Match Document Document Title
PCT No. PCT/FR95/00914 Sec. 371 Date Feb. 28, 1997 Sec. 102(e) Date Feb. 28, 1997 PCT Filed Jul. 7, 1995 PCT Pub. No. WO96/02655 PCT Pub. Date Feb. 1, 1996Compositions containing one or more...
DE102010038842A1 New aptamer that specifically binds to human tau protein or its fragment, useful e.g. in vitro for isolating, purifying and/or detecting tau protein, and to treat cerebral infarction, pick disease and/or progressive supranuclear palsy  
Aptamer that specifically binds to human tau protein or its fragment, is new. Independent claims are included for: (1) kit comprising the aptamer; (2) a method for the purification of human tau...
DE102010033102A1 Determining a locus change i.e. single nucleotide polymorphism on male cattle, comprises determining the weight and/or the proportions of a fetus by molecular markers  
Determining a locus change on male cattle, comprises determining the weight and/or the proportions of a fetus by molecular markers. Independent claims are included for: (1) primers for detection...
DE102009013748B4 Determination of interactions constant antibody portions with Fc gamma receptors  
A recombinant expression vector comprising sequences for the recombinant expression of at least one fusion protein on the surface of a mammalian cell comprising a) an extracellular portion of a...
DE102009024757B4 Methods and devices for controlling a chemical reaction using pressure using high-pressure-optimized biocomponents  
Method for controlling a chemical reaction by means of pressure using high-pressure-optimized biocomponents, a combination of high-pressure-optimized and low-pressure-optimized biocomponents,...
DE102010036356A1 Device for synthesis of radiolabeled compounds  
The invention relates to a device for the synthesis of radiolabeled compounds, comprising - Having a reaction vessel for reacting a precursor compound, the protecting groups, with a radioactive...
DE102008063592B4 Multifunctional laboratory process bags for the clean production of biomolecules  
Process for as many times repeatable providing subsets purified biomolecules or Biologicals a whole the same clonal origin for quality tests or functional tests with steps a) introducing at least...
The present invention relates to novel Death Domain Containing Receptor-4 (DR4) proteins which are members of the tumor necrosis factor (TNF) receptor family. In particular, isolated nucleic acid...
DE202011103324U1 Therapeutic anti-TIRC7 antibody for use in immune and other diseases  
Monoclonal antibody or antigen-binding molecule which is able to bind to an antigen comprising or consisting of the amino acid sequence of one of the SEQ ID NOs: 9 to 11.
DE102009044085A1 Procedure for in vitro detection and differentiation of pathophysiological conditions  
The present invention relates to the use of defined polynucleotides for the formation of at least one multi-gene marker for the production of a multiplex assay as an aid for in vitro detection and...
DE102010015792A1 Active ingredient combinations of magnolia bark extract and surface-active agents  
Active ingredient combinations a) a Magnolia bark extract from Magnolia grandiflora containing Magnolol and / or Honokiol and b) one or more surface-active substances A, selected from the group of...
DE102010006245A1 Manufacture and use of antibacterial, antiproliferative and antiphytopathogenic benzanthrins  
Connection of the general structure in which R is a hydrogen atom (H) or an unsubstituted, monosubstituted or polysubstituted C1-C20-Alkyl, where the alkyl can be straight, branched, cyclic or...
DE102010010052A1 Signaling binding molecules, devices, and methods of use thereof  
The invention relates to signaling binding molecules, also referred to as the sensor-actuator molecules, as well as devices and methods for their use. The sensor-actuator molecules comprise at...
DE102010008067A1 Reducing carbon dioxide emission into atmosphere by recycling carbon dioxide in energy- and natural cycle, comprises chemically reacting filtered out carbon dioxide with hydrogen in a controlled production process, to obtain glucose  
Reducing the carbon dioxide emission into the atmosphere by recycling carbon dioxide in energy- and natural cycle, comprises chemically reacting the filtered out carbon dioxide with hydrogen in a...
DE102010007548A1 Microarray consisting of spots, at which mixture of polymerase and sequence specific primers is immobilized and coated with substrate, in which enzyme enabling sequence specific amplification is added, useful to genotype and quantify DNA  
Microarray consisting of spots, at which a mixture of polymerase and sequence-specific primers is immobilized using a method and is additionally coated with a precipitation efficient substrate, in...
