EXAMPLE 1

Assay Method for Base Alteration and Preferred Oligonucleotide Selection

[0052] In this example, single-stranded and double-hairpin oligonucleotides with chimeric backbones (see FIG. 1 for structures (A and B) and sequences (C and D) of assay oligonucleotides) are used to correct a point mutation in the kanamycin gene of pK^sm4021 (FIG. 2) or the tetracycline gene of pT^sΔ208 (FIG. 3). All kan oligonucleotides share the same 25 base sequence surrounding the target base identified for change, just as all tet oligonucleotides do. The sequence is given in FIG. 1C and FIG. 1D. Each plasmid contains a functional ampicillin gene. Kanamycin gene function is restored when a G at position 4021 is converted to a C (via a substitution mutation); tetracycline gene function is restored when a deletion at position 208 is replaced by a C (via frameshift mutation). A separate plasmid, pAURNeo(−)FIAsH (FIG. 9), bearing the kan^s gene is used in the cell culture experiments. This plasmid was constructed by inserting a synthetic expression cassette containing a neomycin phosphotransferasea (kanamycin resistance) gene and an extended reading frame that encodes a receptor for the FIAsH ligand into the pAUR123 shuttle vector (Panvera Corp., Madison, Wis.). The resulting construct replicates in S. cerevisiae at low copy number, confers resistance to aureobasidinA and constitutively expresses either the Neo+/FIAsH fusion product (after alteration) or the truncated Neo−/FIAsH product (before alteration) from the ADH1 promoter. By extending the reading frame of this gene to code for a unique peptide sequence capable of binding a small ligand to form a fluorescent complex, restoration of expression by correction of the stop codon can be detected in real time using confocal microscopy.

[0053] Additional constructs can be made to test additional gene alteration events or for specific use in different expression systems. For example, alternative comparable plant plasmids or integration vectors such as, e.g. those based on T-DNA, can be constructed for stable expression in plant cells according to the disclosures herein. Such constructs would use a plant specific promoter such as, e.g., cauliflower mosaic virus 35S promoter, to replace the promoters directing expression of the neo, hyg or aureobasidinA resistance gene disclosed herein, including for example, in FIGS. 7B, 9 and 10 herein. Moreover, the green fluorescent protein (GFP) sequence used herein may be modified to increase expression in plant cells such as Arabidopsis and the other plants disclosed herein as described in Haseloff et al., Proc. Natl.Acad. Sci. 94(6): 2122-7 (1997), Rouwendal et al. Plant Mol. Biol. 33(6): 989-99 (1997) and Hu et al. FEBS Lett. 369(2-3): 331-4 (1995). Codon usage for optimal expression of GFP in plants results from increasing the frequency of codons with a C or a G in the third position from 32 to about 60%. Specific constructs are disclosed and can be used as follows with such plant specific alterations.

[0054] We also construct three mammalian expression vectors, pHyg(rep)eGFP, pHyg(Δ)eGFP, pHyg(ins)eGFP, that contain a substitution mutation at nucleotide 137 of the hygromycin-B coding sequence. (rep) indicates a T1374→G replacement, (Δ) represents a deletion of the G137 and (ins) represents an A insertion between nucleotides 136 and 137. All point mutations create a nonsense termination codon at residue 46. We use pHYGeGFP plasmid (Invitrogen, CA) DNA as a template to introduce the mutations into the hygromycin-eGFP fusion gene by a two step site-directed mutagenesis PCR protocol. First, we generate overlapping 5′ and a 3′ amplicons surrounding the mutation site by PCR for each of the point mutation sites. A 215 bp 5′ amplicon for the (rep), (Δ) or (ins) was generated by polymerization from oligonucleotide primer HygEGFPf (5′-AATACGACTCACTATAGG-3′; SEQ ID NO: 2701) to primer Hygrepr (5′GACCTATCCACGCCCTCC-3′; SEQ ID NO: 2702), HygΔr (5′-GACTATCCACGCCCTCC-3′; SEQ ID NO: 2703), or Hyginsr (5′-GACATTATCCACGCCCTCC-3′; SEQ ID NO: 2704), respectively. We generate a 300 bp 3′ amplicon for the (rep), (Δ) or (ins) by polymerization from oligonucleotide primers Hygrepf (5′-CTGGGATAGGTCCTGCGG-3′; SEQ ID NO: 2705), HygΔf (5′-CGTGGATAGTCCTGCGG-3′; SEQ ID NO: 2706), Hyginsf (5′-CGTGGATAATGTCCTGCGG-3′; SEQ ID NO: 2707), respectively to primer HygEGFPr (5′-AAATCACGCCATGTAGTG-3′; SEQ ID NO: 2708). We mix 20 ng of each of the resultant 5′ and 3′ overlapping amplicon mutation sets and use the mixture as a template to amplify a 523 bp fragment of the Hygromycin gene spanning the KpnI and RsrII restriction endonuclease sites. We use the Expand PCR system (Roche) to generate all amplicons with 25 cycles of denaturing at 94° C. for 10 seconds, annealing at 55° C. for 20 seconds and elongation at 68° C. for 1 minute. We digest 10 μg of vector pHYGeGFP and 5 μg of the resulting fragments for each mutation with KpnI and RsrII (NEB) and gel purify the fragment for enzymatic ligation. We ligate each mutated insert into pHYGeGFP vector at 3:1 molar ratio using T4 DNA ligase (Roche). We screen clones by restriction digest, confirm the mutation by Sanger dideoxy chain termination sequencing and purify the plasmid using a Qiagen maxiprep kit.

[0055] Oligonucleotide synthesis and cells. Chimeric oligonucleotides and single-stranded oligonucleotides (including those with the indicated modifications) are synthesized using available phosphoramidites on controlled pore glass supports. After deprotection and detachment from the solid support, each oligonucleotide is gel-purified using, for example, procedures such as those described in Gamper et al., Biochem. 39, 5808-5816 (2000) and the concentrations determined spectrophotometrically (33 or 40 μg/ml per A₂₆₀ unit of single-stranded or hairpin oligomer). HUH7 cells are grown in DMEM, 10% FBS, 2 mM glutamine, 0.5% pen/strep. The E.coli strain, DH10B, is obtained from Life Technologies (Gaithersburg, Md.); DH10B cells contain a mutation in the RECA gene (recA).

