[0001] The present invention is in the field of animal health, and is directed to vaccine compositions and diagnostics for disease. More particularly, the present invention relates to polynucleotide molecules comprising nucleotide sequences encoding GRA1, GRA2, SAG1, MIC1, and MAG1 proteins from Neospora, which polynucleotide molecules and proteins are useful in the production of vaccines against neosporosis, and as diagnostic reagents.
[0002] Neospora is a pathogenic protozoan parasite of animals that has been recognized as a major cause of abortion, neonatal death, congenital infection, and encephalitic disease in mammals. Dubey and Lindsay, 1996, Vet. Parasitol. 67:1-59; Dubey and Lindsay, 1993, Parasitology Today, 9:452458.
[0003] Although
[0004] The etiologic role of a bovine isolate of Neospora in bovine abortion and congenital disease has been confirmed. Barr et al., 1994, J. Vet. Diag. Invest. 6:207-215. A rodent model of central nervous system neosporosis has been developed using inbred BALB/c mice infected with
[0005] In
[0006]
[0007] Micronemes are intracelluar organelles located at the apical end of tachyzoites of both
[0008] The conversion of parasites from tachyzoites to bradyzoites is critical for chronic infection and persistence of
[0009] Identification in Neospora of protein homologs of
[0010] The present invention provides an isolated polynucleotide molecule comprising a nucleotide sequence encoding the GRA1 protein from
[0011] The present invention further provides an isolated polynucleotide molecule comprising a nucleotide sequence encoding the GRA2 protein from
[0012] The present invention further provides an isolated polynucleotide molecule comprising a nucleotide sequence encoding the SAG1 protein from
[0013] The present invention further provides an isolated polynucleotide molecule comprising a nucleotide sequence encoding the MIC1 protein from
[0014] The present invention further provides an isolated polynucleotide molecule comprising a nucleotide sequence encoding the MAG1 protein from
[0015] The present invention further provides a polynucleotide molecule comprising the nucleotide sequence of the promoters of the
[0016] The present invention further provides oligonucleotide molecules that hybridize to any of the polynucleotide molecules of the present invention, or that hybridize to a polynucleotide molecule having a nucleotide sequence that is the complement of any of the polynucleotide molecules of the present invention.
[0017] The present invention further provides compositions and methods for cloning and expressing any of the polynucleotide molecules of the present invention, including recombinant cloning vectors, recombinant expression vectors, transformed host cells comprising any of said vectors, and novel strains or cell lines derived therefrom. More particularly, the present invention provides a recombinant vector comprising a polynucleotide molecule having a nucleotide sequence encoding the GRA1, GRA2, SAG1, MIC1 or MAG1 protein of
[0018] The present invention further provides a substantially purified or isolated
[0019] The present invention further provides a method of preparing any of the aforementioned polypeptides, comprising culturing host cells transformed with a recombinant expression vector, said vector comprising a polynucleotide molecule comprising a nucleotide sequence encoding any of the aforementioned polypeptides, wherein the nucleotide sequence is in operative association with one or more regulatory elements, under conditions conducive to the expression of the polypeptide, and recovering the expressed polypeptide from the cell culture.
[0020] The present invention further provides antibodies specifically directed against a
[0021] The present invention further provides genetic constructs for use in mutating a Neospora GRA1, GRA2, SAG1, MIC1 or MAG1 gene to produce modified Neospora cells. Such modified Neospora cells are useful in vaccine compositions to protect mammals against neosporosis. In a preferred though non-limiting embodiment, a genetic construct of the present invention comprises a polynucleotide molecule comprising a nucleotide sequence that is otherwise the same as a nucleotide sequence encoding a GRA1, GRA2, SAG1, MIC1 or MAG1 protein from
[0022] The present invention further provides a vaccine against neosporosis, comprising an immunologically effective amount of a polypeptide of the present invention, or an immunologically effective amount of a polynucleotide molecule of the present invention, or an immunologically effective amount of modified Neospora cells of the present invention; and a veterinarily acceptable carrier. In a preferred embodiment, the vaccine of the present invention comprises modified live cells of
[0023] The present invention further provides a method of preparing a vaccine against neosporosis, comprising combining an immunologically effective amount of a
[0024] The present invention further provides a method of vaccinating a mammal against neosporosis, comprising administering to the mammal an immunologically effective amount of a vaccine of the present invention.
[0025] The present invention further provides a kit for vaccinating a mammal against neosporosis, comprising a first container having an immunologically effective amount of a polypeptide of the present invention, or an immunologically effective amount of a polynucleotide molecule of the present invention, or an immunologically effective amount of modified Neospora cells of the present invention; and a second container having a veterinarily acceptable carrier or diluent.
[0026] 4.1. Polynucleotide Molecules
[0027] An isolated polynucleotide molecule of the present invention can have a nucleotide sequence derived from any species or strain of Neospora, but is preferably from a pathogenic species of Neospora such as
[0028] As used herein, the terms “polynucleotide molecule,” “polynucleotide sequence.” “coding sequence,” “open-reading frame (ORF),” and the like, are intended to refer to both DNA and RNA molecules, which can either be single-stranded or double-stranded, and that can include one or more prokaryotic sequences, cDNA sequences, genomic DNA sequences including exons and introns, and chemically synthesized DNA and RNA sequences, and both sense and corresponding anti-sense strands. As used herein, the term “ORF” refers to the minimal nucleotide sequence required to encode a particular Neospora protein, i.e., either a GRA1, GRA2, SAG1, MIC1 or MAG1 protein, without any intervening termination codons.
[0029] Production and manipulation of the polynucleotide molecules and oligonucleotide molecules disclosed herein are within the skill in the art and can be carried out according to recombinant techniques described, among other places, in Maniatis et al., 1989,
[0030] 4.1.1. GRA1-Related Polynucleotide Molecules
[0031] References herein below to the nucleotide sequences shown in SEQ ID NOS: 1 and 3, and to substantial portions thereof, are intended to also refer to the corresponding nucleotide sequences and substantial portions thereof, respectively, as present in plasmid pRC77 (ATCC 209685), unless otherwise indicated. In addition, references herein below to the amino acid sequences shown in SEQ ID NO: 2, and to substantial portions and peptide fragments thereof, are intended to also refer to the corresponding amino acid sequences, and substantial portions and peptide fragments thereof, respectively, encoded by the corresponding GRA1-encoding nucleotide sequence present in plasmid pRC77 (ATCC 209685), unless otherwise indicated.
[0032] The present invention provides an isolated polynucleotide molecule comprising a nucleotide sequence encoding the GRA1 protein from
[0033] The present invention further provides an isolated polynucleotide molecule having a nucleotide sequence that is homologous to the nucleotide sequence of a GRA1-encoding polynucleotide molecule of the present invention. The term “homologous” when used to refer to a GRA1-related polynucleotide molecule means a polynucleotide molecule having a nucleotide sequence: (a) that encodes the same protein as one of the aforementioned GRA1-encoding polynucleotide molecules of the present invention, but that includes one or more silent changes to the nucleotide sequence according to the degeneracy of the genetic code; or (b) that hybridizes to the complement of a polynucleotide molecule having a nucleotide sequence that encodes the amino acid sequence of the
[0034] As used herein, a polynucleotide molecule is “useful in practicing the present invention” where the polynucleotide molecule can be used to amplify a Neospora-specific polynucleotide molecule using standard amplification techniques, or as a diagnostic reagent to detect the presence of a Neospora-specific polynucleotide in a fluid or tissue sample from a Neospora-infected animal;
[0035] Polynucleotide molecules of the present invention having nucleotide sequences that are homologous to the nucleotide sequence of a GRA1-encoding polynucleotide molecule of the present invention do not include polynucleotide molecules having the native nucleotide sequence of
[0036] The present invention further provides an isolated polynucleotide molecule comprising a nucleotide sequence that encodes a polypeptide that is homologous to the
[0037] As used herein, a polypeptide is “useful in practicing the present invention” where the polypeptide can be used as a diagnostic reagent to detect the presence of Neospora-specific antibodies in a blood or serum sample from an animal that is currently infected, or that has been infected, with Neospora.
[0038] The present invention further provides a polynucleotide molecule consisting of a substantial portion of any of the aforementioned Neospora GRA1-related polynucleotide molecules of the present invention. As used herein, a “substantial portion” of a GRA1-related polynucleotide molecule means a polynucleotide molecule consisting of less than the complete nucleotide sequence of the GRA1-related polynucleotide molecule, but comprising at least about 5%, more preferably at least about 10%, and most preferably at least about 20%, of the nucleotide sequence of the GRA1-related polynucleotide molecule, and that is useful in practicing the present invention, as usefulness is defined above for polynucleotide molecules.
[0039] In addition to the nucleotide sequences of any of the aforementioned GRA1-related polynucleotide molecules, polynucleotide molecules of the present invention can further comprise, or alternatively may consist of, nucleotide sequences selected from those that naturally flank the GRA1 ORF or gene in situ in
[0040] 4.1.2. GRA2-Related Polynucleotide Molecules
[0041] References herein below to the nucleotide sequence shown in SEQ ID NO: 4, and to substantial portions thereof, are intended to also refer to the corresponding nucleotide sequence and substantial portions thereof, respectively, as present in plasmid pRC5 (ATCC 209686), unless otherwise indicated. In addition, references herein below to the amino acid sequence shown in SEQ ID NO: 5, and to substantial portions and peptide fragments thereof, are intended to also refer to the corresponding amino acid sequence, and substantial portions and peptide fragments thereof, respectively, encoded by the corresponding GRA2-encoding nucleotide sequence present in plasmid pRC5 (ATCC 209686), unless otherwise indicated.
