2069119795513262AC
ATOM33OALAA 20−1.40210.79132.0551.0013.98AO
ANISOU33OALAA 20133116421760183−3114AO
SIGUIJ33OALAA 2010022157289AO
ATOM34NPROA 21−3.04311.66133.3011.0014.48AN
ANISOU34NPROA 211288163220073959−5AN
SIGUIJ34NPROA 2110022166290AN
ATOM35CDPROA 21−4.04812.64433.7561.0014.83AC
ANISOU35CDPROA 21154118002794175325−92AC
SIGUIJ35CDPROA 21711120187213263AC
ATOM36CAPROA 21−2.94110.50534.2191.0014.80AC
ANISOU36CAPROA 21137516261987340AC
SIGUIJ36CAPROA 21713120480713263AC
ATOM37CBPROA 21−4.06710.76535.2431.0014.78AC
ANISOU37CBPROA 2116262137227087260−36AC
SIGUIJ37CBPROA 21920020675513263AC
ATOM38CGPROA 21−4.24912.30635.2081.0015.02AC
ANISOU38CGPROA 2117102137281095340−30AC
SIGUIJ38CGPROA 2150020871213264AC
ATOM39CPROA 21−3.1249.16833.4621.0015.07AC
ANISOU39CPROA 21144416201929−40416AC
SIGUIJ39CPROA 2151120967513264AC
ATOM40OPROA 21−4.0009.04032.5921.0015.55AO
ANISOU40OPROA 21169222592177−91−215−34AO
SIGUIJ40OPROA 2110022157289AO
ATOM41NCYSA 22−2.2968.18533.7611.0015.39AN
ANISOU41NCYSA 2215491659205623−111AN
SIGUIJ41NCYSA 2210022166290AN
ATOM42CACYSA 22−2.4186.86533.1301.0015.88AC
ANISOU42CACYSA 2218531653210010−75−3AC
SIGUIJ42CACYSA 2251121064413265AC
ATOM43CCYSA 22−3.6976.22833.6071.0016.58AC
ANISOU43CCYSA 22186417192307−16−270AC
SIGUIJ43CCYSA 2251121161713265AC
ATOM44OCYSA 22−4.1056.44834.7231.0016.62AO
ANISOU44OCYSA 22205118092331−1449−2AO
SIGUIJ44OCYSA 2210022157289AO
ATOM45CBCYSA 22−1.2595.92533.5231.0015.41AC
ANISOU45CBCYSA 22180214802278−117−1474AC
SIGUIJ45CBCYSA 2251121259213266AC
ATOM46SGCYSA 220.4216.52333.1621.0014.69AS
ANISOU46SGCYSA 22182216961955−194−22461AS
SIGUIJ46SGCYSA 2210022149289AS
ATOM47NALAA 23−4.3215.43332.7591.0017.74AN
ANISOU47NALAA 232277173226345−394−34AN
SIGUIJ47NALAA 2310022166290AN
ATOM48CAALAA 23−5.5084.66933.1941.0018.55AC
ANISOU48CAALAA 23239118093463−41−135−3AC
SIGUIJ48CAALAA 2351121357113267AC
ATOM49CBALAA 23−6.0373.78132.0421.0018.86AC
ANISOU49CBALAA 23296520683487−401−128−35AC
SIGUIJ49CBALAA 2351121355213268AC
ATOM50CALAA 23−5.1663.80434.4071.0019.23AC
ANISOU50CALAA 231845183234271371AC
SIGUIJ50CALAA 2351121453413269AC
ATOM51OALAA 23−4.1123.14434.4611.0018.85AO
ANISOU51OALAA 231841183131200481AO
SIGUIJ51OALAA 2310022157289AO
ATOM52NARGA 24−6.0323.81635.4111.0020.08AN
ANISOU52NARGA 24188228043472575−1AN
SIGUIJ52NARGA 2410022165290AN
ATOM53CAARGA 24−5.6973.20736.6911.0020.80AC
ANISOU53CAARGA 24185528153452129140−15AC
SIGUIJ53CAARGA 2451121451813269AC
ATOM54CBARGA 24−6.8223.45837.6941.0022.17AC
ANISOU54CBARGA 243555474656123062004−298AC
SIGUIJ54CBARGA 2451121450413270AC
ATOM55CGARGA 24−6.8714.91738.1041.0024.04AC
ANISOU55CGARGA 24756646533991894390104AC
SIGUIJ55CGARGA 2451121549013271AC
ATOM56CDARGA 24−5.6515.34838.9111.0025.58AC
ANISOU56CDARGA 24839573835215−3−3852AC
SIGUIJ56CDARGA 2451121547813273AC
ATOM57NEARGA 24−6.0745.58540.2911.0027.17AN
ANISOU57NEARGA 2410414886253549057725AN
SIGUIJ57NEARGA 2410022165290AN
ATOM58CZARGA 24−6.2856.79340.8121.0027.52AC
ANISOU58CZARGA 246679875254302241474AC
SIGUIJ58CZARGA 2451121546613274AC
ATOM59NH1ARGA 24−6.0987.88740.0641.0028.32AN
ANISOU59NH1ARGA 246831876454281721184AN
SIGUIJ59NH1ARGA 2410022165290AN
ATOM60NH2ARGA 24−6.7316.92342.0601.0028.06AN
ANISOU60NH2ARGA 245890114955319752−191−109AN
SIGUIJ60NH2ARGA 2410022165290AN
ATOM61CARGA 24−5.4761.72436.4891.0020.46AC
ANISOU61CARGA 24196428103539158110−16AC
SIGUIJ61CARGA 2451121645513275AC
ATOM62OARGA 24−6.2521.05635.7741.0021.02AO
ANISOU62OARGA 24256231503998−121−294−37AO
SIGUIJ62OARGA 2410022157289AO
ATOM63NGLYA 25−4.4051.18537.0661.0019.77AN
ANISOU63NGLYA 25169421523266−18729855AN
SIGUIJ63NGLYA 2510022165290AN
ATOM64CAGLYA 25−4.142−0.25236.9601.0019.02AC
ANISOU64CAGLYA 25249421783788−31221−4AC
SIGUIJ64CAGLYA 2551121644513276AC
ATOM65CGLYA 25−3.455−0.70435.6911.0018.44AC
ANISOU65CGLYA 25159920433543−102−238−3AC
SIGUIJ65CGLYA 2551121643613277AC
ATOM66OGLYA 25−3.197−1.87935.5661.0018.78AO
ANISOU66OGLYA 252182206939091−69−1AO
SIGUIJ66OGLYA 2510022157289AO
ATOM67NSERA 26−3.1010.19934.7751.0017.58AN
ANISOU67NSERA 26163719263293−297−416−184AN
SIGUIJ67NSERA 2610022165290AN
ATOM68CASERA 26−2.521−0.20433.5391.0016.76AC
ANISOU68CASERA 26163918283224−141−487−92AC
SIGUIJ68CASERA 2651121642713279AC
ATOM69CBSERA 26−2.9590.74432.4201.0017.50AC
ANISOU69CBSERA 2623411960330423−634−58AC
SIGUIJ69CBSERA 2651121641913280AC
ATOM70OGSERA 26−2.5232.08132.6331.0017.84AO
ANISOU70OGSERA 26270519732835−62−85169AO
SIGUIJ70OGSERA 2610022157289AO
ATOM71CSERA 26−0.983−0.26733.5621.0015.79AC
ANISOU71CSERA 26164219012649−132−475−100AC
SIGUIJ71CSERA 2641121641113282AC
ATOM72OSERA 26−0.388−0.64232.5691.0015.91AO
ANISOU72OSERA 261789192326335−449−18AO
SIGUIJ72OSERA 2610022157289AO
ATOM73NHISA 27−0.4040.09334.7051.0014.85AN
ANISOU73NHISA 27159712332583−97−45088AN
SIGUIJ73NHISA 2710022165290AN
ATOM74CAHISA 271.0730.04534.8911.0014.13AC
ANISOU74CAHISA 27159611822242−107−396104AC
SIGUIJ74CAHISA 2741121740413283AC
ATOM75CBHISA 271.6481.47134.9611.0014.38AC
ANISOU75CBHISA 27162211942354−125−156−12AC
SIGUIJ75CBHISA 2741121739713285AC
ATOM76CGHISA 271.4952.17933.6791.0015.00AC
ANISOU76CGHISA 27175812782360−48−128−2AC
SIGUIJ76CGHISA 2741121739013286AC
ATOM77CD2HISA 272.3372.36432.6561.0015.85AC
ANISOU77CD2HISA 272142136926191518334AC
SIGUIJ77CD2HISA 2741121738413288AC
ATOM78ND1HISA 270.2592.63833.2591.0015.70AN
ANISOU78ND1HISA 271802146226720−2102AN
SIGUIJ78ND1HISA 2710022165290AN
ATOM79CE1HISA 270.3393.05032.0171.0015.87AC
ANISOU79CE1HISA 27257316502706234−5363AC
SIGUIJ79CE1HISA 2741121737813290AC
ATOM80NE2HISA 271.5842.88931.6131.0015.97AN
ANISOU80NE2HISA 27257916302756223−2716AN
SIGUIJ80NE2HISA 2710022165290AN
ATOM81CHISA 271.499−0.71136.1031.0013.41AC
ANISOU81CHISA 27133510302120−38−247−16AC
SIGUIJ81CHISA 2741121737213292AC
ATOM82OHISA 272.230−0.21336.9431.0012.83AO
ANISOU82OHISA 27131912891972−233−1099AO
SIGUIJ82OHISA 2710022157289AO
ATOM83NPROA 281.059−1.97636.2271.0012.88AN
ANISOU83NPROA 28158710632237−143−40236AN
SIGUIJ83NPROA 2810022165290AN
ATOM84CDPROA 280.178−2.76435.3231.0013.22AC
ANISOU84CDPROA 28183512152589−167−633−88AC
SIGUIJ84CDPROA 2841121736613294AC
ATOM85CAPROA 281.373−2.73437.4521.0012.51AC
ANISOU85CAPROA 28138511102197−28−27824AC
SIGUIJ85CAPROA 2841121736113296AC
ATOM86CBPROA 280.454−3.95237.3701.0013.00AC
ANISOU86CBPROA 28184113592863−369−41998AC
SIGUIJ86CBPROA 2841121835613298AC
ATOM87CGPROA 280.220−4.14635.9901.0013.60AC
ANISOU87CGPROA 28197512842883−96−48153AC
SIGUIJ87CGPROA 2841121835113300AC
ATOM88CPROA 282.842−3.13937.5751.0012.04AC
ANISOU88CPROA 28137710991824−36−23919AC
SIGUIJ88CPROA 2841121834713302AC
ATOM89OPROA 283.260−3.58138.6161.0011.68AO
ANISOU89OPROA 28132611141831−80−22936AO
SIGUIJ89OPROA 2810022157289AO
ATOM90NTRPA 293.566−2.99136.5011.0011.90AN
ANISOU90NTRPA 29152812411911−72−107−4AN
SIGUIJ90NTRPA 2910022165290AN
ATOM91CATRPA 294.996−3.30036.4961.0012.18AC
ANISOU91CATRPA 29152313321800−64−10115AC
SIGUIJ91CATRPA 2941121834213304AC
ATOM92CBTRPA 295.462−3.94935.1701.0013.13AC
ANISOU92CBTRPA 29201415451850145−35−22AC
SIGUIJ92CBTRPA 2941121833813306AC
ATOM93CGTRPA 294.557−3.67734.0631.0014.19AC
ANISOU93CGTRPA 291935142118405952AC
SIGUIJ93CGTRPA 2941121833413309AC
ATOM94CD2TRPA 294.456−2.46833.2691.0014.61AC
ANISOU94CD2TRPA 2916781431184515−70AC
SIGUIJ94CD2TRPA 2941121833013311AC
ATOM95CE2TRPA 293.367−2.64732.3971.0014.65AC
ANISOU95CE2TRPA 29166823201813−1302614AC
SIGUIJ95CE2TRPA 2941121832613313AC
ATOM96CE3TRPA 295.164−1.26033.2231.0014.33AC
ANISOU96CE3TRPA 291697143517781630AC
SIGUIJ96CE3TRPA 2941121832213316AC
ATOM97CD1TRPA 293.550−4.50033.6131.0015.11AC
ANISOU97CD1TRPA 29276124401961−856−156143AC
SIGUIJ97CD1TRPA 2941121831913318AC
ATOM98NE1TRPA 292.846−3.88832.6511.0015.86AN
ANISOU98NE1TRPA 29288125801940−698−148114AN
SIGUIJ98NE1TRPA 2910022165290AN
ATOM99CZ2TRPA 292.979−1.69131.4981.0015.40AC
ANISOU99CZ2TRPA 29205823351811−28170AC
SIGUIJ99CZ2TRPA 2941121831513321AC
ATOM100CZ3TRPA 294.756−0.30532.3101.0014.89AC
ANISOU100CZ3TRPA 291979152417751793017AC
SIGUIJ100CZ3TRPA 2941121831213324AC
ATOM101CH2TRPA 293.670−0.53731.4601.0014.79AC
ANISOU101CH2TRPA 2920122299177413280AC
SIGUIJ101CH2TRPA 2941121830813326AC
ATOM102CTRPA 295.828−2.04336.7371.0012.02AC
ANISOU102CTRPA 2913591288151812231AC
SIGUIJ102CTRPA 2931121830513329AC
ATOM103OTRPA 297.069−2.12536.7961.0012.59AO
ANISOU103OTRPA 291355171521006010AO
SIGUIJ103OTRPA 2910022157289AO
ATOM104NAGLNA 305.205−0.86336.8300.5011.35AN
ANISOU104NAGLNA 30132912751273−2−10AN
SIGUIJ104NAGLNA 3010022165290AN
ATOM105NBGLNA 305.203−0.88136.8500.5013.54AN
ANISOU105NBGLNA 30132312911407000AN
SIGUIJ105NBGLNA 3010022165290AN
ATOM106CAAGLNA 305.8940.40337.1810.5011.36AC
ANISOU106CAAGLNA 301320126712690−20AC
SIGUIJ106CAAGLNA 3031121830213332AC
ATOM107CABGLNA 305.9700.31337.1550.5013.55AC
ANISOU107CABGLNA 301312130113990−20AC
SIGUIJ107CABGLNA 3031121829913335AC
ATOM108CBAGLNA 305.0011.60936.8220.5012.26AC
ANISOU108CBAGLNA 30133312531305−200AC
SIGUIJ108CBAGLNA 3031121829613338AC
ATOM109CBBGLNA 305.2671.54036.5920.5014.45AC
ANISOU109CBBGLNA 301335131214520−60AC
SIGUIJ109CBBGLNA 3031221929413341AC
ATOM110CGAGLNA 305.5083.02537.3340.5014.52AC
ANISOU110CGAGLNA 30137112411278−710AC
SIGUIJ110CGAGLNA 3031221929113344AC
ATOM111CGBGLNA 306.1612.79436.7220.5016.71AC
ANISOU111CGBGLNA 301348131515800−350AC
SIGUIJ111CGBGLNA 3031221928813347AC
ATOM112CDAGLNA 306.2883.79536.2610.5014.95AC
ANISOU112CDAGLNA 301351115312823752AC
SIGUIJ112CDAGLNA 3031121928613350AC
ATOM113CDBGLNA 306.0133.74635.5600.5017.14AC
ANISOU113CDBGLNA 302113137915822557629AC
SIGUIJ113CDBGLNA 30311352109290AC
ATOM114OE1AGLNA 305.8763.82135.1180.5016.06AO
ANISOU114OE1AGLNA 30145120711288196−24−17AO
SIGUIJ114OE1AGLNA 3010022157289AO
ATOM115OE1BGLNA 305.2313.48834.6620.5018.25AO
ANISOU115OE1BGLNA 30220314201669292−14−6AO
SIGUIJ115OE1BGLNA 3010022157289AO
ATOM116NE2AGLNA 307.4034.42836.6400.5016.36AN
ANISOU116NE2AGLNA 30138112421350−600AN
SIGUIJ116NE2AGLNA 3010022165289AN
ATOM117NE2BGLNA 306.7484.85035.5860.5018.55AN
ANISOU117NE2BGLNA 301820124916124505357AN
SIGUIJ117NE2BGLNA 3010022165289AN
ATOM118CAGLNA 306.2080.47338.6640.5010.74AC
ANISOU118CAGLNA 30109111251264−1150AC
SIGUIJ118CAGLNA 303111571501290AC
ATOM119CBGLNA 306.2100.47438.6510.5012.93AC
ANISOU119CBGLNA 30109810881390010AC
SIGUIJ119CBGLNA 303111811228290AC
ATOM120OAGLNA 305.3370.14739.4890.5010.87AO
ANISOU120OAGLNA 30110613311279−50256AO
SIGUIJ120OAGLNA 3010022157289AO
ATOM121OBGLNA 305.3170.18839.4630.5013.06AO
ANISOU121OBGLNA 30116913131472−636619AO
SIGUIJ121OBGLNA 3010022157289AO
ATOM122NVALA 317.4220.90539.0051.009.60AN
ANISOU122NVALA 311089105712135141AN
SIGUIJ122NVALA 3110022165289AN
ATOM123CAVALA 317.7631.19940.3671.009.54AC
ANISOU123CAVALA 31116610821207−810AC
SIGUIJ123CAVALA 313111911065290AC
ATOM124CBVALA 318.7540.15640.9631.009.53AC
ANISOU124CBVALA 3111981106123511−10AC
SIGUIJ124CBVALA 31311197953290AC
ATOM125CG1VALA 318.192−1.23840.8881.0010.19AC
ANISOU125CG1VALA 31145711401524−82−5−3AC
SIGUIJ125CG1VALA 31311201870290AC
ATOM126CG2VALA 3110.1340.26640.2961.009.91AC
ANISOU126CG2VALA 31120611641260340AC
SIGUIJ126CG2VALA 31311204806290AC
ATOM127CVALA 318.3372.61540.4231.009.25AC
ANISOU127CVALA 311145107910941210AC
SIGUIJ127CVALA 31311206754290AC
ATOM128OVALA 318.6763.23039.4171.009.42AO
ANISOU128OVALA 311235112310988181AO
SIGUIJ128OVALA 3110022157289AO
ATOM129NALAA 328.4363.15341.6521.009.37AN
ANISOU129NALAA 32127210991098−2316−2AN
SIGUIJ129NALAA 3210022165289AN
ATOM130CAALAA 329.2104.36641.8981.009.78AC
ANISOU130CAALAA 32124910941197−13−10AC
SIGUIJ130CAALAA 32310208711290AC
ATOM131CBALAA 328.3515.46042.4811.009.76AC
ANISOU131CBALAA 3213591149120166103AC
SIGUIJ131CBALAA 32310209675290AC
ATOM132CALAA 3210.3304.05042.8731.0010.12AC
ANISOU132CALAA 32124211291199−11−10AC
SIGUIJ132CALAA 32310210643290AC
ATOM133OALAA 3210.1393.27143.8441.0010.36AO
ANISOU133OALAA 32145612311233−165−6941AO
SIGUIJ133OALAA 3210022157289AO
ATOM134NLEUA 3311.4764.68242.6641.0010.54AN
ANISOU134NLEUA 33122411121226300AN
SIGUIJ134NLEUA 3310022165289AN
ATOM135CALEUA 3312.5604.61343.6071.0011.11AC
ANISOU135CALEUA 331222114212447−30AC
SIGUIJ135CALEUA 33310211616290AC
ATOM136CBLEUA 3313.8984.46642.8771.0012.76AC
ANISOU136CBLEUA 3313071723153478145−32AC
SIGUIJ136CBLEUA 33310212592290AC
ATOM137CGLEUA 3314.0133.13342.0961.0013.82AC
ANISOU137CGLEUA 33200517821606316−131−94AC
SIGUIJ137CGLEUA 33310213570290AC
ATOM138CD1LEUA 3315.3393.07741.2981.0015.26AC
ANISOU138CD1LEUA 3321523310194355189191AC
SIGUIJ138CD1LEUA 33310213551290AC
ATOM139CD2LEUA 3313.8241.97643.0171.0014.92AC
ANISOU139CD2LEUA 3333271868175921491AC
SIGUIJ139CD2LEUA 33310214534290AC
ATOM140CLEUA 3312.5405.91044.3921.0011.52AC
ANISOU140CLEUA 33120811401249−7−10AC
SIGUIJ140CLEUA 33310214518290AC
ATOM141OLEUA 3312.6647.00443.7801.0010.87AO
ANISOU141OLEUA 33139511371241−1813−1AO
SIGUIJ141OLEUA 3310022157289AO
ATOM142NLEUA 3412.3965.78845.7151.0011.68AN
ANISOU142NLEUA 341170137612481530AN
SIGUIJ142NLEUA 3410022165289AN
ATOM143CALEUA 3412.3146.94346.6041.0012.60AC
ANISOU143CALEUA 341479137012437733AC
SIGUIJ143CALEUA 34310214503290AC
ATOM144CBLEUA 3411.0816.84247.5411.0012.95AC
ANISOU144CBLEUA 34151417341296−1711910AC
SIGUIJ144CBLEUA 34310215490290AC
ATOM145CGLEUA 349.7776.38546.8301.0012.96AC
ANISOU145CGLEUA 34160719061508−69−31AC
SIGUIJ145CGLEUA 34310215477290AC
ATOM146CD1LEUA 348.6506.23847.8721.0013.74AC
ANISOU146CD1LEUA 34168722061548−13051−19AC
SIGUIJ146CD1LEUA 34310215466290AC
ATOM147CD2LEUA 349.3577.36545.7671.0013.15AC
ANISOU147CD2LEUA 3417861933151411−10AC
SIGUIJ147CD2LEUA 34310216455290AC
ATOM148CLEUA 3413.5657.00247.4681.0013.57AC
ANISOU148CLEUA 34151116241306−12301AC
SIGUIJ148CLEUA 34310216445290AC
ATOM149OLEUA 3414.1595.98747.8501.0013.68AO
ANISOU149OLEUA 341564163714162−110AO
SIGUIJ149OLEUA 3410022157289AO
ATOM150NSERA 3513.9368.23247.7931.0014.73AN
ANISOU150NSERA 35189816541350−116−7021AN
SIGUIJ150NSERA 3510022165289AN
ATOM151CASERA 3514.8818.46448.8571.0016.41AC
ANISOU151CASERA 35218024691578−157−305−116AC
SIGUIJ151CASERA 35310216436290AC
ATOM152CBSERA 3515.7539.66048.4591.0017.26AC
ANISOU152CBSERA 35221624592653−9500AC
SIGUIJ152CBSERA 35310216427290AC
ATOM153OGSERA 3516.6639.94949.5321.0019.50AO
ANISOU153OGSERA 35254150152800−738−110−149AO
SIGUIJ153OGSERA 3510022157289AO
ATOM154CSERA 3514.0328.78550.0831.0016.90AC
ANISOU154CSERA 35239823661625−6−1932AC
SIGUIJ154CSERA 35310216419290AC
ATOM155OSERA 3513.5219.89150.1751.0016.99AO
ANISOU155OSERA 352400236517810−161−2AO
SIGUIJ155OSERA 3510022157289AO
ATOM156NGLYA 3613.8707.81650.9961.0017.66AN
ANISOU156NGLYA 36245724011660−24−18329AN
SIGUIJ156NGLYA 3610022165289AN
ATOM157CAGLYA 3612.9027.99652.0761.0018.35AC
ANISOU157CAGLYA 36298323002129−149320−62AC
SIGUIJ157CAGLYA 36310217411290AC
ATOM158CGLYA 3611.4998.00451.4751.0018.74AC
ANISOU158CGLYA 36292724531870−152436−76AC
SIGUIJ158CGLYA 36310217404290AC
ATOM159OGLYA 3611.0316.95950.9801.0019.36AO
ANISOU159OGLYA 36330527822182−526835−406AO
SIGUIJ159OGLYA 3610022157289AO
ATOM160NAASNA 3810.8419.15651.4770.5019.21AN
ANISOU160NAASNA 38299824811260−106463−60AN
SIGUIJ160NAASNA 3810022165289AN
ATOM161NBASNA 3810.8379.16151.4840.5021.40AN
ANISOU161NBASNA 38293524511681−163415−91AN
SIGUIJ161NBASNA 3810022165289AN
ATOM162CAAASNA 389.5259.29250.8670.5019.45AC
ANISOU162CAAASNA 38307126251630−86299−37AC
SIGUIJ162CAAASNA 38310217397290AC
ATOM163CABASNA 389.5849.33650.7460.5021.64AC
ANISOU163CABASNA 38323824552604−245−10936AC
SIGUIJ163CABASNA 38310217390290AC
ATOM164CBAASNA 388.5659.93151.8670.5021.32AC
ANISOU164CBAASNA 38396930971906520779254AC
SIGUIJ164CBAASNA 38310217384290AC
ATOM165CBBASNA 388.4469.76051.6780.5023.51AC
ANISOU165CBBASNA 3836003504290415914364AC
SIGUIJ165CBBASNA 38310217378290AC
ATOM166CGAASNA 389.04711.30552.3050.5022.29AC
ANISOU166CGAASNA 38433431582340437629163AC
SIGUIJ166CGAASNA 38310217372290AC
ATOM167CGBASNA 387.7978.60152.3310.5024.48AC
ANISOU167CGBASNA 383999356130062531614AC
SIGUIJ167CGBASNA 38310217366290AC
ATOM168OD1AASNA 389.51811.48353.4180.5023.94AO
ANISOU168OD1AASNA 381364249024099786−3366−264AO
SIGUIJ168OD1AASNA 3810022157289AO
ATOM169OD1BASNA 387.6438.55753.5490.5026.13AO
ANISOU169OD1BASNA 38465177863014−90736632AO
SIGUIJ169OD1BASNA 3810022157289AO
ATOM170ND2AASNA 388.95412.27251.4200.5023.58AN
ANISOU170ND2AASNA 38350629612202−23218−6AN
SIGUIJ170ND2AASNA 3810022165289AN
ATOM171ND2BASNA 387.3997.63151.5250.5025.77AN
ANISOU171ND2BASNA 38530536913182−249−81AN
SIGUIJ171ND2BASNA 3810022165289AN
ATOM172CAASNA 389.58710.17149.6090.5018.94AC
ANISOU172CAASNA 38270325751608−86266−69AC
SIGUIJ172CAASNA 38310217361290AC
ATOM173CBASNA 389.64010.32249.5800.5021.13AC
ANISOU173CBASNA 38270323942572−4249−10AC
SIGUIJ173CBASNA 38310218356290AC
ATOM174OAASNA 388.55710.47549.0080.5019.09AO
ANISOU174OAASNA 38294429732298−1−114−3AO
SIGUIJ174OAASNA 3810022157289AO
ATOM175OBASNA 388.59710.68749.0320.5021.28AO
ANISOU175OBASNA 382746255526887−50AO
SIGUIJ175OBASNA 3810022157289AO
ATOM176NAGLNA 3910.78910.60249.2210.5017.84AN
ANISOU176NAGLNA 3925641698169727723369AN
SIGUIJ176NAGLNA 3910022165289AN
ATOM177NBGLNA 3910.84210.75649.1950.5020.03AN
ANISOU177NBGLNA 3925852227162917−247−9AN
SIGUIJ177NBGLNA 3910022165289AN
ATOM178CAAGLNA 3910.91111.55248.1180.5016.87AC
ANISOU178CAAGLNA 392168164216361495916AC
SIGUIJ178CAAGLNA 39310218351290AC
ATOM179CABGLNA 3910.96811.68448.0780.5019.06AC
ANISOU179CABGLNA 39214021821656365−2−1AC
SIGUIJ179CABGLNA 39310218346290AC
ATOM180CBAGLNA 3912.01012.55648.4390.5018.21AC
ANISOU180CBAGLNA 39248520551554−214134−43AC
SIGUIJ180CBAGLNA 39310218342290AC
ATOM181CBBGLNA 3912.11912.67948.3230.5020.40AC
ANISOU181CBBGLNA 39246726091793−4−342AC
SIGUIJ181CBBGLNA 39310218338290AC
ATOM182CGAGLNA 3911.59013.51949.5430.5020.94AC
ANISOU182CGAGLNA 3948132247155849840067AC
SIGUIJ182CGAGLNA 39310218334290AC
ATOM183CGBGLNA 3912.16213.85647.3330.5023.13AC
ANISOU183CGBGLNA 3966092671194254079397AC
SIGUIJ183CGBGLNA 39310218330290AC
ATOM184CDAGLNA 3910.53014.48749.0570.5022.09AC
ANISOU184CDAGLNA 39484418043110132−396−23AC
SIGUIJ184CDAGLNA 39310218326290AC
ATOM185CDBGLNA 3913.24914.88447.6420.5024.28AC
ANISOU185CDBGLNA 39788738805011−57513−2AC
SIGUIJ185CDBGLNA 39310218322290AC
ATOM186OE1AGLNA 3910.75715.24448.1220.5023.85AO
ANISOU186OE1AGLNA 3979521817336228548126AO
SIGUIJ186OE1AGLNA 3910022157289AO
ATOM187OE1BGLNA 3914.09814.66848.5080.5026.04AO
ANISOU187OE1BGLNA 39911865396004151−1012−51AO
SIGUIJ187OE1BGLNA 3910022157289AO
ATOM188NE2AGLNA 399.36514.45449.6820.5023.39AN
ANISOU188NE2AGLNA 395096521239834171−10AN
SIGUIJ188NE2AGLNA 3910022165289AN
ATOM189NE2BGLNA 3913.22116.01046.9390.5025.58AN
ANISOU189NE2BGLNA 39617838514926−526159−50AN
SIGUIJ189NE2BGLNA 3910022165289AN
ATOM190CAGLNA 3911.21510.86946.7770.5015.25AC
ANISOU190CAGLNA 39158615831636000AC
SIGUIJ190CAGLNA 39310218318290AC
ATOM191CBGLNA 3911.23110.91446.7730.5017.44AC
ANISOU191CBGLNA 39163620811649161−13AC
SIGUIJ191CBGLNA 39310218315290AC
ATOM192OAGLNA 3912.14510.05046.6760.5014.48AO
ANISOU192OAGLNA 391594158114570−140AO
SIGUIJ192OAGLNA 3910022157289AO
ATOM193OBGLNA 3912.13810.06946.6960.5016.67AO
ANISOU193OBGLNA 39167421111542191−4−4AO
SIGUIJ193OBGLNA 3910022157289AO
ATOM194NLEUA 4010.46011.23645.7421.0013.93AN
ANISOU194NLEUA 40149115821598−2661AN
SIGUIJ194NLEUA 4010022165289AN
ATOM195CALEUA 4010.68310.60644.4101.0012.92AC
ANISOU195CALEUA 40135615241597−31538AC
SIGUIJ195CALEUA 40310218312290AC
ATOM196CBLEUA 409.76911.22343.3941.0012.72AC
ANISOU196CBLEUA 40149314941694−1−55−8AC
SIGUIJ196CBLEUA 40310218308290AC
ATOM197CGLEUA 4010.03910.71541.9631.0012.55AC
ANISOU197CGLEUA 40172213871706−500AC
SIGUIJ197CGLEUA 40310218305290AC
ATOM198CD1LEUA 409.6799.24641.8501.0012.53AC
ANISOU198CD1LEUA 401609137717471420AC
SIGUIJ198CD1LEUA 40310218302290AC
ATOM199CD2LEUA 409.16611.49740.9891.0012.87AC
ANISOU199CD2LEUA 40209017801721377−27−22AC
SIGUIJ199CD2LEUA 40310218299290AC
ATOM200CLEUA 4012.11910.85943.9971.0012.46AC
ANISOU200CLEUA 401335119714242550AC
SIGUIJ200CLEUA 40310218296290AC
ATOM201OLEUA 4012.60412.01344.0121.0012.88AO
ANISOU201OLEUA 40162512481672−9433AO
SIGUIJ201OLEUA 4010022157289AO
ATOM202NHISA 4112.7889.81043.5651.0011.50AN
ANISOU202NHISA 41124811601302−2410AN
SIGUIJ202NHISA 4110022165289AN
ATOM203CAHISA 4114.0959.94742.9331.0010.71AC
ANISOU203CAHISA 41124911551274−2800AC
SIGUIJ203CAHISA 41310219293290AC
ATOM204CBHISA 4115.1289.14243.7221.0010.98AC
ANISOU204CBHISA 41126612091307−4−10AC
SIGUIJ204CBHISA 41310219291290AC
ATOM205CGHISA 4116.5239.50043.3471.0010.96AC
ANISOU205CGHISA 41128114291279−9126AC
SIGUIJ205CGHISA 41210219288290AC
ATOM206CD2HISA 4117.5178.80042.7551.0010.94AC
ANISOU206CD2HISA 41130615131249−42−10AC
SIGUIJ206CD2HISA 41210219285290AC
ATOM207ND1HISA 4117.04810.74943.6181.0011.76AN
ANISOU207ND1HISA 41148214741696−178−65−59AN
SIGUIJ207ND1HISA 4110022165289AN
ATOM208CE1HISA 4118.29310.80143.1951.0011.42AC
ANISOU208CE1HISA 41148017071745−159−40−22AC
SIGUIJ208CE1HISA 41210219283290AC
ATOM209NE2HISA 4118.6149.64242.6801.0011.19AN
ANISOU209NE2HISA 41140616871633−183138AN
SIGUIJ209NE2HISA 4110022165289AN
ATOM210CHISA 4114.0679.52341.4441.0010.29AC
ANISOU210CHISA 41118210501269−7−30AC
SIGUIJ210CHISA 41210219280290AC
ATOM211OHISA 4114.59010.27340.5881.0010.52AO
ANISOU211OHISA 41144710681291−9277−27AO
SIGUIJ211OHISA 4110022157289AO
ATOM212NCYSA 4213.4818.35441.1381.009.76AN
ANISOU212NCYSA 42123310631149−3410−3AN
SIGUIJ212NCYSA 4210022164289AN
ATOM213CACYSA 4213.4587.88539.7601.009.65AC
ANISOU213CACYSA 42122211131149−3010AC
SIGUIJ213CACYSA 42210219278290AC
ATOM214CCYSA 4212.2876.93239.5671.009.15AC
ANISOU214CCYSA 42107989711501511−2AC
SIGUIJ214CCYSA 42210219276290AC
ATOM215OCYSA 4211.6526.45740.5451.009.16AO
ANISOU215OCYSA 42121011441141−830AO
SIGUIJ215OCYSA 4210022157289AO
ATOM216CBCYSA 4214.7057.10639.4231.0010.11AC
ANISOU216CBCYSA 421254121112361611AC
SIGUIJ216CBCYSA 42210219273290AC
ATOM217SGCYSA 4216.1878.08139.0761.0010.44AS
ANISOU217SGCYSA 42125912621221050AS
SIGUIJ217SGCYSA 4210022149289AS
ATOM218NGLYA 4311.9816.64438.3261.009.41AN
ANISOU218NGLYA 4311239161162722−2AN
SIGUIJ218NGLYA 4310022164289AN
ATOM219CAGLYA 4311.1225.52538.0281.009.14AC
ANISOU219CAGLYA 43118494611822300AC
SIGUIJ219CAGLYA 43210219271290AC
ATOM220CGLYA 4311.8884.24637.8481.009.24AC
ANISOU220CGLYA 43122295611433572AC
SIGUIJ220CGLYA 43210219269290AC
ATOM221OGLYA 4313.1184.21437.8891.009.94AO
ANISOU221OGLYA 431219107115872750AO
SIGUIJ221OGLYA 4310022156289AO
ATOM222NGLYA 4411.1543.16537.5681.009.21AN
ANISOU222NGLYA 44122795112414600AN
SIGUIJ222NGLYA 4410022164289AN
ATOM223CAGLYA 4411.7591.84037.2971.009.38AC
ANISOU223CAGLYA 441195949126942−20AC
SIGUIJ223CAGLYA 44210219267290AC
ATOM224CGLYA 4410.6700.88136.9251.009.47AC
ANISOU224CGLYA 44116793510906084AC
SIGUIJ224CGLYA 44210219265290AC
ATOM225OGLYA 449.4751.22636.8941.009.28AO
ANISOU225OGLYA 441154100512726411−2AO
SIGUIJ225OGLYA 4410022156289AO
ATOM226NVALA 4511.109−0.34336.6411.009.57AN
ANISOU226NVALA 45122893911656395AN
SIGUIJ226NVALA 4510022164289AN
ATOM227CAVALA 4510.162−1.42836.3791.0010.47AC
ANISOU227CAVALA 45134910421480−33−43−3AC
SIGUIJ227CAVALA 45210219263290AC
ATOM228CBVALA 4510.067−1.86734.8951.0011.25AC
ANISOU228CBVALA 4519341227148457−100−12AC
SIGUIJ228CBVALA 45210219261290AC
ATOM229CG1VALA 459.505−0.69934.0791.0012.17AC
ANISOU229CG1VALA 45244312841519201−199−37AC
SIGUIJ229CG1VALA 45210219259290AC
ATOM230CG2VALA 4511.426−2.31434.3851.0011.84AC
ANISOU230CG2VALA 4519641327165179−23−4AC
SIGUIJ230CG2VALA 45210219257290AC
ATOM231CVALA 4510.536−2.64037.1931.0010.59AC
ANISOU231CVALA 45119310431477−72−271AC
SIGUIJ231CVALA 45210219255290AC
ATOM232OVALA 4511.695−2.92637.5051.0010.74AO
ANISOU232OVALA 45120210611805−105−12041AO
SIGUIJ232OVALA 4510022156289AO
ATOM233NLEUA 469.494−3.40837.5391.0010.71AN
ANISOU233NLEUA 4611689731575−1040AN
SIGUIJ233NLEUA 4610022164289AN
ATOM234CALEUA 469.719−4.66038.2561.0010.83AC
ANISOU234CALEUA 46141799115832370AC
SIGUIJ234CALEUA 46210219253290AC
ATOM235CBLEUA 468.469−5.02139.0521.0011.09AC
ANISOU235CBLEUA 46145012691572−6461AC
SIGUIJ235CBLEUA 46210219252290AC
ATOM236CGLEUA 468.600−6.22839.9861.0011.03AC
ANISOU236CGLEUA 46156212721562−600−2AC
SIGUIJ236CGLEUA 46210219250290AC
ATOM237CD1LEUA 469.556−5.86941.0991.0011.37AC
ANISOU237CD1LEUA 46154011811562−100AC
SIGUIJ237CD1LEUA 46210219248290AC
ATOM238CD2LEUA 467.237−6.66140.5021.0012.42AC
ANISOU238CD2LEUA 46166314182039−113194−12AC
SIGUIJ238CD2LEUA 46210219247290AC
ATOM239CLEUA 4610.037−5.76237.2791.0011.25AC
ANISOU239CLEUA 46150810241604634−1AC
SIGUIJ239CLEUA 46210219245290AC
ATOM240OLEUA 469.172−6.11636.4431.0011.54AO
ANISOU240OLEUA 46155412951635−16−8−1AO
SIGUIJ240OLEUA 4610022156289AO
ATOM241NVALA 4711.218−6.36037.3741.0011.33AN
ANISOU241NVALA 4714739171721−1−80AN
SIGUIJ241NVALA 4710022164289AN
ATOM242CAVALA 4711.617−7.45736.4561.0012.20AC
ANISOU242CAVALA 47158994417492280AC
SIGUIJ242CAVALA 47210219243290AC
ATOM243CBVALA 4713.132−7.53136.3191.0011.95AC
ANISOU243CBVALA 471588111620272727−1AC
SIGUIJ243CBVALA 47210219242290AC
ATOM244CG1VALA 4713.524−8.72235.4591.0012.53AC
ANISOU244CG1VALA 4718811165204313524−11AC
SIGUIJ244CG1VALA 47210219240290AC
ATOM245CG2VALA 4713.676−6.21035.7001.0012.70AC
ANISOU245CG2VALA 47170711392103−9563AC
SIGUIJ245CG2VALA 47210219239290AC
ATOM246CVALA 4711.094−8.79237.0191.0012.39AC
ANISOU246CVALA 47151194517694617−1AC
SIGUIJ246CVALA 47210219237290AC
ATOM247OVALA 4710.525−9.64136.2981.0013.11AO
ANISOU247OVALA 47187511531846−2009−29AO
SIGUIJ247OVALA 4710022156289AO
ATOM248NASNA 4811.274−8.98638.3101.0012.97AN
ANISOU248NASNA 4816101093176710−91AN
SIGUIJ248NASNA 4810022164289AN
ATOM249CAASNA 4810.692−10.19738.9401.0013.56AC
ANISOU249CAASNA 48188111841765−143−3021AC
SIGUIJ249CAASNA 48210219236290AC
ATOM250CBASNA 4811.514−11.46538.6911.0013.95AC
ANISOU250CBASNA 48198012321875−85−223AC