[0056] Cell-free extracts. Although this portion of this example is directed to mammalian systems, similar extracts from plants can be prepared as disclosed elsewhere in this application and used as disclosed in this example. We prepare cell-free extracts from HUH7 cells or other mammalian cells, as follows. We employ this protocol with essentially any mammalian cell including, for example, H1299 cells (human epithelial carcinoma, non-small cell lung cancer), C127I (immortal murine mammary epithelial cells), MEF (mouse embryonic fibroblasts), HEC-1-A (human uterine carcinoma), HCT15 (human colon cancer), HCT116 (human colon carcinoma), LoVo (human colon adenocarcinoma), and HeLa (human cervical carcinoma). We harvest approximately 2×10⁸ cells. We then wash the cells immediately in cold hypotonic buffer (20 mM HEPES, pH7.5; 5 mM KCl; 1.5 mM MgCl₂; 1 mM DTT) with 250 mM sucrose. We then resuspend the cells in cold hypotonic buffer without sucrose and after 15 minutes we lyse the cells with 25 strokes of a Dounce homogenizer using a tight fitting pestle. We incubate the lysed cells for 60 minutes on ice and centrifuge the sample for 15 minutes at 12000×g. The cytoplasmic fraction is enriched with nuclear proteins due to the extended co-incubation of the fractions following cell breakage. We then immediately aliquote and freeze the supernatant at −80° C. We determine the protein concentration in the extract by the Bradford assay.

[0057] We also perform these experiments with cell-free extracts obtained from fungal cells, including, for example, S. cerevisiae (yeast), Ustilago maydis, and Candida albicans. For example, we grow yeast cells into log phase in 2L YPD medium for 3 days at 30° C. We then centrifuge the cultures at 5000×g, resuspend the pellets in a 10% sucrose, 50 mM Tris, 1 mM EDTA lysis solution and freeze them on dry ice. After thawing, we add KCl, spermidine and lyticase to final concentrations of 0.25 mM, 5 mM and 0.1 mg/ml, respectively. We incubate the suspension on ice for 60 minutes, add PMSF and Triton X100 to final concentrations of 0.1 mM and 0.1% and continue to incubate on ice for 20 minutes. We centrifuge the lysate at 3000×g for 10 minutes to remove larger debris. We then remove the supernatant and clarify it by centrifuging at 30000×g for 15 minutes. We then add glycerol to the clarified extract to a concentration of 10% (v/v) and freeze aliquots at −80° C. We determine the protein concentration of the extract by the Bradford assay.

[0058] Reaction mixtures of 50 μl are used, consisting of 10-30 μg protein of cell-free extract, which can be optionally substituted with purified proteins or enriched fractions, about 1.5 μg chimeric double-hairpin oligonucleotide or 0.55 μg single-stranded molecule (3S/25G or 6S/25G, see FIG. 1), and 1 μg of plasmid DNA (see FIGS. 2 and 3) in a reaction buffer of 20 mM Tris, pH 7.4, 15 mM MgCl₂, 0.4 mM DTT, and 1.0 mM ATP. Reactions are initiated with extract and incubated at 30° C. for 45 min. The reaction is stopped by placing the tubes on ice and then immediately deproteinized by two phenol/chloroform (1:1) extractions. Samples are then ethanol precipitated. The nucleic acid is pelleted at 15,000 r.p.m. at 4° C. for 30 min., is washed with 70% ethanol, resuspended in 50 μl H₂O, and is stored at −20° C. 5 μl of plasmid from the resuspension (˜100 ng) was transfected in 20 μl of DH10B cells by electroporation (400 V, 300 μF, 4 kΩ) in a Cell-Porator apparatus (Life Technologies). After electroporation, cells are transferred to a 14 ml Falcon snap-cap tube with 2 ml SOC and shaken at 37° C. for 1 h. Enhancement of final kan colony counts is achieved by then adding 3 ml SOC with 10 μg/ml kanamycin and the cell suspension is shaken for a further 2 h at 37° C. Cells are then spun down at 3750×g and the pellet is resuspended in 500 μl SOC. 200 μl is added undiluted to each of two kanamycin (50 μg/ml) agar plates and 200 μl of a 10⁵ dilution is added to an ampicillin (100 μg/ml) plate. After overnight 37° C. incubation, bacterial colonies are counted using an Accucount 1000 (Biologics). Gene conversion effectiveness is measured as the ratio of the average of the kan colonies on both plates per amp colonies multiplied by 10⁻⁵ to correct for the amp dilution.

[0059] The following procedure can also be used. 5 μl of resuspended reaction mixtures (total volume 50 μl) are used to transform 20 μl aliquots of electro-competent DH10B bacteria using a Cell-Porator apparatus (Life Technologies). The mixtures are allowed to recover in 1 ml SOC at 37° C. for 1 hour at which time 50 μg/ml kanamycin or 12 μg/ml tetracycline is added for an additional 3 hours. Prior to plating, the bacteria are pelleted and resuspended in 200 μl of SOC. 100 μl aliquots are plated onto kan or tet agar plates and 100 μl of a 10^{31 4} dilution of the cultures are concurrently plated on agar plates containing 100 μg/ml of ampicillin. Plating is performed in triplicate using sterile Pyrex beads. Colony counts are determined by an Accu-count 1000 plate reader (Biologics). Each plate contains 200-500 ampicillin resistant colonies or 0-500 tetracycline or kanamycin resistant colonies. Resistant colonies are selected for plasmid extraction and DNA sequencing using an ABI Prism kit on an ABI 310 capillary sequencer (PE Biosystems).

[0060] Chimeric single-stranded oligonucleotides. In FIG. 1 the upper strands of chimeric oligonucleotides I and II are separated into pathways resulting in the generation of single-stranded oligo-nucleotides that contain (FIG. 1A) 2′-O-methyl RNA nucleotides or (FIG. 1B) phosphorothioate linkages. Fold changes in repair activity for correction of kan^s in the HUH7 cell-free extract are presented in parenthesis. Each single-stranded oligonucleotide is 25 bases in length and contains a G residue mismatched to the complementary sequence of the kan^s gene.

[0061] Molecules bearing 3, 6, 8, 10 and 12 phosphorothioate linkages in the terminal regions at each end of a backbone with a total of 24 linkages (25 bases) are tested in the kan^s system. Alternatively, molecules bearing 2, 4, 5, 7, 9 and 11 in the terminal regions at each end are tested. The results of one such experiment, presented in Table 1 and FIG. 1B, illustrate an enhancement of correction activity directed by some of these modified structures. In this illustrative example, the most efficient molecules contained 3 or 6 phosphorothioate linkages at each end of the 25-mer; the activities are approximately equal (molecules IX and X with results of 3.09 and 3.7 respectively). A reduction in alteration activity may be observed as the number of modified linkages in the molecule is further increased. Interestingly, a single-strand molecule containing 24 phosphorothioate linkages is minimally active suggesting that this backbone modification when used throughout the molecule supports only a low level of targeted gene repair or alteration. Such a non-altering, completely modified molecule can provide a baseline control for determining efficiency of correction for a specific oligonucleotide molecule of known sequence in defining the optimum oligonucleotide for a particular alteration event.

