Match Document Document Title
DE102010008067A1 Reducing carbon dioxide emission into atmosphere by recycling carbon dioxide in energy- and natural cycle, comprises chemically reacting filtered out carbon dioxide with hydrogen in a controlled production process, to obtain glucose  
Reducing the carbon dioxide emission into the atmosphere by recycling carbon dioxide in energy- and natural cycle, comprises chemically reacting the filtered out carbon dioxide with hydrogen in a...
DE102010007548A1 Microarray consisting of spots, at which mixture of polymerase and sequence specific primers is immobilized and coated with substrate, in which enzyme enabling sequence specific amplification is added, useful to genotype and quantify DNA  
Microarray consisting of spots, at which a mixture of polymerase and sequence-specific primers is immobilized using a method and is additionally coated with a precipitation efficient substrate, in...
DE102010007097A1 Conjugates from [F-18] carriers with bioactive, organic compounds and their representation  
The present invention relates to novel chemical compounds that are used under particularly mild conditions 18Can be F-fluorinated. In this way, they enable the use of a novel fluorination process...
DE10344967B4 Cyclodextrin derivatives containing alkoxyl groups; Process for their production and their use  
Cyclodextrin derivative of the formula (I) A [-Z1-XZ2- (EO / PO)n-R1]m(I)wherein A denotes an m-valent cyclodextrin residue, which is formed from a cyclodextrin molecule by removing m hydroxyl...
DE102010004957A1 Biologically active molecules for influencing viral, bacterial, parasite-infected cells and / or tumor cells and methods for their application  
The task was to specifically inhibit viral, bacterial, parasite-infected cells and tumor cells even in the case of mutations effectively. According to the invention biologically active molecules...
DE69535036T3 immunomodulatory OLIGONUCLEOTIDES  
Stabilised immunostimulatory oligonucleotides which contain at least one unmethylated CpG dinucleotide for medicinal use.
DE102006053637B4 New fluorine-substituted 1,4-benzothiepin-1,1-dioxide derivatives, medicaments containing these compounds and their use  
Compounds of formula I, in what mean X NH; R1 (C1-C6) Alkyl; R4 F; R4 'H, F; R2, R2 ', R3, R3', R5, R5 'independently of one another H, F, Cl, Br, I, OH, - (CH2) -OH, CH2F, CHF2, CF3, NO2, N3, CN,...
DE102006053635B4 New 1,4-benzothiepin-1,1-dioxide derivatives substituted with benzyl radicals, medicaments containing these compounds and their use  
Compounds of the formula and their pharmaceutically acceptable salts.
DE102008064667B4 A method for producing a Detektionskonjugats  
A method for producing a Detektionskonjugats for use in the analysis of cells for the presence of an analyte, characterized in that a metal is eroded in an aqueous composition containing a...
DE102009046982A1 Solid phase bound nucleosides  
The invention relates to solid phase-bound nucleosides in which the nucleoside is covalently bound to a solid phase via a 3'-O-disulfide bridge, and to a method for their production and their use.
DE102009046981A1 Process for the production of trinucleotides  
The invention relates to a method for producing protected trinucleotides using a combination of specific protective groups.
DE102009051438A1 Fluorescent dyes  
The present invention relates to new compounds suitable as fluorescent dyes. In particular, the present invention relates to a new class of pharmacologically active compounds derivatized with...
DE102006022569B4 Species-independent detection method for biological material  
Use of at least one first primer for DNA fingerprint analysis, wherein the at least first primer contains a sequence derived from an 8 bp palindromic or GC rich sequence, wherein 5 'to the...
DE102009045006A1 Anti-CD33 antibodies and their use in immunotargeting in the treatment of CD33-associated diseases  
The invention relates to antibodies against the tumor-associated antigen CD33 and their use for the immunotargeting of CD33-positive cells. The antibodies according to the invention are suitable...
DE202009016292U1 Composition acting as an emulsifier for water-soluble solubilisates of hydrophobic compounds  
Composition with an HLB value of greater than 10, which acts as an emulsifier for a solubilizate of at least one raw and / or active ingredient which is insoluble or only sparingly soluble in...
DE102010034968A1 Polymerizable compounds and liquid crystal media  
The invention relates to polymerizable compounds of the formula I, where P, Sp, R1, R2, A1, A2, A3, Z1, Z3, V, m, n, o, x and y have the meanings given in claim 1, and liquid-crystalline media...