[0042] The present invention further provides an isolated polynucleotide molecule comprising a nucleotide sequence encoding the GRA2 protein from
[0043] The present invention further provides an isolated polynucleotide molecule having a nucleotide sequence that is homologous to the nucleotide sequence of a GRA2-encoding polynucleotide molecule of the present invention. The term “homologous” when used to refer to a GRA2-related polynucleotide molecule means a polynucleotide molecule having a nucleotide sequence: (a) that encodes the same protein as one of the aforementioned GRA2-encoding polynucleotide molecules of the present invention, but that includes one or more silent changes to the nucleotide sequence according to the degeneracy of the genetic code; or (b) that hybridizes to the complement of a polynucleotide molecule having a nucleotide sequence that encodes the amino acid sequence of the
[0044] Polynucleotide molecules of the present invention having nucleotide sequences that are homologous to the nucleotide sequence of a GRA2-encoding polynucleotide molecule of the present invention do not include polynucleotide molecules having the native nucleotide sequence of
[0045] The present invention further provides an isolated polynucleotide molecule comprising a nucleotide sequence that encodes a polypeptide that is homologous to the
[0046] The present invention further provides a polynucleotide molecule consisting of a substantial portion of any of the aforementioned Neospora GRA2-related polynucleotide molecules of the present invention. As used herein, a substantial portion of a GRA2-related polynucleotide molecule means a polynucleotide molecule consisting of less than the complete nucleotide sequence of the GRA2-related polynucleotide molecule, but comprising at least about 5%, more preferably at least about 10%, and most preferably at least about 20%, of the nucleotide sequence of the GRA2-related polynucleotide molecule, and that is useful in practicing the present invention, as usefulness is defined above for polynucleotide molecules.
[0047] In addition to the nucleotide sequences of any of the aforementioned GRA2-related polynucleotide molecules, polynucleotide molecules of the present invention can further comprise, or alternatively may consist of, nucleotide sequences that naturally flank the GRA2 gene or ORF in situ in
[0048] 4.1.3. SAG1-Related Polynucleotide Molecules
[0049] References herein below to the nucleotide sequence shown in SEQ ID NO: 6, and to substantial portions thereof, are intended to also refer to the corresponding nucleotide sequence and substantial portions thereof, respectively, as present in plasmid pRC102 (ATCC 209687), unless otherwise indicated. In addition, references herein below to the amino acid sequence shown in SEQ ID NO: 7, and to substantial portions and peptide fragments thereof, are intended to also refer to the corresponding amino acid sequence, and substantial portions and peptide fragments thereof, respectively, encoded by the corresponding SAG1-encoding nucleotide sequence present in plasmid pRC102 (ATCC 209687), unless otherwise indicated.
[0050] The present invention further provides an isolated polynucleotide molecule comprising a nucleotide sequence encoding the SAG1 protein from
[0051] The present invention further provides an isolated polynucleotide molecule having a nucleotide sequence that is homologous to the nucleotide sequence of a SAG1-encoding polynucleotide molecule of the present invention. The term “homologous” when used to refer to a SAG1-related polynucleotide molecule means a polynucleotide molecule having a nucleotide sequence: (a) that encodes the same protein as one of the aforementioned SAG1-encoding polynucleotide molecules of the present invention, but that includes one or more silent changes to the nucleotide sequence according to the degeneracy of the genetic code; or (b) that hybridizes to the complement of a polynucleotide molecule having a nucleotide sequence that encodes the amino acid sequence of the
[0052] Polynucleotide molecules of the present invention having nucleotide sequences that are homologous to the nucleotide sequence of a SAG1-encoding polynucleotide molecule of the present invention do not include polynucleotide molecules having the native nucleotide sequence of
[0053] The present invention further provides an isolated polynucleotide molecule comprising a nucleotide sequence that encodes a polypeptide that is homologous to the
[0054] The present invention further provides a polynucleotide molecule consisting of a substantial portion of any of the aforementioned Neospora SAG1-related polynucleotide molecules of the present invention. As used herein, a “substantial portion” of a SAG1-related polynucleotide molecule means a polynucleotide molecule consisting of less than the complete nucleotide sequence of the SAG1-related polynucleotide molecule, but comprising at least about 5%, more preferably at least about 10%, and most preferably at least about 20%, of the nucleotide sequence of the SAG1-related polynucleotide molecule, and that is useful in practicing the present invention, as usefulness is defined above for polynucleotide molecules.
[0055] In addition to the nucleotide sequences of any of the aforementioned SAG1-related polynucleotide molecules, polynucleotide molecules of the present invention can further comprise, or alternatively may consist of, nucleotide sequences that naturally flank the SAG1 gene or ORF in situ in
[0056] 4.1.4. MIC1-Related Polynucleotide Molecules
[0057] References herein below to the nucleotide sequences shown in SEQ ID NOS: 8 and 10, and to substantial portions thereof, are intended to also refer to the corresponding nucleotide sequences and substantial portions thereof, respectively, as present in plasmid pRC340 (ATCC 209688), unless otherwise indicated. In addition, references herein below to the amino acid sequences shown in SEQ ID NO: 9, and to substantial portions and peptide fragments thereof, are intended to also refer to the corresponding amino acid sequences, and substantial portions and peptide fragments thereof, respectively, encoded by the corresponding MIC1-encoding nucleotide sequence present in plasmid pRC340 (ATCC 209688), unless otherwise indicated.
[0058] The present invention further provides an isolated polynucleotide molecule comprising a nucleotide sequence encoding the MIC1 protein from
[0059] The present invention further provides an isolated polynucleotide molecule having a nucleotide sequence that is homologous to the nucleotide sequence of a MIC1-encoding polynucleotide molecule of the present invention. The term “homologous” when used to refer to a MIC1-related polynucleotide molecule means a polynucleotide molecule having a nucleotide sequence: (a) that encodes the same protein as one of the aforementioned MIC1-encoding polynucleotide molecules of the present invention, but that includes one or more silent changes to the nucleotide sequence according to the degeneracy of the genetic code; or (b) that hybridizes to the complement of a polynucleotide molecule having a nucleotide sequence that encodes the amino acid sequence of the
[0060] Polynucleotide molecules of the present invention having nucleotide sequences that are homologous to the nucleotide sequence of a MIC1-encoding polynucleotide molecule of the present invention do not include polynucleotide molecules having the native nucleotide sequence of
[0061] The present invention further provides an isolated polynucleotide molecule comprising a nucleotide sequence that encodes a polypeptide that is homologous to the
[0062] The present invention further provides a polynucleotide molecule consisting of a substantial portion of any of the aforementioned Neospora MIC1-related polynucleotide molecules of the present invention. As used herein, a “substantial portion” of a MIC1-related polynucleotide molecule means a polynucleotide molecule consisting of less than the complete nucleotide sequence of the MIC1-related polynucleotide molecule, but comprising at least about 5%, more preferably at least about 10%, and most preferably at least about 20%, of the nucleotide sequence of the MIC1-related polynucleotide molecule, and that is useful in practicing the present invention, as usefulness is defined above for polynucleotide molecules.
[0063] In addition to the nucleotide sequences of any of the aforementioned MIC1-related polynucleotide molecules, polynucleotide molecules of the present invention can further comprise, or alternatively may consist of, nucleotide sequences that naturally flank the MIC1 ORF or gene in situ in
[0064] 4.1.5. MAG1-Related Polynucleotide Molecules
[0065] References herein below to the nucleotide sequence shown in SEQ ID NO: 11, and to substantial portions thereof, are intended to also refer to the corresponding nucleotide sequences and substantial portions thereof, respectively, as present in plasmid bd304 (ATCC 203413), unless otherwise indicated. In addition, references herein below to the amino acid sequence shown in SEQ ID NO: 13, and to substantial portions and peptide fragments thereof; are intended to also refer to the corresponding amino acid sequence, and substantial portions and peptide fragments thereof, respectively, encoded by the corresponding MAG1-encoding nucleotide sequence present in plasmid bd304 (ATCC 203413), unless otherwise indicated.
[0066] The present invention further provides an isolated polynucleotide molecule comprising a nucleotide sequence encoding the MAG1 protein from
[0067] The present invention further provides an isolated polynucleotide molecule having a nucleotide sequence that is homologous to the nucleotide sequence of a MAG1-encoding polynucleotide molecule of the present invention. The term “homologous” when used to refer to a MAG1-related polynucleotide molecule means a polynucleotide molecule having a nucleotide sequence: (a) that encodes the same protein as one of the aforementioned MAG1-encoding polynucleotide molecules of the present invention, but that includes one or more silent changes to the nucleotide sequence according to the degeneracy of the genetic code; or (b) that hybridizes to the complement of a polynucleotide molecule having a nucleotide sequence that encodes the amino acid sequence of the
[0068] Polynucleotide molecules of the present invention having nucleotide sequences that are homologous to the nucleotide sequence of a MAG1-encoding polynucleotide molecule of the present invention do not include polynucleotide molecules having the native nucleotide sequence of
[0069] The present invention further provides an isolated polynucleotide molecule comprising a nucleotide sequence that encodes a polypeptide that is homologous to the
[0070] The present invention further provides a polynucleotide molecule consisting of a substantial portion of any of the aforementioned Neospora MAG 1-related polynucleotide molecules of the present invention. As used herein, a “substantial portion” of a MAG1-related polynucleotide molecule means a polynucleotide molecule consisting of less than the complete nucleotide sequence of the MAG1-related polynucleotide molecule, but comprising at least about 5%, more preferably at least about 10%, and most preferably at least about 20%, of the nucleotide sequence of the MAG1-related polynucleotide molecule, and that is useful in practicing the present invention, as usefulness is defined above for polynucleotide molecules. For example, a substantial portion of the polynucleotide molecule of SEQ ID NO: 11 can comprise putative exon 1 from about nt 704 to about nt 820, or putative exon 2 from about nt 1301 to about nt 1399, or putative exon 3 from about nt 1510 to about nt 1808, or putative exon 4 from about nt 1921 to about nt 3297.