[0062] The efficiency of gene repair directed by phosphorothioate-modified, single-stranded molecules, in a length dependent fashion, led us to examine the length of the RNA modification used in the original chimera as it relates to correction. Construct III represents the “RNA-containing” strand of chimera I and, as shown in Table 1 and FIG. 2A, it promotes inefficient gene repair. But, as shown in the same figure, reducing the RNA residues on each end from 10 to 3 increases the frequency of repair. At equal levels of modification, however, 25-mers with 2′-O-methyl ribonucleotides were less effective gene repair agents than the same oligomers with phosphorothioate linkages. These results reinforce the fact that an RNA containing oligonucleotide is not as effective in promoting gene repair or alteration as a modified DNA oligonucleotide.

[0063] Repair of the kanamycin mutation requires a G→C exchange. To confirm that the specific desired correction alteration was obtained, colonies selected at random from multiple experiments are processed and the isolated plasmid DNA is sequenced. As seen in FIG. 4, colonies generated through the action of the single-stranded molecules 3S/25G (IX), 6S/25G (X) and 8S/25G (XI) respectively contained plasmid molecules harboring the targeted base correction. While a few colonies appeared on plates derived from reaction mixtures containing 25-mers with 10 or 12 thioate linkages on both ends, the sequences of the plasmid molecules from these colonies contain nonspecific base changes. In these illustrative examples, the second base of the codon is changed (see FIG. 3). These results show that modified single-strands can direct gene repair, but that efficiency and specificity are reduced when the 25-mers contain 10 or more phosphorothioate linkages at each end.

[0064] In FIG. 1, the numbers 3, 6, 8, 10, 12 and 12.5 respectively indicate how many phosphorothioate linkages (S) or 2′-O-methyl RNA nucleotides (R) are at each end of the examplified molecule although other molecules with 2, 4, 5, 7, 9 and 11 modifications at each end can also be tested. Hence oligo 12S/25G represents a 25-mer oligonucleotide which contains 12 phosphorothioate linkages on each side of the central G target mismatch base producing a fully phosphorothioate linked backbone, displayed as a dotted line. The dots are merely representative of a linkage in the figure and do not depict the actual number of linkages of the oligonucleotide. Smooth lines indicate DNA residues, wavy lines indicate 2′-O-methyl RNA residues and the carat indicates the mismatched base site (G).

[0065] Correction of a mutant kanamycin gene in cultured mammalian cells. Although this portion of this example is directed to cultured mammalian cells, comparable methods may be used using cultured plant cells or protoplasts of those cells from the plant species disclosed herein. The experiments are performed using different eukaryotic cells including plant and mammalian cells, including, for example, 293 cells (transformed human primary kidney cells), HeLa cells (human cervical carcinoma), and H1299 (human epithelial carcinoma, non-small cell lung cancer). HeLa cells are grown at 37° C. and 5% CO₂ in a humidified incubator to a density of 2×10⁵ cells/ml in an 8 chamber slide (Lab-Tek). After replacing the regular DMEM with Optimem, the cells are co-transfected with 10 μg of plasmid pAURNeo(−) FIAsH and 5 μg of modified single-stranded oligonucleotide (3S/25G) that is previously complexed with 10 μg lipofectamine, according to the manufacturer's directions (Life Technologies). The cells are treated with the liposome-DNA-oligo mix for 6 hrs at 37° C. Treated cells are washed with PBS and fresh DMEM is added. After a 16-18 hr recovery period, the culture is assayed for gene repair. The same oligonucleotide used in the cell-free extract experiments is used to target transfected plasmid bearing the kan^s gene. Correction of the point mutation in this gene eliminates a stop codon and restores full expression. This expression can be detected by adding a small non-fluorescent ligand that bound to a C-C-R-E-C-C sequence (SEQ ID NO: 2717) in the genetically modified carboxy terminus of the kan protein, to produce a highly fluorescent complex (FIAsH system, Aurora Biosciences Corporation). Following a 60 min incubation at room temperature with the ligand (FIAsH-EDT2), cells expressing full length kan product acquire an intense green fluorescence detectable by fluorescence microscopy using a fluorescein filter set. Similar experiments are performed using the HygeGFP target as described in Example 2 with a variety of mammalian cells, including, for example, COS-1 and COS-7 cells (African green monkey), and CHO-K1 cells (Chinese hamster ovary). The experiments are also performed with PG12 cells (rat pheochromocytoma) and ES cells (human embryonic stem cells).

[0066] Summary of experimental results. Tables 1, 2 and 3 respectively provide data on the efficiency of gene repair directed by single-stranded oligonucleotides. Table 1 presents data using a cell-free extract from human liver cells (HUH7) to catalyze repair of the point mutation in plasmid pkan^sm4021 (see FIG. 1). Table 2 illustrates that the oligomers are not dependent on MSH2 or MSH3 for optimal gene repair activity. Table 3 illustrates data from the repair of a frameshift mutation (FIG. 3) in the tet gene contained in plasmid pTetΔ208. Table 4 illustrates data from repair of the pkan^sm4021 point mutation catalyzed by plant cell extracts prepared from canola and musa (banana). Colony numbers are presented as kan^r or tet^r and fold increases (single strand versus double hairpin) are presented for kan^r in Table 1.

[0067] FIG. 5A is a confocal picture of HeLa cells expressing the corrected fusion protein from an episomal target. Gene repair is accomplished by the action of a modified single-stranded oligonucleotide containing 3 phosphorothioate linkages at each end (3S/25G). FIG. 5B represents a “Z-series” of HeLa cells bearing the corrected fusion gene. This series sections the cells from bottom to top and illustrates that the fluorescent signal is “inside the cells”.

[0068] Results. In summary, we have designed a novel class of single-stranded oligonucleotides with backbone modifications at the termini and demonstrate gene repair/conversion activity in mammalian and plant cell-free extracts. We confirm that the all DNA strand of the RNA-DNA double-stranded double hairpin chimera is the active component in the process of gene repair. In some cases, the relative frequency of repair by the novel oligonucleotides of the invention is elevated approximately 3-4-fold in certain embodiments when compared to frequencies directed by chimeric RNA-DNA double hairpin oligonucleotides.