SIGUIJ250CBASNA 48210219234290AC
ATOM251CGASNA 4812.949−11.32339.1281.0014.48AC
ANISOU251CGASNA 48203216242353−125−1788AC
SIGUIJ251CGASNA 48210219233290AC
ATOM252OD1ASNA 4813.236−10.80240.2341.0014.80AO
ANISOU252OD1ASNA 4817441578235513−166−9AO
SIGUIJ252OD1ASNA 4810022156289AO
ATOM253ND2ASNA 4813.863−11.73638.2671.0015.49AN
ANISOU253ND2ASNA 482331202926144656−4AN
SIGUIJ253ND2ASNA 4810022164289AN
ATOM254CASNA 4810.591−9.86340.4321.0014.01AC
ANISOU254CASNA 48193812591777−30726−25AC
SIGUIJ254CASNA 48210219232290AC
ATOM255OASNA 4810.777−8.67440.8331.0013.61AO
ANISOU255OASNA 48185012301641−252−4432AO
SIGUIJ255OASNA 4810022156289AO
ATOM256NAGLUA 4910.232−10.83541.2750.5014.78AN
ANISOU256NAGLUA 49199313421824−383−3133AN
SIGUIJ256NAGLUA 4910022164289AN
ATOM257NBGLUA 4910.279−10.86841.2590.5016.97AN
ANISOU257NBGLUA 49269214511833−668−12573AN
SIGUIJ257NBGLUA 4910022164289AN
ATOM258CAAGLUA 499.895−10.51942.6700.5015.14AC
ANISOU258CAAGLUA 49195312821836−526−1014AC
SIGUIJ258CAAGLUA 49210219230290AC
ATOM259CABGLUA 499.970−10.66042.6800.5017.33AC
ANISOU259CABGLUA 49214029231801−131−322−14AC
SIGUIJ259CABGLUA 49210219229290AC
ATOM260CBAGLUA 499.299−11.75343.3880.5016.48AC
ANISOU260CBAGLUA 49232013461820−68941−34AC
SIGUIJ260CBAGLUA 49210219228290AC
ATOM261CBBGLUA 499.618−12.00943.3670.5018.67AC
ANISOU261CBBGLUA 4957352899297233184323AC
SIGUIJ261CBBGLUA 49210219226290AC
ATOM262CGAGLUA 498.105−12.39442.6920.5018.70AC
ANISOU262CGAGLUA 49262621541929−1165−4854AC
SIGUIJ262CGAGLUA 49210219225290AC
ATOM263CGBGLUA 498.504−12.83842.7150.5020.89AC
ANISOU263CGBGLUA 49685828506466104−162−36AC
SIGUIJ263CGBGLUA 49210219224290AC
ATOM264CDAGLUA 498.468−13.54441.7390.5019.66AC
ANISOU264CDAGLUA 49302221581755−883−230149AC
SIGUIJ264CDAGLUA 49210219223290AC
ATOM265CDBGLUA 497.906−13.86243.6550.5021.85AC
ANISOU265CDBGLUA 49624226976614528−9869AC
SIGUIJ265CDBGLUA 49210219222290AC
ATOM266OE1AGLUA 499.352−13.40440.8780.5020.29AO
ANISOU266OE1AGLUA 49330012542020−90554−28AO
SIGUIJ266OE1AGLUA 4910022156289AO
ATOM267OE1BGLUA 498.685−14.45244.4150.5022.48AO
ANISOU267OE1BGLUA 4957601973643447220AO
SIGUIJ267OE1BGLUA 4910022156289AO
ATOM268OE2AGLUA 497.836−14.61541.8420.5021.02AO
ANISOU268OE2AGLUA 49253819441986−562−2116AO
SIGUIJ268OE2AGLUA 4910022156289AO
ATOM269OE2BGLUA 496.671−14.05543.6460.5023.21AO
ANISOU269OE2BGLUA 49632661864560−14−653AO
SIGUIJ269OE2BGLUA 4910022156289AO
ATOM270CAGLUA 4911.092−9.97743.4710.5014.59AC
ANISOU270CAGLUA 4918779591825−364−13AC
SIGUIJ270CAGLUA 49210219220290AC
ATOM271CBGLUA 4911.117−10.00343.4520.5016.78AC
ANISOU271CBGLUA 49189827211417−13−682AC
SIGUIJ271CBGLUA 49210219219290AC
ATOM272OAGLUA 4910.911−9.40644.5380.5014.43AO
ANISOU272OAGLUA 4916179681833−452−2−5AO
SIGUIJ272OAGLUA 4910022156289AO
ATOM273OBGLUA 4910.903−9.40344.4970.5016.62AO
ANISOU273OBGLUA 49260727381454381−1AO
SIGUIJ273OBGLUA 4910022156289AO
ATOM274NAARGA 5012.298−10.15042.9350.5014.49AN
ANISOU274NAARGA 50189115881752−249−2323AN
SIGUIJ274NAARGA 5010022164289AN
ATOM275NBARGA 5012.324−10.13742.9170.5016.68AN
ANISOU275NBARGA 50193314791657−16339−17AN
SIGUIJ275NBARGA 5010022164289AN
ATOM276CAAARGA 5013.500−9.68143.6060.5014.49AC
ANISOU276CAAARGA 50181812711701−8817−7AC
SIGUIJ276CAAARGA 50210219218290AC
ATOM277CABARGA 5013.521−9.69143.6040.5016.68AC
ANISOU277CABARGA 50192512611694−7821−5AC
SIGUIJ277CABARGA 50210219217290AC
ATOM278CBAARGA 5014.485−10.85443.7330.5016.52AC
ANISOU278CBAARGA 5020451410276376−144−3AC
SIGUIJ278CBAARGA 50210219216290AC
ATOM279CBBARGA 5014.511−10.86343.6820.5018.71AC
ANISOU279CBBARGA 50223314592243166015AC
SIGUIJ279CBBARGA 50210220215290AC
ATOM280CGAARGA 5014.078−11.82744.8300.5019.27AC
ANISOU280CGAARGA 50266814912900486856AC
SIGUIJ280CGAARGA 50210220214290AC
ATOM281CGBARGA 5015.776−10.56344.4360.5021.46AC
ANISOU281CGBARGA 50229926362258−1055−9AC
SIGUIJ281CGBARGA 50210220213290AC
ATOM282CDAARGA 5014.453−11.22646.1450.5021.50AC
ANISOU282CDAARGA 50400928612974−1194251−214AC
SIGUIJ282CDAARGA 50210220212290AC
ATOM283CDBARGA 5015.496−10.24445.9040.5023.69AC
ANISOU283CDBARGA 50196127022258−105−36−9AC
SIGUIJ283CDBARGA 50210220210290AC
ATOM284NEAARGA 5014.330−12.16347.2430.5023.77AN
ANISOU284NEAARGA 501090029573100−1335899−149AN
SIGUIJ284NEAARGA 5010022164289AN
ATOM285NEBARGA 5015.178−11.46846.6330.5025.96AN
ANISOU285NEBARGA 50326827532278−36695−42AN
SIGUIJ285NEBARGA 5010022164289AN
ATOM286CZAARGA 5014.812−11.93348.4550.5024.33AC
ANISOU286CZAARGA 501300234493369−1870159−30AC
SIGUIJ286CZAARGA 50210220209290AC
ATOM287CZBARGA 5014.845−11.52447.9160.5026.52AC
ANISOU287CZBARGA 50640118962492−303909−62AC
SIGUIJ287CZBARGA 50210220208290AC
ATOM288NH1AARGA 5015.452−10.79448.6880.5024.98AN
ANISOU288NH1AARGA 507444167251391342−320−124AN
SIGUIJ288NH1AARGA 5010022164289AN
ATOM289NH1BARGA 5014.778−10.41948.6440.5027.17AN
ANISOU289NH1BARGA 5029821878232388−20AN
SIGUIJ289NH1BARGA 5010022164289AN
ATOM290NH2AARGA 5014.635−12.81349.4320.5025.28AN
ANISOU290NH2AARGA 501090332803376−1231350−56AN
SIGUIJ290NH2AARGA 5010022164289AN
ATOM291NH2BARGA 5014.585−12.69948.4710.5027.47AN
ANISOU291NH2BARGA 50504319782193−488−12821AN
SIGUIJ291NH2BARGA 5010022164289AN
ATOM292CAARGA 5014.230−8.47242.9960.5013.60AC
ANISOU292CAARGA 50161012071674404−1AC
SIGUIJ292CAARGA 50210220207290AC
ATOM293CBARGA 5014.234−8.47242.9950.5015.79AC
ANISOU293CBARGA 50166311871666690−8AC
SIGUIJ293CBARGA 50210220207290AC
ATOM294OAARGA 5015.150−7.93843.6350.5013.67AO
ANISOU294OAARGA 50165813391681−2611AO
SIGUIJ294OAARGA 5010022156289AO
ATOM295OBARGA 5015.147−7.92843.6300.5015.86AO
ANISOU295OBARGA 50174213701670−36−93AO
SIGUIJ295OBARGA 5010022156289AO
ATOM296NTRPA 5113.850−8.06741.7791.0012.29AN
ANISOU296NTRPA 51150511521666−23121AN
SIGUIJ296NTRPA 5110022164289AN
ATOM297CATRPA 5114.687−7.15541.0151.0011.48AC
ANISOU297CATRPA 5113221088157880−574AC
SIGUIJ297CATRPA 51210220206290AC
ATOM298CBTRPA 5115.438−7.96039.9421.0011.69AC
ANISOU298CBTRPA 5115121196165015629−17AC
SIGUIJ298CBTRPA 51210220205290AC
ATOM299CGTRPA 5116.522−8.84540.5091.0012.06AC
ANISOU299CGTRPA 51154612441789172−234AC
SIGUIJ299CGTRPA 51210220204290AC
ATOM300CD2TRPA 5117.836−8.42340.8811.0012.06AC
ANISOU300CD2TRPA 51154711342005202−632AC
SIGUIJ300CD2TRPA 51210220203290AC
ATOM301CE2TRPA 5118.523−9.57241.3581.0012.45AC
ANISOU301CE2TRPA 51161411232069211−805AC
SIGUIJ301CE2TRPA 51210220202290AC
ATOM302CE3TRPA 5118.514−7.19140.8591.0012.45AC
ANISOU302CE3TRPA 51158011602082175−53−2AC
SIGUIJ302CE3TRPA 51210220201290AC
ATOM303CD1TRPA 5116.465−10.19740.7651.0012.45AC
ANISOU303CD1TRPA 5115551255211720113636AC
SIGUIJ303CD1TRPA 51210220200290AC
ATOM304NE1TRPA 5117.655−10.61741.2711.0012.82AN
ANISOU304NE1TRPA 51166511402779176−14722AN
SIGUIJ304NE1TRPA 5110022164289AN
ATOM305CZ2TRPA 5119.835−9.53041.7851.0012.49AC
ANISOU305CZ2TRPA 51161111632023200−567AC
SIGUIJ305CZ2TRPA 51210220199290AC
ATOM306CZ3TRPA 5119.811−7.15341.2801.0012.11AC
ANISOU306CZ3TRPA 51156011521987177−121AC
SIGUIJ306CZ3TRPA 51210220198290AC
ATOM307CH2TRPA 5120.475−8.31841.7381.0012.39AC
ANISOU307CH2TRPA 51162211612100192−453AC
SIGUIJ307CH2TRPA 51210220197290AC
ATOM308CTRPA 5113.891−6.07240.3351.0010.92AC
ANISOU308CTRPA 51117610241481−870AC
SIGUIJ308CTRPA 51210220197290AC
ATOM309OTRPA 5112.875−6.33139.6721.0010.75AO
ANISOU309OTRPA 51125310571624−29−902AO
SIGUIJ309OTRPA 5110022156289AO
ATOM310NVALA 5214.461−4.86340.4201.009.93AN
ANISOU310NVALA 52118010121381350AN
SIGUIJ310NVALA 5210022164289AN
ATOM311CAVALA 5213.946−3.68339.6871.0010.04AC
ANISOU311CAVALA 5212601029140135−81AC
SIGUIJ311CAVALA 52210220196290AC
ATOM312CBVALA 5213.646−2.57040.7421.0010.01AC
ANISOU312CBVALA 52126710281421850AC
SIGUIJ312CBVALA 52210220195290AC
ATOM313CG1VALA 5213.540−1.17440.0861.0010.49AC
ANISOU313CG1VALA 521519102714292281AC
SIGUIJ313CG1VALA 52210220194290AC
ATOM314CG2VALA 5212.358−2.90441.4421.0010.41AC
ANISOU314CG2VALA 52131511761577−2566−2AC
SIGUIJ314CG2VALA 52210220193290AC
ATOM315CVALA 5214.986−3.24938.6951.009.93AC
ANISOU315CVALA 521213950139598−183AC
SIGUIJ315CVALA 52210220193290AC
ATOM316OVALA 5216.193−3.21039.0221.0010.38AO
ANISOU316OVALA 52120014741279893−2AO
SIGUIJ316OVALA 5210022156289AO
ATOM317NLEUA 5314.537−2.83437.5321.009.71AN
ANISOU317NLEUA 531220933139584−20AN
SIGUIJ317NLEUA 5310022164289AN
ATOM318CALEUA 5315.414−2.26236.5041.009.85AC
ANISOU318CALEUA 531255969142069140AC
SIGUIJ318CALEUA 53210220192290AC
ATOM319CBLEUA 5315.126−2.91335.1491.0010.62AC
ANISOU319CBLEUA 53140710631430183−3AC
SIGUIJ319CBLEUA 53210220191290AC
ATOM320CGLEUA 5315.952−2.42633.9451.0011.41AC
ANISOU320CGLEUA 53156412851460−10958−30AC
SIGUIJ320CGLEUA 53210220190290AC
ATOM321CD1LEUA 5317.413−2.81134.1441.0011.99AC
ANISOU321CD1LEUA 531598174017910140AC
SIGUIJ321CD1LEUA 53210220190290AC
ATOM322CD2LEUA 5315.368−3.09932.6831.0012.17AC
ANISOU322CD2LEUA 53183413001485−176−2711AC
SIGUIJ322CD2LEUA 53210220189290AC
ATOM323CLEUA 5315.139−0.74936.4471.009.78AC
ANISOU323CLEUA 53116195711614200AC
SIGUIJ323CLEUA 53210220188290AC
ATOM324OLEUA 5313.987−0.28336.4341.009.80AO
ANISOU324OLEUA 5311611023141459−19−2AO
SIGUIJ324OLEUA 5310022156289AO
ATOM325NTHRA 5416.2060.05436.3931.009.36AN
ANISOU325NTHRA 54118698013661550AN
SIGUIJ325NTHRA 5410022164289AN
ATOM326CATHRA 5416.1271.50436.3721.008.84AC
ANISOU326CATHRA 54107598313111130AC
SIGUIJ326CATHRA 54210220187290AC
ATOM327CBTHRA 5416.0052.00337.8221.009.07AC
ANISOU327CBTHRA 541303102313156300AC
SIGUIJ327CBTHRA 54210220187290AC
ATOM328OG1THRA 5415.7353.39537.8001.009.46AO
ANISOU328OG1THRA 541233102113163320AO
SIGUIJ328OG1THRA 5410022156289AO
ATOM329CG2THRA 5417.2461.74638.6801.009.74AC
ANISOU329CG2THRA 5413171192132710202AC
SIGUIJ329CG2THRA 54210220186290AC
ATOM330CTHRA 5417.3862.04235.6721.008.45AC
ANISOU330CTHRA 541059100812410−140AC
SIGUIJ330CTHRA 54210220185290AC
ATOM331OTHRA 5418.1351.27935.0191.008.67AO
ANISOU331OTHRA 5411161041123219110AO
SIGUIJ331OTHRA 5410022156289AO
ATOM332NALAA 5517.6173.34735.7621.007.93AN
ANISOU332NALAA 55104910051170−2−70AN
SIGUIJ332NALAA 5510022164289AN
ATOM333CAALAA 5518.7953.97735.1471.008.32AC
ANISOU333CAALAA 55106910111176−7120AC
SIGUIJ333CAALAA 55210220185290AC
ATOM334CBALAA 5518.4115.40934.6901.008.36AC
ANISOU334CBALAA 551358103611906351AC
SIGUIJ334CBALAA 55210220184290AC
ATOM335CALAA 5519.9574.00036.1031.008.62AC
ANISOU335CALAA 55109110081198−13−140AC
SIGUIJ335CALAA 55200220183290AC
ATOM336OALAA 5519.7794.15837.3131.009.17AO
ANISOU336OALAA 55121411031202−800AO
SIGUIJ336OALAA 5510022156289AO
ATOM337NALAA 5621.1613.88635.5531.008.88AN
ANISOU337NALAA 56109510721255200AN
SIGUIJ337NALAA 5610022164289AN
ATOM338CAALAA 5622.3914.02236.3491.009.13AC
ANISOU338CAALAA 561104110012680−80AC
SIGUIJ338CAALAA 56200220183290AC
ATOM339CBALAA 5623.6103.71335.5081.009.18AC
ANISOU339CBALAA 561170135513685468−18AC
SIGUIJ339CBALAA 56200220182290AC
ATOM340CALAA 5622.5545.40037.0291.009.29AC
ANISOU340CALAA 56103110981243−5281AC
SIGUIJ340CALAA 56200220181290AC
ATOM341OALAA 5623.1435.50438.1091.009.43AO
ANISOU341OALAA 561154120812751−410AO
SIGUIJ341OALAA 5610022156289AO
ATOM342NHISA 5721.9946.44036.4181.009.29AN
ANISOU342NHISA 5795710831231−438418AN
SIGUIJ342NHISA 5710022164289AN
ATOM343CAHISA 5722.0407.79436.9801.009.88AC
ANISOU343CAHISA 57121910961260−3000AC
SIGUIJ343CAHISA 57200220181290AC
ATOM344CBHISA 5721.4118.78135.9631.0010.96AC
ANISOU344CBHISA 571419125112711385839AC
SIGUIJ344CBHISA 57200220180290AC
ATOM345CGHISA 5721.86210.19936.1741.0012.51AC
ANISOU345CGHISA 5717371288189838−50AC
SIGUIJ345CGHISA 57200220179290AC
ATOM346CD2HISA 5722.60610.74137.1621.0013.42AC
ANISOU346CD2HISA 57186215141884−12703AC
SIGUIJ346CD2HISA 57200220179290AC
ATOM347ND1HISA 5721.56011.22935.3241.0014.09AN
ANISOU347ND1HISA 57260813221981155−147−10AN
SIGUIJ347ND1HISA 5710022164289AN
ATOM348CE1HISA 5722.11112.33935.7711.0013.23AC
ANISOU348CE1HISA 57274414801458−159453−54AC
SIGUIJ348CE1HISA 57200220178290AC
ATOM349NE2HISA 5722.75812.07636.8801.0014.35AN
ANISOU349NE2HISA 57316315181641−219192−26AN
SIGUIJ349NE2HISA 5710022164289AN
ATOM350CHISA 5721.2707.85938.2941.009.53AC
ANISOU350CHISA 57118910891252−510AC
SIGUIJ350CHISA 57200220177290AC
ATOM351OHISA 5721.4588.81439.0871.0010.26AO
ANISOU351OHISA 57133811041272−3710AO
SIGUIJ351OHISA 5710022156289AO
ATOM352NCYSA 5820.4256.85138.5541.009.49AN
ANISOU352NCYSA 581141105611353000AN
SIGUIJ352NCYSA 5810022164289AN
ATOM353CACYSA 5819.5716.82739.7461.009.52AC
ANISOU353CACYSA 58113511741134100AC
SIGUIJ353CACYSA 58200220177290AC
ATOM354CCYSA 5820.2726.26240.9601.009.45AC
ANISOU354CCYSA 58114511411148000AC
SIGUIJ354CCYSA 58200220176290AC
ATOM355OCYSA 5819.6446.12642.0341.009.93AO
ANISOU355OCYSA 58117513461160−850−2AO
SIGUIJ355OCYSA 5810022156289AO
ATOM356CBCYSA 5818.2556.01939.5041.009.74AC
ANISOU356CBCYSA 58114212231171−10−10AC
SIGUIJ356CBCYSA 58200220176290AC
ATOM357SGCYSA 5817.3436.73838.1091.0010.15AS
ANISOU357SGCYSA 5812551365116773−21−8AS
SIGUIJ357SGCYSA 5810022149289AS
ATOM358NLYSA 5921.5455.87940.8301.009.63AN
ANISOU358NLYSA 59115311581143000AN
SIGUIJ358NLYSA 5910022164289AN
ATOM359CALYSA 5922.2955.24841.9321.0010.30AC
ANISOU359CALYSA 591207121311580−50AC
SIGUIJ359CALYSA 59200220175290AC
ATOM360CBLYSA 5923.7805.18841.5661.0010.96AC
ANISOU360CBLYSA 591230135114041359−5AC
SIGUIJ360CBLYSA 59200220174290AC
ATOM361CGLYSA 5924.6604.44042.5511.0011.83AC
ANISOU361CGLYSA 5913731413155626−7522AC
SIGUIJ361CGLYSA 59200220174290AC
ATOM362CDLYSA 5924.5332.93842.4811.0012.32AC
ANISOU362CDLYSA 591496141619895−200AC
SIGUIJ362CDLYSA 59200220173290AC
ATOM363CELYSA 5925.4382.25943.4951.0013.78AC
ANISOU363CELYSA 5919431448235132−40022AC
SIGUIJ363CELYSA 59200220173290AC
ATOM364NZLYSA 5925.3950.77143.3061.0014.23AN
ANISOU364NZLYSA 591869144624952−88−1AN
SIGUIJ364NZLYSA 5910022164289AN
ATOM365CLYSA 5922.1625.99443.2351.0010.26AC
ANISOU365CLYSA 591250123911630−30AC
SIGUIJ365CLYSA 59200220172290AC
ATOM366OLYSA 5922.3887.23643.3001.0010.37AO
ANISOU366OLYSA 59127212391294−600AO
SIGUIJ366OLYSA 5910022156289AO
ATOM367NMETA 6021.8815.23244.2861.0010.70AN
ANISOU367NMETA 60133612751175−9−152AN
SIGUIJ367NMETA 6010022164289AN
ATOM368CAMETA 6021.8975.74545.6571.0011.34AC
ANISOU368CAMETA 60124814091190−705−4AC
SIGUIJ368CAMETA 60200220172290AC
ATOM369CBMETA 6020.4856.15346.1601.0011.40AC
ANISOU369CBMETA 60126015081141−545−1AC
SIGUIJ369CBMETA 60200220171290AC
ATOM370CGMETA 6019.8647.31645.3701.0011.47AC
ANISOU370CGMETA 601539155212100−881AC
SIGUIJ370CGMETA 60200220170290AC
ATOM371SDMETA 6018.4298.01746.1541.0012.13AS
ANISOU371SDMETA 60161716191416032−4AS
SIGUIJ371SDMETA 6010022149289AS
ATOM372CEMETA 6017.3356.67445.9531.0012.68AC
ANISOU372CEMETA 601631161816850−10AC
SIGUIJ372CEMETA 60200220170290AC
ATOM373CMETA 6022.4734.64246.5381.0011.97AC
ANISOU373CMETA 60134914541244−22−151AC
SIGUIJ373CMETA 60200220169290AC
ATOM374OMETA 6022.5583.46846.1351.0011.95AO
ANISOU374OMETA 601622145813616−42−1AO
SIGUIJ374OMETA 6010022156289AO
ATOM375NASNA 6122.8455.04647.7701.0012.35AN
ANISOU375NASNA 61148416811245−2589−7AN
SIGUIJ375NASNA 6110022164289AN
ATOM376CAASNA 6123.3604.02748.7341.0013.41AC
ANISOU376CAASNA 61161717711319−213−5315AC
SIGUIJ376CAASNA 61200220169290AC
ATOM377CBASNA 6123.8924.69450.0381.0014.86AC
ANISOU377CBASNA 61326617791457−502−580159AC
SIGUIJ377CBASNA 61200220168290AC
ATOM378CGASNA 6122.8135.44550.8231.0016.38AC
ANISOU378CGASNA 61333514411982−792−221101AC
SIGUIJ378CGASNA 61200220168290AC
ATOM379OD1ASNA 6122.0456.21350.2701.0018.80AO
ANISOU379OD1ASNA 61407220681933−106−27214AO
SIGUIJ379OD1ASNA 6110022156289AO
ATOM380ND2ASNA 6122.7365.21352.1501.0016.96AN
ANISOU380ND2ASNA 61356338352029−1706−396422AN
SIGUIJ380ND2ASNA 6110022164289AN
ATOM381CASNA 6122.2853.00349.0771.0013.01AC
ANISOU381CASNA 61142415711372−3−70AC
SIGUIJ381CASNA 61200220167290AC
ATOM382OASNA 6122.6081.87249.3491.0013.50AO
ANISOU382OASNA 611675160919329−25591AO
SIGUIJ382OASNA 6110022156289AO
ATOM383NGLUA 6321.0233.43149.0901.0012.53AN
ANISOU383NGLUA 63138514711537−62−3−1AN
SIGUIJ383NGLUA 6310022163289AN
ATOM384CAGLUA 6319.9132.51349.3061.0012.71AC
ANISOU384CAGLUA 63132614711544−29−20−3AC
SIGUIJ384CAGLUA 63200220167290AC
ATOM385CBGLUA 6319.7362.16550.7951.0014.43AC
ANISOU385CBGLUA 63220017091562−8164−8AC
SIGUIJ385CBGLUA 63200220166290AC
ATOM386CGGLUA 6319.2983.35851.6171.0016.54AC
ANISOU386CGGLUA 6323431765155627−22−1AC
SIGUIJ386CGGLUA 63200220166290AC
ATOM387CDGLUA 6319.2013.10953.1321.0018.20AC
ANISOU387CDGLUA 63275031941587−794−150148AC
SIGUIJ387CDGLUA 63200220165290AC
ATOM388OE1GLUA 6319.5231.97753.5671.0019.99AO
ANISOU388OE1GLUA 63449832861741−416−449110AO
SIGUIJ388OE1GLUA 6310022156289AO
ATOM389OE2GLUA 6318.8184.06053.8651.0019.97AO
ANISOU389OE2GLUA 63405835631631−98−36837AO
SIGUIJ389OE2GLUA 6310022156289AO
ATOM390CGLUA 6318.6643.19148.7631.0012.29AC
ANISOU390CGLUA 63130914871482−25−4−1AC
SIGUIJ390CGLUA 63200220165290AC
ATOM391OGLUA 6318.6914.40848.4311.0011.91AO
ANISOU391OGLUA 63159414841449−48−83AO
SIGUIJ391OGLUA 6310022156289AO
ATOM392NTYRA 6417.5662.42348.7071.0011.40AN
ANISOU392NTYRA 64130215041269−3300AN
SIGUIJ392NTYRA 6410022163289AN
ATOM393CATYRA 6416.3422.92048.0901.0011.01AC
ANISOU393CATYRA 64130415291246−1720AC
SIGUIJ393CATYRA 64200220164290AC
ATOM394CBTYRA 6416.1712.36946.6491.0011.12AC
ANISOU394CBTYRA 64139915771236−31120AC
SIGUIJ394CBTYRA 64200220164290AC
ATOM395CGTYRA 6417.4292.39545.7951.0010.88AC
ANISOU395CGTYRA 64140612991206−279−2AC
SIGUIJ395CGTYRA 64200220163290AC
ATOM396CD1TYRA 6417.6233.38844.8171.0010.36AC
ANISOU396CD1TYRA 64123613071181−10−20AC
SIGUIJ396CD1TYRA 64200220163290AC
ATOM397CE1TYRA 6418.7853.42544.0421.0011.12AC
ANISOU397CE1TYRA 64125114001198−523−1AC
SIGUIJ397CE1TYRA 64200220162290AC
ATOM398CD2TYRA 6418.4181.45645.9831.0010.39AC
ANISOU398CD2TYRA 64140112791269−3718−5AC
SIGUIJ398CD2TYRA 64200220162290AC
ATOM399CE2TYRA 6419.5721.46145.2261.0011.07AC
ANISOU399CE2TYRA 64138214421213−5−60AC
SIGUIJ399CE2TYRA 64200220161290AC
ATOM400CZTYRA 6419.7442.46544.2511.0010.47AC
ANISOU400CZTYRA 64131414341196−10−100AC
SIGUIJ400CZTYRA 64200220161290AC
ATOM401OHTYRA 6420.9202.53143.5181.0010.97AO
ANISOU401OHTYRA 64133812501217−1311−1AO
SIGUIJ401OHTYRA 6410022156289AO
ATOM402CTYRA 6415.1402.45248.8821.0010.76AC
ANISOU402CTYRA 64129514501252−510AC
SIGUIJ402CTYRA 64200220161290AC
ATOM403OTYRA 6415.2151.38849.5001.0011.00AO
ANISOU403OTYRA 64144714471285050AO
SIGUIJ403OTYRA 6410022156289AO
ATOM404NTHRA 6514.0503.18448.8081.0010.90AN
ANISOU404NTHRA 65126314141312−4221AN
SIGUIJ404NTHRA 6510022163289AN
ATOM405CATHRA 6512.7292.61349.1601.0010.94AC
ANISOU405CATHRA 65127516021189−104−1510AC
SIGUIJ405CATHRA 65200220160290AC
ATOM406CBTHRA 6512.0103.50750.1691.0011.44AC
ANISOU406CBTHRA 651538175812225428−1AC
SIGUIJ406CBTHRA 65200220160290AC
ATOM407OG1THRA 6512.8043.54251.3781.0012.76AO
ANISOU407OG1THRA 6516862183127426−63−3AO
SIGUIJ407OG1THRA 6510022156289AO
ATOM408CG2THRA 6510.6012.97750.4841.0012.54AC
ANISOU408CG2THRA 65162022471409−12971−9AC
SIGUIJ408CG2THRA 65200220159290AC
ATOM409CTHRA 6511.9682.48947.8601.0010.48AC
ANISOU409CTHRA 65123412471178140AC
SIGUIJ409CTHRA 65200220159290AC
ATOM410OTHRA 6511.7543.48547.1431.0010.45AO
ANISOU410OTHRA 65162612611260−28−15111AO
SIGUIJ410OTHRA 6510022156289AO
ATOM411NVALA 6611.5311.28547.5561.0010.31AN
ANISOU411NVALA 66126912451202−150AN
SIGUIJ411NVALA 6610022163289AN
ATOM412CAVALA 6610.8261.05046.3181.0010.41AC
ANISOU412CAVALA 66128312551218000AC
SIGUIJ412CAVALA 66200220158290AC
ATOM413CBVALA 6611.278−0.30545.7071.0010.27AC
ANISOU413CBVALA 66130812521283420AC
SIGUIJ413CBVALA 66200220158290AC
ATOM414CG1VALA 6610.536−0.51244.3651.0011.03AC
ANISOU414CG1VALA 66133612941294−1−20AC
SIGUIJ414CG1VALA 66200220157290AC
ATOM415CG2VALA 6612.791−0.32845.5241.0011.29AC
ANISOU415CG2VALA 661317150121411495−6AC
SIGUIJ415CG2VALA 66200220157290AC
ATOM416CVALA 669.3231.05646.5491.0010.46AC
ANISOU416CVALA 6612811388120729−30AC
SIGUIJ416CVALA 66200220157290AC
ATOM417OVALA 668.8090.33847.4371.0010.81AO
ANISOU417OVALA 661451142512334546AO
SIGUIJ417OVALA 6610022156289AO
ATOM418NHISA 678.6071.88445.7931.0010.18AN
ANISOU418NHISA 67119413411212−900AN
SIGUIJ418NHISA 6710022163289AN
ATOM419CAHISA 677.1431.91945.7671.0010.17AC
ANISOU419CAHISA 67119612441298−1−50AC
SIGUIJ419CAHISA 67200220156290AC
ATOM420CBHISA 676.7083.37145.4961.0010.26AC
ANISOU420CBHISA 67123212461435020AC
SIGUIJ420CBHISA 67200220156290AC
ATOM421CGHISA 675.3083.50344.9841.0010.76AC
ANISOU421CGHISA 67124511941533−2−281AC
SIGUIJ421CGHISA 67200220155290AC
ATOM422CD2HISA 674.7683.23443.7831.0010.31AC
ANISOU422CD2HISA 67121612501538−1−170AC
SIGUIJ422CD2HISA 67200220155290AC
ATOM423ND1HISA 674.2944.01245.7691.0011.12AN
ANISOU423ND1HISA 6713601233168631073AN
SIGUIJ423ND1HISA 6710022163289AN
ATOM424CE1HISA 673.1824.03445.0611.0010.85AC
ANISOU424CE1HISA 671383146517351771−9AC
SIGUIJ424CE1HISA 67200220155290AC
ATOM425NE2HISA 673.4363.56143.8581.0010.92AN
ANISOU425NE2HISA 671229141717186120AN
SIGUIJ425NE2HISA 6710022163289AN
ATOM426CHISA 676.6271.01544.6641.0010.07AC
ANISOU426CHISA 67115812241269130AC
SIGUIJ426CHISA 67200220154290AC
ATOM427OHISA 677.0461.16743.5041.0010.01AO
ANISOU427OHISA 67120512451268070AO
SIGUIJ427OHISA 6710022156289AO
ATOM428NLEUA 685.6890.11545.0041.009.85AN
ANISOU428NLEUA 681174122014000480AN
SIGUIJ428NLEUA 6810022163289AN
ATOM429CALEUA 685.041−0.76144.0091.0010.06AC
ANISOU429CALEUA 68125412181423−580AC
SIGUIJ429CALEUA 68200220154290AC
ATOM430CBLEUA 685.539−2.22944.1291.0011.11AC
ANISOU430CBLEUA 6814141239163255−120AC
SIGUIJ430CBLEUA 68200220153290AC
ATOM431CGLEUA 687.056−2.39944.2411.0010.33AC
ANISOU431CGLEUA 68140812501460601−1AC
SIGUIJ431CGLEUA 68200220153290AC
ATOM432CD1LEUA 687.481−2.43145.6951.0011.37AC
ANISOU432CD1LEUA 68145716131458−500AC
SIGUIJ432CD1LEUA 68200220153290AC
ATOM433CD2LEUA 687.459−3.72343.5261.0011.32AC
ANISOU433CD2LEUA 6816071255148511242AC
SIGUIJ433CD2LEUA 68200220152290AC
ATOM434CLEUA 683.539−0.77244.2641.0010.57AC
ANISOU434CLEUA 681264128413040−20AC
SIGUIJ434CLEUA 68200220152290AC
ATOM435OLEUA 683.091−0.49445.3941.0010.51AO
ANISOU435OLEUA 68130912761306300AO
SIGUIJ435OLEUA 6810022156289AO
ATOM436NGLYA 692.783−1.09243.2291.0010.50AN
ANISOU436NGLYA 69127012441298000AN
SIGUIJ436NGLYA 6910022163289AN
ATOM437CAGLYA 691.403−1.48343.4611.0010.99AC
ANISOU437CAGLYA 691293123117090861AC
SIGUIJ437CAGLYA 69100220151290AC
ATOM438CGLYA 690.398−0.36843.5761.0011.51AC
ANISOU438CGLYA 6913281234164921104AC
SIGUIJ438CGLYA 69100220151290AC
ATOM439OGLYA 69−0.713−0.61144.0761.0012.48AO
ANISOU439OGLYA 6914281370214227322166AO
SIGUIJ439OGLYA 6910022156289AO
ATOM440NSERA 700.7470.84843.1341.0011.57AN
ANISOU440NSERA 701235123615740240AN
SIGUIJ440NSERA 7010022163289AN
ATOM441CASERA 70−0.2371.92543.0561.0011.55AC
ANISOU441CASERA 701239125114290210AC
SIGUIJ441CASERA 70100220151290AC
ATOM442CBSERA 70−0.4412.61944.4231.0011.96AC
ANISOU442CBSERA 70173812851450−4694−11AC
SIGUIJ442CBSERA 70100220150290AC
ATOM443OGSERA 70−1.4433.61844.2701.0012.98AO
ANISOU443OGSERA 70176412881593−4822−4AO
SIGUIJ443OGSERA 7010022156289AO
ATOM444CSERA 700.2042.96542.0581.0011.53AC
ANISOU444CSERA 70122812591420343−2AC
SIGUIJ444CSERA 70100220150290AC
ATOM445OSERA 701.3503.34341.9901.0011.37AO
ANISOU445OSERA 70123913661663−21495AO
SIGUIJ445OSERA 7010022156289AO
ATOM446NASPA 71−0.7703.52141.3541.0011.71AN
ANISOU446NASPA 711281126515340−310AN
SIGUIJ446NASPA 7110022163289AN
ATOM447CAASPA 71−0.4894.71140.5341.0012.03AC
ANISOU447CAASPA 711427127515969486AC
SIGUIJ447CAASPA 71100220150290AC
ATOM448CBASPA 71−1.6044.89439.5091.0013.40AC
ANISOU448CBASPA 71154619201725110−5322AC
SIGUIJ448CBASPA 71100220149290AC
ATOM449CGASPA 71−1.7913.67938.6651.0014.52AC
ANISOU449CGASPA 711903195217671812−1AC
SIGUIJ449CGASPA 71100220149290AC
ATOM450OD1ASPA 71−0.7693.14738.1641.0014.88AO
ANISOU450OD1ASPA 71189119281789−5181AO
SIGUIJ450OD1ASPA 7110022156289AO
ATOM451OD2ASPA 71−2.9333.14738.5411.0016.44AO
ANISOU451OD2ASPA 71205526382741−297−69−29AO
SIGUIJ451OD2ASPA 7110022156289AO
ATOM452CASPA 71−0.3345.98341.3661.0012.00AC
ANISOU452CASPA 711593128615891800AC
SIGUIJ452CASPA 71100220148290AC
ATOM453OASPA 710.0927.01440.8221.0011.57AO
ANISOU453OASPA 7114161223174820522223AO
SIGUIJ453OASPA 7110022156289AO
ATOM454NTHRA 72−0.5895.93242.6781.0011.84AN
ANISOU454NTHRA 7216271334159116712AN
SIGUIJ454NTHRA 7210022163289AN
ATOM455CATHRA 72−0.4667.13643.5271.0011.99AC
ANISOU455CATHRA 72126813561575−73220AC
SIGUIJ455CATHRA 72100220148290AC
ATOM456CBTHRA 72−1.8027.37944.2801.0012.04AC
ANISOU456CBTHRA 7212891617162129345−17AC
SIGUIJ456CBTHRA 72100220148290AC
ATOM457OG1THRA 72−2.8517.50943.3061.0012.69AO
ANISOU457OG1THRA 72147218321826116159−45AO
SIGUIJ457OG1THRA 7210022156289AO
ATOM458CG2THRA 72−1.6908.60745.1391.0012.47AC
ANISOU458CG2THRA 721869157515771637838AC
SIGUIJ458CG2THRA 72100220147290AC
ATOM459CTHRA 720.6806.99944.5231.0012.26AC
ANISOU459CTHRA 721391132617780167−1AC
SIGUIJ459CTHRA 72100220147290AC
ATOM460OTHRA 720.6706.11345.3751.0012.26AO
ANISOU460OTHRA 721528134018121419014AO
SIGUIJ460OTHRA 7210022156289AO
ATOM461NLEUA 731.6807.88344.4621.0012.60AN
ANISOU461NLEUA 73140213391916−10225−38AN
SIGUIJ461NLEUA 7310022163289AN
ATOM462CALEUA 732.7357.88445.5041.0013.57AC
ANISOU462CALEUA 73141816281928−5921436AC
SIGUIJ462CALEUA 73100220147290AC
ATOM463CBLEUA 733.8468.88045.1301.0014.14AC
ANISOU463CBLEUA 73146515972415−2840722AC
SIGUIJ463CBLEUA 73100220146290AC
ATOM464CGLEUA 734.6648.54043.8671.0013.84AC
ANISOU464CGLEUA 7313011722234302893AC
SIGUIJ464CGLEUA 73100220146290AC
ATOM465CD1LEUA 735.7309.65043.6161.0014.45AC
ANISOU465CD1LEUA 73179222242208−505131111AC
SIGUIJ465CD1LEUA 73100220146290AC
ATOM466CD2LEUA 735.2757.16543.9261.0013.66AC
ANISOU466CD2LEUA 73157217741998116193−65AC
SIGUIJ466CD2LEUA 73100220145290AC
ATOM467CLEUA 732.1468.24846.8641.0014.07AC
ANISOU467CLEUA 73141517641928−2819610AC
SIGUIJ467CLEUA 73100220145290AC