[0071] In addition to the nucleotide sequences of any of the aforementioned MAG1-related polynucleotide molecules, polynucleotide molecules of the present invention can further comprise, or alternatively may consist of, nucleotide sequences that naturally flank the MAG1 gene or ORF in situ in
[0072] 4.2. Gra1/Mag1 Promoter Region
[0073] The present invention further provides a polynucleotide molecule comprising the nucleotide sequence of the
[0074] The GRA1/MAG1 bidirectional promoter region of the present invention, and functional portions thereof, are useful for a variety of purposes including for controlling the recombinant expression of either the GRA1 or MAG1 genes, or both genes, or of one or more other genes or coding sequences, in host cells of
[0075] 4.3. Oligonucleotide Molecules
[0076] The present invention further provides oligonucleotide molecules that hybridize to any one of the aforementioned polynucleotide molecules of the present invention, or that hybridize to a polynucleotide molecule having a nucleotide sequence that is the complement of any one of the aforementioned polynucleotide molecules of the present invention. Such oligonucleotide molecules are preferably at least about 10 nucleotides in length, and more preferably from about 15 to about 30 nucleotides in length, and hybridize to one or more of the aforementioned polynucleotide molecules under highly stringent conditions, i.e., washing in 6'SSC/0.5% sodium pyrophosphate at about 37° C. for ˜14-base oligos, at about 48° C. for ˜17-base oligos, at about 55° C. for ˜20-base oligos, and at about 60° C. for ˜23-base oligos. Other hybridization conditions for longer oligonucleotide molecules of the present invention can be determined by the skilled artisan using standard techniques. In a preferred embodiment, an oligonucleotide molecule of the present invention is complementary to a portion of at least one of the aforementioned polynucleotide molecules of the present invention.
[0077] Specific though non-limiting embodiments of oligonucleotide molecules useful in practicing the present invention include oligonucleotide molecules selected from the group consisting of SEQ ID NOS: 14-26 and 28-34, and the complements thereof.
[0078] The oligonucleotide molecules of the present invention are useful for a variety of purposes, including as primers in amplification of a Neospora-specific polynucleotide molecule for use, e.g., in differential disease diagnosis, or to encode or act as antisense molecules useful in gene regulation. Regarding diagnostics, suitably designed primers can be used to detect the presence of Neospora-specific polynucleotide molecules in a sample of animal tissue or fluid, such as brain tissue, lung, tissue, placental tissue, blood, cerebrospinal fluid, mucous, urine, amniotic fluid, etc. The production of a specific amplification product can support a diagnosis of Neospora infection, while lack of an amplified product can point to a lack of infection. Methods for conducting amplifications, such as the polymerase chain reaction (PCR), are described, among other plates, in Innis et al. (eds), 1995, above: and Erlich (ed) 1992, above. Other amplification techniques known in the art, e.g., the ligase chain reaction, can alternatively be used. The sequences of the polynucleotide molecules disclosed herein can also be used to design primers for use in isolating homologous genes from other species or strains of Neospora or other members of the Apicomplexa.
[0079] 4.4. Recombinant Expression Systems
[0080] 4.4.1. Cloning and Expression Vectors
[0081] The present invention further provides compositions for cloning and expressing any of the polynucleotide molecules of the present invention, including cloning vectors, expression vectors, transformed host cells comprising any of said vectors, and novel strains or cell lines derived therefrom. In a preferred embodiment, the present invention provides a recombinant vector comprising a polynucleotide molecule having a nucleotide sequence encoding the GRA1, GRA2, SAG1, MIC1 or MAG1 protein of
[0082] Recombinant vectors of the present invention, particularly expression vectors, are preferably constructed so that the coding sequence for the polynucleotide molecule of the invention is in operative association with one or more regulatory elements necessary for transcription and translation of the coding sequence to produce a polypeptide. As used herein, the term “regulatory element” includes but is not limited to nucleotide sequences that encode inducible and non-inducible promoters, enhancers, operators and other elements known in the art that serve to drive and/or regulate expression of polynucleotide coding sequences. Also, as used herein, the coding sequence is in “operative association” with one or more regulatory elements where the regulatory elements effectively regulate and allow for the transcription of the coding sequence or the translation of its mRNA, or both.
[0083] Methods are well-known in the art for constructing recombinant vectors containing particular coding sequences in operative association with appropriate regulatory elements, and these can be used to practice the present invention. These methods include in vitro recombinant techniques, synthetic techniques, and in vivo genetic recombination. See, e.g., the techniques described in Maniatis et al., 1989, above; Ausubel et al., 1989, above; Sambrook et al., 1989, above; Innis et al., 1995, above; and Erlich, :1992, above.
[0084] A variety of expression vectors are known in the art which can be utilized to express the GRA1, GRA2, SAG1, MIC1, and MAG1 coding sequences of the present invention, including recombinant bacteriophage DNA, plasmid DNA, and cosmid DNA expression vectors containing the particular coding sequences. Typical prokaryotic expression vector plasmids that can be engineered to contain a polynucleotide molecule of the present invention include pUC8, pUC9, pBR322 and pBR329 (Biorad Laboratories, Richmond, Calif.), pPL and pKK223 (Pharmacia, Piscataway, N.J.), pQE50 (Qiagen, Chatsworth, Calif.), and pGEM-T EASY (Promega, Madison, Wis.), among many others. Typical eukaryotic expression vectors that can be engineered to contain a polynucleotide molecule of the present invention include an ecdysone-inducible mammalian expression system (Invitrogen, Carlsbad, Calif.), cytomegalovirus promoter-enhancer-based systems (Promega, Madison, Wis.; Stratagene, La Jolla, Calif.; Invitrogen), and baculovirus-based expression systems (Promega), among others.
[0085] The regulatory elements of these and other vectors can vary in their strength and specificities. Depending on the host/vector system utilized, any of a number of suitable transcription and translation elements can be used. For instance, when cloning in mammalian cell systems, promoters isolated from the genome of mammalian cells, e.g., mouse metallothionein promoter, or from viruses that grow in these cells, e.g., vaccinia virus 7.5K promoter or Moloney murine sarcoma virus long terminal repeat, can be used. Promoters obtained, by recombinant DNA or synthetic techniques can also be used to provide for transcription of the inserted sequence. In addition, expression from certain promoters can be elevated in the presence of particular inducers, e.g., zinc and cadmium ions for metallothionein promoters. Non-limiting examples of transcriptional regulatory regions or promoters include for bacteria, the β-gal promoter, the T7 promoter, the TAC promoter, λ left and right promoters, trp and lac promoters, trp-lac fusion promoters, etc.; for yeast, glycolytic enzyme promoters, such as ADH-I and -II promoters, GPK promoter, PGI promoter, TRP promoter, etc.; and for mammalian cells, SV40 early and late promoters, adenovirus major late promoters, among others. The present invention further provides a polynucleotide molecule comprising the nucleotide sequence of the promoters of both the GRA1 and MAG1 genes of
[0086] Specific initiation signals are also required for sufficient translation of inserted coding sequences. These signals typically include an ATG initiation codon and adjacent sequences. In cases where the polynucleotide molecule of the present invention including its own initiation codon and adjacent sequences are inserted into the appropriate expression vector, no additional translation control signals may be needed. However, in cases where only a portion of a coding sequence is inserted, exogenous translational control signals, including the ATG initiation codon, may be required. These exogenous translational control signals and initiation codons can be obtained from a variety of sources, both natural and synthetic. Furthermore, the initiation codon must be in phase with the reading frame of the coding regions to ensure in-frame translation of the entire insert.
[0087] Expression vectors can also be constructed that will express a fusion protein comprising a protein or polypeptide of the present invention. Such fusion proteins can be used, e.g., to raise antisera against a Neospora protein, to study the biochemical properties of the Neospora protein, to engineer a Neospora protein exhibiting different immunological or functional properties, or to aid in the identification or purification, or to improve the stability, of a recombinantly-expressed Neospora protein. Possible fusion protein expression vectors include but are not limited to vectors incorporating sequences that encode β-galactosidase and trpE fusions, maltose-binding protein fusions, glutathione-S-transferase fusions and polyhistidine fusions (carrier regions). Methods are well-known in the art that can be used to construct expression vectors encoding these and other fusion proteins.
[0088] The fusion protein can be useful to aid in purification of the expressed protein. In non-limiting embodiments, e.g., a GRA1-maltose-binding fusion protein can be purified using amylose resin; a GRA1-glutathione-S-transferase fusion protein can be purified using glutathione-agarose beads; and a GRA1-polyhistidine fusion protein can be purified using divalent nickel resin. Alternatively, antibodies against a carrier protein or peptide can be used for affinity chromatography purification of the fusion protein. For example, a nucleotide sequence coding for the target epitope of a monoclonal antibody can be engineered into the expression vector in operative association with the regulatory elements and situated so that the expressed epitope is fused to a Neospora protein of the present invention. In a non-limiting embodiment, a nucleotide sequence coding for the FLAG™ epitope tag (International Biotechnologies Inc.), which is a hydrophilic marker peptide, can be inserted by standard techniques into the expression vector at a point corresponding, e.g., to the amino or carboxyl terminus of the GRA1 protein. The expressed GRA1 protein-FLAG™ epitope fusion product can then be detected and affinity-purified using commercially available anti-FLAG™ antibodies.