[0069] This strategy centers around the use of extracts from various sources to correct a mutation in a plasmid using a modified single-stranded or a chimeric RNA-DNA double hairpin oligonucleotide. A mutation is placed inside the coding region of a gene conferring antibiotic resistance in bacteria, here kanamycin or tetracycline. The appearance of resistance is measured by genetic readout in E.coli grown in the presence of the specified antibiotic. The importance of this system is that both phenotypic alteration and genetic inheritance can be measured. Plasmid pK^sm4021 contains a mutation (T→G) at residue 4021 rendering it unable to confer antibiotic resistance in E.coli. This point mutation is targeted for repair by oligonucleotides designed to restore kanamycin resistance. To avoid concerns of plasmid contamination skewing the colony counts, the directed correction is from G→C rather than G→T (wild-type). After isolation, the plasmid is electroporated into the DH10B strain of E.coli, which contains inactive RecA protein. The number of kanamycin colonies is counted and normalized by ascertaining the number of ampicillin colonies, a process that controls for the influence of electroporation. The number of colonies generated from three to five independent reactions was averaged and is presented for each experiment. A fold increase number is recorded to aid in comparison.

[0070] The original RNA-DNA double hairpin chimera design, e.g., as disclosed in U.S. Pat. No. 5,565,350, consists of two hybridized regions of a single-stranded oligonucleotide folded into a double hairpin configuration. The double-stranded targeting region is made up of a 5 base pair DNA/DNA segment bracketed by 10 base pair RNA/DNA segments. The central base pair is mismatched to the corresponding base pair in the target gene. When a molecule of this design is used to correct the kan^s mutation, gene repair is observed (I in FIG. 1A). Chimera II (FIG. 1B) differs partly from chimera I in that only the DNA strand of the double hairpin is mismatched to the target sequence. When this chimera was used to correct the kan^s mutation, it was twice as active. In the same study, repair function could be further increased by making the targeting region of the chimera a continuous RNA/DNA hybrid.

[0071] Frame shift mutations are repaired. By using plasmid pT^sΔ208, described in FIG. 1(C) and FIG. 3, the capacity of the modified single-stranded molecules that showed activity in correcting a point mutation, can be tested for repair of a frameshift. To determine efficiency of correction of the mutation, a chimeric oligonucleotide (Tet I), which is designed to insert a T residue at position 208, is used. A modified single-stranded oligonucleotide (Tet IX) directs the insertion of a T residue at this same site. FIG. 3 illustrates the plasmid and target bases designated for change in the experiments. When all reaction components are present (extract, plasmid, oligomer), tetracycline resistant colonies appear. The colony count increases with the amount of oligonucleotide used up to a point beyond which the count falls off (Table 3). No colonies above background are observed in the absence of either extract or oligonucleotide, nor when a modified single-stranded molecule bearing perfect complementarity is used. FIG. 3 represents the sequence surrounding the target site and shows that a T residue is inserted at the correct site. We have isolated plasmids from fifteen colonies obtained in three independent experiments and each analyzed sequence revealed the same precise nucleotide insertion. These data suggest that the single-stranded molecules used initially for point mutation correction can also repair nucleotide deletions.

[0072] Comparison of phosphorothioate oligonucleotides to 2′-O-methyl substituted oligonucleotides. From a comparison of molecules VII and XI, it is apparent that gene repair is more subject to inhibition by RNA residues than by phosphorothioate linkages. Thus, even though both of these oligonucleotides contain an equal number of modifications to impart nuclease resistance, XI (with 16 phosphorothioate linkages) has good gene repair activity while VII (with 16 2′-O-methyl RNA residues) is inactive. Hence, the original chimeric double hairpin oligonucleotide enabled correction directed, in large part, by the strand containing a large region of contiguous DNA residues.

[0073] Oligonucleotides can target multiple nucleotide alterations within the same template. The ability of individual single-stranded oligonucleotides to correct multiple mutations in a single target template is tested using the plasmid pK^sm4021 and the following single-stranded oligonucleotides modified with 3 phosphorothioate linkages at each end (indicated as underlined nucleotides): Oligo1 is a 25-mer with the sequence TTCGATAAGCCTATGCTGACCCGTG (SEQ ID NO: 2709) corrects the original mutation present in the kanamycin resistance gene of pK^sm4021 as well as directing another alteration 2 basepairs away in the target sequence (both indicated in boldface); Oligo2 is a 70-mer with the 5′-end sequence TTCGGCTACGACTGGGCACAACAGACAATTGGC (SEQ ID NO: 2710) with the remaining nucleotides being completely complementary to the kanamycin resistance gene and also ending in 3 phosphorothioate linkages at the 3′ end. Oigo2 directs correction of the mutation in pK^sm4021 as well as directing another alteration 21 basepairs away in the target sequence (both indicated in boldface).

[0074] We also use additional oligonucleotides to assay the ability of individual oligonucleotides to correct multiple mutations in the pK^sM4021 plasmid. These include, for example, a second 25-mer that alters two nucleotides that are three nucleotides apart with the sequence 5′-TTGTGCCCAGTCGTATCCGAATAGC-3′ (SEQ ID NO: 2711); a 70-mer that alters two nucleotides that are 21 nucleotides apart with the sequence 5′-CATCAGAGCAGCCAATTGTCTGTTGTGCCCAGTCGTAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGA-3′ (SEQ ID NO: 2712); and another 70-mer that alters two nucleotides that are 21 nucleotides apart with the sequence 5′-GCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCAATTGTCTGTTGTGCCCAGTCGTAGCCGMTAGCCT-3′ (SEQ ID NO: 2713). The nucleotides in the oligonucleotides that direct alteration of the target sequence are underlined and in boldface. These oligonucleotides are modified in the same way as the other oligonucleotides of the invention.

[0075] We assay correction of the original mutation in pK^sm4021 by monitoring kanamycin resistance (the second alterations which are directed by Oligo2 and Oligo3 are silent with respect to the kanamycin resistance phenotype). In addition, in experiments with Oligo2, we also monitor cleavage of the resulting plasmids using the restriction enzyme Tsp5091 which cuts at a specific site present only when the second alteration has occurred (at ATT in Oligo2). We then sequence these clones to determine whether the additional, silent alteration has also been introduced. The results of an analysis are presented below: 2

[0076] Nuclease sensitivity of unmodified DNA oligonucleotide. Electrophoretic analysis of nucleic acid recovered from the cell-free extract reactions conducted here confirm that the unmodified single-stranded 25-mer did not survive incubation whereas greater than 90% of the terminally modified oligos did survive (as judged by photo-image analyses of agarose gels).

[0077] Plant extracts direct repair. The modified single-stranded constructs can be tested in plant cell extracts. We have observed gene alteration using extracts from multiple plant sources, including, for example, Arabidopsis, tobacco, banana, maize, soybean, canola, wheat, spinach as well as spinach chloroplast extract or extracts made from other plant cells disclosed herein. We prepare the extracts by grinding plant tissue or cultured cells under liquid nitrogen with a mortar and pestle. We extract 3 ml of the ground plant tissue with 1.5 ml of extraction buffer (20 mM HEPES, pH7.5; 5 mM KCl; 1.5 mM MgCl₂; 10 mM DTT; and 10% [v/v] glycerol). Some plant cell-free extracts also include about 1% (w/v) PVP. We then homogenize the samples with 15 strokes of a Dounce homogenizer. Following homogenization, we incubate the samples on ice for 1 hour and centrifuge at 3000×g for 5 minutes to remove plant cell debris. We then determine the protein concentration in the supernatants (extracts) by Bradford assay. We dispense 100 μg (protein) aliquots of the extracts which we freeze in a dry ice-ethanol bath and store at −80° C.