ATOM468OLEUA 731.2919.14546.9491.0014.84AO
ANISOU468OLEUA 73160419162178129180−51AO
SIGUIJ468OLEUA 7310022156289AO
ATOM469NGLYA 762.5737.55847.8941.0014.43AN
ANISOU469NGLYA 761813179319880310AN
SIGUIJ469NGLYA 7610022163289AN
ATOM470CAGLYA 762.0297.75749.2271.0014.66AC
ANISOU470CAGLYA 76174418341985−3082AC
SIGUIJ470CAGLYA 76100220145290AC
ATOM471CGLYA 760.7476.99049.5091.0014.25AC
ANISOU471CGLYA 76172117561856−5−26−3AC
SIGUIJ471CGLYA 76100220144290AC
ATOM472OGLYA 760.2697.02850.6331.0014.94AO
ANISOU472OGLYA 761824224518753613−5AO
SIGUIJ472OGLYA 7610022156289AO
ATOM473NASPA 770.1596.34048.5231.0013.69AN
ANISOU473NASPA 77131716371787112135−36AN
SIGUIJ473NASPA 7710022163289AN
ATOM474CAASPA 77−1.0655.55848.7481.0013.68AC
ANISOU474CAASPA 7712531499149718860−38AC
SIGUIJ474CAASPA 77100220144290AC
ATOM475CBASPA 77−1.3284.78847.4491.0013.39AC
ANISOU475CBASPA 7712751491149914477−42AC
SIGUIJ475CBASPA 77100220144290AC
ATOM476CGASPA 77−2.6243.98347.4291.0013.49AC
ANISOU476CGASPA 771298159416528169−17AC
SIGUIJ476CGASPA 77100220143290AC
ATOM477OD1ASPA 77−3.2493.76348.4971.0013.62AO
ANISOU477OD1ASPA 7716081673175627252−26AO
SIGUIJ477OD1ASPA 7710022156289AO
ATOM478OD2ASPA 77−3.0163.55746.3181.0014.34AO
ANISOU478OD2ASPA 77185819271673−312−414AO
SIGUIJ478OD2ASPA 7710022156289AO
ATOM479CASPA 77−0.7984.56549.9021.0014.30AC
ANISOU479CASPA 7713731544150916423−19AC
SIGUIJ479CASPA 77100220143290AC
ATOM480OASPA 770.2223.79249.8561.0014.35AO
ANISOU480OASPA 7715621823191839735−31AO
SIGUIJ480OASPA 7710022156289AO
ATOM481NARGA 78−1.6554.55750.9201.0014.71AN
ANISOU481NARGA 7814521639152712877−58AN
SIGUIJ481NARGA 7810022163289AN
ATOM482CAARGA 78−1.4643.61852.0221.0016.17AC
ANISOU482CAARGA 782269175016012876528AC
SIGUIJ482CAARGA 78100220143290AC
ATOM483CBARGA 78−2.5293.87153.0991.0017.47AC
ANISOU483CBARGA 782312248716064646116AC
SIGUIJ483CBARGA 78100220142290AC
ATOM484CGARGA 78−2.3955.23753.7371.0019.88AC
ANISOU484CGARGA 784181250816462827110AC
SIGUIJ484CGARGA 78100220142290AC
ATOM485CDARGA 78−2.6225.23555.2221.0022.19AC
ANISOU485CDARGA 7892981249517701438545AC
SIGUIJ485CDARGA 78100220142290AC
ATOM486NEARGA 78−2.0026.44455.7771.0024.36AN
ANISOU486NEARGA 7812217126165189−25−2043−76AN
SIGUIJ486NEARGA 7810022163289AN
ATOM487CZARGA 78−2.4657.10856.8411.0024.83AC
ANISOU487CZARGA 78123961244951501−198033AC
SIGUIJ487CZARGA 78100220141290AC
ATOM488NH1ARGA 78−3.5526.67057.4511.0025.75AN
ANISOU488NH1ARGA 7813703124699248−20334−1AN
SIGUIJ488NH1ARGA 7810022163289AN
ATOM489NH2ARGA 78−1.8388.19257.3001.0025.77AN
ANISOU489NH2ARGA 7810587123832300134175−3AN
SIGUIJ489NH2ARGA 7810022163289AN
ATOM490CARGA 78−1.5442.17851.5521.0016.15AC
ANISOU490CARGA 78142317952007264272−124AC
SIGUIJ490CARGA 78100220141290AC
ATOM491OARGA 78−1.0311.26752.2691.0016.98AO
ANISOU491OARGA 7824462180245165947112AO
SIGUIJ491OARGA 7810022156289AO
ATOM492NARGA 79−2.1721.90150.4141.0016.20AN
ANISOU492NARGA 79140218101951−732719AN
SIGUIJ492NARGA 7910022163289AN
ATOM493CAARGA 79−2.2890.52849.9131.0016.42AC
ANISOU493CAARGA 7915691827208826234−31AC
SIGUIJ493CAARGA 79100220141290AC
ATOM494CBARGA 79−3.4460.37948.9381.0017.75AC
ANISOU494CBARGA 79201520162694−8−291−5AC
SIGUIJ494CBARGA 79100220141290AC
ATOM495CGARGA 79−4.7720.90049.4541.0019.73AC
ANISOU495CGARGA 79235225024693128447−122AC
SIGUIJ495CGARGA 79100220140290AC
ATOM496CDARGA 79−5.8520.87848.3821.0021.61AC
ANISOU496CDARGA 79299530345338−6−194−6AC
SIGUIJ496CDARGA 79100220140290AC
ATOM497NEARGA 79−5.7281.91847.3481.0023.13AN
ANISOU497NEARGA 79253530365331−8−269−3AN
SIGUIJ497NEARGA 7910022163289AN
ATOM498CZARGA 79−5.2631.69046.1321.0022.93AC
ANISOU498CZARGA 79353529725475−31109−1AC
SIGUIJ498CZARGA 79100220140290AC
ATOM499NH1ARGA 79−4.8400.45645.8331.0024.17AN
ANISOU499NH1ARGA 7913175414653693344−187−71AN
SIGUIJ499NH1ARGA 7910022163289AN
ATOM500NH2ARGA 79−5.2752.63645.1961.0023.78AN
ANISOU500NH2ARGA 79234729535443101254−27AN
SIGUIJ500NH2ARGA 7910022163289AN
ATOM501CARGA 79−1.0340.09849.1301.0015.58AC
ANISOU501CARGA 79160616182236032712AC
SIGUIJ501CARGA 79100220139290AC
ATOM502OARGA 79−0.912−1.08748.7421.0015.65AO
ANISOU502OARGA 7918701615233224645AO
SIGUIJ502OARGA 7910022155289AO
ATOM503NALAA 80−0.1421.02748.8131.0014.69AN
ANISOU503NALAA 8015281554194942261−52AN
SIGUIJ503NALAA 8010022163289AN
ATOM504CAALAA 801.0550.67148.0281.0013.83AC
ANISOU504CAALAA 80136215391466101−4126AC
SIGUIJ504CAALAA 80100220139290AC
ATOM505CBALAA 801.8201.91447.6221.0014.11AC
ANISOU505CBALAA 80164815941901321016AC
SIGUIJ505CBALAA 80100220139290AC
ATOM506CALAA 801.967−0.20748.8801.0013.53AC
ANISOU506CALAA 801254144713665732−12AC
SIGUIJ506CALAA 80100220138290AC
ATOM507OALAA 801.945−0.15250.1331.0014.15AO
ANISOU507OALAA 801894215613645332417AO
SIGUIJ507OALAA 8010022155289AO
ATOM508NGLNA 812.777−1.00748.2111.0012.88AN
ANISOU508NGLNA 81116413531355−3170AN
SIGUIJ508NGLNA 8110022163289AN
ATOM509CAGLNA 813.903−1.70248.8581.0012.88AC
ANISOU509CAGLNA 81125815381457117−3115AC
SIGUIJ509CAGLNA 81100220138290AC
ATOM510CBGLNA 814.243−2.97448.1131.0013.68AC
ANISOU510CBGLNA 81162815571580178−15−23AC
SIGUIJ510CBGLNA 81100220138290AC
ATOM511CGGLNA 813.280−4.09448.3651.0014.30AC
ANISOU511CGGLNA 81211819381820−25912−9AC
SIGUIJ511CGGLNA 81100220138290AC
ATOM512CDGLNA 813.665−5.30447.5531.0014.78AC
ANISOU512CDGLNA 81241019631852−20354−20AC
SIGUIJ512CDGLNA 81100220137290AC
ATOM513OE1GLNA 814.755−5.84047.6851.0014.65AO
ANISOU513OE1GLNA 81228515321692−43553−31AO
SIGUIJ513OE1GLNA 8110022155289AO
ATOM514NE2GLNA 812.772−5.73146.6941.0015.20AN
ANISOU514NE2GLNA 81259416102068−72−18619AN
SIGUIJ514NE2GLNA 8110022163289AN
ATOM515CGLNA 815.107−0.79848.8601.0012.83AC
ANISOU515CGLNA 81127216211317871−1AC
SIGUIJ515CGLNA 81100220137290AC
ATOM516OGLNA 815.399−0.13047.8541.0013.03AO
ANISOU516OGLNA 81165817441347−33498AO
SIGUIJ516OGLNA 8110022155289AO
ATOM517NARGA 825.822−0.75149.9821.0012.82AN
ANISOU517NARGA 821266196213106900AN
SIGUIJ517NARGA 8210022163289AN
ATOM518CAARGA 827.114−0.10250.0761.0013.15AC
ANISOU518CAARGA 82129821221292−4119AC
SIGUIJ518CAARGA 82100220137290AC
ATOM519CBARGA 827.1021.05551.0761.0013.97AC
ANISOU519CBARGA 82154221951404−7489−71AC
SIGUIJ519CBARGA 82100220136290AC
ATOM520CGARGA 826.2582.21750.6051.0015.61AC
ANISOU520CGARGA 82186023641795128−3−4AC
SIGUIJ520CGARGA 82100220136290AC
ATOM521CDARGA 825.9723.22051.7591.0017.78AC
ANISOU521CDARGA 8239122325188714748837AC
SIGUIJ521CDARGA 82100220136290AC
ATOM522NEARGA 827.1523.80152.4391.0020.13AN
ANISOU522NEARGA 82447732002961−273−13025AN
SIGUIJ522NEARGA 8210022163289AN
ATOM523CZARGA 827.6123.63553.7041.0020.42AC
ANISOU523CZARGA 8232833539277821351−15AC
SIGUIJ523CZARGA 82100220136290AC
ATOM524NH1ARGA 827.0712.83654.6591.0021.72AN
ANISOU524NH1ARGA 8226663558258715−60AN
SIGUIJ524NH1ARGA 8210022163289AN
ATOM525NH2ARGA 828.6674.34554.0401.0021.55AN
ANISOU525NH2ARGA 82339635673679−3601AN
SIGUIJ525NH2ARGA 8210022163289AN
ATOM526CARGA 828.125−1.14250.5201.0012.58AC
ANISOU526CARGA 82140622561072133744AC
SIGUIJ526CARGA 82100220135290AC
ATOM527OARGA 827.855−1.91451.5071.0013.16AO
ANISOU527OARGA 82145024001172188134113AO
SIGUIJ527OARGA 8210022155289AO
ATOM528NILEA 839.274−1.26749.8271.0011.91AN
ANISOU528NILEA 8314091711110468861AN
SIGUIJ528NILEA 8310022163289AN
ATOM529CAILEA 8310.267−2.29450.1471.0011.49AC
ANISOU529CAILEA 83134916091387−2600AC
SIGUIJ529CAILEA 83100220135290AC
ATOM530CBILEA 8310.238−3.45849.1161.0011.87AC
ANISOU530CBILEA 83145916151407−377−2AC
SIGUIJ530CBILEA 83100220135290AC
ATOM531CG2ILEA 8311.302−4.50749.4561.0012.03AC
ANISOU531CG2ILEA 83149316361501−1100AC
SIGUIJ531CG2ILEA 83100220135290AC
ATOM532CG1ILEA 838.827−4.06849.0361.0011.90AC
ANISOU532CG1ILEA 83147717641850−95216AC
SIGUIJ532CG1ILEA 83100220134290AC
ATOM533CD1ILEA 838.669−5.10947.9831.0012.03AC
ANISOU533CD1ILEA 83159317631886−7−62−2AC
SIGUIJ533CD1ILEA 83100220134290AC
ATOM534CILEA 8311.635−1.62550.0991.0011.35AC
ANISOU534CILEA 831318144813104900AC
SIGUIJ534CILEA 83100220134290AC
ATOM535OILEA 8312.039−0.95349.1091.0011.54AO
ANISOU535OILEA 83138714861327760AO
SIGUIJ535OILEA 8310022155289AO
ATOM536NALYSA 8412.412−1.87551.1550.5011.01AN
ANISOU536NALYSA 84131113051306000AN
SIGUIJ536NALYSA 8410022163289AN
ATOM537NBLYSA 8412.408−1.86051.1620.5013.20AN
ANISOU537NBLYSA 84131312841307000AN
SIGUIJ537NBLYSA 8410022163289AN
ATOM538CAALYSA 8413.788−1.37551.2160.5011.28AC
ANISOU538CAALYSA 84131813191231020AC
SIGUIJ538CAALYSA 84100220134290AC
ATOM539CABLYSA 8413.787−1.36551.2220.5013.47AC
ANISOU539CABLYSA 84132213001256−130AC
SIGUIJ539CABLYSA 84100220133290AC
ATOM540CBALYSA 8414.322−1.57652.6310.5012.09AC
ANISOU540CBALYSA 84146017371232119−21−2AC
SIGUIJ540CBALYSA 84100220133290AC
ATOM541CBBLYSA 8414.312−1.52652.6540.5014.28AC
ANISOU541CBBLYSA 841368146412542540AC
SIGUIJ541CBBLYSA 84100220133290AC
ATOM542CGALYSA 8415.582−0.80852.9310.5013.81AC
ANISOU542CGALYSA 84159620521371−78−7118AC
SIGUIJ542CGALYSA 84100220132290AC
ATOM543CGBLYSA 8415.719−0.99352.9070.5016.00AC
ANISOU543CGBLYSA 84142218061303−1043−1AC
SIGUIJ543CGBLYSA 84100220132290AC
ATOM544CDALYSA 8415.2720.69253.0480.5015.76AC
ANISOU544CDALYSA 84177020631729−42−52AC
SIGUIJ544CDALYSA 84100220132290AC
ATOM545CDBLYSA 8415.8240.51952.7070.5017.95AC
ANISOU545CDBLYSA 84213818201735−173−16768AC
SIGUIJ545CDBLYSA 84100220132290AC
ATOM546CEALYSA 8416.4901.52053.3800.5017.29AC
ANISOU546CEALYSA 8417951956258926−25721AC
SIGUIJ546CEALYSA 84100220131290AC
ATOM547CEBLYSA 8414.8201.32553.5150.5019.48AC
ANISOU547CEBLYSA 842552220920961057519AC
SIGUIJ547CEBLYSA 84100220131290AC
ATOM548NZALYSA 8416.0292.81753.9360.5018.71AN
ANISOU548NZALYSA 84233519932853103110AN
SIGUIJ548NZALYSA 8410022163289AN
ATOM549NZBLYSA 8415.0681.39654.9970.5020.90AN
ANISOU549NZBLYSA 843179314121191−31−1AN
SIGUIJ549NZBLYSA 8410022163289AN
ATOM550CALYSA 8414.654−2.17750.2320.5010.91AC
ANISOU550CALYSA 841313131412400−10AC
SIGUIJ550CALYSA 84100220131290AC
ATOM551CBLYSA 8414.659−2.17550.2450.5013.10AC
ANISOU551CBLYSA 84131613041255000AC
SIGUIJ551CBLYSA 84100220131290AC
ATOM552OALYSA 8414.506−3.40350.0980.5011.25AO
ANISOU552OALYSA 84136513141304−120AO
SIGUIJ552OALYSA 8410022155289AO
ATOM553OBLYSA 8414.502−3.39550.1080.5013.44AO
ANISOU553OBLYSA 84140913051320−420AO
SIGUIJ553OBLYSA 8410022155289AO
ATOM554NALAA 8515.588−1.49649.5751.0010.86AN
ANISOU554NALAA 851309130712360−60AN
SIGUIJ554NALAA 8510022163289AN
ATOM555CAALAA 8516.554−2.12748.6971.0010.85AC
ANISOU555CAALAA 85133212851263−520−2AC
SIGUIJ555CAALAA 85100220130290AC
ATOM556CBALAA 8516.188−1.86847.2121.0010.61AC
ANISOU556CBALAA 85154513761277−32−406AC
SIGUIJ556CBALAA 85100220130290AC
ATOM557CALAA 8517.920−1.57449.0101.0011.52AC
ANISOU557CALAA 85134012781472−15−60AC
SIGUIJ557CALAA 85100220130290AC
ATOM558OALAA 8518.180−0.36748.8111.0011.81AO
ANISOU558OALAA 85142312891607−3680AO
SIGUIJ558OALAA 8510022155289AO
ATOM559NSERA 8618.835−2.43249.4611.0011.89AN
ANISOU559NSERA 8614301388148881−11AN
SIGUIJ559NSERA 8610022163289AN
ATOM560CASERA 8620.157−1.97949.8721.0012.90AC
ANISOU560CASERA 86147617771455−501−1AC
SIGUIJ560CASERA 86100220130290AC
ATOM561CBSERA 8620.636−2.82051.0511.0013.15AC
ANISOU561CBSERA 86198118801582−59−22863AC
SIGUIJ561CBSERA 86100220130290AC
ATOM562OGSERA 8619.800−2.65152.1571.0014.64AO
ANISOU562OGSERA 86218621071678−37−9722AO
SIGUIJ562OGSERA 8610022155289AO
ATOM563CSERA 8621.190−2.06248.7451.0013.37AC
ANISOU563CSERA 86147317071453−4300AC
SIGUIJ563CSERA 86100220129290AC
ATOM564OSERA 8622.076−1.20748.6641.0014.89AO
ANISOU564OSERA 86182321102787−4088646AO
SIGUIJ564OSERA 8610022155289AO
ATOM565NLYSA 8721.103−3.04847.8761.0013.17AN
ANISOU565NLYSA 87150716781442−3000AN
SIGUIJ565NLYSA 8710022162289AN
ATOM566CALYSA 8722.134−3.29246.8481.0013.39AC
ANISOU566CALYSA 8715131739143322−30AC
SIGUIJ566CALYSA 87100220129290AC
ATOM567CBLYSA 8722.532−4.78346.7931.0015.31AC
ANISOU567CBLYSA 871588175619883446−8AC
SIGUIJ567CBLYSA 87100220129290AC
ATOM568CGLYSA 8723.052−5.30148.1191.0016.98AC
ANISOU568CGLYSA 87198021742064209−6666AC
SIGUIJ568CGLYSA 87100220129290AC
ATOM569CDLYSA 8723.352−6.79447.9481.0019.00AC
ANISOU569CDLYSA 87326122292866465−27−20AC
SIGUIJ569CDLYSA 87100220128290AC
ATOM570CELYSA 8723.903−7.40549.1951.0020.42AC
ANISOU570CELYSA 873382321529041007191243AC
SIGUIJ570CELYSA 87100220128290AC
ATOM571NZLYSA 8723.646−8.86549.1451.0022.25AN
ANISOU571NZLYSA 87848533895651921139−70AN
SIGUIJ571NZLYSA 8710022162289AN
ATOM572CLYSA 8721.668−2.89745.4461.0012.69AC
ANISOU572CLYSA 87130915331428−82199AC
SIGUIJ572CLYSA 87100220128290AC
ATOM573OLYSA 8720.487−3.07645.0721.0012.42AO
ANISOU573OLYSA 87133515101674−77−56−16AO
SIGUIJ573OLYSA 8710022155289AO
ATOM574NSERA 8822.603−2.42744.6411.0011.85AN
ANISOU574NSERA 88123112931400335−2AN
SIGUIJ574NSERA 8810022162289AN
ATOM575CASERA 8822.302−2.15743.2421.0011.82AC
ANISOU575CASERA 881310126614050−40AC
SIGUIJ575CASERA 88100220128290AC
ATOM576CBSERA 8821.699−0.75143.1091.0011.87AC
ANISOU576CBSERA 8814111273161129−170AC
SIGUIJ576CBSERA 88100220127290AC
ATOM577OGSERA 8822.4900.27043.7061.0011.43AO
ANISOU577OGSERA 88145612881576−5−60AO
SIGUIJ577OGSERA 8810022155289AO
ATOM578CSERA 8823.561−2.29542.3971.0011.83AC
ANISOU578CSERA 88131014051435145−1AC
SIGUIJ578CSERA 88100220127290AC
ATOM579OSERA 8824.684−2.16542.9281.0011.99AO
ANISOU579OSERA 88135416871594−27−86−8AO
SIGUIJ579OSERA 8810022155289AO
ATOM580NPHEA 8923.369−2.55841.1081.0011.41AN
ANISOU580NPHEA 89122413441444318−2AN
SIGUIJ580NPHEA 8910022162289AN
ATOM581CAPHEA 8924.457−2.97240.2081.0011.41AC
ANISOU581CAPHEA 891236135915165126−7AC
SIGUIJ581CAPHEA 89100220127290AC
ATOM582CBPHEA 8924.433−4.48940.0021.0012.08AC
ANISOU582CBPHEA 89185413481848580−2AC
SIGUIJ582CBPHEA 89100220127290AC
ATOM583CGPHEA 8924.452−5.26441.2981.0012.41AC
ANISOU583CGPHEA 8919771324185687−10−4AC
SIGUIJ583CGPHEA 89100220127290AC
ATOM584CD1PHEA 8923.290−5.58741.9631.0013.24AC
ANISOU584CD1PHEA 892000145719194941AC
SIGUIJ584CD1PHEA 89100220126290AC
ATOM585CD2PHEA 8925.664−5.58541.9111.0013.13AC
ANISOU585CD2PHEA 89203619101891269−31−35AC
SIGUIJ585CD2PHEA 89100220126290AC
ATOM586CE1PHEA 8923.316−6.18143.1911.0013.82AC
ANISOU586CE1PHEA 892540147719321704510AC
SIGUIJ586CE1PHEA 89100220126290AC
ATOM587CE2PHEA 8925.653−6.19143.1781.0013.75AC
ANISOU587CE2PHEA 89256319501900194−63−18AC
SIGUIJ587CE2PHEA 89100220126290AC
ATOM588CZPHEA 8924.517−6.46443.7791.0013.84AC
ANISOU588CZPHEA 8925821757203025110AC
SIGUIJ588CZPHEA 89100220125290AC
ATOM589CPHEA 8924.226−2.25238.9031.0011.62AC
ANISOU589CPHEA 89122212451445252138−127AC
SIGUIJ589CPHEA 89100220125290AC
ATOM590OPHEA 8923.326−2.59038.1081.0011.21AO
ANISOU590OPHEA 8913011248149121385−90AO
SIGUIJ590OPHEA 8910022155289AO
ATOM591NAARGA 9025.105−1.29438.6300.5012.01AN
ANISOU591NAARGA 90145215151438−800AN
SIGUIJ591NAARGA 9010022162289AN
ATOM592NBARGA 9025.097−1.28038.6330.5014.20AN
ANISOU592NBARGA 90147415291451−1710AN
SIGUIJ592NBARGA 9010022162289AN
ATOM593CAAARGA 9025.103−0.57437.3490.5013.07AC
ANISOU593CAAARGA 90133715151436−720AC
SIGUIJ593CAAARGA 90100220125290AC
ATOM594CABARGA 9025.092−0.53637.3590.5015.26AC
ANISOU594CABARGA 90131115511448440AC
SIGUIJ594CABARGA 90100220125290AC
ATOM595CBAARGA 9025.9640.65337.3980.5013.27AC
ANISOU595CBAARGA 90135915301493−2200AC
SIGUIJ595CBAARGA 90100220125290AC
ATOM596CBBARGA 9025.8790.76637.4740.5015.46AC
ANISOU596CBBARGA 90141515993073−44−208−23AC
SIGUIJ596CBBARGA 90100220124290AC
ATOM597CGAARGA 9025.3631.76538.2070.5014.09AC
ANISOU597CGAARGA 90131515061503−5731AC
SIGUIJ597CGAARGA 90100220124290AC
ATOM598CGBARGA 9025.2381.76438.4510.5016.28AC
ANISOU598CGBARGA 90159716233101−3−141−7AC
SIGUIJ598CGBARGA 90100220124290AC
ATOM599CDAARGA 9026.3992.86138.2970.5015.12AC
ANISOU599CDAARGA 90118013771504727−2AC
SIGUIJ599CDAARGA 90100220124290AC
ATOM600CDBARGA 9026.0493.04338.6680.5017.31AC
ANISOU600CDBARGA 90171316224341−7−56548AC
SIGUIJ600CDBARGA 90100220124290AC
ATOM601NEAARGA 9025.7904.16138.5710.5015.48AN
ANISOU601NEAARGA 9011291362135252−163AN
SIGUIJ601NEAARGA 9010022162289AN
ATOM602NEBARGA 9027.4052.74839.0940.5017.67AN
ANISOU602NEBARGA 90161824423049156−16624AN
SIGUIJ602NEBARGA 9010022162289AN
ATOM603CZAARGA 9026.4645.24938.9290.5015.12AC
ANISOU603CZAARGA 901156137112913021−4AC
SIGUIJ603CZAARGA 90100220123290AC
ATOM604CZBARGA 9028.3973.62839.0730.5017.31AC
ANISOU604CZBARGA 90165424953133110−15416AC
SIGUIJ604CZBARGA 90100220123290AC
ATOM605NH1AARGA 9027.7895.18739.0880.5015.97AN
ANISOU605NH1AARGA 9011711391225929−896AN
SIGUIJ605NH1AARGA 9010022162289AN
ATOM606NH1BARGA 9028.1854.87838.6670.5018.16AN
ANISOU606NH1BARGA 9015732490311482−17812AN
SIGUIJ606NH1BARGA 9010022162289AN
ATOM607NH2AARGA 9025.8186.40139.0260.5014.36AN
ANISOU607NH2AARGA 907801244886−18398AN
SIGUIJ607NH2AARGA 9010022162289AN
ATOM608NH2BARGA 9029.6203.21939.3940.5016.55AN
ANISOU608NH2BARGA 9015992618212715998−22AN
SIGUIJ608NH2BARGA 9010022162289AN
ATOM609CAARGA 9025.703−1.41936.2460.5013.71AC
ANISOU609CAARGA 901376153514371913−3AC
SIGUIJ609CAARGA 90100220123290AC
ATOM610CBARGA 9025.739−1.35236.2460.5015.90AC
ANISOU610CBARGA 90137515811444518−4AC
SIGUIJ610CBARGA 90100220123290AC
ATOM611OAARGA 9026.568−2.27536.4920.5013.91AO
ANISOU611OAARGA 90171718821575358336AO
SIGUIJ611OAARGA 9010022155289AO
ATOM612OBARGA 9026.653−2.14536.4900.5016.10AO
ANISOU612OBARGA 90165619112112331−11176AO
SIGUIJ612OBARGA 9010022155289AO
ATOM613NHISA 9125.256−1.18435.0201.0014.41AN
ANISOU613NHISA 91145319031440182−15AN
SIGUIJ613NHISA 9110022162289AN
ATOM614CAHISA 9125.955−1.76733.8711.0015.48AC
ANISOU614CAHISA 9115772114143932828AC
SIGUIJ614CAHISA 91100220123290AC
ATOM615CBHISA 9125.243−1.34232.6091.0015.53AC
ANISOU615CBHISA 91169221161439400−21−23AC
SIGUIJ615CBHISA 91100220122290AC
ATOM616CGHISA 9125.732−2.05431.3641.0016.17AC
ANISOU616CGHISA 9120802039147840311214AC
SIGUIJ616CGHISA 91100220122290AC
ATOM617CD2HISA 9125.170−3.04930.6321.0016.53AC
ANISOU617CD2HISA 9125752179148911212022AC
SIGUIJ617CD2HISA 91100220122290AC
ATOM618ND1HISA 9126.940−1.75230.7601.0016.33AN
ANISOU618ND1HISA 91220827091805237296−14AN
SIGUIJ618ND1HISA 9110022162289AN
ATOM619CE1HISA 9127.098−2.55129.7071.0016.71AC
ANISOU619CE1HISA 9131682580178114953068AC
SIGUIJ619CE1HISA 91100220122290AC
ATOM620NE2HISA 9126.049−3.34329.6091.0016.79AN
ANISOU620NE2HISA 91303623231757343466148AN
SIGUIJ620NE2HISA 9110022162289AN
ATOM621CHISA 9127.399−1.21333.8781.0016.12AC
ANISOU621CHISA 9115491980175537951−52AC
SIGUIJ621CHISA 91100220122290AC
ATOM622OHISA 9127.633−0.03334.1491.0015.90AO
ANISOU622OHISA 91163020272064291356−175AO
SIGUIJ622OHISA 9110022155289AO
ATOM623NPROA 9228.377−2.09633.5681.0017.08AN
ANISOU623NPROA 92159919602747346307−122AN
SIGUIJ623NPROA 9210022162289AN
ATOM624CDPROA 9228.200−3.52833.2281.0017.34AC
ANISOU624CDPROA 92155519642959352421−171AC
SIGUIJ624CDPROA 92100220121290AC
ATOM625CAPROA 9229.789−1.73233.6621.0018.05AC
ANISOU625CAPROA 92163725753230178267−45AC
SIGUIJ625CAPROA 92100220121290AC
ATOM626CBPROA 9230.523−3.03933.3521.0018.03AC
ANISOU626CBPROA 922147259553472381218−26AC
SIGUIJ626CBPROA 92100220121290AC
ATOM627CGPROA 9229.595−3.94332.7451.0017.85AC
ANISOU627CGPROA 921886256456844691307−351AC
SIGUIJ627CGPROA 92100220121290AC
ATOM628CPROA 9230.261−0.61432.7411.0018.73AC
ANISOU628CPROA 9228702518332360795−195AC
SIGUIJ628CPROA 92100220121290AC
ATOM629OPROA 9231.3350.01932.9971.0019.68AO
ANISOU629OPROA 92328932233753−484378338AO
SIGUIJ629OPROA 9210022155289AO
ATOM630NGLYA 9329.503−0.36731.6871.0019.18AN
ANISOU630NGLYA 932405245530562091157−308AN
SIGUIJ630NGLYA 9310022162289AN
ATOM631CAGLYA 9329.9540.62330.7161.0019.61AC
ANISOU631CAGLYA 932978288336792491468152AC
SIGUIJ631CAGLYA 93100220120290AC
ATOM632CGLYA 9329.4732.04630.9781.0019.41AC
ANISOU632CGLYA 93205329021983215−4−11AC
SIGUIJ632CGLYA 93100220120290AC
ATOM633OGLYA 9329.5972.92130.1121.0019.30AO
ANISOU633OGLYA 93171827901916404188−106AO
SIGUIJ633OGLYA 9310022155289AO
ATOM634NTYRA 9428.8712.29532.1571.0019.65AN
ANISOU634NTYRA 94215833871987465−3−8AN
SIGUIJ634NTYRA 9410022162289AN
ATOM635CATYRA 9428.1063.54732.3151.0019.52AC
ANISOU635CATYRA 941425310618125304AC
SIGUIJ635CATYRA 94100220120290AC
ATOM636CBTYRA 9427.2153.52533.5871.0018.03AC
ANISOU636CBTYRA 941488221818330630AC
SIGUIJ636CBTYRA 94100220120290AC
ATOM637CGTYRA 9426.5404.84233.8861.0016.64AC
ANISOU637CGTYRA 94119021181697−1768121AC
SIGUIJ637CGTYRA 94100220120290AC
ATOM638CD1TYRA 9425.6705.43132.9671.0016.20AC
ANISOU638CD1TYRA 94120017981785−351−38−20AC
SIGUIJ638CD1TYRA 94100220119290AC
ATOM639CE1TYRA 9425.0036.63333.2221.0015.88AC
ANISOU639CE1TYRA 94129617981741−3278953AC
SIGUIJ639CE1TYRA 94100220119290AC
ATOM640CD2TYRA 9426.7655.48435.0891.0016.08AC
ANISOU640CD2TYRA 94168321451718−21847AC
SIGUIJ640CD2TYRA 94100220119290AC
ATOM641CE2TYRA 9426.1566.67835.3801.0015.75AC
ANISOU641CE2TYRA 94182421771776−14500AC
SIGUIJ641CE2TYRA 94100220119290AC
ATOM642CZTYRA 9425.2697.25534.4551.0015.56AC
ANISOU642CZTYRA 94164918541770−3742331AC
SIGUIJ642CZTYRA 94100220119290AC
ATOM643OHTYRA 9424.6168.43134.7131.0016.26AO
ANISOU643OHTYRA 94223720351910−4822−4AO
SIGUIJ643OHTYRA 9410022155289AO
ATOM644CTYRA 9428.9944.75232.3421.0020.49AC
ANISOU644CTYRA 94169832732675−205152AC
SIGUIJ644CTYRA 94100220119290AC
ATOM645OTYRA 9429.9674.77933.0961.0020.98AO
ANISOU645OTYRA 94182440792897−213−149−19AO
SIGUIJ645OTYRA 9410022155289AO
ATOM646NSERA 9528.6235.73431.5361.0021.52AN
ANISOU646NSERA 95163733322624−11914513AN
SIGUIJ646NSERA 9510022162289AN
ATOM647CASERA 9529.3626.98931.4431.0022.67AC
ANISOU647CASERA 95208935013158−38815647AC
SIGUIJ647CASERA 95100220118290AC
ATOM648CBSERA 9529.6917.32329.9841.0022.92AC
ANISOU648CBSERA 95256229153189−9350−2AC
SIGUIJ648CBSERA 95100220118290AC
ATOM649OGSERA 9530.3498.58729.8681.0023.39AO
ANISOU649OGSERA 95266429453663−5837036AO
SIGUIJ649OGSERA 9510022155289AO
ATOM650CSERA 9528.5038.10331.9721.0023.35AC
ANISOU650CSERA 95261339172845123−6622AC
SIGUIJ650CSERA 95100220118290AC
ATOM651OSERA 9527.4478.41831.3831.0023.22AO
ANISOU651OSERA 95240627212567−27111196AO
SIGUIJ651OSERA 9510022155289AO
ATOM652NTHRA 9628.9868.76033.0151.0024.40AN
ANISOU652NTHRA 96250239022847184−5718AN
SIGUIJ652NTHRA 9610022162289AN
ATOM653CATHRA 9628.3119.98133.4451.0025.35AC
ANISOU653CATHRA 96319940994076423382−155AC
SIGUIJ653CATHRA 96100220118290AC
ATOM654CBTHRA 9628.95410.61334.7181.0025.49AC
ANISOU654CBTHRA 96432442434194791AC
SIGUIJ654CBTHRA 96100220118290AC
ATOM655OG1THRA 9630.20711.24634.3891.0026.34AO
ANISOU655OG1THRA 96438342665130824212AO
SIGUIJ655OG1THRA 9610022155289AO
ATOM656CG2THRA 9629.1509.56435.7861.0025.75AC
ANISOU656CG2THRA 964300424442015−60AC
SIGUIJ656CG2THRA 96100220117290AC
ATOM657CTHRA 9628.27111.06432.3641.0025.73AC
ANISOU657CTHRA 96328442324245−37−73−3AC
SIGUIJ657CTHRA 96100220117290AC
ATOM658OTHRA 9627.34811.86332.3341.0026.22AO
ANISOU658OTHRA 9633744343584763−1105AO
SIGUIJ658OTHRA 9610022155289AO
ATOM659NGLNA 9729.22311.08631.4381.0025.95AN
ANISOU659NGLNA 97344628034422−4980AN
SIGUIJ659NGLNA 9710022162289AN
ATOM660CAGLNA 9729.31612.20230.5151.0026.11AC
ANISOU660CAGLNA 97435228184419−15545AC
SIGUIJ660CAGLNA 97100220117290AC
ATOM661CBGLNA 9730.75912.40230.0991.0026.98AC
ANISOU661CBGLNA 97437037464402−2912−12AC
SIGUIJ661CBGLNA 97100220117290AC
ATOM662CGGLNA 9730.86813.20928.8091.0028.30AC
ANISOU662CGGLNA 9775643747446611351818AC
SIGUIJ662CGGLNA 97100220117290AC
ATOM663CDGLNA 9732.28713.30428.2751.0028.85AC
ANISOU663CDGLNA 977752121705505−481913−68AC
SIGUIJ663CDGLNA 97100220117290AC
ATOM664OE1GLNA 9733.06212.32228.3171.0029.55AO
ANISOU664OE1GLNA 9776101206321148−62317318AO
SIGUIJ664OE1GLNA 9710022155289AO
ATOM665NE2GLNA 9732.64314.48427.7601.0029.45AN
ANISOU665NE2GLNA 978173122955335−805457−5AN
SIGUIJ665NE2GLNA 9710022162289AN
ATOM666CGLNA 9728.46411.98129.2541.0025.48AC
ANISOU666CGLNA 97437732094425−221−1−4AC
SIGUIJ666CGLNA 97100220116290AC
ATOM667OGLNA 9727.76412.89928.7701.0025.97AO
ANISOU667OGLNA 97443832444429−1780−1AO
SIGUIJ667OGLNA 9710022155289AO
ATOM668NTHRA 9828.51710.76828.7091.0024.71AN
ANISOU668NTHRA 98213931294134−535501154AN
SIGUIJ668NTHRA 9810022162289AN
ATOM669CATHRA 9827.84510.47427.4481.0023.55AC
ANISOU669CATHRA 98223423974212−131363126AC
SIGUIJ669CATHRA 98100220116290AC
ATOM670CBTHRA 9828.6729.55326.5351.0024.14AC
ANISOU670CBTHRA 982923265247898855−11AC
SIGUIJ670CBTHRA 98100220116290AC
ATOM671OG1THRA 9828.6938.24227.0901.0025.41AO
ANISOU671OG1THRA 9826822630467718885−60AO
SIGUIJ671OG1THRA 9810022155289AO
ATOM672CG2THRA 9830.13910.01326.4431.0024.07AC
ANISOU672CG2THRA 98293626411000722116450AC
SIGUIJ672CG2THRA 98100220116290AC
ATOM673CTHRA 9826.4749.80327.6461.0022.30AC
ANISOU673CTHRA 9821552072268132069AC
SIGUIJ673CTHRA 98100220116290AC
ATOM674OTHRA 9825.7049.65526.6891.0022.13AO
ANISOU674OTHRA 98240133402810−2474820AO
SIGUIJ674OTHRA 9810022155289AO
ATOM675NHISA 9926.1939.36028.8681.0020.81AN
ANISOU675NHISA 991992199626631155−3AN
SIGUIJ675NHISA 9910022162289AN
ATOM676CAHISA 9924.9518.63429.1681.0019.34AC
ANISOU676CAHISA 99198319872190−2560AC
SIGUIJ676CAHISA 99100220116290AC
ATOM677CBHISA 9923.7159.43828.7291.0019.79AC
ANISOU677CBHISA 992185200537474−48419AC
SIGUIJ677CBHISA 99100220115290AC
ATOM678CGHISA 9923.72810.84629.2131.0020.14AC
ANISOU678CGHISA 99235120153830−96−197−2AC
SIGUIJ678CGHISA 99100220115290AC
ATOM679CD2HISA 9924.03611.99628.5811.0020.41AC
ANISOU679CD2HISA 99220320173899−57−20333AC
SIGUIJ679CD2HISA 99100220115290AC
ATOM680ND1HISA 9923.38211.19030.5011.0020.50AN
ANISOU680ND1HISA 99230319933822−68−21325AN
SIGUIJ680ND1HISA 9910022162289AN
ATOM681CE1HISA 9923.46612.50130.6411.0020.81AC
ANISOU681CE1HISA 99314620054017−15295−5AC
SIGUIJ681CE1HISA 99100220115290AC
ATOM682NE2HISA 9923.86213.01229.4871.0020.46AN
ANISOU682NE2HISA 99263320273964−118−623AN
SIGUIJ682NE2HISA 9910022162289AN
ATOM683CHISA 9924.8667.23428.5831.0018.13AC
ANISOU683CHISA 991816198021603445−7AC
SIGUIJ683CHISA 99100220115290AC
ATOM684OHISA 9923.8236.60228.6851.0017.56AO