[0089] The expression vector can also be engineered to contain polylinker sequences that encode specific protease cleavage sites so that the expressed Neospora protein can be released from the carrier region or fusion partner by treatment with a specific protease. For example, the fusion protein vector can include a nucleotide sequence encoding a thrombin or factor Xa cleavage site, among others.
[0090] A signal sequence upstream from and in reading frame with the Neospora coding sequence can be engineered into the expression vector by known methods to direct the trafficking and secretion of the expressed protein. Non-limiting examples of signal sequences include those from α-factor, immunoglobulins, outer membrane proteins, penicillinase, and T-cell receptors, among others.
[0091] To aid in the selection of host cells transformed or transfected with a recombinant vector of the present invention, the vector can be engineered to further comprise a coding sequence for a reporter gene product or other selectable marker. Such a coding sequence is preferably in operative association with the regulatory elements, as described above. Reporter genes that are useful in practicing the invention are well-known in the art and include those encoding chloramphenicol acetyltransferase (CAT), green fluorescent protein, firefly luciferase, and human growth hormone, among others. Nucleotide sequences encoding selectable markers are well-known in the art, and include those that encode gene products conferring resistance to antibiotics or anti-metabolites, or that supply an auxotrophic requirement. Examples of such sequences include those that encode thymidine kinase activity, or resistance to methotrexate, ampicillin, kanamycin, chloramphenicol, zeocin, pyrimethamine, aminoglycosides, or hygromycin, among others.
[0092] 4.4.2. Transformation of Host Cells
[0093] The present invention further provides transformed host cells comprising a polynucleotide molecule or recombinant vector of the present invention, and cell lines derived therefrom. Host cells useful in practicing the invention can be eukaryotic or prokaryotic cells. Such transformed host cells include but are not limited to microorganisms, such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA vectors, or yeast transformed with a recombinant vector, or animal cells, such as insect cells infected with a recombinant virus vector, e.g., baculovirus, or mammalian cells infected with a recombinant virus vector, e.g., adenovirus or vaccinia virus, among others. For example, a strain of
[0094] The recombinant vector of the invention is preferably transformed or transfected into one or more host cells of a substantially homogeneous culture of cells. The vector is generally introduced into host cells in accordance with known techniques, such as, e.g., by protoplast transformation, calcium phosphate: precipitation, calcium chloride treatment, microinjection, electroporation, transfection by contact with a recombined virus, liposome-mediated transfection, DEAE-dextran transfection, transduction, conjugation, or microprojectile bombardment, among others. Selection of transformants can be conducted by standard procedures, such as by selecting for cells expressing a selectable marker, e.g., antibiotic resistance, associated with the recombinant expression vector.
[0095] Once an expression vector is introduced into the host cell, the integration and maintenance of the polynucleotide molecule of the present invention, either in the host cell genome or episomally, can be confirmed by standard techniques, e.g., by Southern hybridization analysis, restriction enzyme analysis, PCR analysis including reverse transcriptase PCR (rt-PCR), or by immunological assay to detect the expected protein product. Host cells containing and/or expressing a polynucleotide molecule of the present invention can be identified by any of at least four general approaches that are well-known in the art, including: (i) DNA-DNA, DNA-RNA, or RNA-antisense RNA hybridization; (ii) detecting the presence of “marker” gene functions; (iii) assessing the level of transcription as measured by the expression of specific mRNA transcripts in the host cell; or (iv) detecting the presence of mature polypeptide product, e.g., by immunoassay, as known in the art.
[0096] 4.4.3. Expression and Purification of Recombinant Polypeptides
[0097] Once a polynucleotide molecule of the present invention has been stably introduced into an appropriate host cell, the transformed host cell is clonally propagated, and the resulting cells are grown under conditions conducive to the maximum production of the encoded polypeptide. Such conditions typically include growing transformed cells to high density. Where the expression vector comprises an inducible promoter, appropriate induction conditions such as, e.g., temperature shift, exhaustion of nutrients, addition of gratuitous inducers (e.g., analogs of carbohydrates, such as isopropyl-β-D-thiogalactopyranoside (IPTG)), accumulation of excess metabolic by-products, or the like, are employed as needed to induce expression.
[0098] Where the polypeptide is retained inside the host cells, the cells are harvested and lysed, and the product is substantially purified or isolated from the lysate under extraction conditions known in the art to minimize protein degradation such as, e.g., at 4° C., or in the presence of protease inhibitors, or both. Where the polypeptide is secreted from the host cells, the exhausted nutrient medium can simply be collected and the polypeptide substantially purified or isolated therefrom.
[0099] The polypeptide can be substantially purified or isolated from cell lysates or culture medium, as necessary, using standard methods, including but not limited to one or more of the following methods: ammonium sulfate precipitation, size fractionation, ion exchange chromatography, HPLC, density centrifugation, and affinity chromatography. If the polypeptide lacks biological activity, it can be detected as based, e.g., on size, or reactivity with a polypeptide-specific antibody, or by the presence of a fusion tag. For use in practicing the present invention, the polypeptide can be in an unpurified state as secreted into the culture fluid or as present in a cell lysate, but is preferably substantially purified or isolated therefrom. As used herein, a polypeptide is “substantially purified” where the polypeptide constitutes at least about 20 wt % of the protein in a particular preparation. Also, as used herein, a polypeptide is “isolated” where the polypeptide constitutes at least about 80 wt % of the protein in a particular preparation.
[0100] Thus, the present invention provides a substantially purified or isolated polypeptide encoded by a polynucleotide of the present invention. In a non-limiting embodiment, the polypeptide is a
[0101] The present invention further provides polypeptides that are homologous to any of the aforementioned
[0102] The present invention further provides polypeptides consisting of a substantial portion of any one of the aforementioned polypeptides of the present invention. As used herein, a “substantial portion” of a polypeptide of the present invention, or “peptide fragment,” means a polypeptide consisting of less than the complete amino acid sequence of the corresponding full-length polypeptide, but comprising at least about 10%, and more preferably at least about 20%, of the amino acid sequence thereof, and that is useful in practicing the present invention, as defined above for polypeptides. Particularly preferred are, peptide fragments that are immunogenic, i.e., capable of inducing an immune response which results in production of antibodies that react specifically against the corresponding full-length Neospora polypeptide.
[0103] The present invention further provides fusion proteins comprising any of the aforementioned polypeptides fused to a carrier or fusion partner as known in the art.
[0104] The present invention further provides a method of preparing any of the aforementioned polypeptides, comprising culturing a host cell transformed with a recombinant expression vector, said recombinant expression vector comprising a polynucleotide molecule comprising a nucleotide sequence encoding the particular polypeptide, which polynucleotide molecule is in operative association with one or more regulatory elements, under conditions conducive to the expression of the polypeptide, and recovering the expressed polypeptide from the cell culture.
[0105] 4.5. Use of Polypeptides
[0106] Once a polypeptide of the present invention of sufficient purity has been obtained, it can be characterized by standard methods, including by SDS-PAGE, size exclusion chromatography, amino acid sequence analysis, immunological activity, biological activity, etc. The polypeptide can be further characterized using hydrophilicity analysis (see, e.g., Hopp and Woods, 1981, Proc. Natl. Acad. Sci. USA 78:3824), or analogous software algorithms, to identify hydrophobic and hydrophilic regions. Structural analysis can be carried out to identify regions of the polypeptide that assume specific secondary structures. Biophysical methods such as X-ray crystallography (Engstrom, 1974, Biochem. Exp. Biol. 11: 7-13), computer modeling (Fletterick and Zoller (eds), 1986, in:
[0107] Polypeptides of the present invention, are useful for a variety of purposes, including as components of vaccine compositions to protect mammals against neosporosis; or as diagnostic reagents, e.g., using standard techniques such as ELISA assays, to screen for Neospora-specific antibodies in blood or serum samples from animals; or as antigens to raise polyclonal or monoclonal antibodies, as described below, which antibodies are useful as diagnostic reagents, e.g., using standard techniques such as Western blot assays, to screen for Neospora-specific proteins in cell, tissue or fluid samples from an animal.
[0108] 4.6. Analogs and Derivatives of Polypeptides
[0109] Any polypeptide of the present invention can be modified at the protein level to improve or otherwise alter its biological or immunological characteristics. One or more chemical modifications of the polypeptide can be carried out using known techniques to prepare analogs therefrom, including but not limited to any of the following: substitution of one or more L-amino acids of the polypeptide with corresponding D-amino acids, amino acid analogs, or amino acid mimics, so as to produce, e.g., carbazates or tertiary centers; or specific chemical modification, such as, e.g., proteolytic cleavage with trypsin, chymotrypsin, papain or V8 protease, or treatment with NaBH
[0110] A polypeptide of the present invention can be derivatized by conjugation thereto of one or more chemical groups, including but not limited to acetyl groups, sulfur bridging groups, glycosyl groups, lipids, and phosphates, and/or by conjugation to a second polypeptide of the present invention, or to another protein, such as, e.g., serum albumin, keyhole limpet hemocyanin, or commercially activated BSA, or to a polyamino acid (e.g.,. polylysine), or to a polysaccharide, (e.g., sepharose, agarose, or modified or unmodified celluloses), among others. Such conjugation is preferably by covalent linkage at amino acid side chains and/or at the N-terminus or C-terminus of the polypeptide. Methods for carrying out such conjugation reactions are well-known in the field of protein chemistry.