[0078] We describe experiments using two sources here: a dicot (canola) and a monocot (banana, Musa acuminata cv. Rasthali). Each vector directs gene repair of the kanamycin mutation (Table 4); however, the level of correction is elevated 2-3 fold relative to the frequency observed with the chimeric oligonucleotide. These results are similar to those observed in the mammalian system wherein a significant improvement in gene repair occurred when modified single-stranded molecules were used.

[0079] Tables are attached hereto. 3

[0080] Plasmid pK^Sm4021 (1 μg), the indicated oligonucleotide (1.5 μg chimeric oligonucleotide or 0.55 μg single-stranded oligonucleotide; molar ratio of oligo to plasmid of 360 to 1) and either 10 or 20 μg of HUH7 cell-free extract were incubated 45 min at 37° C. Isolated plasmid DNA was electroporated into E. coli (strain DH10B) and the number of kan^r colonies counted. The data represent the number of kanamycin resistant colonies per 10⁶ ampicillin resistant colonies generated from the same reaction and is the average of three experiments (standard deviation usually less than +/−15%). Fold increase is defined relative to 418 kan^r colonies (second reaction) and in all reactions was calculated using the 20 μg sample. 4

[0081] Chimeric oligonucleotide (1.5 μg) or modified single-stranded oligonucleotide (0.55 μg) was incubated with 1 μg of plasmid pK^Sm4021 and 20 μg of the indicated extracts. MEF represents mouse embryonic fibroblasts with either MSH2 (2^−/−) or MSH3 (3^−/−) deleted. MEF^+/+ indicates wild-type mouse embryonic fibroblasts. The other reaction components were then added and processed through the bacterial readout system. The data represent the number of kanamycin resistant colonies per 10⁶ ampicillin resistant colonies. 5

[0082] Each reaction mixture contained the indicated amounts of plasmid and oligonucleotide. The extract used for these experiments came from HUH7 cells. The data represent the number of tetracycline resistant colonies per 10⁶ ampicillin resistant colonies generated from the same reaction and is the average of 3 independent experiments. Tet I is a chimeric oligonucleotide and Tet IX is a modified single-stranded oligonucleotide that are designed to insert a T residue at position 208 of pT^sΔ208. The oligonucleotides are equivalent to structures I and IX in FIG. 2. 6

[0083] Canola or Musa cell-free extracts were tested for gene repair activity on the kanamycin-sensitive gene as previously described in (18). Chimeric oligonucleotide II (1.5 μg) and modified single-stranded oligonucleotides IX and X (0.55 μg) were used to correct pK^Sm4021. Total number of kan^r colonies are present per 10⁷ ampicillin resistant colonies and represent an average of four independent experiments. 7

EXAMPLE 2

Yeast Cell Targeting Assay Method for Base Alteration and Preferred Oligonucleotide Selection

[0084] In this example, single-stranded oligonucleotides with modified backbones and double-hairpin oligonucleotides with chimeric, RNA-DNA backbones are used to measure gene repair using two episomal targets with a fusion between a hygromycin resistance gene and eGFP as a target for gene repair. These plasmids are pAURHYG(rep)GFP, which contains a point mutation in the hygromycin resistance gene (FIG. 7), pAURHYG(ins)GFP, which contains a single-base insertion in the hygromycin resistance gene (FIG. 7) and pAURHYG(Δ)GFP which has a single base deletion. We also use the plasmid containing a wild-type copy of the hygromycin-eGFP fusion gene, designated pAURHYG(wt)GFP, as a control. These plasmids also contain an aureobasidinA resistance gene. In pAURHYG(rep)GFP, hygromycin resistance gene function and green fluorescence from the eGFP protein are restored when a G at position 137, at codon 46 of the hygromycin B coding sequence, is converted to a C thus removing a premature stop codon in the hygromycin resistance gene coding region. In pAURHYG(ins)GFP, hygromycin resistance gene function and green fluorescence from the eGFP protein are restored when an A inserted between nucleotide positions 136 and 137, at codon 46 of the hygromycin B coding sequence, is deleted and a C is substituted for the T at position 137, thus correcting a frameshift mutation and restoring the reading frame of the hygromycin-eGFP fusion gene.

[0085] We synthesize the set of three yeast expression constructs pAURHYG(rep)eGFP, pAURHYG(Δ)eGFP, pAURHYG(ins)eGFP, that contain a point mutation at nucleotide 137 of the hygromycin-B coding sequence as follows. (rep) indicates a T137→G replacement, (Δ) represents a deletion of the G137 and (ins) represents an A insertion between nucleotides 136 and 137. We construct this set of plasmids by excising the respective expression cassettes by restriction digest from pHyg(x)EGFP and ligation into pAUR123 (Panvera, Calif.). We digest 10 μg pAUR123 vector DNA, as well as, 10 μg of each pHyg(x)EGFP construct with KpnI and SaII (NEB). We gel purify each of the DNA fragments and prepare them for enzymatic ligation. We ligate each mutated insert into pHygEGFP vector at 3:1 molar ratio using T4 DNA ligase (Roche). We screen clones by restriction digest, confirm by Sanger dideoxy chain termination sequencing and purify using a Qiagen maxiprep kit.

[0086] We use this system to assay the ability of five oligonucleotides (shown in FIG. 8) to support correction under a variety of conditions. The oligonucleotides which direct correction of the mutation in pAURHYG(rep)GFP can also direct correction of the mutation in pAURHYG(ins)GFP. Three of the four oligonucleotides (HygE3T/25, HygE3T/74 and HygGG/Rev) share the same 25-base sequence surrounding the base targeted for alteration. HygGG/Rev is an RNA-DNA chimeric double hairpin oligonucleotide of the type described in the prior art. One of these oligonucleotides, HygE3T/74, is a 74-base oligonucleotide with the 25-base sequence centrally positioned. The fourth oligonucleotide, designated HygE3T/74α, is the reverse complement of HygE3T/74. The fifth oligonucleotide, designated Kan70T, is a non-specific, control oligonucleotide which is not complementary to the target sequence. Alternatively, an oligonucleotide of identical sequence but lacking a mismatch to the target or a completely thioate modified oligonucleotide or a completely 2-O-methylated modified oligonucleotide may be used as a control. Alternatively, oligonucleotides containing one, two, three, four, five, six, eight, ten or more LNA modifications on at least one of the two termini (and preferrably the 3′ terminus) may be used in different embodiments.