ANISOU684OHISA 991823201419951639−3AO
SIGUIJ684OHISA 9910022155289AO
ATOM685NVALA10025.9456.72327.9861.0016.94AN
ANISOU685NVALA100176918612023−14−8−1AN
SIGUIJ685NVALA10010022162289AN
ATOM686CAVALA10025.8685.36927.4791.0015.87AC
ANISOU686CAVALA100225218501935−476−1AC
SIGUIJ686CAVALA100100220115290AC
ATOM687CBVALA10027.0675.02726.5141.0016.42AC
ANISOU687CBVALA100236321012040271029AC
SIGUIJ687CBVALA100100220114290AC
ATOM688CG1VALA10027.0485.93625.3291.0017.26AC
ANISOU688CG1VALA10054383054256217401368709AC
SIGUIJ688CG1VALA100100220114290AC
ATOM689CG2VALA10028.3285.04127.2271.0017.69AC
ANISOU689CG2VALA10024242757223610−10AC
SIGUIJ689CG2VALA100100220114290AC
ATOM690CVALA10025.7694.38028.6191.0014.72AC
ANISOU690CVALA100179018131929−430AC
SIGUIJ690CVALA100100220114290AC
ATOM691OVALA10026.2434.59729.7311.0013.86AO
ANISOU691OVALA100143818381841−12319252AO
SIGUIJ691OVALA10010022155289AO
ATOM692NASNA10125.0883.29128.3281.0014.10AN
ANISOU692NASNA101152117581671104276−91AN
SIGUIJ692NASNA10110022162289AN
ATOM693CAASNA10124.9022.22329.3101.0013.56AC
ANISOU693CAASNA10115591763168987245−77AC
SIGUIJ693CAASNA101100220114290AC
ATOM694CBASNA10126.2341.52529.5921.0014.79AC
ANISOU694CBASNA101160919602094186184−71AC
SIGUIJ694CBASNA101100220114290AC
ATOM695CGASNA10126.8200.96328.3061.0015.68AC
ANISOU695CGASNA101169622252125340181−106AC
SIGUIJ695CGASNA101100220113290AC
ATOM696OD1ASNA10126.1000.32327.5151.0016.85AO
ANISOU696OD1ASNA101185022742189254114−66AO
SIGUIJ696OD1ASNA10110022155289AO
ATOM697ND2ASNA10128.0911.26028.0641.0017.12AN
ANISOU697ND2ASNA101175431412634138263−32AN
SIGUIJ697ND2ASNA10110022162289AN
ATOM698CASNA10124.2082.65730.6021.0012.67AC
ANISOU698CASNA101117613901549−9341AC
SIGUIJ698CASNA101100220113290AC
ATOM699OASNA10124.5822.22331.7071.0012.12AO
ANISOU699OASNA101125514741494236113−82AO
SIGUIJ699OASNA10110022155289AO
ATOM700NASPA10223.2063.50930.4391.0011.51AN
ANISOU700NASPA102119713691286−530AN
SIGUIJ700NASPA10210022162289AN
ATOM701CAASPA10222.5224.09531.5891.0011.50AC
ANISOU701CAASPA102122613171276−1900AC
SIGUIJ701CAASPA102100220113290AC
ATOM702CBASPA10221.9245.44931.1921.0011.19AC
ANISOU702CBASPA1021327132912860−10AC
SIGUIJ702CBASPA102100220113290AC
ATOM703CGASPA10221.4426.26932.4001.0011.45AC
ANISOU703CGASPA1021369134412830−20AC
SIGUIJ703CGASPA102100220113290AC
ATOM704OD1ASPA10221.6735.85633.5631.0011.51AO
ANISOU704OD1ASPA102125113471283−1020AO
SIGUIJ704OD1ASPA10210022155289AO
ATOM705OD2ASPA10220.8017.31332.1691.0011.08AO
ANISOU705OD2ASPA102142113541220981AO
SIGUIJ705OD2ASPA10210022155289AO
ATOM706CASPA10221.4553.14432.1311.0011.59AC
ANISOU706CASPA102122312801252200AC
SIGUIJ706CASPA102100220113290AC
ATOM707OASPA10220.2453.45932.0841.0012.68AO
ANISOU707OASPA102125816871990120−296AO
SIGUIJ707OASPA10210022155289AO
ATOM708NLEUA10321.8912.00732.6761.0011.50AN
ANISOU708NLEUA103127012691266000AN
SIGUIJ708NLEUA10310022162289AN
ATOM709CALEUA10320.9521.08333.2861.0011.53AC
ANISOU709CALEUA103127812631325340AC
SIGUIJ709CALEUA103100220112290AC
ATOM710CBLEUA10320.3280.08832.3001.0013.13AC
ANISOU710CBLEUA103196515151359−384−117AC
SIGUIJ710CBLEUA103100220112290AC
ATOM711CGLEUA10321.231−1.00531.7561.0013.55AC
ANISOU711CGLEUA103231217411668−140116−26AC
SIGUIJ711CGLEUA103100220112290AC
ATOM712CD1LEUA10320.335−2.05730.9571.0014.38AC
ANISOU712CD1LEUA103218016791605−68167−20AC
SIGUIJ712CD1LEUA103100220112290AC
ATOM713CD2LEUA10322.241−0.48930.7441.0014.48AC
ANISOU713CD2LEUA103228216091715−26149−6AC
SIGUIJ713CD2LEUA103100220112290AC
ATOM714CLEUA10321.5630.40534.4951.0010.75AC
ANISOU714CLEUA103121712101320−19−1AC
SIGUIJ714CLEUA103100220112290AC
ATOM715OLEUA10322.8070.31734.6471.0010.74AO
ANISOU715OLEUA103121212891464500AO
SIGUIJ715OLEUA10310022155289AO
ATOM716NMETA10420.688−0.02735.4001.0010.28AN
ANISOU716NMETA1041183106213068612−3AN
SIGUIJ716NMETA10410022162289AN
ATOM717CAMETA10421.074−0.50836.7111.009.73AC
ANISOU717CAMETA1041188101513102−120AC
SIGUIJ717CAMETA104100220112290AC
ATOM718CBMETA10421.2420.68937.6701.009.60AC
ANISOU718CBMETA104115610181297−47200AC
SIGUIJ718CBMETA104100220111290AC
ATOM719CGMETA10421.6210.32239.1001.009.22AC
ANISOU719CGMETA1041309111712942510AC
SIGUIJ719CGMETA104100220111290AC
ATOM720SDMETA10421.9341.76940.1441.0010.10AS
ANISOU720SDMETA10413651162140892−113−79AS
SIGUIJ720SDMETA10410022148289AS
ATOM721CEMETA10420.2752.46140.3181.009.48AC
ANISOU721CEMETA10413651153152795−275AC
SIGUIJ721CEMETA104100220111290AC
ATOM722CMETA10419.992−1.44437.2311.009.69AC
ANISOU722CMETA104116896513596028−1AC
SIGUIJ722CMETA104100220111290AC
ATOM723OMETA10418.798−1.17237.0661.0010.37AO
ANISOU723OMETA1041184108016468741AO
SIGUIJ723OMETA10410022155289AO
ATOM724NLEUA10520.411−2.51437.9071.009.28AN
ANISOU724NLEUA105111696613473910AN
SIGUIJ724NLEUA10510022162289AN
ATOM725CALEUA10519.499−3.41438.5801.009.44AC
ANISOU725CALEUA10510329261390124141AC
SIGUIJ725CALEUA105100220111290AC
ATOM726CBLEUA10519.892−4.87738.2631.0010.10AC
ANISOU726CBLEUA1051389953164020253−30AC
SIGUIJ726CBLEUA105100220111290AC
ATOM727CGLEUA10519.402−5.29036.8911.0010.37AC
ANISOU727CGLEUA10516201043165820−10AC
SIGUIJ727CGLEUA105100220110290AC
ATOM728CD1LEUA10520.243−6.49436.4161.0011.78AC
ANISOU728CD1LEUA105211613311753403−62−49AC
SIGUIJ728CD1LEUA105100220110290AC
ATOM729CD2LEUA10517.882−5.62336.9141.0011.41AC
ANISOU729CD2LEUA105164214951676−870−1AC
SIGUIJ729CD2LEUA105100220110290AC
ATOM730CLEUA10519.553−3.16840.0741.009.78AC
ANISOU730CLEUA1051222104513904419−1AC
SIGUIJ730CLEUA105100220110290AC
ATOM731OLEUA10520.639−3.05640.6681.0010.06AO
ANISOU731OLEUA105125115671485−8−34−1AO
SIGUIJ731OLEUA10510022155289AO
ATOM732NVALA10618.376−3.05340.7001.009.72AN
ANISOU732NVALA10612111073132660−61AN
SIGUIJ732NVALA10610022162289AN
ATOM733CAVALA10618.253−2.80642.1181.009.98AC
ANISOU733CAVALA10611659971333−15−20AC
SIGUIJ733CAVALA106100220110290AC
ATOM734CBVALA10617.319−1.59242.4011.009.38AC
ANISOU734CBVALA10611951027132218−110AC
SIGUIJ734CBVALA106100220110290AC
ATOM735CG1VALA10617.014−1.47043.8551.0010.46AC
ANISOU735CG1VALA1061714107913351277919AC
SIGUIJ735CG1VALA106100220110290AC
ATOM736CG2VALA10617.961−0.32641.8391.0010.19AC
ANISOU736CG2VALA106137210811382−8003AC
SIGUIJ736CG2VALA106100220109290AC
ATOM737CVALA10617.652−4.04642.7671.009.99AC
ANISOU737CVALA1061187973138417690AC
SIGUIJ737CVALA106100220109290AC
ATOM738OVALA10616.621−4.55842.3151.0010.40AO
ANISOU738OVALA106125710521559−27−372AO
SIGUIJ738OVALA10610022155289AO
ATOM739NLYSA10718.348−4.59143.7701.0010.39AN
ANISOU739NLYSA10713701019144776−63AN
SIGUIJ739NLYSA10710022162289AN
ATOM740CALYSA10717.914−5.84244.3881.0010.98AC
ANISOU740CALYSA1071397100514591013−2AC
SIGUIJ740CALYSA107100220109290AC
ATOM741CBLYSA10719.106−6.66844.8031.0011.90AC
ANISOU741CBLYSA107160112501934297−16411AC
SIGUIJ741CBLYSA107100220109290AC
ATOM742CGLYSA10718.732−8.04945.2451.0013.32AC
ANISOU742CGLYSA10718301239206631618−9AC
SIGUIJ742CGLYSA107100220109290AC
ATOM743CDLYSA10719.993−8.86345.6081.0014.98AC
ANISOU743CDLYSA10720791905219471585171AC
SIGUIJ743CDLYSA107100220109290AC
ATOM744CELYSA10719.721−10.36245.7721.0016.42AC
ANISOU744CELYSA107271319213605647435263AC
SIGUIJ744CELYSA107100220109290AC
ATOM745NZLYSA10721.008−11.03246.2971.0017.72AN
ANISOU745NZLYSA10730262306402898193−57AN
SIGUIJ745NZLYSA10710022162289AN
ATOM746CLYSA10717.065−5.53145.6041.0011.00AC
ANISOU746CLYSA10713951032145071−11AC
SIGUIJ746CLYSA107100220108290AC
ATOM747OLYSA10717.547−4.88746.5531.0011.19AO
ANISOU747OLYSA107156711701442−785−2AO
SIGUIJ747OLYSA10710022155289AO
ATOM748NLEUA10815.802−5.98145.6031.0011.24AN
ANISOU748NLEUA108142212311342200AN
SIGUIJ748NLEUA10810022162289AN
ATOM749CALEUA10814.907−5.71146.7401.0011.85AC
ANISOU749CALEUA1081465127713529221AC
SIGUIJ749CALEUA108100220108290AC
ATOM750CBLEUA10813.474−6.13246.3871.0012.01AC
ANISOU750CBLEUA108147813431502−20−10AC
SIGUIJ750CBLEUA108100220108290AC
ATOM751CGLEUA10812.919−5.41845.1671.0011.86AC
ANISOU751CGLEUA10815361382150524−4−2AC
SIGUIJ751CGLEUA108100220108290AC
ATOM752CD1LEUA10811.513−5.98444.8371.0012.58AC
ANISOU752CD1LEUA108161415012352−35−22951AC
SIGUIJ752CD1LEUA108100220108290AC
ATOM753CD2LEUA10812.846−3.92645.3991.0012.88AC
ANISOU753CD2LEUA10821131389160857−30−3AC
SIGUIJ753CD2LEUA108100220108290AC
ATOM754CLEUA10815.392−6.54647.9521.0012.20AC
ANISOU754CLEUA108151912671374−32−255AC
SIGUIJ754CLEUA108100220108290AC
ATOM755OLEUA10815.854−7.68547.7861.0012.60AO
ANISOU755OLEUA108185213131599917018AO
SIGUIJ755OLEUA10810022155289AO
ATOM756NASNA10915.259−6.00649.1391.0012.92AN
ANISOU756NASNA109157313451374−40−41AN
SIGUIJ756NASNA10910022162289AN
ATOM757CAASNA10915.681−6.75750.3451.0013.41AC
ANISOU757CAASNA10918471426137846−54−5AC
SIGUIJ757CAASNA109100220107290AC
ATOM758CBASNA10915.811−5.83651.5421.0013.05AC
ANISOU758CBASNA10916871456137640−37−5AC
SIGUIJ758CBASNA109100220107290AC
ATOM759CGASNA10917.005−4.89151.4311.0012.98AC
ANISOU759CGASNA10916801476152543−12−3AC
SIGUIJ759CGASNA109100220107290AC
ATOM760OD1ASNA10917.785−4.88650.4421.0012.94AO
ANISOU760OD1ASNA10917301565155232285AO
SIGUIJ760OD1ASNA10910022155289AO
ATOM761ND2ASNA10917.173−4.09652.4701.0013.30AN
ANISOU761ND2ASNA10916871502153328−5−1AN
SIGUIJ761ND2ASNA10910022161289AN
ATOM762CASNA10914.724−7.85950.7191.0014.69AC
ANISOU762CASNA109209915881559−14026−7AC
SIGUIJ762CASNA109100220107290AC
ATOM763OASNA10915.098−8.81651.4331.0014.91AO
ANISOU763OASNA109237416411909−293−314134AO
SIGUIJ763OASNA10910022155289AO
ATOM764NASERA11013.476−7.73650.2670.5015.29AN
ANISOU764NASERA110213517621816−127−6322AN
SIGUIJ764NASERA11010022161289AN
ATOM765NBSERA11013.510−7.78950.2030.5017.48AN
ANISOU765NBSERA110214316401822−165−8433AN
SIGUIJ765NBSERA11010022161289AN
ATOM766CAASERA11012.395−8.69650.5290.5016.79AC
ANISOU766CAASERA110234120201933−347−3828AC
SIGUIJ766CAASERA110100220107290AC
ATOM767CABSERA11012.531−8.83550.4090.5018.98AC
ANISOU767CABSERA110225117102035−244−2014AC
SIGUIJ767CABSERA110100220107290AC
ATOM768CBASERA11011.484−8.21051.7030.5017.69AC
ANISOU768CBASERA110266826892019−1641AC
SIGUIJ768CBASERA110100220107290AC
ATOM769CBBSERA11011.640−8.50451.6140.5019.88AC
ANISOU769CBBSERA110240924292071224−1AC
SIGUIJ769CBBSERA110100220107290AC
ATOM770OGASERA11010.860−6.95051.4980.5019.99AO
ANISOU770OGASERA1102698268620361231AO
SIGUIJ770OGASERA11010022155289AO
ATOM771OGBSERA11012.411−8.42752.8000.5022.18AO
ANISOU771OGBSERA110246225762090−34−7−1AO
SIGUIJ771OGBSERA11010022155289AO
ATOM772CASERA11011.603−8.80749.2160.5017.01AC
ANISOU772CASERA110243218441956−290−7437AC
SIGUIJ772CASERA110100220106290AC
ATOM773CBSERA11011.713−8.88549.1380.5019.20AC
ANISOU773CBSERA110222418262022−206−21AC
SIGUIJ773CBSERA110100220106290AC
ATOM774OASERA11011.619−7.86648.3920.5016.63AO
ANISOU774OASERA110143918291952−1179624AO
SIGUIJ774OASERA11010022155289AO
ATOM775OBSERA11011.771−7.97448.2910.5018.82AO
ANISOU775OBSERA110269318172024−219−72AO
SIGUIJ775OBSERA11010022155289AO
ATOM776NGLNA11110.933−9.93248.9961.0017.12AN
ANISOU776NGLNA111198816981958−2800AN
SIGUIJ776NGLNA11110022161289AN
ATOM777CAGLNA11110.229−10.11747.7371.0018.12AC
ANISOU777CAGLNA111216619701991−137−7243AC
SIGUIJ777CAGLNA111100220106290AC
ATOM778CBGLNA1119.766−11.55747.5791.0019.48AC
ANISOU778CBGLNA111237119982746−187−160−30AC
SIGUIJ778CBGLNA111100220106290AC
ATOM779CGGLNA11110.845−12.56847.3921.0022.14AC
ANISOU779CGGLNA1112793226479198085292AC
SIGUIJ779CGGLNA111100220106290AC
ATOM780CDGLNA11110.308−13.81946.7581.0023.28AC
ANISOU780CDGLNA111673127489230−935−488−3AC
SIGUIJ780CDGLNA111100220106290AC
ATOM781OE1GLNA11110.959−14.43445.9071.0024.92AO
ANISOU781OE1GLNA111923848639655100529−45AO
SIGUIJ781OE1GLNA11110022155289AO
ATOM782NE2GLNA1119.103−14.20147.1571.0024.43AN
ANISOU782NE2GLNA111676526219593−908−357−33AN
SIGUIJ782NE2GLNA11110022161289AN
ATOM783CGLNA1119.019−9.20147.5931.0017.61AC
ANISOU783CGLNA111216319381772−146−5724AC
SIGUIJ783CGLNA111100220106290AC
ATOM784OGLNA1118.280−8.95648.5261.0018.10AO
ANISOU784OGLNA11124632452193421449AO
SIGUIJ784OGLNA11110022155289AO
ATOM785NALAA1128.811−8.71846.3771.0017.05AN
ANISOU785NALAA112200318531753−4814−4AN
SIGUIJ785NALAA11210022161289AN
ATOM786CAALAA1127.570−8.04146.0571.0016.69AC
ANISOU786CAALAA112196817311752−1189−4AC
SIGUIJ786CAALAA112100220106290AC
ATOM787CBALAA1127.670−7.43444.6791.0016.65AC
ANISOU787CBALAA112200017441751−188−53AC
SIGUIJ787CBALAA112100220105290AC
ATOM788CALAA1126.462−9.07046.0591.0016.29AC
ANISOU788CALAA1121843158821301780AC
SIGUIJ788CALAA112100220105290AC
ATOM789OALAA1126.640−10.18145.5481.0016.84AO
ANISOU789OALAA112198316112562−162436−121AO
SIGUIJ789OALAA11210022155289AO
ATOM790NARGA1135.317−8.64846.5551.0015.89AN
ANISOU790NARGA113177013102014−103−463AN
SIGUIJ790NARGA11310022161289AN
ATOM791CAARGA1134.134−9.49846.5611.0016.10AC
ANISOU791CAARGA113180913952123−170−36−3AC
SIGUIJ791CAARGA113100220105290AC
ATOM792CBARGA1133.307−9.10547.7891.0016.85AC
ANISOU792CBARGA11319211804213910−90AC
SIGUIJ792CBARGA113100220105290AC
ATOM793CGARGA1132.029−9.91247.9731.0018.15AC
ANISOU793CGARGA113217924622531−3972563AC
SIGUIJ793CGARGA113100220105290AC
ATOM794CDARGA1131.363−9.57749.2791.0019.35AC
ANISOU794CDARGA1132480348125684769AC
SIGUIJ794CDARGA113100220105290AC
ATOM795NEARGA1130.698−8.28049.1881.0021.35AN
ANISOU795NEARGA1133765382131776583335AN
SIGUIJ795NEARGA11310022161289AN
ATOM796CZARGA1131.124−7.14549.7201.0021.76AC
ANISOU796CZARGA11347524010290714733940AC
SIGUIJ796CZARGA113100220105290AC
ATOM797NH1ARGA1132.263−7.11650.4031.0022.87AN
ANISOU797NH1ARGA113483192563113352154AN
SIGUIJ797NH1ARGA11310022161289AN
ATOM798NH2ARGA1130.407−6.03349.5601.0022.28AN
ANISOU798NH2ARGA113431738192073−127387−52AN
SIGUIJ798NH2ARGA11310022161289AN
ATOM799CARGA1133.379−9.24345.2801.0016.20AC
ANISOU799CARGA113160512492069−2158313AC
SIGUIJ799CARGA113100220104290AC
ATOM800OARGA1132.898−8.12645.0431.0015.52AO
ANISOU800OARGA113182112712200−140−20−2AO
SIGUIJ800OARGA11310022155289AO
ATOM801NLEUA1143.248−10.25544.4301.0016.44AN
ANISOU801NLEUA114174712472127−113−551AN
SIGUIJ801NLEUA11410022161289AN
ATOM802CALEUA1142.613−10.09543.1451.0017.11AC
ANISOU802CALEUA114173315042137−27−60−2AC
SIGUIJ802CALEUA114100220104290AC
ATOM803CBLEUA1143.090−11.17742.1601.0016.77AC
ANISOU803CBLEUA114167715002110−15−1162AC
SIGUIJ803CBLEUA114100220104290AC
ATOM804CGLEUA1144.604−11.24441.9361.0016.57AC
ANISOU804CGLEUA114168614142554−26−582AC
SIGUIJ804CGLEUA114100220104290AC
ATOM805CD1LEUA1144.934−12.34440.9311.0016.95AC
ANISOU805CD1LEUA114230214652569124−152AC
SIGUIJ805CD1LEUA114100220104290AC
ATOM806CD2LEUA1145.114−9.90941.4321.0017.11AC
ANISOU806CD2LEUA114227614623081−10832944AC
SIGUIJ806CD2LEUA114100220104290AC
ATOM807CLEUA1141.097−10.14943.2851.0018.00AC
ANISOU807CLEUA114172815732995−6150AC
SIGUIJ807CLEUA114100220104290AC
ATOM808OLEUA1140.577−10.82744.2151.0018.24AO
ANISOU808OLEUA114253618723167−32525455AO
SIGUIJ808OLEUA11410022155289AO
ATOM809NSERA1150.408−9.48242.3371.0018.77AN
ANISOU809NSERA115176315523043−36−494AN
SIGUIJ809NSERA11510022161289AN
ATOM810CASERA115−1.055−9.36442.3581.0019.64AC
ANISOU810CASERA11517662476333746−533AC
SIGUIJ810CASERA115100220104290AC
ATOM811CBSERA115−1.452−8.52343.5391.0020.16AC
ANISOU811CBSERA11526262474344512261−3AC
SIGUIJ811CBSERA115100220104290AC
ATOM812OGSERA115−1.140−7.16243.2231.0021.32AO
ANISOU812OGSERA11533402498464027979112AO
SIGUIJ812OGSERA11510022155289AO
ATOM813CSERA115−1.528−8.64541.0831.0019.90AC
ANISOU813CSERA115176322723371−161−175−32AC
SIGUIJ813CSERA115100220103290AC
ATOM814OSERA115−0.753−8.32540.2271.0020.05AO
ANISOU814OSERA1151816190934869−713AO
SIGUIJ814OSERA11510022154289AO
ATOM815NSERA116−2.838−8.42840.9311.0020.69AN
ANISOU815NSERA116179524185718−141−452−36AN
SIGUIJ815NSERA11610022161289AN
ATOM816CASERA116−3.329−7.55739.8571.0020.69AC
ANISOU816CASERA116195324555706−48−455−54AC
SIGUIJ816CASERA116100220103290AC
ATOM817CBSERA116−4.865−7.37139.9721.0021.19AC
ANISOU817CBSERA11619863668887797−2078AC
SIGUIJ817CBSERA116100220103290AC
ATOM818OGSERA116−5.215−6.76841.2021.0022.45AO
ANISOU818OGSERA116213838158778623−41988AO
SIGUIJ818OGSERA11610022154289AO
ATOM819CSERA116−2.644−6.17139.7841.0020.42AC
ANISOU819CSERA116221425214640−172−509−96AC
SIGUIJ819CSERA116100220103290AC
ATOM820OSERA116−2.550−5.61038.6971.0021.05AO
ANISOU820OSERA116213126404675−95−490−34AO
SIGUIJ820OSERA11610022154289AO
ATOM821NMETA117−2.153−5.66740.9211.0019.82AN
ANISOU821NMETA117140717704466182−30696AN
SIGUIJ821NMETA11710022161289AN
ATOM822CAMETA117−1.520−4.35040.9291.0019.03AC
ANISOU822CAMETA11717291849385032−577AC
SIGUIJ822CAMETA117100220103290AC
ATOM823CBMETA117−1.943−3.54742.1321.0020.66AC
ANISOU823CBMETA117226619463895138617AC
SIGUIJ823CBMETA117100220103290AC
ATOM824CGMETA117−3.379−2.89741.9801.0022.36AC
ANISOU824CGMETA117255432815392737−9642AC
SIGUIJ824CGMETA117100220103290AC
ATOM825SDMETA117−3.694−2.01940.3871.0024.64AS
ANISOU825SDMETA117267932655461451−289102AS
SIGUIJ825SDMETA11710022148289AS
ATOM826CEMETA117−3.179−0.41240.8611.0023.83AC
ANISOU826CEMETA117397834385677−2−1893AC
SIGUIJ826CEMETA117100220103290AC
ATOM827CMETA1170.001−4.37640.8991.0017.74AC
ANISOU827CMETA11717321355234225−741AC
SIGUIJ827CMETA117100220102290AC
ATOM828OMETA1170.612−3.30740.8051.0017.16AO
ANISOU828OMETA11717371336206338−73−2AO
SIGUIJ828OMETA11710022154289AO
ATOM829NVALA1180.611−5.57441.0041.0016.28AN
ANISOU829NVALA118162413302554−26−763AN
SIGUIJ829NVALA11810022161289AN
ATOM830CAVALA1182.095−5.72340.9501.0015.27AC
ANISOU830CAVALA118162911932104−36−941AC
SIGUIJ830CAVALA118100220102290AC
ATOM831CBVALA1182.649−5.93142.3771.0014.08AC
ANISOU831CBVALA1181405126320613120AC
SIGUIJ831CBVALA118100220102290AC
ATOM832CG1VALA1184.176−6.14542.3381.0013.42AC
ANISOU832CG1VALA118140812472297−1220AC
SIGUIJ832CG1VALA118100220102290AC
ATOM833CG2VALA1182.304−4.72243.2321.0014.26AC
ANISOU833CG2VALA11815621269209911761AC
SIGUIJ833CG2VALA118100220102290AC
ATOM834CVALA1182.414−6.89040.0551.0015.11AC
ANISOU834CVALA118143411612121−131−601AC
SIGUIJ834CVALA118100220102290AC
ATOM835OVALA1182.127−8.06040.3961.0014.71AO
ANISOU835OVALA118181411792218−232−43−2AO
SIGUIJ835OVALA11810022154289AO
ATOM836NLYSA1192.949−6.59338.8821.0015.20AN
ANISOU836NLYSA119174613002172−183637AN
SIGUIJ836NLYSA11910022161289AN
ATOM837CALYSA1193.202−7.59237.8381.0015.90AC
ANISOU837CALYSA119168913032175−188653AC
SIGUIJ837CALYSA119100220102290AC
ATOM838CBLYSA1192.212−7.32536.6931.0017.02AC
ANISOU838CBLYSA119215919342519−57−31159AC
SIGUIJ838CBLYSA119100220102290AC
ATOM839CGLYSA1192.221−8.23035.4311.0018.86AC
ANISOU839CGLYSA119260522232673−54142−144AC
SIGUIJ839CGLYSA119100220102290AC
ATOM840CDLYSA1191.015−7.88634.4931.0020.61AC
ANISOU840CDLYSA119275341162776−12049AC
SIGUIJ840CDLYSA119100220101290AC
ATOM841CELYSA1191.219−6.62533.5661.0021.72AC
ANISOU841CELYSA1191238841282918−7021335−104AC
SIGUIJ841CELYSA119100220101290AC
ATOM842NZLYSA1190.012−6.18832.7201.0022.83AN
ANISOU842NZLYSA11915093943068301341−1471−282AN
SIGUIJ842NZLYSA11910022161289AN
ATOM843CLYSA1194.607−7.43937.3051.0015.59AC
ANISOU843CLYSA119164812531821−207−51−38AC
SIGUIJ843CLYSA119100220101290AC
ATOM844OLYSA1195.169−6.30637.2571.0015.70AO
ANISOU844OLYSA119182213012500−310−73−4AO
SIGUIJ844OLYSA11910022154289AO
ATOM845NLYSA1205.202−8.53236.8771.0014.95AN
ANISOU845NLYSA120161512351756−241−16−21AN
SIGUIJ845NLYSA12010022161289AN
ATOM846CALYSA1206.481−8.48236.1871.0015.06AC
ANISOU846CALYSA120164013871823−2262320AC
SIGUIJ846CALYSA120100220101290AC
ATOM847CBLYSA1207.023−9.91936.0341.0015.87AC
ANISOU847CBLYSA120200314502116−8013−2AC
SIGUIJ847CBLYSA120100220101290AC
ATOM848CGLYSA1207.214−10.63437.3961.0017.11AC
ANISOU848CGLYSA120218515792148−69−1547AC
SIGUIJ848CGLYSA120100220101290AC
ATOM849CDLYSA1207.903−12.03237.2311.0019.27AC
ANISOU849CDLYSA1202483163733424026532AC
SIGUIJ849CDLYSA120100220101290AC
ATOM850CELYSA1207.005−13.10036.6161.0020.80AC
ANISOU850CELYSA120318120253841−384−22−5AC
SIGUIJ850CELYSA120100220101290AC
ATOM851NZLYSA1207.677−14.43136.7571.0022.64AN
ANISOU851NZLYSA12040522242534235−27513AN
SIGUIJ851NZLYSA12010022161289AN
ATOM852CLYSA1206.322−7.83634.8351.0014.75AC
ANISOU852CLYSA120176613601821−282−114AC
SIGUIJ852CLYSA120100220100290AC
ATOM853OLYSA1205.385−8.14134.0711.0014.75AO
ANISOU853OLYSA120179416891830−3811−4AO
SIGUIJ853OLYSA12010022154289AO
ATOM854NVALA1217.278−6.99334.4971.0013.48AN
ANISOU854NVALA121161611431653−106−1−3AN
SIGUIJ854NVALA12110022161289AN
ATOM855CAVALA1217.253−6.36433.1741.0013.91AC
ANISOU855CAVALA121181612101670−227−5538AC
SIGUIJ855CAVALA121100220100290AC
ATOM856CBVALA1218.314−5.20933.1261.0013.56AC
ANISOU856CBVALA121177011661874−183−1−1AC
SIGUIJ856CBVALA121100220100290AC
ATOM857CG1VALA1219.753−5.77332.9941.0013.96AC
ANISOU857CG1VALA121178411842409−164501AC
SIGUIJ857CG1VALA121100220100290AC
ATOM858CG2VALA1217.983−4.23932.0101.0013.81AC
ANISOU858CG2VALA121190811831879−146−13AC
SIGUIJ858CG2VALA121100220100290AC
ATOM859CVALA1217.593−7.39532.0721.0014.19AC
ANISOU859CVALA121180512411751−31416−26AC
SIGUIJ859CVALA121100220100290AC
ATOM860OVALA1218.297−8.35532.3171.0014.22AO
ANISOU860OVALA121197013321922−204−912AO
SIGUIJ860OVALA12110022154289AO
ATOM861NARGA1227.115−7.14530.8591.0015.04AN
ANISOU861NARGA122190214391781−380−3647AN
SIGUIJ861NARGA12210022161289AN
ATOM862CAARGA1227.471−7.98729.7181.0016.06AC
ANISOU862CAARGA122201515861913−47571−103AC
SIGUIJ862CAARGA122100220100290AC
ATOM863CBARGA1226.305−8.07328.7391.0017.68AC
ANISOU863CBARGA122207126351977−651624AC
SIGUIJ863CBARGA122100220100290AC
ATOM864CGARGA1226.544−9.09427.6661.0020.19AC
ANISOU864CGARGA122351227432006−3063−1AC
SIGUIJ864CGARGA122100220100290AC
ATOM865CDARGA1225.253−9.41326.8671.0022.38AC
ANISOU865CDARGA122441993972928−2250−689483AC
SIGUIJ865CDARGA12210022099290AC
ATOM866NEARGA1225.370−10.38925.7621.0024.54AN
ANISOU866NEARGA12216521100173336−1114−40252AN
SIGUIJ866NEARGA12210022161289AN
ATOM867CZARGA1225.921−11.60425.8121.0025.24AC
ANISOU867CZARGA12219802107026450339−866−27AC
SIGUIJ867CZARGA12210022099290AC
ATOM868NH1ARGA1226.484−12.07326.9311.0026.18AN
ANISOU868NH1ARGA122142761121851204121934164AN
SIGUIJ868NH1ARGA12210022161289AN
ATOM869NH2ARGA1225.850−12.38724.7281.0025.97AN
ANISOU869NH2ARGA122552010676637638043−11AN
SIGUIJ869NH2ARGA12210022161289AN
ATOM870CARGA1228.683−7.36129.0401.0015.84AC
ANISOU870CARGA122194714501847−37711−15AC
SIGUIJ870CARGA12210022099290AC
ATOM871OARGA1228.602−6.25128.4251.0015.65AO
ANISOU871OARGA122234914681918−374−3621AO
SIGUIJ871OARGA12210022154289AO
ATOM872NLEUA1239.801−8.05129.1591.0015.39AN
ANISOU872NLEUA123211918661765−11515−5AN
SIGUIJ872NLEUA12310022161289AN
ATOM873CALEUA12311.038−7.61828.5181.0015.70AC
ANISOU873CALEUA123210016631771−3416−1AC
SIGUIJ873CALEUA12310022099290AC
ATOM874CBLEUA12312.221−8.34029.1851.0015.74AC
ANISOU874CBLEUA12321961845182679−20−4AC
SIGUIJ874CBLEUA12310022099290AC
ATOM875CGLEUA12312.488−7.89130.6401.0015.65AC
ANISOU875CGLEUA123223319011819−18−30AC
SIGUIJ875CGLEUA12310022099290AC
ATOM876CD1LEUA12313.577−8.78331.2261.0016.72AC
ANISOU876CD1LEUA1233489312621161193−488−401AC
SIGUIJ876CD1LEUA12310022099290AC
ATOM877CD2LEUA12312.911−6.43730.7151.0016.26AC
ANISOU877CD2LEUA123218619022056−19−20AC
SIGUIJ877CD2LEUA12310022099290AC
ATOM878CLEUA12310.950−7.93727.0231.0016.09AC
ANISOU878CLEUA1231925161117755982AC
SIGUIJ878CLEUA12310022099290AC
ATOM879OLEUA12310.185−8.83326.5921.0016.40AO
ANISOU879OLEUA123261221831779−57496−66AO
SIGUIJ879OLEUA12310022154289AO
ATOM880NPROA12411.700−7.22026.2061.0016.35AN
ANISOU880NPROA124197816721766−4−40AN
SIGUIJ880NPROA12410022161289AN
ATOM881CDPROA12412.624−6.12826.5601.0015.91AC
ANISOU881CDPROA124203117341615−7378−16AC
SIGUIJ881CDPROA12410022099290AC
ATOM882CAPROA12411.586−7.38524.7541.0017.20AC
ANISOU882CAPROA124244316761767−42−342AC
SIGUIJ882CAPROA12410022098290AC
ATOM883CBPROA12412.208−6.09424.2051.0016.17AC
ANISOU883CBPROA124215216051773101−16−4AC
SIGUIJ883CBPROA12410022098290AC
ATOM884CGPROA12413.248−5.75025.2561.0015.99AC
ANISOU884CGPROA1242019161716418411022AC
SIGUIJ884CGPROA12410022098290AC
ATOM885CPROA12412.337−8.61824.2671.0018.28AC
ANISOU885CPROA12431631858199830019245AC
SIGUIJ885CPROA12410022098290AC
ATOM886OPROA12413.386−8.98124.8291.0018.87AO
ANISOU886OPROA124334616492602279−159−43AO
SIGUIJ886OPROA12410022154289AO
ATOM887NSERA12511.791−9.24323.2221.0019.66AN
ANISOU887NSERA125384320182171175−77−8AN
SIGUIJ887NSERA12510022161289AN
ATOM888CASERA12512.571−10.20322.4191.0020.69AC
ANISOU888CASERA125405618692511352869AC
SIGUIJ888CASERA12510022098290AC
ATOM889CBSERA12511.778−11.47622.1521.0021.47AC
ANISOU889CBSERA125581225353271−1022117−40AC
SIGUIJ889CBSERA12510022098290AC
ATOM890OGSERA12510.598−11.19321.4561.0023.27AO
ANISOU890OGSERA125625935834621−942−609247AO
SIGUIJ890OGSERA12510022154289AO
ATOM891CSERA12513.076−9.64321.0771.0020.70AC
ANISOU891CSERA125481319562566−188474−34AC
SIGUIJ891CSERA12510022098290AC
ATOM892OSERA12513.944−10.24420.4301.0021.30AO
ANISOU892OSERA125493119112914−268699−84AO
SIGUIJ892OSERA12510022154289AO
ATOM893NARGA12812.552−8.49220.6671.0020.62AN
ANISOU893NARGA128428418532191−355662−99AN
SIGUIJ893NARGA12810022161289AN
ATOM894CAARGA12813.031−7.80619.4771.0020.32AC
ANISOU894CAARGA128319417972110−112365−34AC
SIGUIJ894CAARGA12810022098290AC
ATOM895CBARGA12812.083−8.09118.3181.0021.53AC
ANISOU895CBARGA128447325862833−575−573171AC
SIGUIJ895CBARGA12810022098290AC
ATOM896CGARGA12811.995−9.58617.9931.0023.54AC
ANISOU896CGARGA1281533426293423−1034−1494123AC
SIGUIJ896CGARGA12810022098290AC
ATOM897CDARGA12810.802−9.84517.0971.0024.98AC
ANISOU897CDARGA12818087123996545−4248−41471621AC
SIGUIJ897CDARGA12810022097290AC
ATOM898NEARGA12810.637−8.68616.2291.0026.43AN
ANISOU898NEARGA12819357118683343286165251AN
SIGUIJ898NEARGA12810022161289AN
ATOM899CZARGA12811.441−8.42315.2031.0026.81AC
ANISOU899CZARGA12816526855817821274−336−33AC
SIGUIJ899CZARGA12810022097290AC
ATOM900NH1ARGA12812.441−9.26914.9651.0027.32AN
ANISOU900NH1ARGA128160547639480650843723AN
