Title:
METHOD OF DIAGNOSING BLADDER CANCER
Kind Code:
A1


Abstract:
Objective methods for detecting and diagnosing bladder cancer (BLC) are described herein. In one embodiment, the diagnostic method involves determining the expression level of a BLC-associated gene that discriminates between BLC cells and normal cells. The present invention further provides means for predicting and preventing bladder cancer metastasis using BLC-associated genes having unique altered expression patterns in bladder cancer cells with lymph-node metastasis. Finally, the present invention provides methods of screening for therapeutic agents useful in the treatment of bladder cancer, methods of treating bladder cancer and method for vaccinating a subject against bladder cancer. In particular, the present application provides novel human genes C2093, B5860Ns and C6055s whose expression is markedly elevated in bladder cancers. The genes and polypeptides encoded by the genes can be used, for example, in the diagnosis of bladder cancers, as target molecules for developing drugs against the disease, and for attenuating cell growth of bladder cancer.



Inventors:
Nakamura, Yusuke (Tokyo, JP)
Katagiri, Toyomasa (Tokyo, JP)
Nakatsuru, Shuichi (Kanagawa, JP)
Application Number:
13/168720
Publication Date:
01/19/2012
Filing Date:
06/24/2011
Assignee:
Oncotherapy Science, Inc. (Kanagawa, JP)
Primary Class:
Other Classes:
435/69.3, 435/252.33, 435/320.1, 435/357, 435/362, 435/365, 536/23.5
International Classes:
A61K39/00; A61P35/00; A61P37/04; C07H21/04; C12N1/21; C12N5/10; C12N15/63; C12P21/00
View Patent Images:



Foreign References:
WO2002031111A2
Primary Examiner:
GODDARD, LAURA B
Attorney, Agent or Firm:
KILPATRICK TOWNSEND & STOCKTON LLP (Mailstop: IP Docketing - 22 1100 Peachtree Street Suite 2800 Atlanta GA 30309)
Claims:
1. 1.-33. (canceled)

34. An isolated polynucleotide encoding a polypeptide selected from the group consisting of: (a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 4; (b) a polypeptide that comprises an amino acid sequence having at least about 80% homology to SEQ ID NO: 4; (c) a polypeptide comprising an amino acid sequence of SEQ ID NO: 4, wherein one or more amino acid(s) in the sequence is modified by deletion, addition, insertion and/or substitution by other amino acids, and the number of mutation is typically no more than 35% of all amino acids, and wherein the polypeptide has a biological activity equivalent to a polypeptide consisting of the amino acid sequence of any one of SEQ ID NO: 4; and (d) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, wherein the polypeptide has a biological activity equivalent to a polypeptide consisting of the amino acid sequence of SEQ ID NO: 4.

35. A vector comprising the polynucleotide of claim 34.

36. A host cell harboring the polynucleotide of claim 34 or the vector comprising the polynucleotide.

37. A method for producing a polypeptide selected from the group consisting of: (a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 4; (b) a polypeptide that comprises an amino acid sequence having at least about 80% homology to SEQ ID NO: 4; (c) a polypeptide comprising an amino acid sequence of SEQ ID NO: 4, wherein one or more amino acid(s) in the sequence is modified by deletion, addition, insertion and/or substitution by other amino acids, and the number of mutation is typically no more than 35% of all amino acids, and wherein the polypeptide has a biological activity equivalent to a polypeptide consisting of the amino acid sequence of any one of SEQ ID NO: 4; and (d) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, wherein the polypeptide has a biological activity equivalent to a polypeptide consisting of the amino acid sequence of SEQ ID NO: 4 said method comprising the steps of: (a) culturing the host cell harboring the polynucleotide encoding the polypeptide or the vector comprising the polynucleotide; (b) allowing the host cell to express the polypeptide; and (c) collecting the expressed polypeptide.

38. 38-63. (canceled)

64. A pharmaceutical composition for treating or preventing bladder cancer, said composition comprising a pharmaceutically effective amount of a polynucleotide encoding a polypeptide selected from the group of (a)-(d): (a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 or fragment thereof; (b) a polypeptide that comprises an amino acid sequence having at least about 80% homology to SEQ ID NO: 4; (c) a polypeptide that comprises the amino acid sequence of SEQ ID NO: 4 in which one or more amino acids are substituted, deleted, inserted and/or added and that has a biological activity equivalent to the polypeptide consisting of the amino acid sequence of SEQ ID NO: 4, wherein the number of mutation is typically no more than 35% of all amino acids; (d) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, wherein the polypeptide has a biological activity equivalent to the polypeptide consisting of the amino acid sequence of SEQ ID NO: 4, or fragment thereof. as an active ingredient, and a pharmaceutically acceptable carrier.