[0087] Oligonucleotide synthesis and cells. We synthesized and purified the chimeric, double-hairpin oligonucleotides and single-stranded oligonucleotides (including those with the indicated modifications) as described in Example 1. Plasmids used for assay were maintained stably in yeast (Saccharomyces cerevisiae) strain LSY678 MAT α at low copy number under aureobasidin selection. Plasmids and oligonucleotides are introduced into yeast cells by electroporation as follows: to prepare electrocompetent yeast cells, we inoculate 10 ml of YPD media from a single colony and grow the cultures overnight with shaking at 300 rpm at 30° C. We then add 30 ml of fresh YPD media to the overnight cultures and continue shaking at 30° C. until the OD₆₀₀ was between 0.5 and 1.0 (3-5 hours). We then wash the cells by centrifuging at 4° C. at 3000 rpm for 5 minutes and twice resuspending the cells in 25 ml ice-cold distilled water. We then centrifuge at 4° C. at 3000 rpm for 5 minutes and resuspend in 1 ml ice-cold 1M sorbitol and then finally centrifuge the cells at 4° C. at 5000 rpm for 5 minutes and resuspend the cells in 120 μl 1M sorbitol. To transform electrocompetent cells with plasmids or oligonucleotides, we mix 40 μl of cells with 5 μg of nucleic acid, unless otherwise stated, and incubate on ice for 5 minutes. We then transfer the mixture to a 0.2 cm electroporation cuvette and electroporate with a BIO-RAD Gene Pulser apparatus at 1.5 kV, 25 μF, 200 Ω for one five-second pulse. We then immediately resuspend the cells in 1 ml YPD supplemented with 1M sorbitol and incubate the cultures at 30° C. with shaking at 300 rpm for 6 hours. We then spread 200 μl of this culture on selective plates containing 300 μg/ml hygromycin and spread 200 μl of a 10⁵ dilution of this culture on selective plates containing 500 ng/ml aureobasidinA and/or and incubate at 30° C. for 3 days to allow individual yeast colonies to grow. We then count the colonies on the plates and calculate the gene conversion efficiency by determining the number of hygromycin resistance colonies per 10⁵ aureobasidinA resistant colonies.

[0088] Frameshift mutations are repaired in yeast cells. We test the ability of the oligonucleotides shown in FIG. 8 to correct a frameshift mutation in vivo using LSY678 yeast cells containing the plasmid pAURHYG(ins)GFP. These experiments, presented in Table 6, indicate that these oligonucleotides can support gene correction in yeast cells. These data reinforce the results described in Example 1 indicating that oligonucleotides comprising phosphorothioate linkages facilitate gene correction much more efficiently than control duplex, chimeric RNA-DNA oligonucleotides. This gene correction activity is also specific as transformation of cells with the control oligonucleotide Kan70T produced no hygromycin resistant colonies above background and thus Kan70T did not support gene correction in this system. In addition, we observe that the 74-base oligonucleotide (HygE3T/74) corrects the mutation in pAURHYG(ins)GFP approximately five-fold more efficiently than the 25-base oligonucleotide (HygE3T/25). We also perform control experiments with LSY678 yeast cells containing the plasmid pAURHYG(wt)GFP. With this strain we observed that even without added oligonucleotides, there are too many hygromycin resistant colonies to count.

[0089] We also use additional oligonucleotides to assay the ability of individual oligonucleotides to correct multiple mutations in the pAURHYG(x)eGFP plasmid. These include, for example, one that alters two basepairs that are 3 nucleotides apart is a 74-mer with the sequence 5′-CTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGGTACGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTAC-3′ (SEQ ID NO: 2714); a 74-mer that alters two basepairs that are 15 nucleotides apart with the sequence 5′-CTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATACGTCCTGCGGGTAAACAGCTGCGCCGATGGTTTCTAC-3′ (SEQ ID NO: 2715); and a 74-mer that alters two basepairs that are 27 nucleotides apart with the sequence 5′-CTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATACGTCCTGCGGGTAAATAGCTGCGCCGACGGTTTCTAC (SEQ ID NO: 2716). The nucleotides in these oligonucleotides that direct alteration of the target sequence are underlined and in boldface. These oligonucleotides are modified in the same ways as the other oligonucleotides of the invention.

[0090] Oligonucleotides targeting the sense strand direct gene correction more efficiently. We compare the ability of single-stranded oligonucleotides to target each of the two strands of the target sequence of both pAURHYG(ins)GFP and pAURHYG(rep)GFP. These experiments, presented in Tables 7 and 8, indicate that an oligonucleotide, HygE3T/74α, with sequence complementary to the sense strand (i.e. the strand of the target sequence that is identical to the mRNA) of the target sequence facilitates gene correction approximately ten-fold more efficiently than an oligonucleotide, HygE3T/74, with sequence complementary to the non-transcribed strand which serves as the template for the synthesis of RNA. As indicated in Table 7, this effect was observed over a range of oligonucleotide concentrations from 0-3.6 μg, although we did observe some variability in the difference between the two oligonucleotides (indicated in Table 7 as a fold difference between HygE3T/74α and HygE3T/74). Furthermore, as shown in Table 8, we observe increased efficiency of correction by HygE3T/74α relative to HygE3T/74 regardless of whether the oligonucleotides were used to correct the base substitution mutation in pAURHYG(rep)GFP or the insertion mutation in pAURHYG(ins)GFP. The data presented in Table 8 further indicate that the single-stranded oligonucleotides correct a base substitution mutation more efficiently than an insertion mutation. However, this last effect was much less pronounced and the oligonucleotides of the invention are clearly able efficiently to correct both types of mutations in yeast cells. In addition, the role of transcription is investigated using plasmids with inducible promoters such as that described in FIG. 10.

[0091] Optimization of oligonucleotide concentration. To determine the optimal concentration of oligonucleotide for the purpose of gene alteration, we test the ability of increasing concentrations of Hyg3T/74α to correct the mutation in pAURHYG(rep)GFP contained in yeast LSY678. We chose this assay system because our previous experiments indicated that it supports the highest level of correction. However, this same approach could be used to determine the optimal concentration of any given oligonucleotide. We test the ability of Hyg3T/74α to correct the mutation in pAURHYG(rep)GFP contained in yeast LSY678 over a range of oligonucleotide concentrations from 0-10.0 μg. As shown in Table 9, we observe that the correction efficiency initially increases with increasing oligonucleotide concentration, but then declines at the highest concentration tested.