SIGUIJ900NH1ARGA12810022161289AN
ATOM901NH2ARGA12811.249−7.33814.4341.0026.86AN
ANISOU901NH2ARGA128405782291749−729−403AN
SIGUIJ901NH2ARGA12810022161289AN
ATOM902CARGA12813.053−6.30419.7471.0019.30AC
ANISOU902CARGA128269517891719−3633−1AC
SIGUIJ902CARGA12810022097290AC
ATOM903OARGA12812.416−5.83120.7081.0019.07AO
ANISOU903OARGA128289020041722150629AO
SIGUIJ903OARGA12810022154289AO
ATOM904NCYSA12913.757−5.58818.8941.0018.42AN
ANISOU904NCYSA1292557176816727−390AN
SIGUIJ904NCYSA12910022161289AN
ATOM905CACYSA12913.825−4.12418.9561.0017.61AC
ANISOU905CACYSA12922201775166523−62−3AC
SIGUIJ905CACYSA12910022097290AC
ATOM906CCYSA12912.751−3.51318.0781.0017.14AC
ANISOU906CCYSA129212819641479758828AC
SIGUIJ906CCYSA12910022097290AC
ATOM907OCYSA12912.690−3.77316.8601.0017.35AO
ANISOU907OCYSA129281422111492197163AO
SIGUIJ907OCYSA12910022154289AO
ATOM908CBCYSA12915.170−3.68418.4281.0017.49AC
ANISOU908CBCYSA12922021672177257−59−7AC
SIGUIJ908CBCYSA12910022097290AC
ATOM909SGCYSA12916.567−4.35719.3701.0017.33AS
ANISOU909SGCYSA129252722581937480−253−185AS
SIGUIJ909SGCYSA12910022148289AS
ATOM910NGLUA13011.875−2.71918.6551.0016.42AN
ANISOU910NGLUA130199119221399−622−1AN
SIGUIJ910NGLUA13010022161289AN
ATOM911CAGLUA13010.879−2.00817.8221.0016.19AC
ANISOU911CAGLUA130200019881415−1−30AC
SIGUIJ911CAGLUA13010022097290AC
ATOM912CBGLUA1309.741−1.42918.6871.0016.86AC
ANISOU912CBGLUA130220527731438392142AC
SIGUIJ912CBGLUA13010022097290AC
ATOM913CGGLUA1308.808−2.48319.3171.0019.01AC
ANISOU913CGGLUA13025573102134233−56−6AC
SIGUIJ913CGGLUA13010022097290AC
ATOM914CDGLUA1307.994−3.32818.3391.0019.91AC
ANISOU914CDGLUA130306833371719−65−404−104AC
SIGUIJ914CDGLUA13010022097290AC
ATOM915OE1GLUA1307.833−2.86517.1791.0020.94AO
ANISOU915OE1GLUA130271038031799−221−41482AO
SIGUIJ915OE1GLUA13010022154289AO
ATOM916OE2GLUA1307.530−4.43818.7431.0021.75AO
ANISOU916OE2GLUA130474037062415−733−335139AO
SIGUIJ916OE2GLUA13010022154289AO
ATOM917CGLUA13011.549−0.89017.0371.0015.24AC
ANISOU917CGLUA13019181991134810−503AC
SIGUIJ917CGLUA13010022096290AC
ATOM918OGLUA13012.429−0.22717.5551.0015.46AO
ANISOU918OGLUA1301999201015540−18411AO
SIGUIJ918OGLUA13010022154289AO
ATOM919NPROA13111.143−0.67715.7491.0014.49AN
ANISOU919NPROA13118262049132337−40AN
SIGUIJ919NPROA13110022161289AN
ATOM920CDPROA13110.218−1.51514.9661.0014.56AC
ANISOU920CDPROA131194321101393−15−84−2AC
SIGUIJ920CDPROA13110022096290AC
ATOM921CAPROA13111.8420.29414.8981.0013.90AC
ANISOU921CAPROA1311928206913411447−3AC
SIGUIJ921CAPROA13110022096290AC
ATOM922CBPROA13111.461−0.11613.4951.0014.54AC
ANISOU922CBPROA131236619511375130−87−18AC
SIGUIJ922CBPROA13110022096290AC
ATOM923CGPROA13110.119−0.72613.6641.0014.36AC
ANISOU923CGPROA13124012105137858−81−11AC
SIGUIJ923CGPROA13110022096290AC
ATOM924CPROA13111.4051.72815.1351.0013.68AC
ANISOU924CPROA1311793207512357−59−1AC
SIGUIJ924CPROA13110022096290AC
ATOM925OPROA13110.2931.97115.6041.0013.49AO
ANISOU925OPROA13117862141118517−73−7AO
SIGUIJ925OPROA13110022154289AO
ATOM926NPROA13212.2362.67814.7271.0013.65AN
ANISOU926NPROA13217612065124131−621AN
SIGUIJ926NPROA13210022161289AN
ATOM927CDPROA13213.6622.50714.3081.0013.98AC
ANISOU927CDPROA13218002434162975492AC
SIGUIJ927CDPROA13210022096290AC
ATOM928CAPROA13211.8204.05514.5861.0013.24AC
ANISOU928CAPROA1321713205413389−165−9AC
SIGUIJ928CAPROA13210022096290AC
ATOM929CBPROA13212.9754.69213.7771.0013.98AC
ANISOU929CBPROA132191022971630−11522−1AC
SIGUIJ929CBPROA13210022096290AC
ATOM930CGPROA13214.1753.85114.1831.0013.59AC
ANISOU930CGPROA132198324621533047−1AC
SIGUIJ930CGPROA13210022096290AC
ATOM931CPROA13210.4804.14913.8761.0013.22AC
ANISOU931CPROA1321672166311850−83−1AC
SIGUIJ931CPROA13210022095290AC
ATOM932OPROA13210.2023.37712.9111.0012.65AO
ANISOU932OPROA132183916751185−16−1173AO
SIGUIJ932OPROA13210022154289AO
ATOM933NGLYA1339.6495.09714.3101.0012.65AN
ANISOU933NGLYA1331647164611500−123−6AN
SIGUIJ933NGLYA13310022161289AN
ATOM934CAGLYA1338.3205.25813.7551.0012.67AC
ANISOU934CAGLYA13316491779110820−1068AC
SIGUIJ934CAGLYA13310022095290AC
ATOM935CGLYA1337.2254.58114.5471.0012.73AC
ANISOU935CGLYA133172418111198−9−33−1AC
SIGUIJ935CGLYA13310022095290AC
ATOM936OGLYA1336.0424.87714.3191.0013.38AO
ANISOU936OGLYA13317562135133480−53−1AO
SIGUIJ936OGLYA13310022154289AO
ATOM937NTHRA1347.6003.70415.4771.0013.30AN
ANISOU937NTHRA134175618201198−2−27−1AN
SIGUIJ937NTHRA13410022161289AN
ATOM938CATHRA1346.6173.03016.3011.0013.30AC
ANISOU938CATHRA1341731180612003−371AC
SIGUIJ938CATHRA13410022095290AC
ATOM939CBTHRA1347.2351.79816.9381.0013.36AC
ANISOU939CBTHRA134175917871244−6−84−12AC
SIGUIJ939CBTHRA13410022095290AC
ATOM940OG1THRA1347.7790.97015.9161.0013.52AO
ANISOU940OG1THRA134215617511418−86199−33AO
SIGUIJ940OG1THRA13410022154289AO
ATOM941CG2THRA1346.1970.98717.7181.0014.12AC
ANISOU941CG2THRA134254720221879−383580−260AC
SIGUIJ941CG2THRA13410022095290AC
ATOM942CTHRA1346.0953.99217.3941.0013.61AC
ANISOU942CTHRA134167718051200−4−46−1AC
SIGUIJ942CTHRA13410022095290AC
ATOM943OTHRA1346.8864.67818.0651.0012.95AO
ANISOU943OTHRA134169518051240−11−73−6AO
SIGUIJ943OTHRA13410022154289AO
ATOM944NTHRA1354.7764.05017.5911.0013.92AN
ANISOU944NTHRA1351678213011872−57−5AN
SIGUIJ944NTHRA13510022161289AN
ATOM945CATHRA1354.1684.73818.7361.0014.83AC
ANISOU945CATHRA135195820831256−161049AC
SIGUIJ945CATHRA13510022095290AC
ATOM946CBTHRA1352.6544.99818.4661.0015.90AC
ANISOU946CBTHRA135202636241838264−17−14AC
SIGUIJ946CBTHRA13510022095290AC
ATOM947OG1THRA1352.5105.93117.3841.0018.22AO
ANISOU947OG1THRA135317036401940−12−41338AO
SIGUIJ947OG1THRA13510022154289AO
ATOM948CG2THRA1351.9945.57319.6881.0017.09AC
ANISOU948CG2THRA1352150358518512923113AC
SIGUIJ948CG2THRA13510022095290AC
ATOM949CTHRA1354.3203.96620.0311.0014.33AC
ANISOU949CTHRA135162419741241−20052−19AC
SIGUIJ949CTHRA13510022095290AC
ATOM950OTHRA1354.1132.74620.0781.0014.51AO
ANISOU950OTHRA135261920021444−38377−31AO
SIGUIJ950OTHRA13510022154289AO
ATOM951NCYSA1364.7764.66621.0621.0013.59AN
ANISOU951NCYSA136155817731249−12−20−1AN
SIGUIJ951NCYSA13610022161289AN
ATOM952CACYSA1365.0154.06522.3781.0013.33AC
ANISOU952CACYSA13615541725123710128−5AC
SIGUIJ952CACYSA13610022094290AC
ATOM953CCYSA1364.4714.96423.4731.0012.46AC
ANISOU953CCYSA1361464160112290372AC
SIGUIJ953CCYSA13610022094290AC
ATOM954OCYSA1364.0326.09023.2091.0012.45AO
ANISOU954OCYSA13618791656133115711244AO
SIGUIJ954OCYSA13610022154289AO
ATOM955CBCYSA1366.5093.86922.5901.0014.29AC
ANISOU955CBCYSA13615732489143123300AC
SIGUIJ955CBCYSA13610022094290AC
ATOM956SGCYSA1367.3673.00021.2371.0016.81AS
ANISOU956SGCYSA13625252969155483325066AS
SIGUIJ956SGCYSA13610022148289AS
ATOM957NTHRA1374.5294.46424.7231.0011.20AN
ANISOU957NTHRA137147715531216−9181AN
SIGUIJ957NTHRA13710022161289AN
ATOM958CATHRA1374.0425.27525.8631.0011.13AC
ANISOU958CATHRA137138815661178−4−44−4AC
SIGUIJ958CATHRA13710022094290AC
ATOM959CBTHRA1372.8084.63126.4751.0011.38AC
ANISOU959CBTHRA137149218051290−12028−6AC
SIGUIJ959CBTHRA13710022094290AC
ATOM960OG1THRA1371.7724.51825.4741.0012.96AO
ANISOU960OG1THRA137169023191457−189−1489AO
SIGUIJ960OG1THRA13710022154289AO
ATOM961CG2THRA1372.2945.46027.6441.0012.06AC
ANISOU961CG2THRA137159118481280−2730AC
SIGUIJ961CG2THRA13710022094290AC
ATOM962CTHRA1375.1145.31626.9221.0010.72AC
ANISOU962CTHRA137135812881131−10−40AC
SIGUIJ962CTHRA13710022094290AC
ATOM963OTHRA1375.7014.30227.2591.0010.60AO
ANISOU963OTHRA13714391299127423−53−8AO
SIGUIJ963OTHRA13710022154289AO
ATOM964NAVALA1385.3936.50827.4260.5010.12AN
ANISOU964NAVALA1381211128110948−30AN
SIGUIJ964NAVALA13810022160289AN
ATOM965NBVALA1385.3856.51227.4280.5012.31AN
ANISOU965NBVALA138144312861103−4−401AN
SIGUIJ965NBVALA13810022160289AN
ATOM966CAAVALA1386.3246.70428.5490.5010.10AC
ANISOU966CAAVALA138118212541073690AC
SIGUIJ966CAAVALA13810022094290AC
ATOM967CABVALA1386.3126.71628.5510.5012.29AC
ANISOU967CABVALA13815311444115715−118−14AC
SIGUIJ967CABVALA13810022094290AC
ATOM968CBAVALA1387.5087.65528.1650.5010.53AC
ANISOU968CBAVALA1381183124395710−161AC
SIGUIJ968CBAVALA13810022094290AC
ATOM969CBBVALA1387.3867.75228.2180.5012.72AC
ANISOU969CBBVALA138160614891617−1100AC
SIGUIJ969CBBVALA13810022094290AC
ATOM970CG1AVALA1387.0159.02827.7400.5012.13AC
ANISOU970CG1AVALA1388421196916−110−4−3AC
SIGUIJ970CG1AVALA13810022093290AC
ATOM971CG1BVALA1388.4027.84929.3530.5014.32AC
ANISOU971CG1BVALA138161019331620−5100AC
SIGUIJ971CG1BVALA13810022093290AC
ATOM972CG2AVALA1388.4907.74629.3290.5011.37AC
ANISOU972CG2AVALA13811721688941−4750AC
SIGUIJ972CG2AVALA13810022093290AC
ATOM973CG2BVALA1388.0737.36526.9630.5013.56AC
ANISOU973CG2BVALA138162616321622100AC
SIGUIJ973CG2BVALA13810022093290AC
ATOM974CAVALA1385.5317.20629.7430.509.50AC
ANISOU974CAVALA138113612161080−760AC
SIGUIJ974CAVALA13810022093290AC
ATOM975CBVALA1385.5077.18329.7460.5011.69AC
ANISOU975CBVALA138147712101138−57−11721AC
SIGUIJ975CBVALA13810022093290AC
ATOM976OAVALA1384.5787.98329.5890.509.79AO
ANISOU976OAVALA13811511246152411−363AO
SIGUIJ976OAVALA13810022154289AO
ATOM977OBVALA1384.5277.92729.6000.5011.98AO
ANISOU977OBVALA13815491334100240−111−13AO
SIGUIJ977OBVALA13810022154289AO
ATOM978NSERA1395.9376.74230.9281.009.56AN
ANISOU978NSERA139129112211099−1−380AN
SIGUIJ978NSERA13910022160289AN
ATOM979CASERA1395.1707.00532.1311.009.54AC
ANISOU979CASERA1391324123711188−24−2AC
SIGUIJ979CASERA13910022093290AC
ATOM980CBSERA1394.2695.81232.4611.0010.03AC
ANISOU980CBSERA139140112701287−3410−3AC
SIGUIJ980CBSERA13910022093290AC
ATOM981OGSERA1395.0034.61732.4811.0011.51AO
ANISOU981OGSERA139145912921644−1331AO
SIGUIJ981OGSERA13910022154289AO
ATOM982CSERA1396.0787.35433.2971.009.22AC
ANISOU982CSERA13912531054108766238AC
SIGUIJ982CSERA13910022093290AC
ATOM983OSERA1397.2246.86733.3921.009.85AO
ANISOU983OSERA13912811163130711704AO
SIGUIJ983OSERA13910022154289AO
ATOM984NGLYA1405.5728.18534.2071.009.08AN
ANISOU984NGLYA140111910291087−4−20AN
SIGUIJ984NGLYA14010022160289AN
ATOM985CAGLYA1406.3808.52235.3571.008.65AC
ANISOU985CAGLYA140109510331083−210AC
SIGUIJ985CAGLYA14010022093290AC
ATOM986CGLYA1405.6659.49436.2681.008.84AC
ANISOU986CGLYA1401080101210761300AC
SIGUIJ986CGLYA14010022093290AC
ATOM987OGLYA1404.63110.08335.9121.009.20AO
ANISOU987OGLYA14011541180110013202AO
SIGUIJ987OGLYA14010022154289AO
ATOM988NTRPA1416.2989.71337.4161.008.37AN
ANISOU988NTRPA14110689981071100AN
SIGUIJ988NTRPA14110022160289AN
ATOM989CATRPA1415.86110.71138.4191.008.42AC
ANISOU989CATRPA1411159102810853921AC
SIGUIJ989CATRPA14110022092290AC
ATOM990CBTRPA1415.86310.07139.8211.008.68AC
ANISOU990CBTRPA141123510711094−6−191AC
SIGUIJ990CBTRPA14110022092290AC
ATOM991CGTRPA1414.8159.03740.0461.009.31AC
ANISOU991CGTRPA141125910931260−2300AC
SIGUIJ991CGTRPA14110022092290AC
ATOM992CD2TRPA1414.9737.59940.0331.009.94AC
ANISOU992CD2TRPA141140010921238−27−192AC
SIGUIJ992CD2TRPA14110022092290AC
ATOM993CE2TRPA1413.7217.03640.4311.0010.38AC
ANISOU993CE2TRPA141145412931265−130−32AC
SIGUIJ993CE2TRPA14110022092290AC
ATOM994CE3TRPA1416.0416.72939.7211.0010.05AC
ANISOU994CE3TRPA14114501194114655−80−15AC
SIGUIJ994CE3TRPA14110022092290AC
ATOM995CD1TRPA1413.5279.25240.4281.0010.23AC
ANISOU995CD1TRPA141125512661297−1−20AC
SIGUIJ995CD1TRPA14110022092290AC
ATOM996NE1TRPA1412.8518.07140.6721.0010.13AN
ANISOU996NE1TRPA141145813201352−12221−17AN
SIGUIJ996NE1TRPA14110022160289AN
ATOM997CZ2TRPA1413.5295.64340.5191.0010.92AC
ANISOU997CZ2TRPA141191312991413−192−11938AC
SIGUIJ997CZ2TRPA14110022092290AC
ATOM998CZ3TRPA1415.8115.34839.8101.0010.75AC
ANISOU998CZ3TRPA141192812081483−30−1308AC
SIGUIJ998CZ3TRPA14110022092290AC
ATOM999CH2TRPA1414.5614.85040.2071.0011.25AC
ANISOU999CH2TRPA141196913951465−113−12625AC
SIGUIJ999CH2TRPA14110022092290AC
ATOM1000CTRPA1416.77511.90738.4301.009.04AC
ANISOU1000CTRPA14111421016128154−40AC
SIGUIJ1000CTRPA14110022092290AC
ATOM1001OTRPA1416.70812.69439.4161.009.10AO
ANISOU1001OTRPA141142410751289135−48−30AO
SIGUIJ1001OTRPA14110022154289AO
ATOM1002NGLYA1427.58212.10337.3871.008.85AN
ANISOU1002NGLYA1421106950127030−28−1AN
SIGUIJ1002NGLYA14210022160289AN
ATOM1003CAGLYA1428.43813.27337.3081.009.39AC
ANISOU1003CAGLYA142113097114907−140AC
SIGUIJ1003CAGLYA14210022092290AC
ATOM1004CGLYA1427.62414.56737.1821.009.80AC
ANISOU1004CGLYA142113998812621540AC
SIGUIJ1004CGLYA14210022091290AC
ATOM1005OGLYA1426.42514.60937.0011.009.72AO
ANISOU1005OGLYA1421138109312914−60AO
SIGUIJ1005OGLYA14210022154289AO
ATOM1006NTHRA1438.36815.66937.1651.009.84AN
ANISOU1006NTHRA1431165993146211170AN
SIGUIJ1006NTHRA14310022160289AN
ATOM1007CATHRA1437.69916.96937.0951.0010.27AC
ANISOU1007CATHRA143125810181345543−1AC
SIGUIJ1007CATHRA14310022091290AC
ATOM1008CBTHRA1438.74618.08437.2311.0010.32AC
ANISOU1008CBTHRA14312049701652102−170AC
SIGUIJ1008CBTHRA14310022091290AC
ATOM1009OG1THRA1438.06319.35837.2591.009.98AO
ANISOU1009OG1THRA143132910051727174−101AO
SIGUIJ1009OG1THRA14310022154289AO
ATOM1010CG2THRA1439.81418.07736.1021.0011.20AC
ANISOU1010CG2THRA143155614741984−12329−83AC
SIGUIJ1010CG2THRA14310022091290AC
ATOM1011CTHRA1436.90717.09135.7961.009.85AC
ANISOU1011CTHRA14312611021134016−30AC
SIGUIJ1011CTHRA14310022091290AC
ATOM1012OTHRA1437.31916.58734.7231.0010.01AO
ANISOU1012OTHRA1431366105113356422AO
SIGUIJ1012OTHRA14310022154289AO
ATOM1013NTHRA1445.79117.82535.9141.0010.36AN
ANISOU1013NTHRA144123810021364−1060AN
SIGUIJ1013NTHRA14410022160289AN
ATOM1014CATHRA1444.94518.14734.7751.0010.86AC
ANISOU1014CATHRA14412871167139023−211AC
SIGUIJ1014CATHRA14410022091290AC
ATOM1015CBTHRA1443.45417.99335.1451.0010.86AC
ANISOU1015CBTHRA1441301128015052140AC
SIGUIJ1015CBTHRA14410022091290AC
ATOM1016OG1THRA1443.19418.89536.2451.0011.34AO
ANISOU1016OG1THRA1441482131814931120−2AO
SIGUIJ1016OG1THRA14410022154289AO
ATOM1017CG2THRA1443.17116.58235.5801.0011.09AC
ANISOU1017CG2THRA144145812891506−2920AC
SIGUIJ1017CG2THRA14410022091290AC
ATOM1018CTHRA1445.18319.52434.2441.0011.05AC
ANISOU1018CTHRA14413151164143314−20AC
SIGUIJ1018CTHRA14410022091290AC
ATOM1019OTHRA1444.54519.93133.2721.0011.42AO
ANISOU1019OTHRA144168112581494202−153−83AO
SIGUIJ1019OTHRA14410022154289AO
ATOM1020NTHRA1456.05220.27934.9041.0011.43AN
ANISOU1020NTHRA1451298110314713010AN
SIGUIJ1020NTHRA14510022160289AN
ATOM1021CATHRA1456.40521.64034.5241.0012.02AC
ANISOU1021CATHRA145164311281554−733−1AC
SIGUIJ1021CATHRA14510022091290AC
ATOM1022CBTHRA1455.84022.67635.5331.0011.75AC
ANISOU1022CBTHRA1451687117715830−10AC
SIGUIJ1022CBTHRA14510022091290AC
ATOM1023OG1THRA1456.30122.37236.8511.0012.15AO
ANISOU1023OG1THRA14516581383159411922AO
SIGUIJ1023OG1THRA14510022154289AO
ATOM1024CG2THRA1454.31622.69435.4801.0012.43AC
ANISOU1024CG2THRA14516861575212114−22−1AC
SIGUIJ1024CG2THRA14510022091290AC
ATOM1025CTHRA1457.91521.77734.4991.0013.22AC
ANISOU1025CTHRA145165111481958−98352AC
SIGUIJ1025CTHRA14510022090290AC
ATOM1026OTHRA1458.64021.00135.1081.0012.96AO
ANISOU1026OTHRA1451572127916983931239AO
SIGUIJ1026OTHRA14510022154289AO
ATOM1027NSERA1468.39622.80533.7891.0014.32AN
ANISOU1027NSERA146208112401923−31613−12AN
SIGUIJ1027NSERA14610022160289AN
ATOM1028CASERA1469.82723.07833.7781.0015.69AC
ANISOU1028CASERA146207713692390−354295AC
SIGUIJ1028CASERA14610022090290AC
ATOM1029CBSERA14610.53122.07432.8281.0015.13AC
ANISOU1029CBSERA146195514142348−341−53−21AC
SIGUIJ1029CBSERA14610022090290AC
ATOM1030OGSERA14611.94722.13632.9481.0015.26AO
ANISOU1030OGSERA146194714941868−352−1015AO
SIGUIJ1030OGSERA14610022154289AO
ATOM1031CSERA14610.01624.52933.2961.0016.96AC
ANISOU1031CSERA146227013852791−31727489AC
SIGUIJ1031CSERA14610022090290AC
ATOM1032OSERA1469.31724.94332.4021.0017.83AO
ANISOU1032OSERA14628351765296626−71AO
SIGUIJ1032OSERA14610022154289AO
ATOM1033NPROA14710.98425.28133.8881.0018.13AN
ANISOU1033NPROA147261417233238−5794825AN
SIGUIJ1033NPROA14710022160289AN
ATOM1034CDPROA14711.20326.69533.4771.0018.57AC
ANISOU1034CDPROA147332117583547−69435114AC
SIGUIJ1034CDPROA14710022090290AC
ATOM1035CAPROA14711.93524.86534.9191.0018.91AC
ANISOU1035CAPROA147236616353105−710235100AC
SIGUIJ1035CAPROA14710022090290AC
ATOM1036CBPROA14713.03825.94134.8601.0018.92AC
ANISOU1036CBPROA147274620353761−1103220172AC
SIGUIJ1036CBPROA14710022090290AC
ATOM1037CGPROA14712.24727.12034.4491.0019.82AC
ANISOU1037CGPROA147338622063649−752−3−16AC
SIGUIJ1037CGPROA14710022090290AC
ATOM1038CPROA14711.38424.71436.3291.0019.36AC
ANISOU1038CPROA147228118413094−744184101AC
SIGUIJ1038CPROA14710022090290AC
ATOM1039OPROA14712.02724.08837.1511.0020.21AO
ANISOU1039OPROA147318924353163−541−1AO
SIGUIJ1039OPROA14710022154289AO
ATOM1040NASPA14810.19925.27336.5931.0019.73AN
ANISOU1040NASPA148248428862571−25145AN
SIGUIJ1040NASPA14810022160289AN
ATOM1041CAASPA1489.53825.13437.8861.0019.78AC
ANISOU1041CAASPA148241821102565−14−60AC
SIGUIJ1041CAASPA14810022090290AC
ATOM1042CBASPA1488.23425.93737.9381.0021.32AC
ANISOU1042CBASPA148248022803978855510AC
SIGUIJ1042CBASPA14810022090290AC
ATOM1043CGASPA1488.45727.41438.1121.0022.69AC
ANISOU1043CGASPA148380023144254−11330AC
SIGUIJ1043CGASPA14810022090290AC
ATOM1044OD1ASPA1489.58727.82838.3791.0024.07AO
ANISOU1044OD1ASPA148394828975492−327−284−8AO
SIGUIJ1044OD1ASPA14810022154289AO
ATOM1045OD2ASPA1487.48328.18837.9671.0024.12AO
ANISOU1045OD2ASPA1484594322611473650−1275−255AO
SIGUIJ1045OD2ASPA14810022154289AO
ATOM1046CASPA1489.20623.66138.0781.0018.72AC
ANISOU1046CASPA148159920682271180104−31AC
SIGUIJ1046CASPA14810022089290AC
ATOM1047OASPA1488.79822.98637.1141.0018.78AO
ANISOU1047OASPA148209621872285−13212AO
SIGUIJ1047OASPA14810022154289AO
ATOM1048NVALA1499.47723.11839.2601.0017.60AN
ANISOU1048NVALA149168519072307−149−66−24AN
SIGUIJ1048NVALA14910022160289AN
ATOM1049CAVALA1499.11721.72339.4751.0016.98AC
ANISOU1049CAVALA149151918862609−52235−23AC
SIGUIJ1049CAVALA14910022089290AC
ATOM1050CBVALA14910.22320.90940.2211.0018.14AC
ANISOU1050CBVALA149236130663460690−224136AC
SIGUIJ1050CBVALA14910022089290AC
ATOM1051CG1VALA14911.60721.41539.7801.0019.42AC
ANISOU1051CG1VALA149278440895840250613−77AC
SIGUIJ1051CG1VALA14910022089290AC
ATOM1052CG2VALA14910.15721.07141.6551.0018.89AC
ANISOU1052CG2VALA149241041723483−116−129−11AC
SIGUIJ1052CG2VALA14910022089290AC
ATOM1053CVALA1497.74721.54840.1521.0015.68AC
ANISOU1053CVALA149135316011887−25−116−11AC
SIGUIJ1053CVALA14910022089290AC
ATOM1054OVALA1497.38622.23541.1251.0015.49AO
ANISOU1054OVALA149180016361937718−1AO
SIGUIJ1054OVALA14910022154289AO
ATOM1055NTHRA1506.96120.63939.5771.0014.24AN
ANISOU1055NTHRA150120115601574−12943AN
SIGUIJ1055NTHRA15010022160289AN
ATOM1056CATHRA1505.61320.33640.0831.0013.97AC
ANISOU1056CATHRA150120314191588992−3AC
SIGUIJ1056CATHRA15010022089290AC
ATOM1057CBTHRA1504.52521.01539.2331.0013.75AC
ANISOU1057CBTHRA15013821432189216−12525AC
SIGUIJ1057CBTHRA15010022089290AC
ATOM1058OG1THRA1504.80922.40239.1361.0013.44AO
ANISOU1058OG1THRA1501530143217793220AO
SIGUIJ1058OG1THRA15010022154289AO
ATOM1059CG2THRA1503.15620.86639.8711.0014.02AC
ANISOU1059CG2THRA150150021532403−7611611AC
SIGUIJ1059CG2THRA15010022089290AC
ATOM1060CTHRA1505.46618.80739.9471.0013.95AC
ANISOU1060CTHRA150139614211565−4262AC
SIGUIJ1060CTHRA15010022089290AC
ATOM1061OTHRA1505.42518.25338.8191.0013.25AO
ANISOU1061OTHRA1501375143915532220AO
SIGUIJ1061OTHRA15010022154289AO
ATOM1062NPHEA1515.43818.12341.0691.0014.35AN
ANISOU1062NPHEA151237614021568−8518−2AN
SIGUIJ1062NPHEA15110022160289AN
ATOM1063CAPHEA1515.47916.63541.0881.0014.74AC
ANISOU1063CAPHEA151210414021576−90106−15AC
SIGUIJ1063CAPHEA15110022089290AC
ATOM1064CBPHEA1516.44816.16842.1841.0015.42AC
ANISOU1064CBPHEA151253519671768224−141−45AC
SIGUIJ1064CBPHEA15110022089290AC
ATOM1065CGPHEA1517.87616.30241.8221.0016.52AC
ANISOU1065CGPHEA15125751771239825297AC
SIGUIJ1065CGPHEA15110022089290AC
ATOM1066CD1PHEA1518.71517.16442.5371.0017.26AC
ANISOU1066CD1PHEA151379828602442−887−5434AC
SIGUIJ1066CD1PHEA15110022088290AC
ATOM1067CD2PHEA1518.42115.59140.8041.0016.32AC
ANISOU1067CD2PHEA15122201574239318−231AC
SIGUIJ1067CD2PHEA15110022088290AC
ATOM1068CE1PHEA15110.04617.27242.2121.0017.77AC
ANISOU1068CE1PHEA151381431632595−917−43AC
SIGUIJ1068CE1PHEA15110022088290AC
ATOM1069CE2PHEA1519.75615.70840.4671.0016.62AC
ANISOU1069CE2PHEA1512235161526667320AC
SIGUIJ1069CE2PHEA15110022088290AC
ATOM1070CZPHEA15110.58716.55941.1831.0017.51AC
ANISOU1070CZPHEA151351930532754−1333125−143AC
SIGUIJ1070CZPHEA15110022088290AC
ATOM1071CPHEA1514.08416.08341.3171.0014.71AC
ANISOU1071CPHEA151213816511557−198138−47AC
SIGUIJ1071CPHEA15110022088290AC
ATOM1072OPHEA1513.49516.30742.3801.0014.96AO
ANISOU1072OPHEA151240618321649−231303−94AO
SIGUIJ1072OPHEA15110022154289AO
ATOM1073NPROA1523.49715.38540.3401.0014.27AN
ANISOU1073NPROA152187613071561787712AN
SIGUIJ1073NPROA15210022160289AN
ATOM1074CDPROA1524.17714.88839.1191.0013.63AC
ANISOU1074CDPROA152170413351524105−2−1AC
SIGUIJ1074CDPROA15210022088290AC
ATOM1075CAPROA1522.16814.84340.4781.0014.57AC
ANISOU1075CAPROA152191215811682−2348−4AC
SIGUIJ1075CAPROA15210022088290AC
ATOM1076CBPROA1521.83414.42039.0501.0013.80AC
ANISOU1076CBPROA152173414701696164−4−6AC
SIGUIJ1076CBPROA15210022088290AC
ATOM1077CGPROA1523.20713.88438.5611.0013.60AC
ANISOU1077CGPROA152170913421615106−9−6AC
SIGUIJ1077CGPROA15210022088290AC
ATOM1078CPROA1522.09413.62341.4161.0014.68AC
ANISOU1078CPROA152193815821662−2850AC
SIGUIJ1078CPROA15210022088290AC
ATOM1079OPROA1523.01412.75941.3871.0014.95AO
ANISOU1079OPROA15220521731196311286AO
SIGUIJ1079OPROA15210022154289AO
ATOM1080NASERA1531.03713.45242.1770.5014.75AN
ANISOU1080NASERA15319411271166236172AN
SIGUIJ1080NASERA15310022160289AN
ATOM1081NBSERA1531.02713.44942.1650.5016.94AN
ANISOU1081NBSERA153196616861691−3228−3AN
SIGUIJ1081NBSERA15310022160289AN
ATOM1082CAASERA1530.89512.19442.9060.5015.25AC
ANISOU1082CAASERA15319241273163127252AC
SIGUIJ1082CAASERA15310022088290AC
ATOM1083CABSERA1530.87412.19442.9010.5017.44AC
ANISOU1083CABSERA153266616971679−10053−5AC
SIGUIJ1083CABSERA15310022088290AC
ATOM1084CBASERA153−0.13112.36444.0380.5015.90AC
ANISOU1084CBASERA1531966158116401045014AC
SIGUIJ1084CBASERA15310022088290AC
ATOM1085CBBSERA153−0.20312.34743.9700.5018.09AC
ANISOU1085CBBSERA153332723682346−33714−24AC
SIGUIJ1085CBBSERA15310022087290AC
ATOM1086OGASERA1530.27413.37544.9620.5017.70AO
ANISOU1086OGASERA153244917071640−138105−18AO
SIGUIJ1086OGASERA15310022154289AO
ATOM1087OGBSERA153−1.39312.81943.3780.5019.89AO
ANISOU1087OGBSERA153369224883783170AO
SIGUIJ1087OGBSERA15310022154289AO
ATOM1088CASERA1530.49111.03142.0010.5014.78AC
ANISOU1088CASERA153208313341618−109123−22AC
SIGUIJ1088CASERA15310022087290AC
ATOM1089CBSERA1530.49811.03341.9950.5016.97AC
ANISOU1089CBSERA153211716501628211336AC
SIGUIJ1089CBSERA15310022087290AC
ATOM1090OASERA1530.8219.87842.2970.5014.89AO
ANISOU1090OASERA1532390139215066444427AO
SIGUIJ1090OASERA15310022154289AO
ATOM1091OBSERA1530.8379.88342.2900.5017.08AO
ANISOU1091OBSERA153207716311788−1854−3AO
SIGUIJ1091OBSERA15310022154289AO
ATOM1092NASPA154−0.21511.32940.9131.0014.61AN
ANISOU1092NASPA154186716021507−21292−15AN
SIGUIJ1092NASPA15410022160289AN
ATOM1093CAASPA154−0.71610.25940.0731.0014.15AC
ANISOU1093CAASPA15418291493150612911139AC
SIGUIJ1093CAASPA15410022087290AC
ATOM1094CBASPA154−2.13310.54739.6061.0016.72AC
ANISOU1094CBASPA154203925603065290−403134AC
SIGUIJ1094CBASPA15410022087290AC
ATOM1095CGASPA154−3.14910.21240.6981.0018.51AC
ANISOU1095CGASPA154309238653820−195421100AC
SIGUIJ1095CGASPA15410022087290AC
ATOM1096OD1ASPA154−2.7369.96441.8551.0020.68AO
ANISOU1096OD1ASPA1545297768839452014103129AO
SIGUIJ1096OD1ASPA15410022154289AO
ATOM1097OD2ASPA154−4.29210.17740.3921.0020.27AO
ANISOU1097OD2ASPA154312634684265−18029683AO
SIGUIJ1097OD2ASPA15410022154289AO
ATOM1098CASPA1540.21710.03538.9161.0013.00AC
ANISOU1098CASPA15416191251139654−30−6AC
SIGUIJ1098CASPA15410022087290AC
ATOM1099OASPA1540.73210.98738.3171.0013.08AO
ANISOU1099OASPA15417251288148335253AO
SIGUIJ1099OASPA15410022153289AO
ATOM1100NLEUA1550.4318.75038.5911.0011.46AN
ANISOU1100NLEUA155126812291300−210AN
SIGUIJ1100NLEUA15510022160289AN
ATOM1101CALEUA1551.3338.39637.4821.0010.69AC
ANISOU1101CALEUA155127811731299900AC
SIGUIJ1101CALEUA15510022087290AC
ATOM1102CBLEUA1551.3236.88637.3541.0010.62AC
ANISOU1102CBLEUA1551357117014761330AC
SIGUIJ1102CBLEUA15510022087290AC
ATOM1103CGLEUA1552.3216.29436.3411.0010.20AC
ANISOU1103CGLEUA15513691216146842−10AC
SIGUIJ1103CGLEUA15510022087290AC
ATOM1104CD1LEUA1553.7666.51836.7951.0010.47AC
ANISOU1104CD1LEUA155136814301437330AC
SIGUIJ1104CD1LEUA15510022087290AC
ATOM1105CD2LEUA1552.0444.77836.1951.0010.77AC
ANISOU1105CD2LEUA1551559121916411300AC
SIGUIJ1105CD2LEUA15510022087290AC
ATOM1106CLEUA1550.8119.02236.1891.0010.49AC
ANISOU1106CLEUA155124511641304−1060AC
SIGUIJ1106CLEUA15510022087290AC
ATOM1107OLEUA155−0.3718.88235.8381.0011.28AO
ANISOU1107OLEUA155125815191419−58−15−4AO
SIGUIJ1107OLEUA15510022153289AO
ATOM1108NMETA1561.6909.65535.4331.009.99AN
ANISOU1108NMETA1561204108212734610AN
SIGUIJ1108NMETA15610022160289AN
ATOM1109CAMETA1561.32610.32334.1951.0010.37AC
ANISOU1109CAMETA1561254110212701100AC
SIGUIJ1109CAMETA15610022086290AC
ATOM1110CBMETA1561.87511.74134.1431.0010.66AC
ANISOU1110CBMETA15612411089135818150AC
SIGUIJ1110CBMETA15610022086290AC
ATOM1111CGMETA1561.42212.56935.3061.0010.75AC
ANISOU1111CGMETA1561467112913541721916AC
SIGUIJ1111CGMETA15610022086290AC
ATOM1112SDMETA156−0.36712.91335.2571.0011.95AS
ANISOU1112SDMETA15614751478171624847−47AS
SIGUIJ1112SDMETA15610022148289AS
ATOM1113CEMETA156−0.40414.36234.1451.0012.88AC
ANISOU1113CEMETA15621451524179223163AC
SIGUIJ1113CEMETA15610022086290AC
ATOM1114CMETA1561.9269.53533.0031.0010.18AC
ANISOU1114CMETA156122911161253−400AC
SIGUIJ1114CMETA15610022086290AC
ATOM1115OMETA1562.9748.86233.1161.009.91AO
ANISOU1115OMETA15612471152135013−130AO
SIGUIJ1115OMETA15610022153289AO
ATOM1116NCYSA1571.2419.62131.8621.0011.22AN
ANISOU1116NCYSA1571250148312431122−8AN
SIGUIJ1116NCYSA15710022160289AN
ATOM1117CACYSA1571.5158.88030.6261.0012.15AC