65. The pharmaceutical composition of claim 64 wherein the polynucleotide is incorporated in an expression vector.

66. 66-73. (canceled)

74. The polynucleotide of claim 34, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3.

Description:

This application claims the benefit of U.S. Provisional Application Ser. No. 60/652,318 filed Feb. 10, 2005 and U.S. Provisional Application Ser. No. 60/703,225 filed Jul. 27, 2005, the contents of which are hereby incorporated by reference in their entirety.

FIELD OF THE INVENTION

The present invention relates to methods of detecting and diagnosing bladder cancer as well as methods of treating and preventing bladder cancer and bladder cancer metastasis. The present invention also relates to genes and polypeptides associated with bladder cancers.

BACKGROUND OF THE INVENTION

Bladder cancer is the second most common genitourinary tumor in human populations, with an incidence of approximately 261,000 new cases each year worldwide; about a third of those are likely to be invasive or metastatic disease at the time of diagnosis (Parkin D M, et al., (1999) CA Cancer J Clin; 49:33-64). Although radical cystectomy is considered the “gold standard” for treatment of patients with localized but muscle-invasive bladder cancer, about 50% of such patients develop metastases within two years after cystectomy and subsequently die of the disease (Sternberg C N., (1995) Ann Oncol; 6:113-26).

Neoadjuvant chemotherapy is usually prescribed for muscle-invasive bladder cancer to treat micrometastases and to improve resectability of larger neoplasms (Fagg S L, et al., (1984) Br Urol; 56:296-300, Raghavan D, et al., (1984) Med J Aust; 140:276-8). Regimens involving methotrexate, vinblastine, doxorubicin, and cisplatin (M-VAC), followed by radical cystectomy, are more likely to eliminate residual cancer than radical cystectomy alone, and, as such, improve survival among patients with locally advanced bladder cancer ((2003) Lancet; 361:1927-34, Grossman H B, et al., (2003) N Engl J Med; 349:859-66). In some clinical trials, down-staging with drugs prior to surgery was shown to have significant survival benefits (Grossman H B, et al., (2003) N Engl J Med; 349:859-66, Splinter T A, et al., (1992) J Urol; 147:606-8); moreover, patients who respond to neoadjuvant chemotherapy may preserve bladder function and enjoy an improved quality of life. However, since no method yet exists for predicting the response of an individual patient to chemotherapies, such as M-VAC, some patients will suffer from adverse reactions to the drugs without achieving any benefit in terms of positive effects, often losing the opportunity for additional therapy when their physical condition deteriorates. Hence, it is of critical importance to identify molecular targets for the development of novel drugs for bladder cancer patients. Some recent studies have demonstrated that gene expression information generated by cDNA microarray analysis in human tumors can provide molecular phenotyping that identifies distinct tumor classifications not evident by traditional histopathological method (Armstrong, S. A, et al., (2002) Nat Genet, 30: 41-47; Golub, T. R, et al., (1999) Science, 286: 531-537; Hofmann, W. K et al., (2002) Lancet, 359: 481-486). Moreover, several studies have demonstrated the effectiveness of this method for identifying novel cancer-related genes. The promise of such information lies in the potential to improve clinical strategies with neoplastic disease.

SUMMARY OF THE INVENTION

Hence, in the study reported here, we identified novel molecular targets using genome-wide information obtained from 33 invasive bladder cancer cases on a cDNA microarray consisting of 27,648 transcribed elements in combination with laser microbeam microdissection (LMM) of the tumors to obtain pure populations of cancer cells for analysis. These results suggest that such information may lead ultimately to our goal of “personalized therapy”.

To characterize the detailed molecular mechanisms associated with bladder cancers, with a view toward development of novel therapeutic targets, the present inventors analyzed gene-expression profiles of 33 cancer cells using a cDNA microarray representing 27,648 genes coupled with laser microbeam microdissection (LMM). By comparing expression patterns between cancer cells from diagnostic bladder cancer patients and normal human bladder cells (used as universal control), 394 genes that were commonly up-regulated in bladder cancer cells were identified. Of those genes, 288 represent functionally characterized genes that were up-regulated in bladder cancer cells; however, the functions of the remaining 106 (including 51 ESTs) genes are currently unknown. In addition, 1272 genes were identified as being commonly down-regulated in bladder cancer cells. Of these, 1026 represent functionally characterized genes that were down-regulated in bladder cancer cells; however, the functions of the remaining 246 (including 119 ESTs) are currently unknown. The genes contained in the semi-quantitative RT-PCR experiments of representative 44 up-regulated genes supported the results of our microarray analysis. Accordingly, the data herein will provide useful information for finding candidate genes whose products may serve as molecular targets for treatment of bladder cancers.