DE102010007097A1 Conjugates from [F-18] carriers with bioactive, organic compounds and their representation  
The present invention relates to novel chemical compounds that are used under particularly mild conditions 18Can be F-fluorinated. In this way, they enable the use of a novel fluorination process...
DE10344967B4 Cyclodextrin derivatives containing alkoxyl groups; Process for their production and their use  
Cyclodextrin derivative of the formula (I) A [-Z1-XZ2- (EO / PO)n-R1]m(I)wherein A denotes an m-valent cyclodextrin residue, which is formed from a cyclodextrin molecule by removing m hydroxyl...
DE102010004957A1 Biologically active molecules for influencing viral, bacterial, parasite-infected cells and / or tumor cells and methods for their application  
The task was to specifically inhibit viral, bacterial, parasite-infected cells and tumor cells even in the case of mutations effectively. According to the invention biologically active molecules...
DE69535036T3 immunomodulatory OLIGONUCLEOTIDES  
Stabilised immunostimulatory oligonucleotides which contain at least one unmethylated CpG dinucleotide for medicinal use.
DE102006053637B4 New fluorine-substituted 1,4-benzothiepin-1,1-dioxide derivatives, medicaments containing these compounds and their use  
Compounds of formula I, in what mean X NH; R1 (C1-C6) Alkyl; R4 F; R4 'H, F; R2, R2 ', R3, R3', R5, R5 'independently of one another H, F, Cl, Br, I, OH, - (CH2) -OH, CH2F, CHF2, CF3, NO2, N3, CN,...
DE102006053635B4 New 1,4-benzothiepin-1,1-dioxide derivatives substituted with benzyl radicals, medicaments containing these compounds and their use  
Compounds of the formula and their pharmaceutically acceptable salts.
DE69912487T3 Additives for inorganic binder based on a hydrogenated disaccharide, these additives containing inorganic binding agent and processes for their preparation  
Additive for mineral binder comprises polyol composition containing at least 40, preferably 55 and especially at least 65 wt. hydrogenated disaccharide; the % being expressed with respect to dry...
DE102008064667B4 A method for producing a Detektionskonjugats  
A method for producing a Detektionskonjugats for use in the analysis of cells for the presence of an analyte, characterized in that a metal is eroded in an aqueous composition containing a...
DE102009046982A1 Solid phase bound nucleosides  
The invention relates to solid phase-bound nucleosides in which the nucleoside is covalently bound to a solid phase via a 3'-O-disulfide bridge, and to a method for their production and their use.
DE102009046981A1 Process for the production of trinucleotides  
The invention relates to a method for producing protected trinucleotides using a combination of specific protective groups.
DE102009051438A1 Fluorescent dyes  
The present invention relates to new compounds suitable as fluorescent dyes. In particular, the present invention relates to a new class of pharmacologically active compounds derivatized with...
DE102006022569B4 Species-independent detection method for biological material  
Use of at least one first primer for DNA fingerprint analysis, wherein the at least first primer contains a sequence derived from an 8 bp palindromic or GC rich sequence, wherein 5 'to the...
DE102009045006A1 Anti-CD33 antibodies and their use in immunotargeting in the treatment of CD33-associated diseases  
The invention relates to antibodies against the tumor-associated antigen CD33 and their use for the immunotargeting of CD33-positive cells. The antibodies according to the invention are suitable...
DE202009016292U1 Composition acting as an emulsifier for water-soluble solubilisates of hydrophobic compounds  
The invention relates to a composition having an HLB value greater than 10, which acts as an emulsifier for a solubilisate of at least one raw material and/or active substance which is insoluble...
DE102010034968A1 Polymerizable compounds and liquid crystal media  
The invention relates to polymerizable compounds of the formula I, where P, Sp, R1, R2, A1, A2, A3, Z1, Z3, V, m, n, o, x and y have the meanings given in claim 1, and liquid-crystalline media...
A process for producing crystal 1-kestose wherein granular crystal 1-kestose in the form of large crystals can be produced at a high yield is disclosed. A high-purity solution of 1-kestose is...
A recombinant DNA molecule comprising a nucleotide sequence (I) which codes for a polypeptide displaying the antigenicity of one, two or more of the Phl p I epitope clones (28, 34, 41, 42, 43, 45,...