ANISOU1117CACYSA15722561482123627514944AC
SIGUIJ1117CACYSA15710022086290AC
ATOM1118CCYSA1571.5249.86029.4481.0011.80AC
ANISOU1118CCYSA15712921434119650−9−1AC
SIGUIJ1118CCYSA15710022086290AC
ATOM1119OCYSA1570.67510.78229.3981.0011.77AO
ANISOU1119OCYSA157141615401417181−1023AO
SIGUIJ1119OCYSA15710022153289AO
ATOM1120CBCYSA1570.3567.83430.3501.0013.74AC
ANISOU1120CBCYSA15725081751174847473AC
SIGUIJ1120CBCYSA15710022086290AC
ATOM1121SGCYSA1570.6736.23331.1561.0016.07AS
ANISOU1121SGCYSA157221117531968−138−18162AS
SIGUIJ1121SGCYSA15710022148289AS
ATOM1122NVALA1582.4159.64228.4831.0011.72AN
ANISOU1122NVALA1581299137811825−80AN
SIGUIJ1122NVALA15810022160289AN
ATOM1123CAVALA1582.29310.36327.2431.0012.28AC
ANISOU1123CAVALA158170514081171110185AC
SIGUIJ1123CAVALA15810022086290AC
ATOM1124CBVALA1583.13611.68427.2781.0013.24AC
ANISOU1124CBVALA158195915161902−48−10AC
SIGUIJ1124CBVALA15810022086290AC
ATOM1125CG1VALA1584.60811.41827.2961.0013.74AC
ANISOU1125CG1VALA158195715691947−4400AC
SIGUIJ1125CG1VALA15810022086290AC
ATOM1126CG2VALA1582.74512.64726.1781.0014.77AC
ANISOU1126CG2VALA158456816911967560−391−77AC
SIGUIJ1126CG2VALA15810022086290AC
ATOM1127CVALA1582.7519.42526.1281.0012.41AC
ANISOU1127CVALA158143013501159−175−1AC
SIGUIJ1127CVALA15810022086290AC
ATOM1128OVALA1583.6528.60026.2721.0012.16AO
ANISOU1128OVALA15815021396135835−88−21AO
SIGUIJ1128OVALA15810022153289AO
ATOM1129NASPA1592.0869.57824.9651.0012.76AN
ANISOU1129NASPA15915841656119820−7713AN
SIGUIJ1129NASPA15910022160289AN
ATOM1130CAASPA1592.4978.81123.7771.0013.37AC
ANISOU1130CAASPA159159816731204−8−52−2AC
SIGUIJ1130CAASPA15910022086290AC
ATOM1131CBASPA1591.2678.42022.9271.0014.74AC
ANISOU1131CBASPA159185724221533−246−30142AC
SIGUIJ1131CBASPA15910022086290AC
ATOM1132CGASPA1590.4937.28623.5481.0016.02AC
ANISOU1132CGASPA159200723371862−16034−15AC
SIGUIJ1132CGASPA15910022085290AC
ATOM1133OD1ASPA1590.7196.89324.7171.0016.45AO
ANISOU1133OD1ASPA159221524641870−62170AO
SIGUIJ1133OD1ASPA15910022153289AO
ATOM1134OD2ASPA159−0.3516.71922.8341.0018.29AO
ANISOU1134OD2ASPA159507445322734−2701−15691271AO
SIGUIJ1134OD2ASPA15910022153289AO
ATOM1135CASPA1593.4939.56722.9051.0013.43AC
ANISOU1135CASPA1591654162912843362AC
SIGUIJ1135CASPA15910022085290AC
ATOM1136OASPA1593.30310.75922.6271.0013.53AO
ANISOU1136OASPA15919651636136527−70−4AO
SIGUIJ1136OASPA15910022153289AO
ATOM1137NVALA1604.5338.86022.4681.0013.40AN
ANISOU1137NVALA1601625161411690160AN
SIGUIJ1137NVALA16010022160289AN
ATOM1138CAVALA1605.5769.46021.6701.0013.93AC
ANISOU1138CAVALA160168816061314713110AC
SIGUIJ1138CAVALA16010022085290AC
ATOM1139CBVALA1606.7929.84922.5691.0013.94AC
ANISOU1139CBVALA160183619451543−94−38−4AC
SIGUIJ1139CBVALA16010022085290AC
ATOM1140CG1VALA1606.46211.11923.4111.0014.40AC
ANISOU1140CG1VALA160235120111859−197319−127AC
SIGUIJ1140CG1VALA16010022085290AC
ATOM1141CG2VALA1607.1888.69523.4991.0014.36AC
ANISOU1141CG2VALA160223519841618−33−13913AC
SIGUIJ1141CG2VALA16010022085290AC
ATOM1142CVALA1606.0398.42220.6631.0014.44AC
ANISOU1142CVALA160188616371361−2225−19AC
SIGUIJ1142CVALA16010022085290AC
ATOM1143OVALA1605.8437.19920.8541.0014.89AO
ANISOU1143OVALA160276316351732−86614−37AO
SIGUIJ1143OVALA16010022153289AO
ATOM1144NALYSA1616.7098.88019.6160.5014.82AN
ANISOU1144NALYSA161172119231271−115778AN
SIGUIJ1144NALYSA16110022160289AN
ATOM1145NBLYSA1616.7398.89119.6390.5017.01AN
ANISOU1145NBLYSA161167819441216−153150AN
SIGUIJ1145NBLYSA16110022160289AN
ATOM1146CAALYSA1617.1407.98918.5530.5015.17AC
ANISOU1146CAALYSA161180720021245137−1AC
SIGUIJ1146CAALYSA16110022085290AC
ATOM1147CABLYSA1617.1678.04418.5380.5017.36AC
ANISOU1147CABLYSA16118662045119122−241AC
SIGUIJ1147CABLYSA16110022085290AC
ATOM1148CBALYSA1616.7498.60017.1940.5016.95AC
ANISOU1148CBALYSA161206020581278−5−7921AC
SIGUIJ1148CBALYSA16110022085290AC
ATOM1149CBBLYSA1616.8268.76417.2230.5019.14AC
ANISOU1149CBBLYSA161383820631294108−494−25AC
SIGUIJ1149CBBLYSA16110022085290AC
ATOM1150CGALYSA1615.4378.04316.5450.5019.34AC
ANISOU1150CGALYSA161291551311914−1480−539360AC
SIGUIJ1150CGALYSA16110022085290AC
ATOM1151CGBLYSA1617.1177.96515.9510.5021.53AC
ANISOU1151CGBLYSA161354717851294−348−27647AC
SIGUIJ1151CGBLYSA16110022085290AC
ATOM1152CDALYSA1615.3328.48815.0630.5020.76AC
ANISOU1152CDALYSA16143664204177234−188−25AC
SIGUIJ1152CDALYSA16110022085290AC
ATOM1153CDBLYSA1616.5938.70914.7200.5022.95AC
ANISOU1153CDBLYSA161427522161181430−112−19AC
SIGUIJ1153CDBLYSA16110022085290AC
ATOM1154CEALYSA1615.7169.96614.9010.5022.03AC
ANISOU1154CEALYSA161818444183039−842864−158AC
SIGUIJ1154CEALYSA16110022084290AC
ATOM1155CEBLYSA1617.24510.08514.6060.5024.22AC
ANISOU1155CEBLYSA16145382268201131600AC
SIGUIJ1155CEBLYSA16110022084290AC
ATOM1156NZALYSA1615.63310.48013.4920.5023.07AN
ANISOU1156NZALYSA161980253233110434123398AN
SIGUIJ1156NZALYSA16110022160289AN
ATOM1157NZBLYSA1617.09310.74713.2850.5025.26AN
ANISOU1157NZBLYSA1613509220020088560AN
SIGUIJ1157NZBLYSA16110022160289AN
ATOM1158CALYSA1618.6527.77118.6180.5014.88AC
ANISOU1158CALYSA161180318931418−6150AC
SIGUIJ1158CALYSA16110022084290AC
ATOM1159CBLYSA1618.6727.78018.6170.5017.07AC
ANISOU1159CBLYSA1611857189513571−250AC
SIGUIJ1159CBLYSA16110022084290AC
ATOM1160OALYSA1619.4078.73018.9070.5014.76AO
ANISOU1160OALYSA161181918971528−9−26−1AO
SIGUIJ1160OALYSA16110022153289AO
ATOM1161OBLYSA1619.4448.71618.9090.5016.95AO
ANISOU1161OBLYSA161187119041438−5−48−4AO
SIGUIJ1161OBLYSA16110022153289AO
ATOM1162NLEUA1629.1116.53918.3671.0014.53AN
ANISOU1162NLEUA162163718831170−41−184−22AN
SIGUIJ1162NLEUA16210022160289AN
ATOM1163CALEUA16210.5406.24518.4231.0014.97AC
ANISOU1163CALEUA162164119371336−28−196−30AC
SIGUIJ1163CALEUA16210022084290AC
ATOM1164CBLEUA16210.7974.76518.2711.0015.03AC
ANISOU1164CBLEUA16220061945133130−92−19AC
SIGUIJ1164CBLEUA16210022084290AC
ATOM1165CGLEUA16210.2403.91519.3801.0015.42AC
ANISOU1165CGLEUA162241620211397−6836−4AC
SIGUIJ1165CGLEUA16210022084290AC
ATOM1166CD1LEUA16210.7162.47719.1811.0015.74AC
ANISOU1166CD1LEUA162255220291560−38114−6AC
SIGUIJ1166CD1LEUA16210022084290AC
ATOM1167CD2LEUA16210.6934.41620.7551.0015.28AC
ANISOU1167CD2LEUA162282019701440−3−1270AC
SIGUIJ1167CD2LEUA16210022084290AC
ATOM1168CLEUA16211.3046.93517.2951.0015.37AC
ANISOU1168CLEUA1621833194914475−480AC
SIGUIJ1168CLEUA16210022084290AC
ATOM1169OLEUA16210.7947.01516.1481.0015.52AO
ANISOU1169OLEUA162182921441445−15−390AO
SIGUIJ1169OLEUA16210022153289AO
ATOM1170NILEA16312.4987.43517.6191.0015.74AN
ANISOU1170NILEA163188322601359−125−34−3AN
SIGUIJ1170NILEA16310022160289AN
ATOM1171CAILEA16313.3548.20216.7191.0016.21AC
ANISOU1171CAILEA163186222001390−5320AC
SIGUIJ1171CAILEA16310022084290AC
ATOM1172CBILEA16313.4729.67217.2021.0015.92AC
ANISOU1172CBILEA163212022051412−20−124−15AC
SIGUIJ1172CBILEA16310022084290AC
ATOM1173CG2ILEA16314.50010.40016.3301.0015.79AC
ANISOU1173CG2ILEA163219122181522−2−32−1AC
SIGUIJ1173CG2ILEA16310022084290AC
ATOM1174CG1ILEA16312.11710.38217.1851.0015.79AC
ANISOU1174CG1ILEA1632130222816030−121−1AC
SIGUIJ1174CG1ILEA16310022084290AC
ATOM1175CD1ILEA16312.07511.71617.9701.0015.74AC
ANISOU1175CD1ILEA163253922231621−6939−6AC
SIGUIJ1175CD1ILEA16310022084290AC
ATOM1176CILEA16314.7207.50616.8061.0016.73AC
ANISOU1176CILEA163183120971548−115−30AC
SIGUIJ1176CILEA16310022083290AC
ATOM1177OILEA16315.2487.22517.9021.0016.91AO
ANISOU1177OILEA163181221951546−4321−1AO
SIGUIJ1177OILEA16310022153289AO
ATOM1178NASERA16415.2837.16615.6490.5017.54AN
ANISOU1178NASERA16419552334155613110AN
SIGUIJ1178NASERA16410022160289AN
ATOM1179NBSERA16415.2997.18115.6480.5019.73AN
ANISOU1179NBSERA164201723991584−1262−5AN
SIGUIJ1179NBSERA16410022160289AN
ATOM1180CAASERA16416.6106.55215.6160.5018.20AC
ANISOU1180CAASERA164192721981631−47110AC
SIGUIJ1180CAASERA16410022083290AC
ATOM1181CABSERA16416.6266.54715.6270.5020.39AC
ANISOU1181CABSERA164200923961594−21531AC
SIGUIJ1181CABSERA16410022083290AC
ATOM1182CBASERA16416.9636.23014.1590.5018.66AC
ANISOU1182CBASERA164250922591665−37143−14AC
SIGUIJ1182CBASERA16410022083290AC
ATOM1183CBBSERA16417.0496.22814.1880.5020.85AC
ANISOU1183CBBSERA164233939081573918−59−42AC
SIGUIJ1183CBBSERA16410022083290AC
ATOM1184OGASERA16418.3055.84414.0250.5020.65AO
ANISOU1184OGASERA164251623541592−9137−6AO
SIGUIJ1184OGASERA16410022153289AO
ATOM1185OGBSERA16417.5037.40813.5430.5022.84AO
ANISOU1185OGBSERA164408642691212−25−553−49AO
SIGUIJ1185OGBSERA16410022153289AO
ATOM1186CASERA16417.6707.49716.2180.5018.34AC
ANISOU1186CASERA164209524451585−26548−6AC
SIGUIJ1186CASERA16410022083290AC
ATOM1187CBSERA16417.6727.49316.2280.5020.53AC
ANISOU1187CBSERA164213925791570−18866−2AC
SIGUIJ1187CBSERA16410022083290AC
ATOM1188OASERA16417.5448.71116.0800.5018.24AO
ANISOU1188OASERA164168924421801−325911AO
SIGUIJ1188OASERA16410022153289AO
ATOM1189OBSERA16417.5478.70616.0890.5020.43AO
ANISOU1189OBSERA164186825761648−238−74AO
SIGUIJ1189OBSERA16410022153289AO
ATOM1190NPROA16518.7266.93616.8711.0018.81AN
ANISOU1190NPROA165214927181539−11289−4AN
SIGUIJ1190NPROA16510022160289AN
ATOM1191CDPROA16518.9875.52517.2131.0018.76AC
ANISOU1191CDPROA165245727211699−69−46−3AC
SIGUIJ1191CDPROA16510022083290AC
ATOM1192CAPROA16519.7757.82417.3741.0019.57AC
ANISOU1192CAPROA165203226681427−48195−33AC
SIGUIJ1192CAPROA16510022083290AC
ATOM1193CBPROA16520.7866.87618.0181.0019.09AC
ANISOU1193CBPROA1652277274219673−1099AC
SIGUIJ1193CBPROA16510022083290AC
ATOM1194CGPROA16520.4665.50417.4911.0019.35AC
ANISOU1194CGPROA165246827652015−50−98−10AC
SIGUIJ1194CGPROA16510022083290AC
ATOM1195CPROA16520.3808.67416.2651.0020.46AC
ANISOU1195CPROA165270931801499−56118970AC
SIGUIJ1195CPROA16510022083290AC
ATOM1196OPROA16520.7239.84116.4751.0020.36AO
ANISOU1196OPROA165225431392103−399−615AO
SIGUIJ1196OPROA16510022153289AO
ATOM1197NGLNA16620.4768.11115.0631.0021.46AN
ANISOU1197NGLNA166218134571534−44099−28AN
SIGUIJ1197NGLNA16610022160289AN
ATOM1198CAGLNA16621.0838.86713.9621.0022.39AC
ANISOU1198CAGLNA166203235341614−30111282AC
SIGUIJ1198CAGLNA16610022083290AC
ATOM1199CBGLNA16621.3137.97112.7341.0023.16AC
ANISOU1199CBGLNA16635813767169741163−25AC
SIGUIJ1199CBGLNA16610022083290AC
ATOM1200CGGLNA16622.3776.90812.9231.0024.35AC
ANISOU1200CGGLNA166351236752572−51334AC
SIGUIJ1200CGGLNA16610022083290AC
ATOM1201CDGLNA16621.9235.71613.7461.0025.19AC
ANISOU1201CDGLNA166503337072696−308498−85AC
SIGUIJ1201CDGLNA16610022083290AC
ATOM1202OE1GLNA16620.7275.47913.9121.0025.85AO
ANISOU1202OE1GLNA166512963612617−82546714AO
SIGUIJ1202OE1GLNA16610022153289AO
ATOM1203NE2GLNA16622.8854.95914.2681.0026.18AN
ANISOU1203NE2GLNA1667239607942941731−609−394AN
SIGUIJ1203NE2GLNA16610022160289AN
ATOM1204CGLNA16620.22110.03713.5751.0022.75AC
ANISOU1204CGLNA1662587380214809161−2AC
SIGUIJ1204CGLNA16610022082290AC
ATOM1205OGLNA16620.70910.98312.9751.0023.16AO
ANISOU1205OGLNA166400642223316401137617AO
SIGUIJ1205OGLNA16610022153289AO
ATOM1206NASPA16718.9389.99113.9131.0022.90AN
ANISOU1206NASPA1672602317017541081350AN
SIGUIJ1206NASPA16710022160289AN
ATOM1207CAASPA16718.05611.09313.5791.0023.15AC
ANISOU1207CAASPA167306434152305420−80−10AC
SIGUIJ1207CAASPA16710022082290AC
ATOM1208CBASPA16716.70610.53813.0681.0024.27AC
ANISOU1208CBASPA167339359921565−639200−15AC
SIGUIJ1208CBASPA16710022082290AC
ATOM1209CGASPA16716.8779.63511.8101.0025.43AC
ANISOU1209CGASPA167565960951537−555−1AC
SIGUIJ1209CGASPA16710022082290AC
ATOM1210OD1ASPA16717.54910.08810.8481.0026.67AO
ANISOU1210OD1ASPA167640863391957−7580105AO
SIGUIJ1210OD1ASPA16710022153289AO
ATOM1211OD2ASPA16716.3818.46811.7491.0026.53AO
ANISOU1211OD2ASPA16756376082419723−2915AO
SIGUIJ1211OD2ASPA16710022153289AO
ATOM1212CASPA16717.84912.04014.7631.0022.74AC
ANISOU1212CASPA1672535330222991555925AC
SIGUIJ1212CASPA16710022082290AC
ATOM1213OASPA16717.05812.94914.6721.0023.11AO
ANISOU1213OASPA1675157535026732471408362AO
SIGUIJ1213OASPA16710022153289AO
ATOM1214NCYSA16818.56511.81915.8631.0021.84AN
ANISOU1214NCYSA168265729092338110−250AN
SIGUIJ1214NCYSA16810022160289AN
ATOM1215CACYSA16818.45512.57417.1091.0021.29AC
ANISOU1215CACYSA16824582912233710181AC
SIGUIJ1215CACYSA16810022082290AC
ATOM1216CCYSA16819.74413.35617.3491.0021.19AC
ANISOU1216CCYSA16824402839256137−10AC
SIGUIJ1216CCYSA16810022082290AC
ATOM1217OCYSA16820.75312.77917.7741.0021.33AO
ANISOU1217OCYSA168235025902614−110−8−3AO
SIGUIJ1217OCYSA16810022153289AO
ATOM1218CBCYSA16818.22711.59218.2891.0020.25AC
ANISOU1218CBCYSA16827992942231422380AC
SIGUIJ1218CBCYSA16810022082290AC
ATOM1219SGCYSA16817.63712.38119.8131.0019.44AS
ANISOU1219SGCYSA168230524852228−37151139AS
SIGUIJ1219SGCYSA16810022148289AS
ATOM1220NTHRA16919.70414.66217.1331.0021.34AN
ANISOU1220NTHRA1692615283224503720AN
SIGUIJ1220NTHRA16910022160289AN
ATOM1221CATHRA16920.93915.44617.0841.0021.34AC
ANISOU1221CATHRA169264828973004−8261AC
SIGUIJ1221CATHRA16910022082290AC
ATOM1222CBTHRA16920.61916.86916.6851.0021.92AC
ANISOU1222CBTHRA1693516294731321913715AC
SIGUIJ1222CBTHRA16910022082290AC
ATOM1223OG1THRA16919.74616.83815.5501.0022.86AO
ANISOU1223OG1THRA169358739243179159−150AO
SIGUIJ1223OG1THRA16910022153289AO
ATOM1224CG2THRA16921.90517.63716.4231.0022.13AC
ANISOU1224CG2THRA169366033273109−4539−4AC
SIGUIJ1224CG2THRA16910022082290AC
ATOM1225CTHRA16921.69115.46518.3901.0021.07AC
ANISOU1225CTHRA169219026622837−6730233AC
SIGUIJ1225CTHRA16910022082290AC
ATOM1226OTHRA16922.90515.51718.3921.0021.00AO
ANISOU1226OTHRA169218728283303−7830329AO
SIGUIJ1226OTHRA16910022153289AO
ATOM1227NLYSA17020.97515.41219.5231.0020.57AN
ANISOU1227NLYSA170189126292700−1199614AN
SIGUIJ1227NLYSA17010022160289AN
ATOM1228CALYSA17021.67215.50720.8061.0020.13AC
ANISOU1228CALYSA170187624972697−38925AC
SIGUIJ1228CALYSA17010022082290AC
ATOM1229CBLYSA17020.70915.88221.9431.0019.74AC
ANISOU1229CBLYSA170182421072682−1578527AC
SIGUIJ1229CBLYSA17010022082290AC
ATOM1230CGLYSA17019.60414.81622.2291.0018.85AC
ANISOU1230CGLYSA170177920602249−12510AC
SIGUIJ1230CGLYSA17010022082290AC
ATOM1231CDLYSA17018.72015.11623.4581.0018.16AC
ANISOU1231CDLYSA170183722562256−43121AC
SIGUIJ1231CDLYSA17010022082290AC
ATOM1232CELYSA17017.99716.46223.3891.0017.62AC
ANISOU1232CELYSA170189522661848−173−1AC
SIGUIJ1232CELYSA17010022082290AC
ATOM1233NZLYSA17016.96816.45222.3151.0016.88AN
ANISOU1233NZLYSA170189818751853−310AN
SIGUIJ1233NZLYSA17010022160289AN
ATOM1234CLYSA17022.41214.20121.1741.0020.06AC
ANISOU1234CLYSA170156724342438−16524544AC
SIGUIJ1234CLYSA17010022081290AC
ATOM1235OLYSA17023.21714.19322.1121.0020.45AO
ANISOU1235OLYSA170199730702753−90−129−13AO
SIGUIJ1235OLYSA17010022153289AO
ATOM1236NVALA17122.15213.09820.4701.0020.14AN
ANISOU1236NVALA171183524152364−22525589AN
SIGUIJ1236NVALA17110022160289AN
ATOM1237CAVALA17122.89511.85320.7271.0020.53AC
ANISOU1237CAVALA171228225222780−12−61−3AC
SIGUIJ1237CAVALA17110022081290AC
ATOM1238CBVALA17122.08410.55620.3101.0020.49AC
ANISOU1238CBVALA171220725202482−16714AC
SIGUIJ1238CBVALA17110022081290AC
ATOM1239CG1VALA17122.9849.28720.4701.0020.47AC
ANISOU1239CG1VALA171224725372636829−1AC
SIGUIJ1239CG1VALA17110022081290AC
ATOM1240CG2VALA17120.77010.41921.1431.0020.58AC
ANISOU1240CG2VALA171216536582337−151−17−8AC
SIGUIJ1240CG2VALA17110022081290AC
ATOM1241CVALA17124.18711.93019.8841.0020.83AC
ANISOU1241CVALA171234637322925−83293AC
SIGUIJ1241CVALA17110022081290AC
ATOM1242OVALA17124.13112.25918.6751.0021.72AO
ANISOU1242OVALA1712571375029254763−4AO
SIGUIJ1242OVALA17110022153289AO
ATOM1243NGLUA17724.7146.14422.0611.0030.45AN
ANISOU1243NGLUA177152335567740321831205295AN
SIGUIJ1243NGLUA17710022159289AN
ATOM1244CAGLUA17725.2085.33620.9381.0030.20AC
ANISOU1244CAGLUA177659936927053−14371152AC
SIGUIJ1244CAGLUA17710022081290AC
ATOM1245CBGLUA17726.2804.35121.4091.0030.89AC
ANISOU1245CBGLUA177848258447054574−73−22AC
SIGUIJ1245CBGLUA17710022081290AC
ATOM1246CGGLUA17727.5484.94022.0221.0031.90AC
ANISOU1246CGGLUA177880874026935−165−364AC
SIGUIJ1246CGGLUA17710022081290AC
ATOM1247CDGLUA17728.2573.88722.8641.0032.41AC
ANISOU1247CDGLUA177932976566884219111AC
SIGUIJ1247CDGLUA17710022081290AC
ATOM1248OE1GLUA17727.7342.73422.8851.0033.04AO
ANISOU1248OE1GLUA17710051780017802−100605−45AO
SIGUIJ1248OE1GLUA17710022153289AO
ATOM1249OE2GLUA17729.3094.19423.4981.0033.04AO
ANISOU1249OE2GLUA17792047747648017524322AO
SIGUIJ1249OE2GLUA17710022153289AO
ATOM1250CGLUA17724.0844.53020.2691.0029.54AC
ANISOU1250CGLUA177627726857931−641−409−78AC
SIGUIJ1250CGLUA17710022081290AC
ATOM1251OGLUA17722.9114.91420.3191.0029.57AO
ANISOU1251OGLUA177638838113113−269−56351AO
SIGUIJ1251OGLUA17710022153289AO
ATOM1252NASNA17824.4793.41919.6381.0028.62AN
ANISOU1252NASNA178908829478004196−131−24AN
SIGUIJ1252NASNA17810022159289AN
ATOM1253CAASNA17823.5712.47718.9811.0027.24AC
ANISOU1253CAASNA178759237694115−4882926−271AC
SIGUIJ1253CAASNA17810022081290AC
ATOM1254CBASNA17824.3521.49518.0671.0028.13AC
ANISOU1254CBASNA178629038772567−1011381−56AC
SIGUIJ1254CBASNA17810022081290AC
ATOM1255CGASNA17825.7451.11918.6251.0028.73AC
ANISOU1255CGASNA1786714466548968145819AC
SIGUIJ1255CGASNA17810022081290AC
ATOM1256OD1ASNA17826.1921.63619.6661.0029.72AO
ANISOU1256OD1ASNA17884554754521423−259−2AO
SIGUIJ1256OD1ASNA17810022153289AO
ATOM1257ND2ASNA17826.4480.22017.9141.0029.42AN
ANISOU1257ND2ASNA17873505001476659043499AN
SIGUIJ1257ND2ASNA17810022159289AN
ATOM1258CASNA17822.7751.68120.0161.0025.77AC
ANISOU1258CASNA178357537052238−4118037AC
SIGUIJ1258CASNA17810022081290AC
ATOM1259OASNA17822.0650.76819.6601.0026.06AO
ANISOU1259OASNA178705576163835−37532759−2585AO
SIGUIJ1259OASNA17810022153289AO
ATOM1260NSERA17922.8962.00921.2991.0023.67AN
ANISOU1260NSERA179230428172162−205341260AN
SIGUIJ1260NSERA17910022159289AN
ATOM1261CASERA17921.9881.39822.2781.0021.65AC
ANISOU1261CASERA17919371871175231149−112AC
SIGUIJ1261CASERA17910022081290AC
ATOM1262CBSERA17922.7600.57723.3011.0021.87AC
ANISOU1262CBSERA1792977279219528492015AC
SIGUIJ1262CBSERA17910022081290AC
ATOM1263OGSERA17923.7511.38223.8771.0022.51AO
ANISOU1263OGSERA179382838642467−1−265−14AO
SIGUIJ1263OGSERA17910022153289AO
ATOM1264CSERA17921.1632.46122.9811.0020.58AC
ANISOU1264CSERA179186617861496278917AC
SIGUIJ1264CSERA17910022080290AC
ATOM1265OSERA17920.6662.22524.0821.0019.04AO
ANISOU1265OSERA179160018021451−24−42−1AO
SIGUIJ1265OSERA17910022153289AO
ATOM1266NMETA18021.0103.60322.3171.0019.80AN
ANISOU1266NMETA18020511818150710726063AN
SIGUIJ1266NMETA18010022159289AN
ATOM1267CAMETA18020.0804.63422.7521.0019.86AC
ANISOU1267CAMETA180214218521489157324100AC
SIGUIJ1267CAMETA18010022080290AC
ATOM1268CBMETA18020.8775.88723.1001.0021.09AC
ANISOU1268CBMETA180243920222291−55297−47AC
SIGUIJ1268CBMETA18010022080290AC
ATOM1269CGMETA18021.7225.64924.3701.0022.71AC
ANISOU1269CGMETA180295330892523123−222AC
SIGUIJ1269CGMETA18010022080290AC
ATOM1270SDMETA18022.7406.96825.0451.0025.89AS
ANISOU1270SDMETA180368734614056−155−668−263AS
SIGUIJ1270SDMETA18010022148289AS
ATOM1271CEMETA18022.6828.04523.9181.0025.18AC
ANISOU1271CEMETA180223237324211587146−47AC
SIGUIJ1271CEMETA18010022080290AC
ATOM1272CMETA18019.0244.91221.6791.0019.33AC
ANISOU1272CMETA18022992089156721921298AC
SIGUIJ1272CMETA18010022080290AC
ATOM1273OMETA18019.2644.70420.4671.0018.97AO
ANISOU1273OMETA18022632650158750250−36AO
SIGUIJ1273OMETA18010022153289AO
ATOM1274NLEUA18117.8605.38522.1101.0018.49AN
ANISOU1274NLEUA1812227198513331418024AN
SIGUIJ1274NLEUA18110022159289AN
ATOM1275CALEUA18116.7215.72521.2571.0018.17AC
ANISOU1275CALEUA181259020841818292−347−155AC
SIGUIJ1275CALEUA18110022080290AC
ATOM1276CBLEUA18115.4994.78221.5841.0019.17AC
ANISOU1276CBLEUA181288725343154−22−109−2AC
SIGUIJ1276CBLEUA18110022080290AC
ATOM1277CGLEUA18115.4883.29721.1621.0020.31AC
ANISOU1277CGLEUA181868125363196113−741−13AC
SIGUIJ1277CGLEUA18110022080290AC
ATOM1278CD1LEUA18114.4092.54821.9041.0020.65AC
ANISOU1278CD1LEUA181850014893825817−292−42AC
SIGUIJ1278CD1LEUA18110022080290AC
ATOM1279CD2LEUA18115.2563.21819.6701.0020.95AC
ANISOU1279CD2LEUA181378832113073−17535−9AC
SIGUIJ1279CD2LEUA18110022080290AC
ATOM1280CLEUA18116.3617.16321.6541.0017.15AC
ANISOU1280CLEUA18117561968129914−1307AC
SIGUIJ1280CLEUA18110022080290AC
ATOM1281OLEUA18116.5787.55622.8111.0016.13AO
ANISOU1281OLEUA18122361939130850−220−20AO
SIGUIJ1281OLEUA18110022153289AO
ATOM1282NCYSA18215.7337.93820.7671.0015.93AN
ANISOU1282NCYSA18216361977125215−620AN
SIGUIJ1282NCYSA18210022159289AN
ATOM1283CACYSA18214.9999.12021.2041.0015.01AC
ANISOU1283CACYSA182149619141462−933−6AC
SIGUIJ1283CACYSA18210022080290AC
ATOM1284CCYSA18213.5218.88020.9891.0014.28AC
ANISOU1284CCYSA182149216091371−2690AC
SIGUIJ1284CCYSA18210022080290AC
ATOM1285OCYSA18213.1257.91520.3031.0013.79AO
ANISOU1285OCYSA182184216351379−107−6922AO
SIGUIJ1285OCYSA18210022153289AO
ATOM1286CBCYSA18215.47110.36420.4461.0015.88AC
ANISOU1286CBCYSA182185419741505−25921−7AC
SIGUIJ1286CBCYSA18210022080290AC
ATOM1287SGCYSA18217.17910.77420.9331.0016.61AS
ANISOU1287SGCYSA182188623311784−338−44−111AS
SIGUIJ1287SGCYSA18210022148289AS
ATOM1288NALAA18312.6919.73421.5481.0013.52AN
ANISOU1288NALAA1831501161112833−501AN
SIGUIJ1288NALAA18310022159289AN
ATOM1289CAALAA18311.2609.59221.2731.0013.20AC
ANISOU1289CAALAA183151716681319−31−57−7AC
SIGUIJ1289CAALAA18310022080290AC
ATOM1290CBALAA18310.5748.60322.2271.0013.34AC
ANISOU1290CBALAA1831571165213891130AC
SIGUIJ1290CBALAA18310022080290AC
ATOM1291CALAA18310.59910.95921.4461.0013.39AC
ANISOU1291CALAA183165116741264−5−10AC
SIGUIJ1291CALAA18310022080290AC
ATOM1292OALAA18310.93711.73622.3831.0013.25AO
ANISOU1292OALAA183190316751270−79−388AO
SIGUIJ1292OALAA18310022153289AO
ATOM1293NGLYA1849.63411.24920.5921.0013.85AN
ANISOU1293NGLYA184169215961308−57−3711AN
SIGUIJ1293NGLYA18410022159289AN
ATOM1294CAGLYA1848.92512.51220.6731.0014.85AC
ANISOU1294CAGLYA1841833163416314210AC
SIGUIJ1294CAGLYA18410022079290AC
ATOM1295CGLYA1847.85312.52419.5911.0015.55AC
ANISOU1295CGLYA18419081981169613−484AC
SIGUIJ1295CGLYA18410022079290AC
ATOM1296OGLYA1847.67311.53418.8651.0015.41AO
ANISOU1296OGLYA1842337198517465−160−1AO
SIGUIJ1296OGLYA18410022153289AO
ATOM1297NILEA1857.14913.64919.4941.0016.56AN
ANISOU1297NILEA185246421621717326−463−226AN
SIGUIJ1297NILEA18510022159289AN
ATOM1298CAILEA1856.10413.88818.4671.0017.76AC
ANISOU1298CAILEA1852356183816992−4034AC
SIGUIJ1298CAILEA18510022079290AC
ATOM1299CBILEA1854.73714.07719.1631.0018.05AC
ANISOU1299CBILEA185255819132521840AC
SIGUIJ1299CBILEA18510022079290AC
ATOM1300CG2ILEA1853.67114.45018.1601.0018.41AC
ANISOU1300CG2ILEA18525922147253291−4−3AC
SIGUIJ1300CG2ILEA18510022079290AC
ATOM1301CG1ILEA1854.30312.78219.8731.0018.24AC
ANISOU1301CG1ILEA185270219372551−4210−1AC
SIGUIJ1301CG1ILEA18510022079290AC
ATOM1302CD1ILEA1853.98611.64418.9041.0018.38AC
ANISOU1302CD1ILEA185239519242566486−1AC
SIGUIJ1302CD1ILEA18510022079290AC
ATOM1303CILEA1856.52815.18317.7491.0018.58AC
ANISOU1303CILEA185266618561746−36−31013AC
SIGUIJ1303CILEA18510022079290AC
ATOM1304OILEA1856.79316.15118.4081.0018.04AO
ANISOU1304OILEA185261618511719−26−3055AO
SIGUIJ1304OILEA18510022153289AO
ATOM1305NPROA1866.59715.19616.3971.0019.42AN
ANISOU1305NPROA186300625541750−76−29029AN
SIGUIJ1305NPROA18610022159289AN
ATOM1306CDPROA1866.27814.12915.4301.0020.02AC
ANISOU1306CDPROA18627362594185450−335−53AC
SIGUIJ1306CDPROA18610022079290AC
ATOM1307CAPROA1866.97416.43715.7251.0020.07AC
ANISOU1307CAPROA186318226001801−148−31858AC
SIGUIJ1307CAPROA18610022079290AC
ATOM1308CBPROA1866.71016.14214.2521.0020.37AC
ANISOU1308CBPROA186357228071829−63−40417AC
SIGUIJ1308CBPROA18610022079290AC
ATOM1309CGPROA1866.66914.73414.1241.0020.70AC
ANISOU1309CGPROA186353328121940−80−15512AC
SIGUIJ1309CGPROA18610022079290AC
ATOM1310CPROA1866.14217.60916.1941.0020.31AC
ANISOU1310CPROA186318226291658−114−39561AC
SIGUIJ1310CPROA18610022079290AC
ATOM1311OPROA1864.90417.52716.3181.0020.36AO
ANISOU1311OPROA186318722742361−89−32831AO
SIGUIJ1311OPROA18610022153289AO
ATOM1312NASPA186A6.83518.71516.4171.0020.72AN
ANISOU1312NASPA186A28992555161028−240−8AN
SIGUIJ1312NASPA186A10022159289AN
ATOM1313CAASPA186A6.23719.99816.7861.0021.18AC
ANISOU1313CAASPA186A347627301801334−321−97AC
SIGUIJ1313CAASPA186A10022079290AC
ATOM1314CBASPA186A5.36620.53915.6251.0022.27AC
ANISOU1314CBASPA186A347323762017−90−51740AC
SIGUIJ1314CBASPA186A10022079290AC
ATOM1315CGASPA186A6.15620.71714.3551.0023.43AC
ANISOU1315CGASPA186A419657812219−920−183−4AC
SIGUIJ1315CGASPA186A10022079290AC
ATOM1316OD1ASPA186A7.28821.21814.4371.0024.41AO
ANISOU1316OD1ASPA186A3792369123985−194−5AO
SIGUIJ1316OD1ASPA186A10022153289AO
ATOM1317OD2ASPA186A5.65320.32613.2721.0024.75AO
ANISOU1317OD2ASPA186A467368132176−1755−10311AO
SIGUIJ1317OD2ASPA186A10022153289AO
ATOM1318CASPA186A5.45119.97218.0871.0020.78AC
ANISOU1318CASPA186A391422291960518−45−12AC
SIGUIJ1318CASPA186A10022079290AC
ATOM1319OASPA186A4.60420.80518.3101.0021.16AO
ANISOU1319OASPA186A444525613025917499248AO
SIGUIJ1319OASPA186A10022153289AO
ATOM1320NSERA186B5.74318.99618.9571.0019.72AN
ANISOU1320NSERA186B27092092200320−197−6AN
SIGUIJ1320NSERA186B10022159289AN
ATOM1321CASERA186B5.02918.81120.2241.0019.06AC
ANISOU1321CASERA186B277624012023−28−1679AC
SIGUIJ1321CASERA186B10022079290AC
ATOM1322CBSERA186B4.33317.45620.2051.0018.95AC
ANISOU1322CBSERA186B280024111927−39−16511AC
SIGUIJ1322CBSERA186B10022078290AC
ATOM1323OGSERA186B3.82817.15521.4921.0018.85AO
ANISOU1323OGSERA186B2384246418747−31530AO
SIGUIJ1323OGSERA186B10022153289AO
ATOM1324CSERA186B5.99418.85421.3911.0018.39AC
ANISOU1324CSERA186B2588170919085−140AC
SIGUIJ1324CSERA186B10022078290AC
ATOM1325OSERA186B7.14318.47821.2441.0018.48AO
ANISOU1325OSERA186B26502316198820273AO
SIGUIJ1325OSERA186B10022153289AO
ATOM1326NALYSA1875.50719.31922.5290.5017.77AN
ANISOU1326NALYSA187222016301851−45−15214AN
SIGUIJ1326NALYSA18710022159289AN
ATOM1327NBLYSA1875.48419.33122.5250.5019.96AN
ANISOU1327NBLYSA187223415921840−71−14820AN
SIGUIJ1327NBLYSA18710022159289AN
ATOM1328CAALYSA1876.28419.35523.7600.5017.28AC
ANISOU1328CAALYSA187207914121804−41−689AC
SIGUIJ1328CAALYSA18710022078290AC