The present invention is based on the discovery of a pattern of gene expression that correlates with bladder cancer (BLC). Genes that are differentially expressed in bladder cancer are collectively referred to herein as “BLC nucleic acids” or “BLC polynucleotides” and the corresponding encoded polypeptides are referred to as “BLC polypeptides” or “BLC proteins.”

Through the expression profiles of bladder cancers, the present inventors identified two specific genes, labeled C2093, B5860N and C6055, respectively, that were significantly overexpressed in bladder cancer cells. Furthermore, the present inventors isolated a novel transcriptional variant of the B5860N and C6055 gene. It was further demonstrated that the treatment of bladder cancer cells with siRNA effectively inhibited expression of C2093, B5860N and C6055 and suppressed cell/tumor growth of bladder cancer. These findings suggest that C2093, B5860N and C6055 play key roles in tumor cell growth, and, therefore, represent promising targets for the development of anti-cancer drugs.

The full-length mRNA sequence of C2093 contained 6319 nucleotides (SEQ ID NO: 1), encoding a polypeptide of 1780 amino acids (SEQ ID NO: 2). The B5860N gene has two different transcriptional variants, consisting of 12 and 11 exons and corresponding to B5860N V1 (SEQ ID NO.3, encoding SEQ ID NO.4) and B5860N V2 (SEQ ID NO.5, encoding SEQ ID NO:6), respectively (FIG. 3b). There were alternative variations in exon 8 of V1; however, the remaining exons were common to both variants. The V2 variant does not have exon 8 of the V1, but does generate the same stop codon within last exon. The full-length cDNA sequences of the B5860NV1 and B5860NV2 variants consist of 5318 and 4466 nucleotides, respectively. The ORF of these variants start within each exon 1. The V1 and V2 transcripts ultimately encode polypeptides of 812 and 528 amino acids, respectively. Accordingly, the term “B5860Ns” as used herein, refers to either or both of transcripts of B5860NV1 and B5860NV2. Namely, in the context of the present invention, it was revealed that the B5860N gene may be expressed as at least two transcript variants. To further confirm the expression pattern of each variant in bladder cancer cell lines and normal human tissues, including bladder, heart, lung, liver, kidney, brain, and pancreas, the present inventors performed northern blot analysis. As a result, it was discovered that both variants were highly overexpressed in bladder cancer cells; however, expression in normal human tissues was either absent or undetectable (FIG. 2f, lower panel). In particular, the V2 transcript was expressed exclusively in testis. The C6055 gene has four different splicing variants consisting of 24, 25, 22 and 22 exons, corresponding to MGC34032 (GeneBank Accession No. NM152697, SEQ ID NO: 133 encoding a polypeptide of SEQ ID NO: 134), Genbank Accession No. AK128063 (SEQ ID NO: 135 encoding a polypeptide of SEQ ID NO: 136, C6055V1 (SEQ ID NO:129 encoding a polypeptide of SEQ ID NO:130) and C6055V2 (SEQ ID NO:131 encoding a polypeptide of SEQ ID NO:132), respectively (FIG. 3c). There were alternative variations in exon 1, 2, 3 and 24 of MGC34032, and the other remaining exons were common among four transcripts. C6055V1 and C6055V2 transcripts have no exon 1, 2 and 3 of MGC34032, generating same stop codon within last exon. Moreover, C6055V1, C6055V2 and Genbank Accession No. AK128063 transcripts have a different exon 24 of MGC34032. Genbank Accession No. AK128063 has a new exon as an exon 4a. In particular, the ORF of C6055V1 and C6055V2 transcripts start at within each exon 4, indicating C6055V1 and C6055V2 transcripts have same ORF. The full-length cDNA sequences of MGC34032, Genbank Accession No. AK128063, C6055V1 and C6055V2 transcripts consist of 2302, 3947, 3851, and 3819 nucleotides, respectively. Eventually, MGC34032, Genbank Accession No. AK128063, C6055V1 and C6055V2 transcripts encode 719, 587, 675 and 675 amino acids, respectively. Accordingly, the term “C6055s” as used herein, refers to one or more of transcripts of MGC34032, Genbank Accession No. AK128063, C6055V1 and C6055V2. Namely, in the context of the present invention, it was revealed that the C6055 gene may be expressed as at least four transcript variants. To further confirm the expression pattern of each variant in bladder cancer cell lines and normal human tissues including bladder, heart, lung, liver, kidney, brain, testis, pancreas, we performed northern blot analysis. As a result, approximately 3.9 kb transcripts were highly overexpressed in some bladder cancer cells (HT-1376, SW780 and RT4), but no or undetectable expression in normal human tissues (FIG. 2g). In addition, 7.5 kb transcript was specifically expressed only in HT1376 cells, but we have not yet identified the entire mRNA sequence of this transcript. Furthermore, when we performed northern blot analysis using the common region among these transcripts as a probe, we detected 2.3 kb transcript exclusively in normal testis, corresponding to MGC34032 (FIG. 2h). Therefore, we further perform functional analysis for C6055V1 gene product.