[0111] Derivatives useful in practicing the claimed invention also include those in which a water-soluble polymer such as, e.g., polyethylene glycol, is conjugated to a polypeptide of the present invention, or to an analog or derivative thereof, thereby providing additional desirable properties while retaining, at least in part, the immunogenicity of the polypeptide. These additional desirable properties include, e.g., increased solubility in aqueous solutions, increased stability in storage, increased resistance to proteolytic degradation, and increased in vivo half-life. Water-soluble polymers suitable for conjugation to a polypeptide of the present invention include but are not limited to polyethylene glycol homopolymers, polypropylene glycol homopolymers, copolymers of ethylene glycol with propylene glycol, wherein said homopolymers and copolymers are unsubstituted or substituted at one end with an alkyl group, polyoxyethylated polyols, polyvinyl alcohol, polysaccharides, polyvinyl ethyl ethers, and α,β-poly(2-hydroxyethyl]-DL-aspartamide. Polyethylene glycol is particularly preferred. Methods for making water-soluble polymer conjugates of polypeptides are known in the art and are described in, among other places, U.S. Pat. No. 3,788,948; U.S. Pat. No. 3,960,830; U.S. Pat. No. 4,002,531; U.S. Pat. No. 4,055,635; U.S. Pat. No. 4,179,337; U.S. Pat. No. 4,261,973; U.S. Pat. No. 4,412,989; U.S. Pat. No. 4,414,147; U.S. Pat. No. 4,415,665; U.S. Pat. No. 4,609,546; U.S. Pat. No. 4,732,863; U.S. Pat. No. 4,745,180; European Patent (EP) 152,847; EP 98,110; and Japanese Patent 5,792,435, which patents are incorporated herein by reference.
[0112] 4.7. Antibodies
[0113] The present invention further provides isolated antibodies directed against a polypeptide of the present invention. In a preferred embodiment, antibodies can be raised against a GRA1, GRA2, SAG1, MIC1 or MAG1 protein from
[0114] Polyclonal antibodies can be obtained and isolated from the serum of an immunized animal and tested for specificity against the antigen using standard techniques. Alternatively, monoclonal antibodies can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally described by Kohler and Milstein (Nature, 1975, 256: 495497); the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology. Today 4:72; Cote et al., 1983, Proc. Natl. Acad. Sci. USA 80: 2026-2030); and the EBV-hybridoma technique (Cole et al., 1985,
[0115] Antibody fragments that contain specific binding sites for a polypeptide of the present invention are also encompassed within the present invention, and can be generated by known techniques. Such fragments include but are not limited to F(ab′)
[0116] Techniques for the production and isolation of monoclonal antibodies and antibody fragments are well-known in the art, and are additionally described, among other places, in Harlow and Lane, 1988,
[0117] 4.8. Targeted Mutation of Neospora Genes
[0118] Based on the disclosure of the polynucleotide molecules of the present invention, genetic constructs can be prepared for use in disabling or otherwise mutating a Neospora GRA1, GRA2, SAG1, MIC1 or MAG1 gene (which genes are hereinafter referred to collectively or individually as the “Neospora genes” or a “Neospora gene,” respectively). Each of the Neospora genes can be mutated using an appropriately designed genetic construct in combination with genetic techniques now known or to be developed in the future. For example, a Neospora gene can be mutated using a genetic construct of the present invention that functions to: (a) delete all or a portion of the coding sequence or regulatory sequence of the Neospora gene; or (b) replace all or a portion of the coding sequence or regulatory sequence of the Neospora gene with a different nucleotide sequence, or (c) insert into the coding sequence or regulatory sequence of the Neospora gene one or more nucleotides, or an oligonucleotide molecule, or polynucleotide molecule, which can comprise a nucleotide sequence from Neospora or from a heterologous source; or (d) carry out some combination of (a), (b) and (c).
[0119] Neospora cells in which a Neospora gene has been mutated are useful in practicing the present invention where mutating the gene reduces the pathogenicity of the Neospora cells carrying the mutated gene compared to cells of the same strain of Neospora where the gene has not been so mutated, and where such Neospora cells carrying the disabled gene can be used in a vaccine composition, particularly in a modified live vaccine, to induce or contribute to the induction of, a protective response in a mammal against neosporosis. In a preferred embodiment, the mutation serves, to partially or completely disable the Neospora gene, or partially or completely disable the protein encoded by the Neospora gene. In this context, a Neospora gene or protein is considered to be partially or completely disabled if either no protein product is made (for example, the gene is deleted), or a protein product is made that can no longer carry out its normal biological function or can no longer be transported to its normal cellular location, or a product is made that carries out its normal biological function but at a significantly reduced rate, or if such mutation results in a detectable decrease in the pathogenicity of cells of a pathogenic strain of Neospora wherein the gene has been so mutated compared to cells of the same strain but in which the gene has not be so mutated.
[0120] In a non-limiting embodiment, a genetic construct of the present invention is used to mutate a wild-type Neospora gene by replacement of the coding sequence of the wild-type gene, or a promoter or other regulatory region thereof, or a portion thereof, with a different nucleotide sequence such as, e.g., a mutated coding sequence or mutated regulatory region, or portion, thereof. Mutated Neospora gene sequences for use in such a genetic construct can be produced by any of a variety of known methods, including by use of error-prone PCR, or by cassette mutagenesis. For example, oligonucleotide-directed mutagenesis can be employed to alter the coding sequence or promoter sequence of a wild-type Neospora gene in a defined way, e.g., to introduce a frame-shift or a termination codon at a specific point within the sequence. Alternatively or additionally, a mutated nucleotide sequence for use in the genetic construct of the present invention can be prepared by insertion into the coding sequence or promoter sequence of one or more nucleotides, oligonucleotide molecules or polynucleotide molecules, or by replacement of a portion of the coding sequence or promoter sequence with one or more different nucleotides, oligonucleotide molecules or polynucleotide molecules. Such oligonucleotide molecules or polynucleotide molecules can be obtained from any naturally occurring source or can be synthetic. The inserted sequence can serve simply to disrupt the reading frame of the Neospora gene, or can further encode a heterologous gene product such as a selectable marker.
[0121] Alternatively or additionally, random mutagenesis can be used to produce a mutated Neospora gene sequence for use in a genetic construct of the present invention. Random mutagenesis can be carried out by any techniques now known or to be developed in the future such as, e.g., by exposing cells carrying a Neospora gene to ultraviolet radiation or x-rays, or to chemical mutagens such as N-methyl-N′-nitrosoguanidine, ethyl methane sulfonate, nitrous acid or nitrogen mustards, and then selecting for cells carrying a mutation in the particular gene. See, e.g., Ausubel, 1989, above, for a review of mutagenesis techniques.
[0122] Mutations to produce modified Neospora cells that are useful in practicing the present invention, as defined above, can occur anywhere in the Neospora gene, including in the ORF, or in the promoter or other regulatory region, or in any other sequences that naturally comprise the gene or ORF. Such Neospora cells include mutants in which a modified form of the protein normally encoded by the Neospora gene is produced, or in which no protein normally encoded by the Neospora gene is produced, and can be null, conditional or leaky mutants.
[0123] Alternatively, a genetic construct of the present invention can comprise nucleotide sequences that naturally flank the Neospora gene or ORF in situ, such as those presented in SEQ ID NOS: 1, 3, 4, 6, 8, 10, 11 and 12, with only a portion or no nucleotide sequences from the coding region of the gene itself. Such a genetic construct would be useful, e.g., to delete the entire Neospora gene or ORF.
[0124] In a preferred embodiment, a genetic construct of the present invention comprises a polynucleotide molecule that can be used to disable a Neospora gene, comprising: (a) a polynucleotide molecule having a nucleotide sequence that is otherwise the same as a nucleotide sequence encoding a GRA1, GRA2, SAG1, MIC1 or MAG1 protein from
[0125] Methods for carrying out homologous gene replacement in parasitic protozoans are known in the art, and are described, among other places, in Cruz and Beverley, 1990, Nature 348:171-173; Cruz et al., 1991, Proc. Natl. Acad. Sci. USA 88:7170-7174; Donald and Roos, 1994, Mol. Biochem. Parasitol. 63:243-253; and Titus et al., 1995, Proc. Natl. Acad. Sci. USA 92:10267-10271, all of which are incorporated herein by reference.
[0126] For targeted gene mutation through homologous recombination, the genetic construct is preferably a plasmid, either circular or linearized, comprising a mutated nucleotide sequence as described above. In a non-limiting embodiment, at least about 200 nucleotides of the mutated sequence are used to specifically direct the genetic construct of the present invention to the particular targeted Neospora gene for homologous recombination, although shorter lengths of nucleotides can also be effective. In addition, the plasmid preferably comprises an additional nucleotide sequence encoding a reporter gene product or other selectable marker that is constructed so that it will insert into the Neospora genome in operative association with the regulatory element sequences of the native. Neospora gene to be disrupted. Reporter genes that can be used in practicing the invention are well-known in the art and include those encoding CAT, green fluorescent protein, and β-galactosidase, among others. Nucleotide sequences encoding selectable markers are also well-known in the art, and include those that encode gene products conferring resistance to antibiotics or anti-metabolites, or that supply an auxotrophic requirement. Examples of such sequences include those that encode pyrimethamine resistance, or neomycin phosphotransferase (which confers resistance to aminoglycosides), or hygromycin phosphotransferase (which confers resistance to hygromycin).