DE69423007T3 DNA CODING FOR A HUMAN RECEPTOR pancreatic polypeptide (Y4) AND ITS USE  
This invention provides an isolated nucleic acid molecule encoding a human Y4 receptor, an isolated protein which is a human Y4 receptor, vectors comprising an isolated nucleic acid molecule...
DE102009032502A1 Detection of antigens  
The invention discloses a method for detecting at least one antigen, which comprises the following steps: providing magnetic beads which are coated with specific antibodies for at least one...
The molecules and methods of the present invention provide a means for in vivo production of a therapeutic molecule in a selected subset of cells. The pre-therapeutic molecules of the invention...
DE102009024732A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-1 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-3, is new. Oligonucleotide, comprising one or more sequences including (5'-gatcttagggatgtccacctc-3') (SEQ ID NO. 1),...
DE102009024731A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-2 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-4, is new. Oligonucleotide, comprising one or more sequences including 5'-tattcctgcccccgtagag-3' (SEQ ID NO. 1),...
DE102009024730A1 New oligonucleotide, comprising specified sequences, is argonaute-3a expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide comprising one or more sequences comprising SEQ ID NOs: 1-7, is new. Oligonucleotide, comprising one or more sequences including agaaaaatgaacgccccaca (SEQ ID NO: 1),...
DE102009024729A1 New oligonucleotide, comprising specified sequences, is argonaute-4 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide, comprising one or more sequences comprising SEQ ID NOs: 1-6, is new. Oligonucleotide, comprising one or more sequences including caggcaaagattggaaaggg (SEQ ID NO: 1),...
DE102009022513A1 A method for protecting membranes  
The present invention relates to a method for the protection of membranes by treatment with an aqueous solution containing at least one water-soluble, nucleophilic compound, and the use of this...
DE102009020261A1 A method for solid-phase-aided manufacturing phosphatverbr├╝ckter nucleoside conjugates  
The invention relates to a process for preparing phosphatverbr├╝ckter nucleoside conjugates. In the method, a cycloSaligenyl-nucleotide is prepared, to which a linker is added, by means of which...
DE69532369T3 Recombinant infectious non-in-segment split, negative-Strange-RNA virus  
The present invention provides the generation of infectious replicating non-segmented negative-stranded RNA virus, entirely from cloned cDNA. This process offers the possibility to introduce...
DE102009012169B3 Device and method for producing a replica or a derivative of an array of molecules and applications thereof  
A method of manufacturing a replica, or a derivative of an array of molecules wherein said array having a spatial array of separate samples of molecules, said generating comprises at least one...
DE102009013748A1 Determination of interactions constant antibody portions with Fc gamma receptors  
The invention relates to a novel method for the exact determination of the binding of the Fc-portion of IgG antibodies to Fc-gamma receptors and for the simultaneous examination of the antigen...
DE102009015978A1 Method for determining the predisposition of a subject to altered biotransformation and the development of adverse drug reactions in a treatment of the patient with atorvastatin  
The present invention relates to a method of determining a predisposition of a patient for the development of muscular disorders and / or modified biotransformation at a treatment of the patient...
DE10103509B4 Phosphoserinphospatase gene of coryneform bacteria  
The present invention provides a DNA coding for a protein defined in the following (A) or (B) is obtained from Brevibacterium flavum chromosomal DNA library by cloning a DNA fragment that...
DE19823062B4 A process for the production of an alkyl glycoside  
The process for producing an alkylglycoside, wherein the amount of coarse sugar particles in alkylglycoside can be reduced without reducing reaction yield, is provided. The process for producing...
DE102008064184A1 Method for increasing the sucrose yield in agricultural cultivation of sugar beet and sugar  
Use of a nucleic acid which is suitable in a plant cell to reduce the enzymatic activity of an invertase, for forming a sucrose storage organ of a plant, wherein the sucrose concentration compared...
The present invention relates to novel complexes of major histocompability complex (MHC) molecules and uses of such complexes. In particular, the invention relates to MHC fusion complexes that...
DE10247073B4 A process for preparing monomeric uronic acids, in particular D-mannuronic acid and D-guluronic acid, and their use as medicaments  
A process for preparing monomeric uronic acids, comprising the steps of: a polyuronic fermenting a producing strain of bacteria, the epimerase gene has been inactivated. b. Isolating the...