[0092] Tables are attached hereto. 8

[0093] 9

[0094] 10

[0095] 11

EXAMPLE 3

Cultured Cell Manipulation

[0096] Although disclosure in this example is directed to use of stem cells or human blood cells and microinjection, the microinjection procedures may also be used with cultured plant cells or protoplasts using any plant species, including those disclosed herein. Mononuclear cells are isolated from human umbilical cord blood of normal donors using Ficoll Hypaque (Pharmacia Biotech, Uppsala, Sweden) density centrifugation. CD34+ cells are immunomagnetically purified from mononuclear cells using either the progenitor or Multisort Kits (Miltenyi Biotec, Auburn, Calif.). Lin⁻CD38⁻ cells are purified from the mononuclear cells using negative selection with StemSep system according to the manufacturer's protocol (Stem Cell Technologies, Vancouver, Calif.). Cells used for microinjection are either freshly isolated or cryopreserved and cultured in Stem Medium (S Medium) for 2 to 5 days prior to microinjection. S Medium contains Iscoves' Modified Dulbecc's Medium without phenol red (IMDM) with 100 μg/ml glutamine/penicillin/streptomycin, 50 mg/ml bovine serum albumin, 50 μg/ml bovine pancreatic insulin, 1 mg/ml human transferrin, and IMDM; Stem Cell Technologies), 40 μg/ml low-density lipoprotein (LDL; Sigma, St. Louis, Mo.), 50 mM HEPEs buffer and 50 μM 2-mercaptoethanol, 20 ng/ml each of thrombopoietin, flt-3 ligand, stem cell factor and human IL-6 (Pepro Tech Inc., Rocky Hill, N.J.). After microinjection, cells are detached and transferred in bulk into wells of 48 well plates for culturing.

[0097] 35 mm dishes are coated overnight at 4° C. with 50 μg/ml Fibronectin (FN) fragment CH-296 (Retronectin; TaKaRa Biomedicals, Panvera, Madison, Wis.) in phosphate buffered saline and washed with IMDM containing glutamine/penicillin/streptomycin. 300 to 2000 cells are added to cloning rings and attached to the plates for 45 minutes at 37° C. prior to microinjection. After incubation, cloning rings are removed and 2 ml of S Medium are added to each dish for microinjection. Pulled injection needles with a range of 0.22 μm to 0.3 μm outer tip diameter are used. Cells are visualized with a microscope equipped with a temperature controlled stage set at 37° C. and injected using an electronically interfaced Eppendorf Micromanipulator and Transjector. Successfully injected cells are intact, alive and remain attached to the plate post injection. Molecules that are flourescently labeled allow determination of the amount of oligonucleotide delivered to the cells.

[0098] For in vitro erythropoiesis from Lin⁻CD38⁻ cells, the procedure of Malik, 1998 can be used. Cells are cultured in ME Medium for 4 days and then cultured in E Medium for 3 weeks. Erythropoiesis is evident by glycophorin A expression as well as the presence of red color representing the presence of hemoglobin in the cultured cells. The injected cells are able to retain their proliferative capacity and the ability to generate myeloid and erythoid progeny. CD34+ cells can convert a normal A (β^A) to sickle T (β^S) mutation in the β-globin gene or can be altered using any of the oligonucleotides of the invention herein for correction or alteration of a normal gene to a mutant gene. Alternatively, stem cells can be isolated from blood of humans having genetic disease mutations and the oligonucleotides of the invention can be used to correct a defect or to modify genomes within those cells.

[0099] Alternatively, non-stem cell populations of cultured cells can be manipulated using any method known to those of skill in the art including, for example, the use of polycations, cationic lipids, liposomes, polyethylenimine (PEI), electroporation, biolistics, calcium phosphate precipitation, or any other method known in the art.

[0100] Biolistic delivery of oligonucleotide into plant cells may be accomplished according to the following method. One milliliter of packed cell volume of plant cell suspensions are subcultured onto plates containing solid medium [with Murashige and Skoog salts from Gibco/BRL, 500 mg/liter Mes, 1 mg/liter thiamin, 100 mg/liter myo-inositol, 180 mg/liter KH2PO4, 2.21 mg/liter 2,4-dichlorophenoxyacetic acid (2,4-D), and 30 g/liter sucrose (pH 5.7) and having 8 g/liter agar-agar from Sigma added before autoclaving]. By using a helium-driven particle gun such as that from BioRad and following manufacturers directions, oligonucleotides may be introduced to cells after precipitation onto 1 micrometer or comparable gold microcarriers (Bio-Rad). To precipitate onto microcarriers, 35 microliters of a particle suspension (60 mg of microcarriers per ml of 100% ethanol) is transferred to a 1.5 ml microcentrifuge tube, which is agitated on a vortex mixer. Then 40 microliter of resuspended oligonucleotide (60 ng/microliter water) is added; then 75 microliter of ice-cold 2.5 M CaCl2 is added; then 75 microliter of ice-cold 0.1 M spermidine is added. The tube is mixed vigorously or a vortex mixer for 10 min at room temperature. The particles are allowed to settle for 10 min and are centrifuged at 11,750 g for 30 sec. The supernatant is removed and the particles are resuspended in 50 microliter of 100% ethanol. An aliquot of 10 microliter of the resuspended particles are applied to each macro-projectile which is used to bombard each plate once at 900 psi (1 psi=6.89 kPa) with a gap distance (distance from power source to macroprojectile) of 1 cm and a target distance (distance from microprojectile launch site to target material) of 10 cm.

[0101] An alternative method of delivery can be used as follows. Cultured cells are suspended in liquid N6 medium and then plated on a VWR Scientific glass fiber filter. About 0.4 microgram of oligonucleotide are precipitated with 15 microliter of 2.5 mM CaCl2 and 5 microliter of 0.1 M spermidine onto 25 microgram of 1.0 micrometer gold particles. Microprojectile bombardment is performed by using a Bio-Rad PDS-1000 He particle delivery system or comparable machine following manufacturers instructions. Alterations in oligonucleotide concentrations can be employed to determine the optimum concentration of oligonucleotide according to the procedures described herein for any particular oligonucleotide of the invention.

[0102] Alternatively, the oligonucleotide of the invention may be delivered to a plant cell by electroporation of a protoplast derived from a plant part. The protoplasts may be formed by enzymatic treatment of a plant part, particularly a leaf, according to techniques such as those in Gallois et al., Methods in Molecular Biology 55: 89-107 by Humana Press. Such conditions for electroporation use about 3×10⁵ protoplasts in a total volume of about 0.3 ml with a concentration of oligonucleotide of between 0.6 to 4 microgram per ml.