ATOM1329CABLYSA1876.18519.39623.8090.5019.47AC
ANISOU1329CABLYSA187271114461981−143−40764AC
SIGUIJ1329CABLYSA18710022078290AC
ATOM1330CBALYSA1875.71220.43124.6830.5018.41AC
ANISOU1330CBALYSA187240015301834140−77−15AC
SIGUIJ1330CBALYSA18710022078290AC
ATOM1331CBBLYSA1875.42420.32724.7770.5020.60AC
ANISOU1331CBBLYSA1873766177924311929911AC
SIGUIJ1331CBBLYSA18710022078290AC
ATOM1332CGALYSA1875.73721.81924.0580.5019.76AC
ANISOU1332CGALYSA187374315551933−99−55928AC
SIGUIJ1332CGALYSA18710022078290AC
ATOM1333CGBLYSA1875.32921.81224.3980.5021.95AC
ANISOU1333CGBLYSA18730971767242867−200−8AC
SIGUIJ1333CGBLYSA18710022078290AC
ATOM1334CDALYSA1875.20222.88525.0070.5021.54AC
ANISOU1334CDALYSA18760931801238738222321AC
SIGUIJ1334CDALYSA18710022078290AC
ATOM1335CDBLYSA1874.57122.61425.5060.5023.73AC
ANISOU1335CDBLYSA1875177359125411906−108−75AC
SIGUIJ1335CDBLYSA18710022078290AC
ATOM1336CEALYSA1875.69124.27624.6020.5022.22AC
ANISOU1336CEALYSA187910621242521−591519−45AC
SIGUIJ1336CEALYSA18710022078290AC
ATOM1337CEBLYSA1874.68824.14825.3450.5024.41AC
ANISOU1337CEBLYSA187137773655572113691007152AC
SIGUIJ1337CEBLYSA18710022078290AC
ATOM1338NZALYSA1875.36425.30725.6400.5023.45AN
ANISOU1338NZALYSA1871414022033005−4451960−75AN
SIGUIJ1338NZALYSA18710022159289AN
ATOM1339NZBLYSA1874.20724.94426.5340.5025.64AN
ANISOU1339NZBLYSA18713596393455961778657131AN
SIGUIJ1339NZBLYSA18710022159289AN
ATOM1340CALYSA1876.36018.02424.5200.5016.33AC
ANISOU1340CALYSA187192414081780−2210AC
SIGUIJ1340CALYSA18710022078290AC
ATOM1341CBLYSA1876.35318.03424.5120.5018.52AC
ANISOU1341CBLYSA187193914241764−37−31AC
SIGUIJ1341CBLYSA18710022078290AC
ATOM1342OALYSA1877.13217.91725.4800.5016.34AO
ANISOU1342OALYSA1871933174917795−30AO
SIGUIJ1342OALYSA18710022153289AO
ATOM1343OBLYSA1877.17717.91725.4260.5018.53AO
ANISOU1343OBLYSA1871942173617620−40AO
SIGUIJ1343OBLYSA18710022153289AO
ATOM1344NLYSA1885.55717.03324.1251.0014.96AN
ANISOU1344NLYSA1881853136317742931AN
SIGUIJ1344NLYSA18810022159289AN
ATOM1345CALYSA1885.44215.77124.8741.0014.02AC
ANISOU1345CALYSA18815891366179110−674AC
SIGUIJ1345CALYSA18810022078290AC
ATOM1346CBLYSA1884.54914.80324.0811.0014.14AC
ANISOU1346CBLYSA188157314021780−10−360AC
SIGUIJ1346CBLYSA18810022078290AC
ATOM1347CGLYSA1883.09315.26224.1071.0014.83AC
ANISOU1347CGLYSA18815931677189569−4819AC
SIGUIJ1347CGLYSA18810022078290AC
ATOM1348CDLYSA1882.26814.48723.1181.0016.07AC
ANISOU1348CDLYSA188183519202045−56−162−51AC
SIGUIJ1348CDLYSA18810022078290AC
ATOM1349CELYSA1880.77114.89123.1681.0016.84AC
ANISOU1349CELYSA18818642302269147−12310AC
SIGUIJ1349CELYSA18810022078290AC
ATOM1350NZLYSA1880.14914.61124.4571.0018.97AN
ANISOU1350NZLYSA188228526812766−116369AN
SIGUIJ1350NZLYSA18810022159289AN
ATOM1351CLYSA1886.82515.15925.1091.0013.21AC
ANISOU1351CLYSA1881592139613142830AC
SIGUIJ1351CLYSA18810022077290AC
ATOM1352OLYSA1887.61114.95024.1821.0012.89AO
ANISOU1352OLYSA188159818271295135−25−1AO
SIGUIJ1352OLYSA18810022153289AO
ATOM1353NASNA1897.10614.82126.3601.0012.05AN
ANISOU1353NASNA189149312871305−3315−2AN
SIGUIJ1353NASNA18910022159289AN
ATOM1354CAASNA1898.44214.33626.7261.0011.64AC
ANISOU1354CAASNA189150612901360−27−132AC
SIGUIJ1354CAASNA18910022077290AC
ATOM1355CBASNA1899.45115.47426.5291.0011.73AC
ANISOU1355CBASNA189150412721391−11−91AC
SIGUIJ1355CBASNA18910022077290AC
ATOM1356CGASNA18910.80815.00426.1221.0012.45AC
ANISOU1356CGASNA18915201412130230−41−8AC
SIGUIJ1356CGASNA18910022077290AC
ATOM1357OD1ASNA18911.23013.84226.3581.0011.93AO
ANISOU1357OD1ASNA18915721450129210012151AO
SIGUIJ1357OD1ASNA18910022153289AO
ATOM1358ND2ASNA18911.54815.93425.5011.0013.28AN
ANISOU1358ND2ASNA189195614911618−105270−58AN
SIGUIJ1358ND2ASNA18910022159289AN
ATOM1359CASNA1898.44213.84828.1841.0011.46AC
ANISOU1359CASNA1891489127913655783AC
SIGUIJ1359CASNA18910022077290AC
ATOM1360OASNA1897.46014.01728.8851.0011.18AO
ANISOU1360OASNA1891475129513838332AO
SIGUIJ1360OASNA18910022153289AO
ATOM1361NALAA1909.58813.32028.6311.0011.38AN
ANISOU1361NALAA19014801239139741−4−1AN
SIGUIJ1361NALAA19010022159289AN
ATOM1362CAALAA1909.83913.02830.0261.0011.34AC
ANISOU1362CAALAA19014281218140311446AC
SIGUIJ1362CAALAA19010022077290AC
ATOM1363CBALAA19010.69511.76230.1291.0011.42AC
ANISOU1363CBALAA19015761290150622067AC
SIGUIJ1363CBALAA19010022077290AC
ATOM1364CALAA19010.59014.23330.6241.0011.69AC
ANISOU1364CALAA190144712161552114−84AC
SIGUIJ1364CALAA19010022077290AC
ATOM1365OALAA19011.00015.19329.8741.0012.39AO
ANISOU1365OALAA1901837127616165442AO
SIGUIJ1365OALAA19010022153289AO
ATOM1366NCYSA19110.75014.23331.9461.0011.81AN
ANISOU1366NCYSA191149011031564920AN
SIGUIJ1366NCYSA19110022159289AN
ATOM1367CACYSA19111.49515.32032.6111.0011.91AC
ANISOU1367CACYSA191154411111703−2−39−5AC
SIGUIJ1367CACYSA19110022077290AC
ATOM1368CCYSA19112.03614.79333.9441.0011.80AC
ANISOU1368CCYSA19112141167166601004AC
SIGUIJ1368CCYSA19110022077290AC
ATOM1369OCYSA19112.04013.57034.1921.0011.71AO
ANISOU1369OCYSA191135711711607−38−730AO
SIGUIJ1369OCYSA19110022153289AO
ATOM1370CBCYSA19110.57516.56232.7521.0012.54AC
ANISOU1370CBCYSA19117301191215712041−2AC
SIGUIJ1370CBCYSA19110022077290AC
ATOM1371SGCYSA19111.38618.12833.2521.0013.85AS
ANISOU1371SGCYSA191197012701902−5619424AS
SIGUIJ1371SGCYSA19110022148289AS
ATOM1372NAASNA19212.57015.68734.7980.5011.82AN
ANISOU1372NAASNA192140811931734−5626−1AN
SIGUIJ1372NAASNA19210022159289AN
ATOM1373NBASNA19212.56815.69634.7950.5014.01AN
ANISOU1373NBASNA192139111891728−4228−1AN
SIGUIJ1373NBASNA19210022159289AN
ATOM1374CAAASNA19213.20115.26636.0670.5012.62AC
ANISOU1374CAAASNA19214201257173620485AC
SIGUIJ1374CAAASNA19210022077290AC
ATOM1375CABASNA19213.22515.29936.0630.5014.81AC
ANISOU1375CABASNA19213741279172512595AC
SIGUIJ1375CABASNA19210022077290AC
ATOM1376CBAASNA19213.67216.44336.9310.5015.37AC
ANISOU1376CBAASNA192225313521788−236−3613AC
SIGUIJ1376CBAASNA19210022077290AC
ATOM1377CBBASNA19213.64416.49436.9690.5017.56AC
ANISOU1377CBBASNA192680916171888−1290−736178AC
SIGUIJ1377CBBASNA19210022077290AC
ATOM1378CGAASNA19214.76917.21536.2800.5017.74AC
ANISOU1378CGAASNA192233913691933−27165−28AC
SIGUIJ1378CGAASNA19210022077290AC
ATOM1379CGBASNA19213.93417.77736.1930.5019.93AC
ANISOU1379CGBASNA192398912831874−239−505AC
SIGUIJ1379CGBASNA19210022077290AC
ATOM1380OD1AASNA19214.52218.10635.4420.5019.81AO
ANISOU1380OD1AASNA192300314232051−256−10724AO
SIGUIJ1380OD1AASNA19210022153289AO
ATOM1381OD1BASNA19215.07818.23236.1210.5022.00AO
ANISOU1381OD1BASNA192451445702567−15495−5AO
SIGUIJ1381OD1BASNA19210022153289AO
ATOM1382ND2AASNA19216.00716.87936.6310.5019.13AN
ANISOU1382ND2AASNA192236816142078−20619−9AN
SIGUIJ1382ND2AASNA19210022159289AN
ATOM1383ND2BASNA19212.90518.35535.6010.5021.32AN
ANISOU1383ND2BASNA192427013092842−265−56776AN
SIGUIJ1383ND2BASNA19210022159289AN
ATOM1384CAASNA19212.26414.46236.9030.5011.77AC
ANISOU1384CAASNA192126712621531−1−132−5AC
SIGUIJ1384CAASNA19210022077290AC
ATOM1385CBASNA19212.27714.47036.8870.5013.96AC
ANISOU1385CBASNA192122312631484−7−135−8AC
SIGUIJ1385CBASNA19210022077290AC
ATOM1386OAASNA19211.12514.86337.1690.5012.07AO
ANISOU1386OAASNA1921291126618460−490AO
SIGUIJ1386OAASNA19210022153289AO
ATOM1387OBASNA19211.13014.86637.1180.5014.26AO
ANISOU1387OBASNA1921248126619971−231AO
SIGUIJ1387OBASNA19210022153289AO
ATOM1388NGLYA19312.80813.37037.4061.0010.39AN
ANISOU1388NGLYA193114412641345176−1AN
SIGUIJ1388NGLYA19310022159289AN
ATOM1389CAGLYA19312.00512.43438.1851.0010.12AC
ANISOU1389CAGLYA193114912881295−17−30−4AC
SIGUIJ1389CAGLYA19310022077290AC
ATOM1390CGLYA19311.53611.26037.3681.009.29AC
ANISOU1390CGLYA1939661257126463−388AC
SIGUIJ1390CGLYA19310022076290AC
ATOM1391OGLYA19311.10910.22837.9491.0010.02AO
ANISOU1391OGLYA193125212991302−710AO
SIGUIJ1391OGLYA19310022153289AO
ATOM1392NASPA19411.60911.35536.0501.008.82AN
ANISOU1392NASPA194105199012552−37−1AN
SIGUIJ1392NASPA19410022159289AN
ATOM1393CAASPA19411.15810.26735.1671.009.00AC
ANISOU1393CAASPA19410949921236−24−60AC
SIGUIJ1393CAASPA19410022076290AC
ATOM1394CBASPA19410.55410.84233.8941.009.29AC
ANISOU1394CBASPA19411591027124522−60AC
SIGUIJ1394CBASPA19410022076290AC
ATOM1395CGASPA1949.25011.54734.1301.009.46AC
ANISOU1395CGASPA19411711042126932−10AC
SIGUIJ1395CGASPA19410022076290AC
ATOM1396OD1ASPA1948.41711.08734.9691.009.59AO
ANISOU1396OD1ASPA194122611501278−1640AO
SIGUIJ1396OD1ASPA19410022153289AO
ATOM1397OD2ASPA1948.99012.56633.4321.0010.06AO
ANISOU1397OD2ASPA19412041058130952−51AO
SIGUIJ1397OD2ASPA19410022153289AO
ATOM1398CASPA19412.2659.29134.8271.008.95AC
ANISOU1398CASPA194111510251181200AC
SIGUIJ1398CASPA19410022076290AC
ATOM1399OASPA19411.9308.20034.3141.009.47AO
ANISOU1399OASPA194129110421204−33−102AO
SIGUIJ1399OASPA19410022152289AO
ATOM1400NSERA19513.5249.64435.0451.008.61AN
ANISOU1400NSERA195111210391117100AN
SIGUIJ1400NSERA19510022159289AN
ATOM1401CASERA19514.6368.72834.7151.009.06AC
ANISOU1401CASERA195110810341200−7150AC
SIGUIJ1401CASERA19510022076290AC
ATOM1402CBSERA19515.9329.22635.3391.009.26AC
ANISOU1402CBSERA195112910291310−11−231AC
SIGUIJ1402CBSERA19510022076290AC
ATOM1403OGSERA19516.9528.23935.2581.0010.77AO
ANISOU1403OGSERA19512511131183694345AO
SIGUIJ1403OGSERA19510022152289AO
ATOM1404CSERA19514.3907.33135.2361.008.79AC
ANISOU1404CSERA1951093103711355−10AC
SIGUIJ1404CSERA19510022076290AC
ATOM1405OSERA19513.9287.14036.3591.008.77AO
ANISOU1405OSERA195114111651125000AO
SIGUIJ1405OSERA19510022152289AO
ATOM1406NGLYA19614.7316.34434.3971.008.96AN
ANISOU1406NGLYA196108310371172830AN
SIGUIJ1406NGLYA19610022159289AN
ATOM1407CAGLYA19614.6034.95534.8241.009.79AC
ANISOU1407CAGLYA196134610451251−265−1AC
SIGUIJ1407CAGLYA19610022076290AC
ATOM1408CGLYA19613.2684.33534.5591.0010.15AC
ANISOU1408CGLYA196135711331279−593−2AC
SIGUIJ1408CGLYA19610022076290AC
ATOM1409OGLYA19613.1223.07734.6251.0011.37AO
ANISOU1409OGLYA196157411381455−8612−5AO
SIGUIJ1409OGLYA19610022152289AO
ATOM1410NGLYA19712.2705.17434.2931.0010.34AN
ANISOU1410NGLYA197139012251252300AN
SIGUIJ1410NGLYA19710022159289AN
ATOM1411CAGLYA19710.9504.63934.0221.0010.70AC
ANISOU1411CAGLYA197139912581271−14−51AC
SIGUIJ1411CAGLYA19710022076290AC
ATOM1412CGLYA19710.7754.17932.5721.0010.49AC
ANISOU1412CGLYA1971284116012643200AC
SIGUIJ1412CGLYA19710022076290AC
ATOM1413OGLYA19711.6284.36431.6871.0010.72AO
ANISOU1413OGLYA197130113861252−630AO
SIGUIJ1413OGLYA19710022152289AO
ATOM1414NPROA1989.6593.48732.3331.0010.32AN
ANISOU1414NPROA198129912111147−422−1AN
SIGUIJ1414NPROA19810022159289AN
ATOM1415CDPROA1988.5773.24233.3321.0010.54AC
ANISOU1415CDPROA1981332124711822561AC
SIGUIJ1415CDPROA19810022076290AC
ATOM1416CAPROA1989.4932.68131.1151.0010.29AC
ANISOU1416CAPROA19814381205115836−19−3AC
SIGUIJ1416CAPROA19810022076290AC
ATOM1417CBPROA1988.4621.65531.5681.0010.41AC
ANISOU1417CBPROA198153712781330−3548−7AC
SIGUIJ1417CBPROA19810022076290AC
ATOM1418CGPROA1987.6442.37532.5861.0011.03AC
ANISOU1418CGPROA198143912791276−34−286AC
SIGUIJ1418CGPROA19810022076290AC
ATOM1419CPROA1988.9573.45629.8951.0010.64AC
ANISOU1419CPROA198135011701163−39−143AC
SIGUIJ1419CPROA19810022076290AC
ATOM1420OPROA1988.0364.27630.0001.0011.03AO
ANISOU1420OPROA19814851332133593−2−1AO
SIGUIJ1420OPROA19810022152289AO
ATOM1421NLEUA1999.5113.08928.7321.0010.69AN
ANISOU1421NLEUA199137311621185−10027−12AN
SIGUIJ1421NLEUA19910022159289AN
ATOM1422CALEUA1998.9603.41627.4181.0010.99AC
ANISOU1422CALEUA199146212581196−2812−1AC
SIGUIJ1422CALEUA19910022076290AC
ATOM1423CBLEUA19910.0644.00126.5361.0011.16AC
ANISOU1423CBLEUA199153113571204−10538−15AC
SIGUIJ1423CBLEUA19910022076290AC
ATOM1424CGLEUA1999.6794.33425.0921.0011.53AC
ANISOU1424CGLEUA199167813871215−188−42AC
SIGUIJ1424CGLEUA19910022076290AC
ATOM1425CD1LEUA1998.6815.51725.0231.0012.70AC
ANISOU1425CD1LEUA19919221558220414−716AC
SIGUIJ1425CD1LEUA19910022076290AC
ATOM1426CD2LEUA19910.9534.70424.3281.0012.64AC
ANISOU1426CD2LEUA199187632211286−74046−32AC
SIGUIJ1426CD2LEUA19910022075290AC
ATOM1427CLEUA1998.4892.05526.8701.0011.49AC
ANISOU1427CLEUA1991340124812701481AC
SIGUIJ1427CLEUA19910022075290AC
ATOM1428OLEUA1999.2871.14726.6651.0011.40AO
ANISOU1428OLEUA1991339124513803−30AO
SIGUIJ1428OLEUA19910022152289AO
ATOM1429NAVALA2007.1851.90526.7070.5011.93AN
ANISOU1429NAVALA20013381137140916−10AN
SIGUIJ1429NAVALA20010022159289AN
ATOM1430NBVALA2007.1861.91526.6800.5014.12AN
ANISOU1430NBVALA200134412871383600AN
SIGUIJ1430NBVALA20010022159289AN
ATOM1431CAAVALA2006.6240.63026.2810.5013.23AC
ANISOU1431CAAVALA200157411801391−88−3612AC
SIGUIJ1431CAAVALA20010022075290AC
ATOM1432CABVALA2006.5810.63926.3000.5015.42AC
ANISOU1432CABVALA200164213381400−117−5623AC
SIGUIJ1432CABVALA20010022075290AC
ATOM1433CBAVALA2005.6060.09927.2950.5013.34AC
ANISOU1433CBAVALA200167217571391−334−6270AC
SIGUIJ1433CBAVALA20010022075290AC
ATOM1434CBBVALA2005.4880.24927.3120.5015.53AC
ANISOU1434CBBVALA200183816261527−30482−66AC
SIGUIJ1434CBBVALA20010022075290AC
ATOM1435CG1AVALA2006.292−0.16228.6320.5013.55AC
ANISOU1435CG1AVALA2001665228613421150AC
SIGUIJ1435CG1AVALA20010022075290AC
ATOM1436CG1BVALA2004.723−1.01726.8430.5015.74AC
ANISOU1436CG1BVALA2001410141215760−60AC
SIGUIJ1436CG1BVALA20010022075290AC
ATOM1437CG2AVALA2004.4631.04727.4610.5014.98AC
ANISOU1437CG2AVALA200194121312307−33273AC
SIGUIJ1437CG2AVALA20010022075290AC
ATOM1438CG2BVALA2006.135−0.02228.6790.5017.17AC
ANISOU1438CG2BVALA200214426401587−35−160AC
SIGUIJ1438CG2BVALA20010022075290AC
ATOM1439CAVALA2005.9810.75224.9080.5014.07AC
ANISOU1439CAVALA200149814851367030AC
SIGUIJ1439CAVALA20010022075290AC
ATOM1440CBVALA2005.9870.76224.8970.5016.26AC
ANISOU1440CBVALA200149014951371000AC
SIGUIJ1440CBVALA20010022075290AC
ATOM1441OAVALA2005.3051.74124.5940.5013.73AO
ANISOU1441OAVALA20016461522142272−118−42AO
SIGUIJ1441OAVALA20010022152289AO
ATOM1442OBVALA2005.3521.76824.5510.5015.92AO
ANISOU1442OBVALA200228716561640355−485−204AO
SIGUIJ1442OBVALA20010022152289AO
ATOM1443NCYSA2016.224−0.25624.0710.5015.72AN
ANISOU1443NCYSA201127114721352−39−2−1AN
SIGUIJ1443NCYSA20110022159289AN
ATOM1444CACYSA2015.658−0.27622.7191.0017.44AC
ANISOU1444CACYSA20125182148157312−528−6AC
SIGUIJ1444CACYSA20110022075290AC
ATOM1445CCYSA2015.110−1.67122.4981.0018.94AC
ANISOU1445CCYSA20126022150212610−638−32AC
SIGUIJ1445CCYSA20110022075290AC
ATOM1446OCYSA2015.813−2.65822.6951.0019.18AO
ANISOU1446OCYSA201409525832869839−1856−746AO
SIGUIJ1446OCYSA20110022152289AO
ATOM1447CBCYSA2016.748−0.00521.6741.0017.59AC
ANISOU1447CBCYSA201325639702261−35313922AC
SIGUIJ1447CBCYSA20110022075290AC
ATOM1448SGCYSA2017.9741.25522.0851.0017.50AS
ANISOU1448SGCYSA201222429441746673162133AS
SIGUIJ1448SGCYSA20110022148289AS
ATOM1449NARGA2023.867−1.77122.0561.0020.47AN
ANISOU1449NARGA202269734302998−9−918−237AN
SIGUIJ1449NARGA20210022159289AN
ATOM1450CAARGA2023.429−3.04821.4761.0021.98AC
ANISOU1450CAARGA202350535462423−510−422−111AC
SIGUIJ1450CAARGA20210022075290AC
ATOM1451CBARGA2024.356−3.48420.3221.0023.51AC
ANISOU1451CBARGA202470844643162−225458−188AC
SIGUIJ1451CBARGA20210022075290AC
ATOM1452CGARGA2024.054−2.87218.9671.0025.72AC
ANISOU1452CGARGA202665048203356−316−152AC
SIGUIJ1452CGARGA20210022075290AC
ATOM1453CDARGA2024.130−3.98117.9131.0027.39AC
ANISOU1453CDARGA20215836505034171325−1073−124AC
SIGUIJ1453CDARGA20210022075290AC
ATOM1454NEARGA2023.147−5.03918.1981.0028.89AN
ANISOU1454NEARGA20219882786511675−17721472−268AN
SIGUIJ1454NEARGA20210022159289AN
ATOM1455CZARGA2023.241−6.30917.8021.0029.52AC
ANISOU1455CZARGA20213635775310102−1680−26798AC
SIGUIJ1455CZARGA20210022075290AC
ATOM1456NH1ARGA2024.279−6.72217.0871.0030.11AN
ANISOU1456NH1ARGA202145691249710591146302AN
SIGUIJ1456NH1ARGA20210022159289AN
ATOM1457NH2ARGA2022.286−7.17718.1341.0030.19AN
ANISOU1457NH2ARGA20214220820310911−2155176−83AN
SIGUIJ1457NH2ARGA20210022159289AN
ATOM1458CARGA2023.527−4.07822.5961.0021.91AC
ANISOU1458CARGA202370937012523−122−1AC
SIGUIJ1458CARGA20210022075290AC
ATOM1459OARGA2023.882−5.25222.3601.0022.61AO
ANISOU1459OARGA202440039232787459−1263−433AO
SIGUIJ1459OARGA20210022152289AO
ATOM1460NGLYA2073.247−3.62923.8161.0021.43AN
ANISOU1460NGLYA207294336582516−77−115−13AN
SIGUIJ1460NGLYA20710022159289AN
ATOM1461CAGLYA2073.230−4.55024.9401.0020.55AC
ANISOU1461CAGLYA20723703677256354−174AC
SIGUIJ1461CAGLYA20710022075290AC
ATOM1462CGLYA2074.528−4.91725.6481.0019.61AC
ANISOU1462CGLYA207226927962561−2142513AC
SIGUIJ1462CGLYA20710022074290AC
ATOM1463OGLYA2074.524−5.66226.6301.0020.31AO
ANISOU1463OGLYA207311127992580−291−106AO
SIGUIJ1463OGLYA20710022152289AO
ATOM1464NTHRA2085.648−4.39725.1551.0018.38AN
ANISOU1464NTHRA208214723792325−38−69−12AN
SIGUIJ1464NTHRA20810022159289AN
ATOM1465CATHRA2086.940−4.76425.7041.0017.05AC
ANISOU1465CATHRA208212016712223−212−84−107AC
SIGUIJ1465CATHRA20810022074290AC
ATOM1466CBTHRA2087.852−5.66224.7301.0017.59AC
ANISOU1466CBTHRA208232616682241−14821−19AC
SIGUIJ1466CBTHRA20810022074290AC
ATOM1467OG1THRA2088.404−4.88923.6241.0018.78AO
ANISOU1467OG1THRA208297922052256−732−6449AO
SIGUIJ1467OG1THRA20810022152289AO
ATOM1468CG2THRA2087.041−6.85224.2281.0018.33AC
ANISOU1468CG2THRA208383723522244−1168−32AC
SIGUIJ1468CG2THRA20810022074290AC
ATOM1469CTHRA2087.712−3.50926.0761.0015.64AC
ANISOU1469CTHRA208173815371589−3137−6AC
SIGUIJ1469CTHRA20810022074290AC
ATOM1470OTHRA2087.567−2.41325.4381.0015.24AO
ANISOU1470OTHRA208189215441644−30−222AO
SIGUIJ1470OTHRA20810022152289AO
ATOM1471NLEUA2098.579−3.70427.0461.0014.47AN
ANISOU1471NLEUA209176612831616−84−52AN
SIGUIJ1471NLEUA20910022159289AN
ATOM1472CALEUA2099.498−2.67027.4401.0013.39AC
ANISOU1472CALEUA209177113531409−14784−29AC
SIGUIJ1472CALEUA20910022074290AC
ATOM1473CBLEUA20910.155−3.06628.7761.0013.02AC
ANISOU1473CBLEUA209171412581427−24060−34AC
SIGUIJ1473CBLEUA20910022074290AC
ATOM1474CGLEUA20911.113−1.98029.3561.0012.58AC
ANISOU1474CGLEUA209166212141564−1887−7AC
SIGUIJ1474CGLEUA20910022074290AC
ATOM1475CD1LEUA20910.365−0.76829.7971.0013.15AC
ANISOU1475CD1LEUA209187113001615−55−10AC
SIGUIJ1475CD1LEUA20910022074290AC
ATOM1476CD2LEUA20911.874−2.57030.4951.0013.63AC
ANISOU1476CD2LEUA20918881584158867−12−3AC
SIGUIJ1476CD2LEUA20910022074290AC
ATOM1477CLEUA20910.546−2.45326.3521.0013.39AC
ANISOU1477CLEUA209168412151320−96−31AC
SIGUIJ1477CLEUA20910022074290AC
ATOM1478OLEUA20911.313−3.37726.0341.0014.33AO
ANISOU1478OLEUA209282116432129572764342AO
SIGUIJ1478OLEUA20910022152289AO
ATOM1479NGLNA21010.630−1.24125.8051.0011.99AN
ANISOU1479NGLNA210145612051300−81−21AN
SIGUIJ1479NGLNA21010022158289AN
ATOM1480CAGLNA21011.629−0.96624.7921.0011.62AC
ANISOU1480CAGLNA210146812601294−944−2AC
SIGUIJ1480CAGLNA21010022074290AC
ATOM1481CBGLNA21010.930−0.47123.5281.0011.73AC
ANISOU1481CBGLNA2101575145812873620AC
SIGUIJ1481CBGLNA21010022074290AC
ATOM1482CGGLNA21010.167−1.57622.7671.0011.87AC
ANISOU1482CGGLNA210168515211267−5834−8AC
SIGUIJ1482CGGLNA21010022074290AC
ATOM1483CDGLNA21011.077−2.55322.0891.0012.65AC
ANISOU1483CDGLNA21017341594116631−32−4AC
SIGUIJ1483CDGLNA21010022074290AC
ATOM1484OE1GLNA21012.101−2.18521.5261.0012.72AO
ANISOU1484OE1GLNA210184517441420−28121−21AO
SIGUIJ1484OE1GLNA21010022152289AO
ATOM1485NE2GLNA21010.699−3.84222.0951.0013.51AN
ANISOU1485NE2GLNA210215816251824−1026−1AN
SIGUIJ1485NE2GLNA21010022158289AN
ATOM1486CGLNA21012.6630.08425.2281.0011.48AC
ANISOU1486CGLNA210140912021310−29−41AC
SIGUIJ1486CGLNA21010022074290AC
ATOM1487OGLNA21013.7570.11024.7041.0011.76AO
ANISOU1487OGLNA210142415331356−1216−1AO
SIGUIJ1487OGLNA21010022152289AO
ATOM1488NGLYA21112.3220.94726.1911.0011.15AN
ANISOU1488NGLYA211139812181310−28−82AN
SIGUIJ1488NGLYA21110022158289AN
ATOM1489CAGLYA21113.2471.98026.6501.0011.16AC
ANISOU1489CAGLYA211154713921244−20755−38AC
SIGUIJ1489CAGLYA21110022074290AC
ATOM1490CGLYA21113.1332.22728.1251.0010.56AC
ANISOU1490CGLYA211128612591228010AC
SIGUIJ1490CGLYA21110022074290AC
ATOM1491OGLYA21112.1131.95728.7791.0010.95AO
ANISOU1491OGLYA211127813671229−2500AO
SIGUIJ1491OGLYA21110022152289AO
ATOM1492NLEUA21214.2122.79328.6581.0010.43AN
ANISOU1492NLEUA21212631140116156136AN
SIGUIJ1492NLEUA21210022158289AN
ATOM1493CALEUA21214.2243.41829.9931.0010.26AC
ANISOU1493CALEUA212139811461150−2842−5AC
SIGUIJ1493CALEUA21210022074290AC
ATOM1494CBLEUA21215.2692.77230.9191.0011.19AC
ANISOU1494CBLEUA21215501227128536−83−10AC
SIGUIJ1494CBLEUA21210022074290AC
ATOM1495CGLEUA21215.2021.26931.1241.0011.64AC
ANISOU1495CGLEUA21220811226142710−103−1AC
SIGUIJ1495CGLEUA21210022074290AC
ATOM1496CD1LEUA21216.5030.80131.8121.0013.23AC
ANISOU1496CD1LEUA212235218161871325−396−185AC
SIGUIJ1496CD1LEUA21210022074290AC
ATOM1497CD2LEUA21213.9260.93631.8891.0012.55AC
ANISOU1497CD2LEUA212216616281566−103−153AC
SIGUIJ1497CD2LEUA21210022073290AC
ATOM1498CLEUA21214.5784.86129.8001.009.76AC
ANISOU1498CLEUA2121189114410043−10AC
SIGUIJ1498CLEUA21210022073290AC
ATOM1499OLEUA21215.5205.19729.0891.009.43AO
ANISOU1499OLEUA212130111731133−33127−24AO
SIGUIJ1499OLEUA21210022152289AO
ATOM1500NVALA21313.8335.75130.4601.009.17AN
ANISOU1500NVALA213120911401034−927−2AN
SIGUIJ1500NVALA21310022158289AN
ATOM1501CAVALA21314.1547.18130.3681.009.13AC
ANISOU1501CAVALA213119011391156−3−10AC
SIGUIJ1501CAVALA21310022073290AC
ATOM1502CBVALA21313.2188.03231.2501.009.23AC
ANISOU1502CBVALA213118211411177500AC
SIGUIJ1502CBVALA21310022073290AC
ATOM1503CG1VALA21313.6609.50431.2531.009.48AC
ANISOU1503CG1VALA213143911561104−66−123AC
SIGUIJ1503CG1VALA21310022073290AC
ATOM1504CG2VALA21311.7757.89930.7441.009.96AC
ANISOU1504CG2VALA213118014301270−20−11−2AC
SIGUIJ1504CG2VALA21310022073290AC
ATOM1505CVALA21315.5987.40730.8091.009.37AC
ANISOU1505CVALA2131197116611100−10AC
SIGUIJ1505CVALA21310022073290AC
ATOM1506OVALA21316.0346.90831.8531.009.26AO
ANISOU1506OVALA213122211641104250AO
SIGUIJ1506OVALA21310022152289AO
ATOM1507NSERA21416.3658.17930.0251.009.91AN
ANISOU1507NSERA214123011741149−66−1AN
SIGUIJ1507NSERA21410022158289AN
ATOM1508CASERA21417.7418.49930.4041.0010.45AC
ANISOU1508CASERA214124312181162−3−20AC
SIGUIJ1508CASERA21410022073290AC
ATOM1509CBSERA21418.7217.91529.3751.0010.69AC
ANISOU1509CBSERA2141287133411861217−1AC
SIGUIJ1509CBSERA21410022073290AC
ATOM1510OGSERA21420.0528.25229.7511.0011.37AO
ANISOU1510OGSERA214131716701351−54−5−5AO
SIGUIJ1510OGSERA21410022152289AO
ATOM1511CSERA21417.9399.99530.5981.0010.93AC
ANISOU1511CSERA214150712211162−60−41AC
SIGUIJ1511CSERA21410022073290AC
ATOM1512OSERA21418.23310.42731.7391.0010.97AO
ANISOU1512OSERA214160012661166−112−103AO
SIGUIJ1512OSERA21410022152289AO
ATOM1513NTRPA21517.81810.82729.5471.0011.11AN
ANISOU1513NTRPA215126711741161−1315−5AN
SIGUIJ1513NTRPA21510022158289AN
ATOM1514CATRPA21518.15812.20829.7281.0011.48AC
ANISOU1514CATRPA215148711861222−1939−5AC
SIGUIJ1514CATRPA21510022073290AC
ATOM1515CBTRPA21519.69112.37829.7891.0012.92AC
ANISOU1515CBTRPA215149316811625−25667AC
SIGUIJ1515CBTRPA21510022073290AC
ATOM1516CGTRPA21520.36612.31928.5231.0014.50AC
ANISOU1516CGTRPA215145526741619−221−19−18AC
SIGUIJ1516CGTRPA21510022073290AC
ATOM1517CD2TRPA21520.79113.45227.7271.0015.30AC
ANISOU1517CD2TRPA215203428391760−470−6387AC
SIGUIJ1517CD2TRPA21510022073290AC
ATOM1518CE2TRPA21521.38412.93126.5811.0015.68AC
ANISOU1518CE2TRPA215223031251842−4146−3AC
SIGUIJ1518CE2TRPA21510022073290AC
ATOM1519CE3TRPA21520.72214.85027.8821.0015.92AC
ANISOU1519CE3TRPA215216728422272−4701420AC
SIGUIJ1519CE3TRPA21510022073290AC
ATOM1520CD1TRPA21520.71311.21127.8601.0014.56AC
ANISOU1520CD1TRPA215123226911612−237−109−47AC
SIGUIJ1520CD1TRPA21510022073290AC
ATOM1521NE1TRPA21521.34711.56226.6681.0015.70AN
ANISOU1521NE1TRPA215153731291696−39589AN
SIGUIJ1521NE1TRPA21510022158289AN
ATOM1522CZ2TRPA21521.91213.75725.5641.0015.96AC
ANISOU1522CZ2TRPA215195830761872−263−1233AC
SIGUIJ1522CZ2TRPA21510022073290AC
ATOM1523CZ3TRPA21521.25215.66426.8851.0016.39AC
ANISOU1523CZ3TRPA215216628212253−47323AC
SIGUIJ1523CZ3TRPA21510022073290AC
ATOM1524CH2TRPA21521.83615.10525.7461.0016.48AC
ANISOU1524CH2TRPA215247330882274−23728−19AC
SIGUIJ1524CH2TRPA21510022073290AC
ATOM1525CTRPA21517.59013.04128.5941.0011.26AC
ANISOU1525CTRPA215159212311237−148−176AC
SIGUIJ1525CTRPA21510022073290AC
ATOM1526OTRPA21517.10512.54427.5691.0011.36AO
ANISOU1526OTRPA215155012391220−12316−6AO
SIGUIJ1526OTRPA21510022152289AO
ATOM1527NGLYA21617.66614.36228.7581.0011.41AN
ANISOU1527NGLYA216161212231346−140−10AN
SIGUIJ1527NGLYA21610022158289AN
ATOM1528CAGLYA21617.27415.28127.6981.0011.86AC
ANISOU1528CAGLYA216177312551381−102−4310AC
SIGUIJ1528CAGLYA21610022073290AC
ATOM1529CGLYA21617.58316.71528.1361.0012.19AC
ANISOU1529CGLYA216170012631421−100−226AC
SIGUIJ1529CGLYA21610022073290AC
ATOM1530OGLYA21618.20816.96929.1741.0013.00AO
ANISOU1530OGLYA216198514471491−264−14364AO
SIGUIJ1530OGLYA21610022152289AO
ATOM1531NTHRA21717.14217.66027.3231.0012.59AN
ANISOU1531NTHRA217178412701510−152−12345AN
SIGUIJ1531NTHRA21710022158289AN
ATOM1532CATHRA21717.44619.08127.5391.0012.76AC
ANISOU1532CATHRA217179812901620−17934−22AC
SIGUIJ1532CATHRA21710022073290AC
ATOM1533CBTHRA21717.00619.86126.2841.0013.20AC
ANISOU1533CBTHRA217231814381753−248−19972AC
SIGUIJ1533CBTHRA21710022072290AC
ATOM1534OG1THRA21717.66319.27925.1471.0014.39AO
ANISOU1534OG1THRA217245515961805−206−13636AO
SIGUIJ1534OG1THRA21710022152289AO
ATOM1535CG2THRA21717.28421.34926.3931.0014.24AC
ANISOU1535CG2THRA217380014892134−517−23659AC
SIGUIJ1535CG2THRA21710022072290AC
ATOM1536CTHRA21716.69119.62528.7511.0012.38AC
ANISOU1536CTHRA217168811911556−168−4030AC
SIGUIJ1536CTHRA21710022072290AC
ATOM1537OTHRA21715.56419.24929.0031.0012.39AO
ANISOU1537OTHRA217171313621514−232−4535AO
SIGUIJ1537OTHRA21710022152289AO
ATOM1538NPHEA21817.33420.55929.4651.0012.21AN
ANISOU1538NPHEA218175712541572−226−2820AN
SIGUIJ1538NPHEA21810022158289AN
ATOM1539CAPHEA21816.67221.33230.4891.0011.90AC
ANISOU1539CAPHEA218167512461486−208−9759AC
SIGUIJ1539CAPHEA21810022072290AC
ATOM1540CBPHEA21817.35621.05831.8291.0012.66AC
ANISOU1540CBPHEA218193313861551−188−22679AC
SIGUIJ1540CBPHEA21810022072290AC
ATOM1541CGPHEA21816.65821.72432.9551.0012.87AC