[0127] Methods that can be used for creating the genetic constructs of the present invention are well-known in the art, and include in vitro recombinant techniques, synthetic techniques, and in vivo genetic recombination, as described, among other places, in Maniatis et al., 1989, above; Ausubel et al., 1989, above; Sambrook et al., 1989, above; Innis et al., 1995, above; and, Erlich, 1992, above.
[0128] Neospora cells can be transformed or transfected with a genetic construct of the present invention in accordance with known techniques, such as, e.g., by electroporation. Selection of transformants can be carried out using standard techniques, such as by selecting for cells expressing a selectable marker associated with the construct. Identification of transformants in which a successful recombination event has occurred and the particular target gene has been disabled can be carried out by genetic analysis, such as by Southern blot analysis, or by Northern analysis to detect a lack of mRNA transcripts encoding the particular protein, or by the appearance of a novel phenotype, such as reduced pathogenicity, or cells lacking the particular protein, as determined, e.g., by immunological analysis, or some combination thereof.
[0129] Neospora cells that can be modified according to the present invention are preferably tachyzoites, but can alternatively be bradyzoites or oocysts. Although cells in certain stages of the Neospora life cycle are diploid, tachyzoites are haploid. Thus, the use of tachyzoites in the production of modified Neospora cells expressing the appropriate mutant phenotype is preferred because tachyzoites require only a single successful recombination event to disrupt the particular Neospora gene. Alternatively, in diploid cells of Neospora, two alleles must be disrupted for each gene. This can be accomplished by sequentially targeting the first allele and then the second allele with genetic constructs bearing two different selectable markers.
[0130] In a further non-limiting embodiment, the genetic construct of the present invention can additionally comprise a different gene or coding region from Neospora or from a different pathogen that infects the animal, which gene or coding region encodes an antigen useful to induce, or contribute to the induction of, a separate and distinct protective immune response in the animal upon vaccination with the modified live Neospora cells of the present invention. This additional gene or coding region can be further engineered to contain a signal sequence that leads to secretion of the encoded antigen from the modified live Neospora cell, thereby allowing for the antigen to be displayed to the immune system of the vaccinated animal.
[0131] The present invention thus provides modified live Neospora cells in which the GRA1, GRA2 SAG1, MIC1 or MAG1 gene has been mutated. The present invention further provides modified live Neospora cells in which a combination of two or more of the GRA1 , GRA2, SAG1, MIC1, and MAG1 genes have been mutated, which cells can be prepared using the general methods presented above. In addition, the present invention provides a method of preparing modified live Neospora cells, comprising: (a) transforming cells of Neospora with a genetic construct of the invention; (b) selecting transformed cells in which the GRA1, GRA2, SAG1, MIC1, or MAG 1 gene has been mutated by the genetic construct; and (c) selecting from among the cells of step (b) those cells that can be used in a vaccine to protect a mammal against neosporosis.
[0132] 4.9. Culturing Neospora Cells
[0133] Neospora cells for use in the present invention can be cultured and maintained in vitro by infecting any receptive host cell line, preferably a mammalian cell line, with tachyzoites according to known techniques described in the art. Mammalian cell lines in which tachyzoites of Neospora can be cultured include, e.g., human foreskin fibroblasts (Lindsay et al., 1993, Am. J. Vet. Res. 54:103-106), bovine cardiopulmonary aortic endothelial cells (Marsh et al., 1995, above), bovine monocytes (Lindsay and Dubey, 1989, above), and monkey kidney cells, among others. For example, tachyzoites of
[0134] Mammalian cell cultures can be grown, and cell cultures that have been infected with Neospora cells can be maintained, in any of several types of culture media described in the art. For example, stationary monolayer cultures of bovine cardiopulmonary aortic endothelial cells infected with tachyzoites of
[0135] Neospora-infected monolayer cultures of mammalian cells are typically maintained under standard tissue culture conditions such as, e.g., at 37° C. and 5% CO
[0136] Modified live Neospora cells of the present invention can also be cultured in mammalian cells, as described above.
[0137] 4.10. Anti-Neospora Vaccines
[0138] The present invention further provides a vaccine against neosporosis, comprising an immunologically effective amount of one or more proteins or polypeptides of the present invention, and a veterinarily acceptable carrier. In a preferred embodiment, the vaccine comprises a
[0139] The present invention further provides a vaccine against neosporosis, comprising an immunologically effective amount of one or more polynucleotide molecules of the present invention, and a veterinarily acceptable carrier. In a preferred embodiment, the vaccine comprises a polynucleotide molecule having a nucleotide sequence encoding a
[0140] The present invention further provides a vaccine against neosporosis, comprising an immunologically effective amount of modified Neospora cells of the present invention, and a veterinarily acceptable carrier. In a preferred embodiment, the modified Neospora cells for use in the vaccine of the present invention are live cells of
[0141] As used herein, the term “immunologically effective amount” refers to that amount of antigen, e.g., protein, polypeptide, polynucleotide molecule, or modified cells, capable of inducing a protective response against neosporosis when administered to a member of a mammalian species after either a single administration, or after multiple administrations.
[0142] The phrase “capable of inducing a protective response” is used broadly herein to include the induction or enhancement of any immune-based response in the animal in response to vaccination, including either an antibody or cell-mediated immune response, or both, that serves to protect the vaccinated animal against neosporosis. The terms “protective response” and “protect” as used herein refer not only to the absolute prevention of neosporosis or absolute prevention of infection by a neosporosis-causing pathogen, but also to any detectable reduction in the degree or rate of infection by such a pathogen, or any detectable reduction in the severity of the disease or any symptom or condition resulting from infection by the pathogen, including, e.g., any detectable reduction in the rate of formation, or in the absolute number, of lesions formed in one or more tissues, or any detectable reduction in the occurrence of abortion, or the transmission of infection from a pregnant mammal to its fetus or from a mammal parent to its offspring, in the vaccinated animal as compared to an unvaccinated infected animal of the same species.
[0143] In a further preferred embodiment, the vaccine of the present invention is a combination vaccine for protecting a mammal against neosporosis and, optionally, one or more other diseases or pathological conditions that can afflict the mammal, which combination vaccine comprises an immunologically effective amount of a first component comprising a polypeptide, polynucleotide molecule, or modified Neospora cells of the present invention; an immunologically effective amount of a second component that is different from the first component, and that is capable of inducing, or contributing to the induction of, a protective response against a disease or pathological condition that can afflict the mammal; and a veterinarily acceptable carrier.
[0144] The second component of the combination vaccine is selected based on its ability to induce, or contribute to the induction of, a protective response against either neosporosis or another disease or pathological condition that can afflict members of the mammalian species, as known in the art. Any antigenic component now known in the art, or to be determined in the future, to be useful in a vaccine composition in the particular mammalian species can be used as the second component of the combination vaccine. Such antigenic components include but are not limited to those that provide protection against pathogens selected from the group consisting of bovine herpes virus (syn., infectious bovine rhinotracheitis), bovine respiratory syncitial virus, bovine viral diarrhea virus, parainfluenza virus types I, II, or III,: Leptospira spp., Campylobacter spp.,
[0145] In a non-limiting embodiment, the combination vaccine of the present invention comprises a combination of two or more components selected from the group consisting of an immunologically effective amount of a protein or polypeptide of the present invention, an immunologically effective amount of a polynucleotide molecule of the present invention, and an immunologically effective amount of modified Neospora cells of the present invention. In a preferred embodiment, the combination vaccine of the present invention comprises a combination of two or more components selected from the group consisting of
[0146] The vaccines of the present invention can further comprise one or more additional immunomodulatory components including, e.g., an adjuvant or cytokine, as described below.
[0147] The present invention *further provides a method of preparing a vaccine against neosporosis, comprising combining an immunologically effective amount of a
[0148] A vaccine comprising modified live Neospora cells of the present invention can be prepared using an aliquot of culture fluid containing said Neospora cells, either free in the medium or residing in mammalian host cells, or both, and can be administered directly or in concentrated form to the mammal. Alternatively, modified live Neospora cells can be combined with a veterinarily acceptable carrier, with or without an immunomodulatory agent, selected from those known in the art and appropriate to the chosen route of administration, preferably where at least some degree of viability of the modified live Neospora cells in the vaccine composition is maintained. Modified Neospora cells that can be used in the vaccine of the present invention are preferably tachyzoites, but can alternatively be bradyzoites or oocysts, or some combination thereof.
[0149] Vaccine compositions of the present invention can be formulated following accepted convention to include veterinarily acceptable carriers, such as standard buffers, stabilizers, diluents, preservatives, and/or solubilizers, and can also be formulated to facilitate sustained release. Diluents include water, saline, dextrose, ethanol, glycerol, and the like. Additives for isotonicity include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others. Stabilizers include albumin, among others. Suitable other vaccine vehicles and additives, including those that are particularly useful in formulating modified live vaccines, are known or will be apparent to those skilled in the art,. See, e.g., Remington's
[0150] The vaccine of the present invention can further comprise one or more additional immunomodulatory components such as, e.g., an adjuvant or cytokine, among others. Non-limiting examples of adjuvants that can be used in the vaccine of the present invention include the RIBI adjuvant system (Ribi Inc., Hamilton, Mont.), alum, mineral gels such as aluminum hydroxide gel, oil-in-water emulsions, water-in-oil emulsions such as, e.g., Freund's complete and incomplete adjuvants, Block co polymer (CytRx, Atlanta Ga.), QS-21 (Cambridge Biotech Inc., Cambridge Mass.), SAF-M (Chiron, Emeryville Calif.), AMPHIGEN® adjuvant, saponin, Quil A or other saponin fraction, monophosphoryl lipid A, and Avridine lipid-amine adjuvant. Specific non-limiting examples of oil-in-water emulsions useful in the vaccine of the invention include modified SEAM62 and SEAM ½ formulations. Modified SEAM62 is an oil-in-water emulsion containing 5% (v/v) squalene (Sigma), 1% (v/v) SPAN® 85 detergent (ICI Surfactants), 0.7% (v/v) TWEEN® 80 detergent (ICI Surfactants), 2.5% (v/v) ethanol, 200 μg/ml Quil A, 100 μg/ml cholesterol, and 0.5% (v/v) lecithin. Modified SEAM ½ is an oil-in-water emulsion comprising 5% (v/v) squalene, 1% (v/v) SPAN® 85 detergent, 0.7% (v/v) Tween 80 detergent, 2.5% (v/v) ethanol, 100 μg/ml Quil A, and 50 μg/ml cholesterol. Other immunomodulatory agents that can be included in the vaccine include, e.g., one or more interleukins, interferons, or other known cytokines. Where the vaccine comprises modified live Neospora cells, the adjuvant is preferably selected based on the ability of the resulting vaccine formulation to maintain at least some degree of viability of the modified live Neospora cells.