DE69535587T3 RECOMBINANT ALLERGEN, ITS FRAGMENTS AND THAT CORRESPONDING DNA MOLECULES, VECTORS, AND THIS DNA MOLECULES CONTAINING FARMERS, AND DIGNOSTISCHE AND THERAPEUTIC USES SAID ALLERGENS AND FRAGMENTS  
A recombinant DNA molecule comprising a nucleotide sequence (I) which codes for a polypeptide displaying the antigenicity of one, two or more of the Phl p I epitope clones (28, 34, 41, 42, 43, 45,...
DE69423007T3 DNA CODING FOR A HUMAN RECEPTOR pancreatic polypeptide (Y4) AND ITS USE  
This invention provides an isolated nucleic acid molecule encoding a human Y4 receptor, an isolated protein which is a human Y4 receptor, vectors comprising an isolated nucleic acid molecule...
DE102009032502A1 Detection of antigens  
The invention discloses a method for detecting at least one antigen, which comprises the following steps: providing magnetic beads which are coated with specific antibodies for at least one...
DE69636937T3 BY TRANS-CLEAVAGE GOT THERAPEUTIC molecules  
The molecules and methods of the present invention provide a means for in vivo production of a therapeutic molecule in a selected subset of cells. The pre-therapeutic molecules of the invention...
DE102009024732A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-1 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-3, is new. Oligonucleotide, comprising one or more sequences including (5'-gatcttagggatgtccacctc-3') (SEQ ID NO. 1),...
DE102009024731A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-2 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-4, is new. Oligonucleotide, comprising one or more sequences including 5'-tattcctgcccccgtagag-3' (SEQ ID NO. 1),...
DE102009024730A1 New oligonucleotide, comprising specified sequences, is argonaute-3a expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide comprising one or more sequences comprising SEQ ID NOs: 1-7, is new. Oligonucleotide, comprising one or more sequences including agaaaaatgaacgccccaca (SEQ ID NO: 1),...
DE102009024729A1 New oligonucleotide, comprising specified sequences, is argonaute-4 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide, comprising one or more sequences comprising SEQ ID NOs: 1-6, is new. Oligonucleotide, comprising one or more sequences including caggcaaagattggaaaggg (SEQ ID NO: 1),...
DE102009022513A1 A method for protecting membranes  
The present invention relates to a method for the protection of membranes by treatment with an aqueous solution containing at least one water-soluble, nucleophilic compound, and the use of this...
DE102009020261A1 A method for solid-phase-aided manufacturing phosphatverbrückter nucleoside conjugates  
The invention relates to a process for preparing phosphatverbrückter nucleoside conjugates. In the method, a cycloSaligenyl-nucleotide is prepared, to which a linker is added, by means of which...
DE69532369T3 Recombinant infectious non-in-segment split, negative-Strange-RNA virus  
The present invention provides the generation of infectious replicating non-segmented negative-stranded RNA virus, entirely from cloned cDNA. This process offers the possibility to introduce...
DE102009012169B3 Device and method for producing a replica or a derivative of an array of molecules and applications thereof  
A method of manufacturing a replica, or a derivative of an array of molecules wherein said array having a spatial array of separate samples of molecules, said generating comprises at least one...
DE102009013748A1 Determination of interactions constant antibody portions with Fc gamma receptors  
The invention relates to a novel method for the exact determination of the binding of the Fc-portion of IgG antibodies to Fc-gamma receptors and for the simultaneous examination of the antigen...
DE102009015978A1 Method for determining the predisposition of a subject to altered biotransformation and the development of adverse drug reactions in a treatment of the patient with atorvastatin  
The present invention relates to a method of determining a predisposition of a patient for the development of muscular disorders and / or modified biotransformation at a treatment of the patient...
DE10103509B4 Phosphoserinphospatase gene of coryneform bacteria  
The present invention provides a DNA coding for a protein defined in the following (A) or (B) is obtained from Brevibacterium flavum chromosomal DNA library by cloning a DNA fragment that...
DE19823062B4 A process for the production of an alkyl glycoside  
A process for producing an alkyl glycoside, comprising the steps of: a) mixing a hydrated, solid sugar with a straight-chain or branched, saturated or unsaturated alcohol having 8 to 22 carbon...
DE102008064184A1 Method for increasing the sucrose yield in agricultural cultivation of sugar beet and sugar  
Use of a nucleic acid which is suitable in a plant cell to reduce the enzymatic activity of an invertase, for forming a sucrose storage organ of a plant, wherein the sucrose concentration compared...
DE69519101T3 MHC COMPLEXES AND THEIR USE  
The present invention relates to novel complexes of major histocompability complex (MHC) molecules and uses of such complexes. In particular, the invention relates to MHC fusion complexes that...