ANISOU1541CGPHEA218173014511439−114−385103AC
SIGUIJ1541CGPHEA21810022072290AC
ATOM1542CD1PHEA21815.70921.01133.6581.0013.77AC
ANISOU1542CD1PHEA218217217571813−381−6148AC
SIGUIJ1542CD1PHEA21810022072290AC
ATOM1543CD2PHEA21816.87823.06633.3111.0013.74AC
ANISOU1543CD2PHEA218158314521407−86−34798AC
SIGUIJ1543CD2PHEA21810022072290AC
ATOM1544CE1PHEA21814.99221.60134.6731.0015.00AC
ANISOU1544CE1PHEA218304422072268−214456−105AC
SIGUIJ1544CE1PHEA21810022072290AC
ATOM1545CE2PHEA21816.14423.61134.3271.0013.52AC
ANISOU1545CE2PHEA21820071966163386−129−59AC
SIGUIJ1545CE2PHEA21810022072290AC
ATOM1546CZPHEA21815.22122.88734.9861.0014.44AC
ANISOU1546CZPHEA218230921502092−19167−12AC
SIGUIJ1546CZPHEA21810022072290AC
ATOM1547CPHEA21816.79922.83230.1141.0011.95AC
ANISOU1547CPHEA218144712371419−177−916AC
SIGUIJ1547CPHEA21810022072290AC
ATOM1548OPHEA21817.88823.29329.7601.0011.79AO
ANISOU1548OPHEA218148715091548−289−938AO
SIGUIJ1548OPHEA21810022152289AO
ATOM1549NPROA21915.71623.60230.2091.0012.08AN
ANISOU1549NPROA219140211671545−231−20−31AN
SIGUIJ1549NPROA21910022158289AN
ATOM1550CDPROA21915.81825.07430.0591.0012.42AC
ANISOU1550CDPROA219199811632680−23716047AC
SIGUIJ1550CDPROA21910022072290AC
ATOM1551CAPROA21914.37523.20230.6681.0012.31AC
ANISOU1551CAPROA219141813121570−249−1−3AC
SIGUIJ1551CAPROA21910022072290AC
ATOM1552CBPROA21913.57224.52530.6781.0012.41AC
ANISOU1552CBPROA219177914491907−2381AC
SIGUIJ1552CBPROA21910022072290AC
ATOM1553CGPROA21914.64225.56030.9201.0012.69AC
ANISOU1553CGPROA219187515322386−98−871AC
SIGUIJ1553CGPROA21910022072290AC
ATOM1554CPROA21913.72622.19529.7311.0012.75AC
ANISOU1554CPROA219155313491561−3128−21AC
SIGUIJ1554CPROA21910022072290AC
ATOM1555OPROA21913.96522.15528.5181.0012.79AO
ANISOU1555OPROA219168613431555−35026−33AO
SIGUIJ1555OPROA21910022152289AO
ATOM1556NCYSA22012.85621.37230.3361.0012.93AN
ANISOU1556NCYSA220150813291644−267928AN
SIGUIJ1556NCYSA22010022158289AN
ATOM1557CACYSA22012.06220.35729.6181.0013.60AC
ANISOU1557CACYSA220154613221772−246−24−18AC
SIGUIJ1557CACYSA22010022072290AC
ATOM1558CCYSA22010.99520.98128.7601.0014.24AC
ANISOU1558CCYSA2201693169917390−10AC
SIGUIJ1558CCYSA22010022072290AC
ATOM1559OCYSA22010.61522.14128.9421.0014.47AO
ANISOU1559OCYSA2201720170418370−80AO
SIGUIJ1559OCYSA22010022152289AO
ATOM1560CBCYSA22011.38819.44230.6141.0013.73AC
ANISOU1560CBCYSA220175413571802−3333−13AC
SIGUIJ1560CBCYSA22010022072290AC
ATOM1561SGCYSA22012.59118.60231.6831.0013.62AS
ANISOU1561SGCYSA220182514041757−22432−41AS
SIGUIJ1561SGCYSA22010022148289AS
ATOM1562NGLYA220A10.39720.12527.9031.0015.11AN
ANISOU1562NGLYA220A183817211732−69−42AN
SIGUIJ1562NGLYA220A10022158289AN
ATOM1563CAGLYA220A9.16420.49327.2611.0016.18AC
ANISOU1563CAGLYA220A18662013171938100AC
SIGUIJ1563CAGLYA220A10022072290AC
ATOM1564CGLYA220A9.31921.38826.0301.0017.12AC
ANISOU1564CGLYA220A244522201770−339−171103AC
SIGUIJ1564CGLYA220A10022072290AC
ATOM1565OGLYA220A8.30721.86525.5991.0017.88AO
ANISOU1565OGLYA220A27132864225617−431−23AO
SIGUIJ1565OGLYA220A10022152289AO
ATOM1566NGLNA22110.49021.59425.4491.0018.02AN
ANISOU1566NGLNA221249718631947−323−7236AN
SIGUIJ1566NGLNA22110022158289AN
ATOM1567CAGLNA22110.57722.38224.1911.0018.94AC
ANISOU1567CAGLNA221266719461980−453−14278AC
SIGUIJ1567CAGLNA22110022072290AC
ATOM1568CBGLNA22112.03322.91223.9781.0020.32AC
ANISOU1568CBGLNA221273521202808−54271−128AC
SIGUIJ1568CBGLNA22110022072290AC
ATOM1569CGGLNA22112.69823.65025.2321.0022.63AC
ANISOU1569CGGLNA221626649612776−3750103−97AC
SIGUIJ1569CGGLNA22110022071290AC
ATOM1570CDGLNA22114.30923.66825.3011.0023.50AC
ANISOU1570CDGLNA221626955762798−3749109−152AC
SIGUIJ1570CDGLNA22110022071290AC
ATOM1571OE1GLNA22115.00423.32424.3111.0024.98AO
ANISOU1571OE1GLNA221670695422425−1564−3460AO
SIGUIJ1571OE1GLNA22110022152289AO
ATOM1572NE2GLNA22114.89324.08226.5071.0024.32AN
ANISOU1572NE2GLNA221494826022776−181490−60AN
SIGUIJ1572NE2GLNA22110022158289AN
ATOM1573CGLNA22110.14821.48923.0081.0018.74AC
ANISOU1573CGLNA221234918461994−295−16394AC
SIGUIJ1573CGLNA22110022071290AC
ATOM1574OGLNA22110.44220.31822.9891.0018.63AO
ANISOU1574OGLNA221283218661658−168−43160AO
SIGUIJ1574OGLNA22110022152289AO
ATOM1575NPROA2229.44222.03621.9941.0018.66AN
ANISOU1575NPROA222244420661903−26−845AN
SIGUIJ1575NPROA22210022158289AN
ATOM1576CDPROA2228.90723.39621.8131.0019.06AC
ANISOU1576CDPROA222324121482479226−555−114AC
SIGUIJ1576CDPROA22210022071290AC
ATOM1577CAPROA2229.12621.15320.8651.0018.29AC
ANISOU1577CAPROA222266220881906−76−9711AC
SIGUIJ1577CAPROA22210022071290AC
ATOM1578CBPROA2228.15321.98420.0081.0018.73AC
ANISOU1578CBPROA222372028242104768−489−244AC
SIGUIJ1578CBPROA22210022071290AC
ATOM1579CGPROA2228.57323.37720.3161.0019.22AC
ANISOU1579CGPROA222465328832550569−865−230AC
SIGUIJ1579CGPROA22210022171290AC
ATOM1580CPROA22210.34820.77020.0821.0018.03AC
ANISOU1580CPROA222241217801354−146−45181AC
SIGUIJ1580CPROA22210022171290AC
ATOM1581OPROA22211.34021.50020.0521.0017.67AO
ANISOU1581OPROA222251019501890−286−507188AO
SIGUIJ1581OPROA22210022152289AO
ATOM1582NASNA22310.27319.62819.4261.0017.53AN
ANISOU1582NASNA223272917931356−225−36079AN
SIGUIJ1582NASNA22310022158289AN
ATOM1583CAASNA22311.35019.14718.5691.0017.54AC
ANISOU1583CAASNA223278019921428−172−32152AC
SIGUIJ1583CAASNA22310022171290AC
ATOM1584CBASNA22311.47920.05717.3211.0018.02AC
ANISOU1584CBASNA223324919761422−171−27833AC
SIGUIJ1584CBASNA22310022171290AC
ATOM1585CGASNA22310.21520.03516.5011.0018.59AC
ANISOU1585CGASNA223326123871455−161−29734AC
SIGUIJ1585CGASNA22310022171290AC
ATOM1586OD1ASNA2239.65018.96816.2511.0018.98AO
ANISOU1586OD1ASNA223316623401973−58−52333AO
SIGUIJ1586OD1ASNA22310022152289AO
ATOM1587ND2ASNA2239.73921.20616.0881.0019.13AN
ANISOU1587ND2ASNA223312323922721−372−737299AN
SIGUIJ1587ND2ASNA22310022158289AN
ATOM1588CASNA22312.67119.04119.3391.0017.09AC
ANISOU1588CASNA223279316971502−204−35859AC
SIGUIJ1588CASNA22310022171290AC
ATOM1589OASNA22313.73819.35118.8531.0017.57AO
ANISOU1589OASNA223292327651808−476−247154AO
SIGUIJ1589OASNA22310022152289AO
ATOM1590NASPA22412.57518.52120.5601.0016.25AN
ANISOU1590NASPA224253817101506−198−36572AN
SIGUIJ1590NASPA22410022158289AN
ATOM1591CAASPA22413.72018.39421.4491.0015.80AC
ANISOU1591CAASPA224249515411476−242−32775AC
SIGUIJ1591CAASPA22410022171290AC
ATOM1592CBASPA22413.63519.53022.4841.0016.19AC
ANISOU1592CBASPA224255915551532−384−15454AC
SIGUIJ1592CBASPA22410022171290AC
ATOM1593CGASPA22414.92919.73523.2421.0016.69AC
ANISOU1593CGASPA224256117771561−421−15967AC
SIGUIJ1593CGASPA22410022171290AC
ATOM1594OD1ASPA22415.90719.00522.9941.0017.24AO
ANISOU1594OD1ASPA224263718662261−364−127AO
SIGUIJ1594OD1ASPA22410022152289AO
ATOM1595OD2ASPA22414.95420.64224.1201.0017.05AO
ANISOU1595OD2ASPA224285118921681−65275−39AO
SIGUIJ1595OD2ASPA22410022152289AO
ATOM1596CASPA22413.58117.04022.1701.0014.99AC
ANISOU1596CASPA224184514781361−19−261AC
SIGUIJ1596CASPA22410022171290AC
ATOM1597OASPA22413.35316.98023.4051.0015.33AO
ANISOU1597OASPA224195117331369−15410AO
SIGUIJ1597OASPA22410022152289AO
ATOM1598NPROA22513.69815.92821.4411.0014.29AN
ANISOU1598NPROA225196614841360−6754−7AN
SIGUIJ1598NPROA22510022158289AN
ATOM1599CDPROA22514.10515.84020.0191.0014.25AC
ANISOU1599CDPROA225260317031416−202249−47AC
SIGUIJ1599CDPROA22510022171290AC
ATOM1600CAPROA22513.22214.64421.9841.0013.59AC
ANISOU1600CAPROA225169314811339−15−614AC
SIGUIJ1600CAPROA22510022171290AC
ATOM1601CBPROA22513.22013.71920.7751.0014.03AC
ANISOU1601CBPROA225242715251340−59−272AC
SIGUIJ1601CBPROA22510022171290AC
ATOM1602CGPROA22514.27914.32319.8331.0014.43AC
ANISOU1602CGPROA225288817021777−198407−66AC
SIGUIJ1602CGPROA22510022171290AC
ATOM1603CPROA22514.12214.11423.0961.0012.87AC
ANISOU1603CPROA22515941510127915101AC
SIGUIJ1603CPROA22510022171290AC
ATOM1604OPROA22515.33414.33623.1341.0013.21AO
ANISOU1604OPROA225160117401530−4120AO
SIGUIJ1604OPROA22510022152289AO
ATOM1605NGLYA22613.48913.43324.0471.0012.02AN
ANISOU1605NGLYA226157515081262−2−160AN
SIGUIJ1605NGLYA22610022158289AN
ATOM1606CAGLYA22614.21712.77825.1381.0011.76AC
ANISOU1606CAGLYA2261492148112170440AC
SIGUIJ1606CAGLYA22610022171290AC
ATOM1607CGLYA22614.91711.52324.6711.0011.47AC
ANISOU1607CGLYA2261455146511500110AC
SIGUIJ1607CGLYA22610022171290AC
ATOM1608OGLYA22614.56810.91423.6421.0011.78AO
ANISOU1608OGLYA226165414871159−6911−3AO
SIGUIJ1608OGLYA22610022152289AO
ATOM1609NVALA22715.94111.15225.4171.0011.46AN
ANISOU1609NVALA227140612341142−7626−9AN
SIGUIJ1609NVALA22710022158289AN
ATOM1610CAVALA22716.80510.02425.1241.0011.12AC
ANISOU1610CAVALA227143712451153−4620−4AC
SIGUIJ1610CAVALA22710022171290AC
ATOM1611CBVALA22718.30310.44225.1801.0011.78AC
ANISOU1611CBVALA227144113351483−7200AC
SIGUIJ1611CBVALA22710022171290AC
ATOM1612CG1VALA22719.1759.31324.6271.0012.98AC
ANISOU1612CG1VALA227187413802701−54678−69AC
SIGUIJ1612CG1VALA22710022171290AC
ATOM1613CG2VALA22718.52411.70124.3191.0012.63AC
ANISOU1613CG2VALA227207015411692−417−314203AC
SIGUIJ1613CG2VALA22710022170290AC
ATOM1614CVALA22716.5558.91026.1271.0010.85AC
ANISOU1614CVALA227158112231175−4111−1AC
SIGUIJ1614CVALA22710022170290AC
ATOM1615OVALA22716.3489.14527.3411.0010.23AO
ANISOU1615OVALA227144312211168−294−1AO
SIGUIJ1615OVALA22710022152289AO
ATOM1616NTYRA22816.5667.70325.5861.0010.02AN
ANISOU1616NTYRA2281415120311694912AN
SIGUIJ1616NTYRA22810022158289AN
ATOM1617CATYRA22816.2226.46326.3081.0010.20AC
ANISOU1617CATYRA228132812171148−226−1AC
SIGUIJ1617CATYRA22810022170290AC
ATOM1618CBTYRA22814.9135.86325.8111.009.96AC
ANISOU1618CBTYRA22813161188121010−30AC
SIGUIJ1618CBTYRA22810022170290AC
ATOM1619CGTYRA22813.7296.77326.0011.009.39AC
ANISOU1619CGTYRA2281307118211502−30AC
SIGUIJ1619CGTYRA22810022170290AC
ATOM1620CD1TYRA22813.5337.89725.1851.009.77AC
ANISOU1620CD1TYRA228142011981189−35−6810AC
SIGUIJ1620CD1TYRA22810022170290AC
ATOM1621CE1TYRA22812.4928.74925.3881.0010.19AC
ANISOU1621CE1TYRA228141312061165−44−5610AC
SIGUIJ1621CE1TYRA22810022170290AC
ATOM1622CD2TYRA22812.8026.53827.0061.009.93AC
ANISOU1622CD2TYRA228131512251146−26−71AC
SIGUIJ1622CD2TYRA22810022170290AC
ATOM1623CE2TYRA22811.7467.36027.1921.0010.22AC
ANISOU1623CE2TYRA2281341128911054−37−2AC
SIGUIJ1623CE2TYRA22810022170290AC
ATOM1624CZTYRA22811.5868.47126.4041.0010.10AC
ANISOU1624CZTYRA228139113091156−46−7323AC
SIGUIJ1624CZTYRA22810022170290AC
ATOM1625OHTYRA22810.4789.26526.6511.0011.60AO
ANISOU1625OHTYRA22814811416167019567AO
SIGUIJ1625OHTYRA22810022152289AO
ATOM1626CTYRA22817.2905.43626.0991.0010.30AC
ANISOU1626CTYRA228132712241215−208−2AC
SIGUIJ1626CTYRA22810022170290AC
ATOM1627OTYRA22817.9305.37625.0131.0010.72AO
ANISOU1627OTYRA22815341590128010137−24AO
SIGUIJ1627OTYRA22810022152289AO
ATOM1628NTHRA22917.5354.60827.1171.0010.63AN
ANISOU1628NTHRA229135312171224−117−1AN
SIGUIJ1628NTHRA22910022158289AN
ATOM1629CATHRA22918.3293.40226.9441.0010.92AC
ANISOU1629CATHRA229131612111479−3037−6AC
SIGUIJ1629CATHRA22910022170290AC
ATOM1630CBTHRA22918.7532.86528.3051.0011.62AC
ANISOU1630CBTHRA229156414411509151911AC
SIGUIJ1630CBTHRA22910022170290AC
ATOM1631OG1THRA22919.4873.87228.9481.0012.39AO
ANISOU1631OG1THRA229181016161576−469−2AO
SIGUIJ1631OG1THRA22910022152289AO
ATOM1632CG2THRA22919.6791.68028.2261.0012.39AC
ANISOU1632CG2THRA229181215631817322−11−29AC
SIGUIJ1632CG2THRA22910022170290AC
ATOM1633CTHRA22917.4802.35726.2221.0011.11AC
ANISOU1633CTHRA2291311118214301240AC
SIGUIJ1633CTHRA22910022170290AC
ATOM1634OTHRA22916.3452.04126.6271.0011.43AO
ANISOU1634OTHRA229137412781621−28140−30AO
SIGUIJ1634OTHRA22910022152289AO
ATOM1635NGLNA23018.0561.75125.1721.0011.04AN
ANISOU1635NGLNA2301353121414097000AN
SIGUIJ1635NGLNA23010022158289AN
ATOM1636CAGLNA23017.3360.79124.3221.0011.88AC
ANISOU1636CAGLNA230149112911412−17−81AC
SIGUIJ1636CAGLNA23010022170290AC
ATOM1637CBGLNA23017.9190.83822.8991.0012.79AC
ANISOU1637CBGLNA2301649165714350571AC
SIGUIJ1637CBGLNA23010022170290AC
ATOM1638CGGLNA23017.081−0.00221.9221.0013.79AC
ANISOU1638CGGLNA230178816611507−12−513AC
SIGUIJ1638CGGLNA23010022170290AC
ATOM1639CDGLNA23017.5840.00920.4821.0014.47AC
ANISOU1639CDGLNA2302306208915555912220AC
SIGUIJ1639CDGLNA23010022170290AC
ATOM1640OE1GLNA23016.787−0.26019.5271.0016.05AO
ANISOU1640OE1GLNA230273224411836−9−214−4AO
SIGUIJ1640OE1GLNA23010022152289AO
ATOM1641NE2GLNA23018.8600.28720.3141.0014.61AN
ANISOU1641NE2GLNA2302271165211071677613AN
SIGUIJ1641NE2GLNA23010022158289AN
ATOM1642CGLNA23017.450−0.61324.9131.0011.68AC
ANISOU1642CGLNA230148312911411−9−60AC
SIGUIJ1642CGLNA23010022170290AC
ATOM1643OGLNA23018.462−1.28724.7621.0011.87AO
ANISOU1643OGLNA2301507134416083015−2AO
SIGUIJ1643OGLNA23010022152289AO
ATOM1644NVALA23116.404−1.04325.6091.0011.59AN
ANISOU1644NVALA2311481125014083−20AN
SIGUIJ1644NVALA23110022158289AN
ATOM1645CAVALA23116.447−2.21926.4661.0012.21AC
ANISOU1645CAVALA23116121250144034294AC
SIGUIJ1645CAVALA23110022170290AC
ATOM1646CBVALA23115.087−2.34727.2661.0011.61AC
ANISOU1646CBVALA231160013171383440AC
SIGUIJ1646CBVALA23110022170290AC
ATOM1647CG1VALA23115.023−3.63328.0141.0012.29AC
ANISOU1647CG1VALA23122961338149312929441AC
SIGUIJ1647CG1VALA23110022170290AC
ATOM1648CG2VALA23114.982−1.16228.2571.0012.18AC
ANISOU1648CG2VALA231185813171395−3979−6AC
SIGUIJ1648CG2VALA23110022170290AC
ATOM1649CVALA23116.754−3.51325.7011.0012.35AC
ANISOU1649CVALA23116081247149542255AC
SIGUIJ1649CVALA23110022170290AC
ATOM1650OVALA23117.418−4.39826.2421.0012.73AO
ANISOU1650OVALA231182513611477194178AO
SIGUIJ1650OVALA23110022152289AO
ATOM1651NCYSA23216.270−3.61224.4641.0013.22AN
ANISOU1651NCYSA23217371327155076−34−9AN
SIGUIJ1651NCYSA23210022158289AN
ATOM1652CACYSA23216.490−4.83423.6611.0014.33AC
ANISOU1652CACYSA23216991321164257−5−3AC
SIGUIJ1652CACYSA23210022170290AC
ATOM1653CCYSA23217.967−5.14023.4081.0014.77AC
ANISOU1653CCYSA2321706148518709920AC
SIGUIJ1653CCYSA23210022169290AC
ATOM1654OCYSA23218.307−6.24922.9351.0015.41AO
ANISOU1654OCYSA232232516062081356−158−129AO
SIGUIJ1654OCYSA23210022152289AO
ATOM1655CBCYSA23215.736−4.75222.3121.0014.90AC
ANISOU1655CBCYSA232197917521751299−178−142AC
SIGUIJ1655CBCYSA23210022169290AC
ATOM1656SGCYSA23216.414−3.48121.1721.0015.55AS
ANISOU1656SGCYSA232215518601847211−149−82AS
SIGUIJ1656SGCYSA23210022148289AS
ATOM1657NLYSA23318.841−4.18323.6611.0014.58AN
ANISOU1657NLYSA233179416051614−1855−5AN
SIGUIJ1657NLYSA23310022158289AN
ATOM1658CALYSA23320.281−4.34523.4411.0014.96AC
ANISOU1658CALYSA2331793191615892034−1AC
SIGUIJ1658CALYSA23310022169290AC
ATOM1659CBLYSA23320.929−3.01323.0481.0015.39AC
ANISOU1659CBLYSA2331886193016830800AC
SIGUIJ1659CBLYSA23310022169290AC
ATOM1660CGLYSA23320.379−2.38721.7451.0015.68AC
ANISOU1660CGLYSA2332041195817091150AC
SIGUIJ1660CGLYSA23310022169290AC
ATOM1661CDLYSA23320.467−3.33720.5171.0016.47AC
ANISOU1661CDLYSA2332745199417069500AC
SIGUIJ1661CDLYSA23310022169290AC
ATOM1662CELYSA23319.967−2.64119.2321.0017.46AC
ANISOU1662CELYSA2332704217216892289027AC
SIGUIJ1662CELYSA23310022169290AC
ATOM1663NZLYSA23320.709−1.42918.8921.0018.10AN
ANISOU1663NZLYSA23329102235216514827453AN
SIGUIJ1663NZLYSA23310022158289AN
ATOM1664CLYSA23320.980−4.90424.7011.0015.08AC
ANISOU1664CLYSA2331856189316249−111AC
SIGUIJ1664CLYSA23310022169290AC
ATOM1665OLYSA23322.189−5.17624.6401.0015.49AO
ANISOU1665OLYSA23318922582199916914−11AO
SIGUIJ1665OLYSA23310022152289AO
ATOM1666NPHEA23420.240−5.09425.8001.0015.18AN
ANISOU1666NPHEA234181713741619144−20−10AN
SIGUIJ1666NPHEA23410022158289AN
ATOM1667CAPHEA23420.859−5.41927.1041.0015.35AC
ANISOU1667CAPHEA234226115371671459−178−108AC
SIGUIJ1667CAPHEA23410022169290AC
ATOM1668CBPHEA23420.684−4.19128.0691.0014.40AC
ANISOU1668CBPHEA2341588141815212161926AC
SIGUIJ1668CBPHEA23410022169290AC
ATOM1669CGPHEA23421.476−3.01227.6491.0013.96AC
ANISOU1669CGPHEA23418111528142248243AC
SIGUIJ1669CGPHEA23410022169290AC
ATOM1670CD1PHEA23420.887−1.97826.9831.0013.80AC
ANISOU1670CD1PHEA23418311597140612611340AC
SIGUIJ1670CD1PHEA23410022169290AC
ATOM1671CD2PHEA23422.840−2.95827.9241.0013.70AC
ANISOU1671CD2PHEA23418131989164532−180AC
SIGUIJ1671CD2PHEA23410022169290AC
ATOM1672CE1PHEA23421.600−0.88226.5701.0013.55AC
ANISOU1672CE1PHEA23419291642131138878AC
SIGUIJ1672CE1PHEA23410022169290AC
ATOM1673CE2PHEA23423.558−1.86827.5211.0013.95AC
ANISOU1673CE2PHEA234189820161674−1060AC
SIGUIJ1673CE2PHEA23410022169290AC
ATOM1674CZPHEA23422.926−0.81726.8321.0013.72AC
ANISOU1674CZPHEA234193920211667560AC
SIGUIJ1674CZPHEA23410022169290AC
ATOM1675CPHEA23420.267−6.69527.7391.0016.19AC
ANISOU1675CPHEA234204714581584530−224−168AC
SIGUIJ1675CPHEA23410022169290AC
ATOM1676OPHEA23420.407−6.95228.9141.0015.82AO
ANISOU1676OPHEA234229216051585596−200−134AO
SIGUIJ1676OPHEA23410022152289AO
ATOM1677NTHRA23519.631−7.51326.9021.0017.36AN
ANISOU1677NTHRA235332816142113297−943−160AN
SIGUIJ1677NTHRA23510022158289AN
ATOM1678CATHRA23518.984−8.75427.3501.0018.36AC
ANISOU1678CATHRA235365716592822242−637−74AC
SIGUIJ1678CATHRA23510022169290AC
ATOM1679CBTHRA23518.554−9.62026.1251.0019.04AC
ANISOU1679CBTHRA235323917692587−218−15927AC
SIGUIJ1679CBTHRA23510022169290AC
ATOM1680OG1THRA23517.678−8.86425.3311.0020.24AO
ANISOU1680OG1THRA235378622372696253−320−59AO
SIGUIJ1680OG1THRA23510022152289AO
ATOM1681CG2THRA23517.874−10.90226.5701.0019.96AC
ANISOU1681CG2THRA235474521262800−925101−39AC
SIGUIJ1681CG2THRA23510022169290AC
ATOM1682CTHRA23519.912−9.62528.1741.0018.18AC
ANISOU1682CTHRA235325216292358211−204−35AC
SIGUIJ1682CTHRA23510022169290AC
ATOM1683OTHRA23519.536−10.10629.2391.0018.19AO
ANISOU1683OTHRA235313214972331257−231−64AO
SIGUIJ1683OTHRA23510022152289AO
ATOM1684NLYSA23621.101−9.82127.6311.0018.29AN
ANISOU1684NLYSA236312717601798232−481−77AN
SIGUIJ1684NLYSA23610022158289AN
ATOM1685CALYSA23622.054−10.72828.2491.0018.63AC
ANISOU1685CALYSA236336320221616529−414−132AC
SIGUIJ1685CALYSA23610022169290AC
ATOM1686CBLYSA23623.253−10.96827.3401.0019.90AC
ANISOU1686CBLYSA2363742241121457273214AC
SIGUIJ1686CBLYSA23610022169290AC
ATOM1687CGLYSA23624.209−11.97427.9021.0021.31AC
ANISOU1687CGLYSA2364377272823741155−279−150AC
SIGUIJ1687CGLYSA23610022169290AC
ATOM1688CDLYSA23625.310−12.23826.8971.0022.84AC
ANISOU1688CDLYSA236689250544324327519151570AC
SIGUIJ1688CDLYSA23610022169290AC
ATOM1689CELYSA23626.216−13.34527.3701.0023.64AC
ANISOU1689CELYSA2366392305645721820−527−327AC
SIGUIJ1689CELYSA23610022169290AC
ATOM1690NZLYSA23627.456−13.34026.5621.0025.02AN
ANISOU1690NZLYSA236679713244553520519592AN
SIGUIJ1690NZLYSA23610022158289AN
ATOM1691CLYSA23622.526−10.12829.5581.0017.98AC
ANISOU1691CLYSA2362715199317061022−413−322AC
SIGUIJ1691CLYSA23610022169290AC
ATOM1692OLYSA23622.612−10.84030.5371.0017.65AO
ANISOU1692OLYSA2363107205317461159−367−267AO
SIGUIJ1692OLYSA23610022152289AO
ATOM1693NTRPA23722.889−8.85329.5671.0017.03AN
ANISOU1693NTRPA2372618199317811025−409−346AN
SIGUIJ1693NTRPA23710022158289AN
ATOM1694CATRPA23723.384−8.25130.8101.0016.42AC
ANISOU1694CATRPA237245519881665736−256−201AC
SIGUIJ1694CATRPA23710022169290AC
ATOM1695CBTRPA23723.834−6.81130.5421.0016.54AC
ANISOU1695CBTRPA237290020571693573−339−161AC
SIGUIJ1695CBTRPA23710022168290AC
ATOM1696CGTRPA23724.301−6.10631.8301.0016.18AC
ANISOU1696CGTRPA2372308200514481997223AC
SIGUIJ1696CGTRPA23710022168290AC
ATOM1697CD2TRPA23723.479−5.30832.7101.0016.10AC
ANISOU1697CD2TRPA2372256188415416816821AC
SIGUIJ1697CD2TRPA23710022168290AC
ATOM1698CE2TRPA23724.264−4.99533.8441.0016.17AC
ANISOU1698CE2TRPA237271518631796162−178−32AC
SIGUIJ1698CE2TRPA23710022168290AC
ATOM1699CE3TRPA23722.168−4.85232.6481.0015.70AC
ANISOU1699CE3TRPA237222216591712−13160−4AC
SIGUIJ1699CE3TRPA23710022168290AC
ATOM1700CD1TRPA23725.489−6.21432.4201.0016.78AC
ANISOU1700CD1TRPA237243621821896260−158−85AC
SIGUIJ1700CD1TRPA23710022168290AC
ATOM1701NE1TRPA23725.485−5.55733.6341.0016.57AN
ANISOU1701NE1TRPA237277821691886304−182−68AN
SIGUIJ1701NE1TRPA23710022158289AN
ATOM1702CZ2TRPA23723.766−4.24734.9441.0015.98AC
ANISOU1702CZ2TRPA237272415961905−22888−20AC
SIGUIJ1702CZ2TRPA23710022168290AC
ATOM1703CZ3TRPA23721.680−4.10633.7621.0016.00AC
ANISOU1703CZ3TRPA237233316991868−218354−114AC
SIGUIJ1703CZ3TRPA23710022168290AC
ATOM1704CH2TRPA23722.476−3.83234.8611.0016.05AC
ANISOU1704CH2TRPA237271414992033−26087−25AC
SIGUIJ1704CH2TRPA23710022168290AC
ATOM1705CTRPA23722.294−8.32231.8961.0016.26AC
ANISOU1705CTRPA237234118151571676−369−261AC
SIGUIJ1705CTRPA23710022168290AC
ATOM1706OTRPA23722.574−8.59033.0531.0015.65AO
ANISOU1706OTRPA237226118821557952−312−302AO
SIGUIJ1706OTRPA23710022152289AO
ATOM1707NILEA23821.056−8.02531.5421.0016.04AN
ANISOU1707NILEA238231314081693542−360−201AN
SIGUIJ1707NILEA23810022158289AN
ATOM1708CAILEA23820.021−8.05032.5741.0016.27AC
ANISOU1708CAILEA238236114251756531−302−181AC
SIGUIJ1708CAILEA23810022168290AC
ATOM1709CBILEA23818.660−7.60631.9531.0015.62AC
ANISOU1709CBILEA238233014401715506−265−149AC
SIGUIJ1709CBILEA23810022168290AC
ATOM1710CG2ILEA23817.504−7.90432.9101.0015.95AC
ANISOU1710CG2ILEA238254219602066479−14−10AC
SIGUIJ1710CG2ILEA23810022168290AC
ATOM1711CG1ILEA23818.744−6.11831.5731.0015.59AC
ANISOU1711CG1ILEA238237514622087558−65−65AC
SIGUIJ1711CG1ILEA23810022168290AC
ATOM1712CD1ILEA23817.582−5.63030.6311.0016.30AC
ANISOU1712CD1ILEA238239818052074675−40−45AC
SIGUIJ1712CD1ILEA23810022168290AC
ATOM1713CILEA23819.877−9.45533.1931.0016.58AC
ANISOU1713CILEA238291714551938494−247−97AC
SIGUIJ1713CILEA23810022168290AC
ATOM1714OILEA23819.856−9.65834.4351.0016.17AO
ANISOU1714OILEA238261813141932523−241−124AO
SIGUIJ1714OILEA23810022152289AO
ATOM1715NASNA23919.772−10.46232.3221.0017.40AN
ANISOU1715NASNA239272014902022587−317−168AN
SIGUIJ1715NASNA23910022158289AN
ATOM1716CAASNA23919.560−11.82332.8381.0018.45AC
ANISOU1716CAASNA239334515202166463−392−119AC
SIGUIJ1716CAASNA23910022168290AC
ATOM1717CBASNA23919.189−12.77431.6911.0020.04AC
ANISOU1717CBASNA239598019001951−956−6315AC
SIGUIJ1717CBASNA23910022168290AC
ATOM1718CGASNA23917.805−12.46831.1221.0021.83AC
ANISOU1718CGASNA239676178105084260−1304222AC
SIGUIJ1718CGASNA23910022168290AC
ATOM1719OD1ASNA23916.900−11.96331.8291.0023.50AO
ANISOU1719OD1ASNA239772276607052−1110−1AO
SIGUIJ1719OD1ASNA23910022152289AO
ATOM1720ND2ASNA23917.616−12.77929.8371.0023.10AN
ANISOU1720ND2ASNA239790991165160−83−1388−43AN
SIGUIJ1720ND2ASNA23910022158289AN
ATOM1721CASNA23920.751−12.32233.6241.0018.28AC
ANISOU1721CASNA239333316892087528−329−114AC
SIGUIJ1721CASNA23910022168290AC
ATOM1722OASNA23920.609−12.85934.7271.0018.24AO
ANISOU1722OASNA239322916062117838−192−107AO
SIGUIJ1722OASNA23910022152289AO
ATOM1723NASPA24021.916−12.03733.1291.0017.82AN
ANISOU1723NASPA240329513421956607−371−137AN
SIGUIJ1723NASPA24010022158289AN
ATOM1724CAASPA24023.106−12.57533.7511.0018.10AC
ANISOU1724CAASPA2403799233424361243−775−496AC
SIGUIJ1724CAASPA24010022168290AC
ATOM1725CBASPA24024.292−12.40632.8521.0019.02AC
ANISOU1725CBASPA2404137196431261487−286−241AC
SIGUIJ1725CBASPA24010022168290AC
ATOM1726CGASPA24024.312−13.41131.7191.0019.82AC
ANISOU1726CGASPA240410515502819841274121AC
SIGUIJ1726CGASPA24010022168290AC
ATOM1727OD1ASPA24023.383−14.23231.5631.0020.77AO
ANISOU1727OD1ASPA24043011803299061828487AO
SIGUIJ1727OD1ASPA24010022152289AO
ATOM1728OD2ASPA24025.296−13.32131.0071.0021.46AO
ANISOU1728OD2ASPA240428040633184794513375AO
SIGUIJ1728OD2ASPA24010022152289AO
ATOM1729CASPA24023.423−11.89735.0571.0017.51AC
ANISOU1729CASPA240202616561996578715AC
SIGUIJ1729CASPA24010022168290AC
ATOM1730OASPA24023.894−12.54535.9961.0017.50AO
ANISOU1730OASPA240315516562025974−314−198AO
SIGUIJ1730OASPA24010022152289AO
ATOM1731NTHRA24123.229−10.57435.1301.0016.51AN
ANISOU1731NTHRA241155416422153499−2518AN
SIGUIJ1731NTHRA24110022158289AN
ATOM1732CATHRA24123.519−9.85336.3741.0015.98AC
ANISOU1732CATHRA2411904178421512266−4AC
SIGUIJ1732CATHRA24110022168290AC
ATOM1733CBTHRA24123.335−8.34436.1681.0015.61AC
ANISOU1733CBTHRA241227217791728242−129−53AC
SIGUIJ1733CBTHRA24110022168290AC
ATOM1734OG1THRA24124.246−7.92435.1361.0016.03AO
ANISOU1734OG1THRA241239218871843240−16−7AO
SIGUIJ1734OG1THRA24110022152289AO
ATOM1735CG2THRA24123.548−7.56537.4961.0015.96AC
ANISOU1735CG2THRA241300618041768311−300−72AC
SIGUIJ1735CG2THRA24110022168290AC
ATOM1736CTHRA24122.581−10.36637.4661.0015.67AC
ANISOU1736CTHRA24118351394215438921−17AC
SIGUIJ1736CTHRA24110022168290AC
ATOM1737OTHRA24122.981−10.53038.6321.0015.41AO
ANISOU1737OTHRA241195314602163397−25AO
SIGUIJ1737OTHRA24110022152289AO
ATOM1738NMETA24221.309−10.61437.1531.0015.65AN
ANISOU1738NMETA24218301169220941821−13AN
SIGUIJ1738NMETA24210022158289AN
ATOM1739CAMETA24220.454−11.16938.1821.0016.26AC
ANISOU1739CAMETA242183413522191308−3111AC
SIGUIJ1739CAMETA24210022168290AC
ATOM1740CBMETA24219.019−11.30637.6881.0016.02AC
ANISOU1740CBMETA242187215072567294−15323AC
SIGUIJ1740CBMETA24210022167290AC
ATOM1741CGMETA24218.363−9.92437.4741.0015.38AC
ANISOU1741CGMETA242183914981717289−44−48AC
SIGUIJ1741CGMETA24210022167290AC
ATOM1742SDMETA24216.600−9.97437.0991.0015.58AS
ANISOU1742SDMETA242187616382298288−182−86AS
SIGUIJ1742SDMETA24210022148289AS
ATOM1743CEMETA24216.608−10.89835.5801.0016.03AC
ANISOU1743CEMETA24222221519225229−10AC
SIGUIJ1743CEMETA24210022167290AC
ATOM1744CMETA24220.951−12.55238.6221.0017.07AC
ANISOU1744CMETA242217613932258422113AC
SIGUIJ1744CMETA24210022167290AC
ATOM1745OMETA24220.917−12.83939.8311.0017.17AO
ANISOU1745OMETA242221117772277403581AO
SIGUIJ1745OMETA24210022152289AO
ATOM1746NLYSA24321.351−13.40237.6651.0018.03AN
ANISOU1746NLYSA2432213142522964340−21AN
SIGUIJ1746NLYSA24310022158289AN
ATOM1747CALYSA24321.732−14.77038.0341.0019.06AC
ANISOU1747CALYSA243222514242431426−36AC
SIGUIJ1747CALYSA24310022167290AC
ATOM1748CBLYSA24321.848−15.65536.7901.0019.69AC
ANISOU1748CBLYSA2434005140124305226517AC
SIGUIJ1748CBLYSA24310022167290AC
ATOM1749CGLYSA24320.535−15.89036.0351.0021.32AC
ANISOU1749CGLYSA243446130803739308−657−170AC
SIGUIJ1749CGLYSA24310022167290AC
ATOM1750CDLYSA24320.933−16.54334.7001.0022.30AC
ANISOU1750CDLYSA2431092225634249114136421AC
SIGUIJ1750CDLYSA24310022167290AC
ATOM1751CELYSA