[0151] Where the vaccine composition comprises a polynucleotide molecule, the polynucleotide molecule can either be DNA or RNA, although DNA is preferred, and is preferably administered to a mammal to be protected against neosporosis in an expression vector construct, such as a recombinant plasmid or viral vector, as known in the art. Examples of recombinant viral vectors include recombinant adenovirus vectors and recombinant retrovirus vectors. However, a preferred vaccine formulation comprises a non-viral DNA vector, most preferably a DNA plasmid-based vector. The polynucleotide molecule may be associated with lipids to form, e.g., DNA-lipid complexes, such as liposomes or cochleates. See, e.g., International Patent Publication WO 93/24640.
[0152] An expression vector useful as a vaccinal agent in a DNA vaccine preferably comprises a nucleotide sequence encoding one or more antigenic Neospora proteins, or a substantial portion of such a nucleotide sequence, in operative association with one or more transcriptional regulatory elements required for expression of the Neospora coding sequence in a eukaryotic cell, such as, e.g., a promoter sequence, as known in the art. In a preferred embodiment, the regulatory element is a strong viral promoter such as, e.g., a viral promoter from RSV or CMV. Such an expression vector also preferably includes a bacterial origin of replication and a prokaryotic selectable marker gene for cloning purposes, and a polyadenylation sequence to ensure appropriate termination of the expressed mRNA. A signal sequence may also be included to direct cellular secretion of the expressed protein.
[0153] The requirements for expression vectors useful as vaccinal agents in DNA vaccines are further described in U.S. Pat. No. 5,703,055, U.S. Pat. No. 5,580,859, U.S. Pat. No. 5,589,466, International Patent Publication WO 98/35562, and in various scientific publications, including Ramsay et al., 1997, Immunol. Cell Biol. 75:360-363; Davis, 1997, Cur. Opinion Biotech. 8:635-640; Maniackan et al., 1997, Critical Rev. Immunol. 17:139-154; Robinson, 1997, Vaccine 15(8):785-787; Lai and Bennett, 1998. Critical Rev. Immunol. 18:449484; and Vogel and Sarver, 1995, Clin. Microbiol. Rev. 8(3):406410, among others.
[0154] Where the vaccine composition comprises modified live Neospora cells, the vaccine can be stored cold or frozen. Where the vaccine composition instead comprises a protein, polypeptide, polynucleotide molecule, or inactivated modified Neospora cells of the present invention, the vaccine may be stored frozen, or in lyophilized form to be rehydrated prior to administration using an appropriate diluent.
[0155] The vaccine of the present invention can optionally be formulated for sustained release of the antigen. Examples of such sustained release formulations include antigen in combination with composites of biocompatible polymers, such as, e.g., poly(lactic acid), poly(lactic-co-glycolic acid), methylcellulose, hyaluronic acid, collagen and the like. The structure, selection and use of degradable polymers in drug delivery vehicles have been reviewed in several publications, including A. Domb et al., 1992, Polymers for Advanced Technologies 3: 279-292, which is incorporated herein by reference. Additional guidance in selecting and using polymers in pharmaceutical formulations can be found in the text by M. Chasin and R. Langer (eds), 1990, “Biodegradable Polymers as Drug Delivery Systems” in:
[0156] Liposomes can also be used to provide for the sustained, release of antigen. Details concerning how to make and use liposomal formulations can be found in, among other places, U.S. Pat. No. 4,016,100; U.S. Pat. No. 4,452,747; U.S. Pat. No. 4,921,706; U.S. Pat. No. 4,927,637; U.S. Pat. No. 4,944,948; U.S. Pat. No. 5,008,050; and U.S. Pat. No. 5,009,956, all of which are incorporated herein by reference.
[0157] The present invention further provides a method of vaccinating a mammal against neosporosis, comprising administering to the mammal an immunologically effective amount of a vaccine of the present invention. The vaccine is preferably administered parenterally, e.g., either by subcutaneous or intramuscular injection. However, the vaccine can alternatively be administered by intraperitoneal or intravenous injection, or by other routes, including, e.g., orally, intranasally, rectally, vaginally, intra-ocularly, or by a combination of routes, and also by delayed release devices as known in the art. The skilled artisan will be able to determine the most optimal route of vaccine administration, and will also recognize acceptable formulations for the vaccine composition according to the chosen route of administration.
[0158] An effective dosage can be determined by conventional means, starting with a low dose of antigen, and then increasing the dosage while monitoring the effects. Numerous factors may be taken into consideration when determining an, optimal dose per animal. Primary among these is the species, size, age and general condition of the animal, the presence of other drugs in the animal, the virulence of a particular species or strain of Neospora against which the animal is being vaccinated, and the like. The actual dosage is preferably chosen after consideration of the results from other animal studies.
[0159] The dose amount of a Neospora protein or polypeptide of the present invention in a vaccine of the present invention preferably ranges from about 10 μg to about 10 mg, more preferably from about 50 μg to about 1 mg, and most preferably from about 100 μg to about 0.5 mg. The dose amount of a Neospora polynucleotide molecule of the present invention in a vaccine of the present invention preferably ranges from about 50 μg to about 1 mg. The dose amount of modified Neospora cells of the present invention in a vaccine of the present invention preferably ranges from about 1×10
[0160] The vaccine of the present invention is useful to protect mammals against neosporosis. As used herein, the term “mammal” refers to any mammalian species that can be protected against neosporosis using the vaccine of the invention, including dogs, cows, goats, sheep and horses, among others. The vaccine of the invention can be administered at any time during the life of a particular animal depending upon several factors including, e.g., the timing of an outbreak of neosporosis among other animals, etc. The vaccine can be administered to animals of weaning age or younger, or to more mature animals, e.g., as a pre-breeding vaccine to protect against Neospora-related congenital disease or abortion. Effective protection may require only a primary vaccination, or one or more booster vaccinations may also be needed. One method of detecting whether adequate immune protection has been achieved is to determine seroconversion and antibody titer in the animal after vaccination. The timing of vaccination and the number of boosters, if any, will preferably be determined by a veterinarian based on analysis of all relevant factors, some of which are described above.
[0161] The present invention further provides a kit for vaccinating a mammal against neosporosis, comprising a container having an immunologically effective amount of a polypeptide, polynucleotide molecule, or modified Neospora cells of the present invention, or a combination thereof. The kit can optionally comprise a second container having a veterinarily acceptable carrier or diluent. In a preferred embodiment, the polypeptide is selected from the group consisting of GRA1, GRA2, SAG1, MIC1 and MAG1 proteins of
[0162] The following example is illustrative only, and is not intended to limit the scope of the present invention.