DE10247073B4 A process for preparing monomeric uronic acids, in particular D-mannuronic acid and D-guluronic acid, and their use as medicaments  
A process for preparing monomeric uronic acids, comprising the steps of: a polyuronic fermenting a producing strain of bacteria, the epimerase gene has been inactivated. b. Isolating the...
DE102007053947B4 A process for the synthesis of sucrose-6-acetic acid ester  
A method for the synthesis of sucrose-6-acetic acid esters, comprising the steps of: (A) the addition of sucrose in a polar aprotic solvent and stirring the solvent to dissolve it and to produce a...
DE102004062386B4 Monacolin K biosynthesis genes  
Isolated DNA molecules (a) have any of the sequences (all reproduced) (1; 226 nucleotides (nt)), a lovastatin probe; (2; 9818 nt), mkA; (3; 8081 nt), mkB; (4; 1717 nt), mkC; (5; 792 nt), mkD; (6;...
DE112008001507T5 New hybrid compounds of nucleobases and organic redox molecules and their use  
Hybrid combination with i) a unit of a purine or pyrimidine nucleobase or a Dervivat thereof, ii) a redox active moiety and iii) a spacer moiety connecting the Nukleobaseeinheit with the redox...
DE69825128T3 USE OF AZITHROMYCIN FOR TOPICAL TREATMENT OF EYE INFECTIONS  
The invention relates to topical compositions containng azithromycin for the treatment of ocular infections.
DE102008053549A1 Glucosylglycerol containing composition  
The invention relates to a composition comprising 20-80 wt .-% wt .-% glucosylglycerol and 0.5-20 one or more mono- and / or disaccharides. Surprisingly, it has been found that a particular...
DE102008053284A1 Stabilizer, useful for stabilizing heparin-binding growth factors and for manufacturing medicament e.g. for wound healing and bone regeneration, comprises a compound having an oligophosphate group  
Stabilizer comprises a compound having at least one oligophosphate group. Independent claims are also included for: (1) stabilizing heparin-binding growth factors, comprising contacting the...
DE102008053607A1 Solubilizing agent for metal ions  
The invention relates to a solubilizing agent for metal ions, and sparingly soluble metal compounds containing, as solubilizing agent, an oxidation product of starch, methods for solubilizing...
DE202009017108U1 Monoclonal antibody to Microcephalin (MCPH1)  
A monoclonal antibody or fragment thereof, characterized in that it specifically binds to Microcephalin (MCHP1) and recognizes an epitope which is located in the area of ​​amino acids 1 to 267 of...
DE102005031755B9 Salmonella spp. binding peptides, nucleic acids coding therefor, their uses, and methods and kits for the enrichment, immobilization and detection of Salmonella spp.  
Salmonella spp. binding peptide selected from the sequences SEQ ID NO. 1 to NO. 3, SEQ ID NO. 5 to NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 14 to NO. 16, SEQ ID NO. 18, SEQ ID NO. 20 to NO....
DE19943491B4 Improved compressed  
A process for producing a compressed product of isomaltulose, isomalt, or isomalt variants, wherein the isomalt variants 1,6-GPS and 1,1-GPM-containing mixtures are that through to deviate from...
DE69029370C5 Erythropoietin isoforms  
Continuation in part of U.S. application no. 421,444 filed 13 October 1989. Erythropoietin isoforms claimed are produced by expression of exogenous DNA in a non-human eukaryotic host cell. They...
DE102008044914A1 A process for preparing nucleoside conjugates phosphatverbrückter  
The invention relates to a process for preparing phosphatverbrückter nucleoside conjugates. In the method, a nucleophile is dissolved in a non-aqueous solvent, and dried and then added a...
DE19854973B4 A method for purifying nucleic acids  
Preparation comprising particles having a glass surface, which contains more than 75th% of these particles have a particle size between 0.5 and 15 microns have characterized in that the glass...
DE102008035299A1 Conjugate, particularly bromovinyl-deoxyuridine for manufacture medicament for inhibiting or suppressing metastasis including distant metastases in cytostatic treatment, includes heat shock protein and nucleoside  
A conjugate includes a heat shock protein 27 (Hsp 27) and a nucleoside. The conjugate has a general formula (I), where the conjugate is made of heat shock protein 27 (Hsp 27) and nucleoside. R...
DE10237691B4 A method for detecting single nucleotide polymorphisms (SNP) in genes of drug metabolism and test kit for performing the method  
A method for the detection of single nucleotide polymorphisms in the cytochrome P450 genes, characterized in that a) gene segments of human CYP2 genes from a sample with the amplification primers...