EXAMPLE 4

Plant Cells

[0103] The oligonucleotides of the invention can also be used to repair or direct a mutagenic event in plants and animal cells. Although little information is available on plant mutations amongst natural cultivars, the oligonucleotides of the invention can be used to produce “knock out” mutations by modification of specific amino acid codons to produce stop codons (e.g., a CAA codon specifying Gln can be modified at a specific site to TAA; a AAG codon specifying Lys can be modified to UAG at a specific site; and a CGA codon for Arg can be modified to a UGA codon at a specific site). Such base pair changes will terminate the reading frame and produce a defective truncated protein, shortened at the site of the stop codon.

[0104] Alternatively, frameshift additions or deletions can be directed into the genome at a specific sequence to interrupt the reading frame and produce a garbled downstream protein. Such stop or frameshift mutations can be introduced to determine the effect of knocking out the protein in either plant or animal cells.

[0105] For introduction of a T-DNA, including the T-DNA in the plasmid of FIG. 11, into a plant cell, Agrobacterium tumefaciens is used. These techniques are routine standard techniques known in the art. For example, one method follows. We transform A. tumefaciens is transformed by electroporation (using a BioRad Gene Pulser™). Competent A. tumefaciens is prepared using a method similar to that of preparing competent E. coli by suspending a freshly grown culture three times in ice-cold water and a final resuspension in 10% glycerol. Electroporation conditions are a 0.2 cm gap cuvette at a setting of 25 μF,200 Ω and2.5 kV.

[0106] A. tumefaciens containing a plasmid with a T-DNA is then used to introduce the T-DNA into a plant cell using routine standard techniques known in the art. For example, we transform Arabidopsis by vacuum infiltration or by dipping flowers in an Agrobacterium solution containing a surfactant, e.g. L-77. Seeds are then collected, grown and screened for presence of the T-DNA. Alternatively, Agrobacterium can be used to transform callus tissue and the callus tissue can then be used to regenerate transformed plants.

[0107] All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

[0108] Notes on the Tables Presented Below:

[0109] Each of the following tables presents, for the specified gene, a plurality of mutations that are known to confer a relevant phenotype and, for each mutation, the oligonucleotides that can be used to correct the respective mutation site-specifically in the genome according to the present invention.

[0110] The left-most column identifies each alteration or mutation and the phenotype that the alteration/mutation confers.

[0111] For most entries, the mutation/alteration is identified at both the nucleic acid and protein level. At the amino acid level, mutations are presented according to the following standard nomenclature. The centered number identifies the position of the mutated codon in the protein sequence; to the left of the number is the wild type residue and to the right of the number is the mutant codon. Terminator codons are shown as “TERM”. At the nucleic acid level, the entire triplet of the wild type and mutated codons is shown.

[0112] The middle column presents, for each mutation, four oligonucleotides capable of repairing the mutation site-specifically in the genome or in cloned DNA including DNA in artificial chromosomes, episomes, plasmids, or other types of vectors. The oligonucleotides of the invention, however, may include any of the oligonucleotides sharing portions of the sequence of the 121 base sequence. Thus, oligonucleotides of the invention for each of the depicted targets may be 18, 19, 20 up to about 121 nucleotides in length. Sequence may be added non-symmetrically.

[0113] All oligonucleotides are presented, per convention, in the 5′ to 3′ orientation. The nucleotide that effects the change in the genome is underlined and presented in bold.

[0114] The first of the four oligonucleotides for each mutation is a 121 nt oligonucleotide centered about the repair/altering nucleotide. The second oligonucleotide, its reverse complement, targets the opposite strand of the DNA duplex for repair/alteration. The third oligonucleotide is the minimal 17 nt domain of the first oligonucleotide, also centered about the repair/alteration nucleotide. The fourth oligonucleotide is the reverse complement of the third, and thus represents the minimal 17 nt domain of the second.

[0115] The third column of each table presents the SEQ ID NO: of the respective repair oligonucleotide.

EXAMPLE 5

Engineering Herbicide Resistant Plants

[0116] Chemical weed control is an important tool of modern agriculture and many herbicides have been developed for this purpose. Their use has resulted in substantial increases in the yields of many crops, including, for example, maize, soybeans, and cotton. Thus while the use of fertilizers and new high-yielding crop varieties have contributed greatly to the “green revolution,” chemical weed control has also been at the forefront of technological achievement.

[0117] Herbicides having broad-spectrum activity are particularly useful because they obviate the need for multiple herbicides targeting different classes of weeds. The problem with such herbicides is that they typically also affect crops which are exposed to the herbicide. One way to overcome this is to generate plants which are resistant to one or more broad-spectrum herbicides. Such herbicide-tolerant plants may reduce the need for tillage to control weeds, thereby effectively reducing soil erosion and can reduce the quantity and number of different herbicides applied in the field.

[0118] Common herbicides used, for example, include those that inhibit the enzyme 5-enolpyruvyl-3-phosphoshikimic acid synthase (EPSPS), for example N-phosphonomethyl-glycine (e.g. glyphosate), those that inhibit acetolactate synthase (ALS) activity, for example the sulfonylureas and related herbicides, and those that inhibit dihydropteroate synthase, for example methyl[(4-amino-phenyl)sulfonyl]carbamate (e.g. Asulam). Herbicide-tolerant plants can be produced by several methods, including, for example, introducing into the genome of the plant the ability to degrade the herbicide, the capacity to produce a higher level of the targeted enzyme, and/or expressing an herbicide-tolerant allele of the enzyme.

[0119] The attached tables disclose exemplary oligonucleotides base sequences which can be used to generate site-specific mutations in plant genes that confer herbicide resistance. 12

[0120] 13

[0121] 14

[0122] 15

EXAMPLE 6

Engineering Male- or Female-Sterile Plants

[0123] Flower development in distantly related dicot plant species is increasingly better understood and appears to be regulated by a family of genes which encode regulatory proteins. These genes include, for example, AGAMOUS (AG), APETALA1 (AP1), and APETALA3 (AP3) and PISTILLATA (PI) in Arabidopsis thaliana, and DEFICIENS A (DEFA), GLOBOSA (GLO), SQUAMOSA (SQUA), and PLENA (PLE) in Antirrhinum majus. Genetic studies have shown that the DEFA, GLO and AP3 genes are essential for petal and stamen development. Sequence analysis of these genes revealed that the gene products contain a conserved MADS box region, a DNA-binding domain. Using these clones as probes, MADS box genes have also been isolated from other species including tomato, tobacco, petunia, Brassica napus, and maize.

[0124] Altering the expression of these genes results in altered floral morphology. For example, mutations in AP3 and PI result in male-sterile flowers because petals develop in place of stamens.

[0125] The attached tables disclose exemplary oligonucleotide base sequences which can be used to generate site-specific mutations that confer altered floral structures in plants. 16