[0163] Isolation of
[0164] 5.1. Identification of λ Clones Containing GRA1, GRA2, SAG1 and MIC1 cDNAs
[0165] A cDNA library of
[0166] The recombinant insert DNA sequences of individual putative λZAPExpress clones identified as described above were subjected to PCR analyses essentially as described by Krishnan et al., 1991, Nucl. Acids. Res. 19:6177-6182; and Krishnan et al., 1993, Meth. Enzym. 218:258-279, which publications are incorporated herein by reference. Thus, plugs of agar containing well separated bacteriophage λ plaques were recovered using a sterile Pasteur pipette and immersed in 100 μl of sterile water for at least 1 hr. About 10 μl of the diffused bacteriophage λ particles was used to perform PCR in a total volume of 100 μl containing: (1) 100 ng each of λDASH-T3 and λDASH-T7 oligonucleotide primers specific to the λ bacteriophage vectors, i.e., λZAPExpress, with specificity to the sequences adjacent to the cloning sites (i.e., EcoRI and XhoI), and oriented in a 5′ to 3′ direction towards the insert DNA sequences; (2) 200 μM dNTPs; (3) PCR buffer (Life Technologies, Inc., Gaithersburg, Md.), and (4) ˜1 unit of Taq DNA polymerase buffer (Life Technologies, Inc.): The sequence of λDASH-T3 is 5′-AATTAACCCTCACTAAAGGG (SEQ ID NO: 14). The sequence of λDASH-T7 is 5′-GTAATACGACTCACTATAGGGC (SEQ ID NO: 15). Thermal cycling conditions were as follows: 94° C., 5 min, 1 cycle; 94° C., 1. min, 55° C., 1 min, 72° C., 1 cycle. An aliquot of the reaction mixture (typically 10 μl) was examined by standard agarose gel electrophoresis, ethidium bromide staining and visualization under UV illumination. The PCR mixtures were purified by ion exchange column chromatography using a PCR purification system (Qiagen), and sequenced directly using the λDASH-T3 and λDASH-T7 primers employing fluorescent labeling and the Sanger dideoxy chain termination DNA sequencing technology. Sequences were analyzed for homology to other known sequences by comparison to DNA sequence databases at the National Center for Biotechnology Information, Bethesda, Maryland, 20894, USA. Four sequences, with homology to
[0167] 5.2. Identification of Complete ORFs for
[0168] The above-described bacteriophage λZAPExpress particles identified as containing
[0169] The recombinant plasmid clone identified as containing the complete
[0170] The recombinant plasmid clone identified as containing the complete
[0171] The recombinant plasmid clone identified as containing the complete
[0172] The recombinant plasmid clone identified as containing the complete
[0173] 5.3. Identification of the GRA1 Gene Sequence
[0174] A genomic DNA library of
[0175] 2.5×10
[0176] A λ clone designated as Gra1#8 was identified by this procedure, and was used as a template for PCR amplification using primers bd256 and bd254. Primer bd256 is 5′-TGCTAGTACTGGCGAGTGAA (SEQ ID NO: 18). Primer bd254 is 5′-CAGGTTTGCCACACATTTTT (SEQ ID NO: 19). The PCR fragment obtained was subcloned into pGEM-T EASY vector (Promega, Madison, Wis.). The cloned fragment was sequenced employing fluorescent labelling and Sanger dideoxy chain termination sequencing technology. Sequence analysis revealed that the cloned fragment contained the GRA1 gene. The GRA1 gene sequence (SEQ ID NO: 3) contains an ORF from nt 605 to nt 855 and from nt 983 to nt 1304, which shares complete identity to the GRA1 cDNA sequence (SEQ ID NO: 1) of pRC77 (ATCC 209685) from nt 205 to nt 777. However, the GRA1 gene sequence (SEQ ID NO: 3) differs from the cDNA sequence (SEQ ID NO: 1) at a single nucleotide position in the 3′ untranslated region at nt 1728 of the GRA1 gene where a thymine resides, instead of a guanine at nt 1201 of pRC77. This difference may be due to a RFLP or a sequencing error in pRC77 because this nucleotide discrepancy was confirmed in 2 separate subclones from the GRA1#8 λ genomic clone. The GRA1 gene sequence (SEQ ID NO: 3) further comprises an intron extending from nt 856 to nt 982. Furthermore, three promoter motifs have been identified within 150 bp. 5′ of the mRNA start site that are similar to those found in
[0177] 5.4. Identification of the SAG1 Gene Sequence
[0178] Oligonucleotide primers specific to the SAG1 gene were synthesized based on the SAG1 ORF of the DNA sequence obtained from pRC102. The first primer, designated as NCSAG1 5′, was 5′-ATGTTTCCTCCTCGGGCAGTG (SEQ ID NO: 20); and the second primer, designated as NCSAG1 3′, was 5′-TCACGCGACGCCAGCCGCTATCG (SEQ ID NO: 21). It was later determined that primer NCSAG1 5′, as presented above, was inadvertently designed to include an additional three nucleotides (CCT), and the presence of these three additional nucleotides was thus taken into account when determining the actual SAG1 gene sequence.
[0179] PCR was performed using primers NCSAG1 5′ (SEQ ID NO: 20) and NCSAG1 3′ (SEQ ID NO: 21) on N. caninum strain NC-1 genomic DNA as template. An ˜1 kb amplified fragment was obtained, which was cloned in plasmid pCR2.1 and in pBlunt (Invitrogen, Carlsbad, Calif.) according to manufacturers recommendations. Recombinant plasmids identified to contain the genomic SAG1 PCR fragment were sequenced employing fluorescent labeling and Sanger dideoxy chain termination sequencing technology using standard ‘universal’, ‘reverse’ and the following oligonucleotides: NCSAG1200: 5′-GCCCTGACAATTCGACCGCC (SEQ ID NO: 22); NCSAG1500: 5′-CCCACAACATCCAAGTCGTTC (SEQ. ID NO: 23); NCSAG1660: 5′-GTTTTGCACCATCCTTAGTG (SEQ ID NO: 24); and NCSAG1320: 5′-GAGAGTTTGCTTTGCACCG (SEQ ID NO: 25). The DNA sequences obtained were assembled using the DNAStar software package, and were found to be identical to the sequence of the SAG1 ORF educed from pRC102. Thus, the genomic sequence of the SAG1 gene is identical to that obtained from cDNA sequencing.
[0180] 5.5. Identification of the MIC1 Gene Sequence
[0181] A ˜2.2 kb DNA fragment was PCR amplified from
[0182] The total length of the MIC1 gene region is 2278 bp (SEQ ID NO: 10), comprising an ORF from nt 1 to nt 73, nt 345 to nt 811, nt 1187 to nt 1265, and nt 1515 to nt 2278, with three intervening introns.
[0183] 5.6. Identification of the MAG1 Gene Sequence
[0184] BspDI, EcoRI and HindIII Vectorette libraries (Genosys) were prepared according to manufacturer's protocols using genomic clone Gra1#8 as template DNA. Using the antisense primer bd234 specific for 5′ GRA1 cDNA, and Vectorette :primer II (ER-70); a ∞2 kb fragment was amplified from the HindIII Vectorette library using Klentaq (AB Peptide Inc.) and PFU (Stratagene) polymerases. Primer bd234 is 5′-CCAGCCGAGTTCGTGTTCAGA (SEQ ID NO: 26), and primer ER-70 is CAACGTGGATCCGATTCAAGCTTC (SEQ ID NO: 27). The product was run on a 1% LMA gel, excised, and used directly in a cloning reaction with pGEM-T EASY vector. Transformation into
[0185] Primer bd252 was used in combination with a variant of primer T7, and Gra1#8 DNA as template, in a PCR to map one end of clone Gra1#8. Primer bd252′ is 5′-CCGCGCTACCACTTTCCA (SEQ ID NO: 29). The T7 primer variant is 5′-GTAATACGACTCACTATA (SEQ ID NO: 30). A ˜2.5 kb-fragment was amplified using primer bd252 and the T7 variant, which product was subcloned into pGEM-T EASY vector, and this plasmid was named bd282. Primer walking, using fluorescent labeling and Sanger dideoxy chain termination sequencing technology, was employed to complete the entire sequence of plasmid bd282.
[0186] Sequences from plasmids bd245 and bd282 were used to generate the contiguous sequence shown in SEQ ID NO: 11, encoding the MAG1 gene which was identified using WU-BLAST2 (Washington University BLAST version 2). Results indicate that this sequence has homology to the
[0187] DNA from lambda Gra1#8 clone was digested with NotI to release insert DNA, which was subsequently extracted with phenol/chloroform, precipitated and resuspended in water. DNA from this preparation was ligated to purified NotI digested BS KS+ vector DNA (Stratagene), and thereafter transformed into
[0188] 5.7. Identification of the MAG1 and GRA1 Promoters of Neospora
[0189] 5.7.1. Background on
[0190] Functional mutational analysis of the
[0191] 5.7.2. Neospora MAG1-GRA1 Promoter Elements
[0192] Genomic sequence analysis of the complete MAG1-GRA1 region of TABLE position to putative transcriptional start promoter element site defined by pRC77 CAAT box −133 to −130 CAAT box (reverse)* −49 to −52 CGTCTCA** −125 to −119 CGTCTCA** −106 to −100 CGTCTCT** −70 to −64
[0193] 5.7.3. Construction of Neospora GRA1 Promoter Construct
[0194] The functionality of the 577 bp putative MAG1/GRA1 bidirectional promoter containing the two heptanucleotide motifs and two CAAT boxes was tested by engineering a plasmid containing the LacZ reporter gene downstream of this defined sequence and then transfecting this plasmid into NC-1 tachyzoites. A Bluescript plasmid, designated as GLS, containing the
[0195]
[0196] To conduct the β-galactosidase assay, tubes were thawed, mixed, incubated at 50° C. for 1 hr, and then spun in a microcentrifuge. Fifty μl of supernatant was used per sample. The β-galactosidase assay was performed as described by Howe et al., 1997, above. A standard curve was prepared using a strain of
[0197] 5.7.4. Results
[0198] Samples containing cell lysate from
[0199] Expression and Immunoreactivity of a Recombinant
[0200] DNA sequences representing the MIC1 ORF were PCR-amplified and cloned into pQE50 (Qiagen), which is a recombinant system that facilitates inducible high level expression of the cloned sequence. The recombinant plasmid was designated as pQEmic1. Whole cell lysates from uninduced and induced
[0201] Whole, cell lysates of induced and uninduced
[0202] Vaccine Formulations
[0203] A vaccine against neosporosis is formulated by combining a
[0204] Deposit of Biological Materials
[0205] The following biological materials were deposited with the American Type Culture Collection (ATCC) at 12301 Parklawn Drive, Rockville, Md., 20852, USA, on Mar. 19, 1998, and were assigned the following accession numbers:
Plasmid ATOC Accession No. pRC77 209685 pRC5 209686 pRC102 209687 pRC340 209688
[0206] The following additional biological material was deposited with the ATCC, at 10801 University Blvd, Manassas, Va., 20110, USA, on Nov. 9, 1998, and was assigned the following accession number:
Plasmid ATCC Accession No. bd304 203413
[0207] All patents, patent applications, and publications cited above are incorporated herein by reference in their entirety.
[0208] The present invention is not limited in scope by the specific embodiments described, which are intended as single illustrations of individual aspects of the invention. Functionally equivalent compositions and methods are within the scope of the invention. Indeed, various modifications of the invention, in addition to those shown and described herein, will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.