Many anticancer drugs are not only toxic to cancer cells but also to normally growing cells. However, since the normal expression of C2093, B5860Ns and C6055s is restricted to the testis, agents that suppress the expression of C2093, B5860Ns and C6055s may not adversely affect other organs, and thus may be conveniently used for treating or preventing bladder cancer.

Thus, the present invention provides a novel transcriptional variant, B5860NV1, which serves as a candidate for a diagnostic marker for bladder cancer as well as a promising potential target for developing new strategies for bladder cancer diagnosis and effective anti-cancer agents. Furthermore, the present invention provides a polypeptide encoded by this gene, as well as methods for the production and use of the same. More specifically, the present invention provides a novel human polypeptide, B5860NV1, or a functional equivalent thereof, the expression of which is elevated in bladder cancer cells.

In a preferred embodiment, the B5860NV1 polypeptide includes an 811 amino acid (SEQ ID NO: 4) protein encoded by the open reading frame of SEQ ID NO: 3. The present application also provides an isolated protein encoded from at least a portion of the B5860NV1 polynucleotide sequence, or polynucleotide sequences that are at least 15%, more preferably at least 25%, complementary to the sequence set forth in SEQ ID NO: 3, to the extent that they encode a B5860NV1 protein or a functional equivalent thereof. Examples of such polynucleotides are degenerates and allelic mutants of B5860NV1 encoded by the sequence of SEQ ID NO: 3.

As used herein, an isolated gene is a polynucleotide the structure of which is not identical to that of any naturally occurring polynucleotide or to that of any fragment of a naturally occurring genomic polynucleotide spanning more than three separate genes. The term therefore includes, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule in the genome of the organism in which it naturally occurs; (b) a polynucleotide incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule, such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion polypeptide.

Accordingly, in one aspect, the invention provides an isolated polynucleotide that encodes a polypeptide described herein or a fragment thereof. Preferably, the isolated polynucleotide includes a nucleotide sequence that is at least 60% identical to the nucleotide sequence shown in SEQ ID NO: 3. More preferably, the isolated nucleic acid molecule is at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, identical to the nucleotide sequence shown in SEQ ID NO: 3. In the case of an isolated polynucleotide which is longer than or equivalent in length to the reference sequence, e.g., SEQ ID NO: 3, the comparison is made with the full length of the reference sequence. Where the isolated polynucleotide is shorter than the reference sequence, e.g., shorter than SEQ ID NO: 3, the comparison is made to a segment of the reference sequence of the same length (excluding any loop required by the homology calculation).

The present invention also provides a method of producing a protein by transfecting or transforming a host cell with a polynucleotide sequence encoding the B5860NV1 protein, and expressing the polynucleotide sequence. In addition, the present invention provides vectors comprising a nucleotide sequence encoding the B5860NV1 protein, and host cells harboring a polynucleotide encoding the B5860NV1 protein. Such vectors and host cells may be used for producing the B5860NV1 protein.

A binding agent that specifically recognizes the B5860NV1 protein is also provided by the present application. For example, a binding agent may be an antibody raised against a B5860NV1 protein. Alternatively, a binding agent may be a ligand specific for the protein, or a synthetic polypeptide that specifically binds the protein (see e.g., WO2004/044011). An antisense polynucleotide (e.g., antisense DNA), ribozyme, and siRNA (small interfering RNA) of the B5860NV1 gene are also provided.

Accordingly, the present invention provides a method of diagnosing or determining a predisposition to bladder cancer in a subject by determining an expression level of a BLC-associated gene in a patient-derived biological sample, such as tissue sample. The term “BLC-associated gene” refers to a gene that is characterized by an expression level which differs in a BLC cell as compared to a normal cell. A normal cell is one obtained from bladder tissue. In the context of the present invention, a BLC-associated gene is a gene listed in Tables 4-5 (i.e., genes of BLC Nos. 1-1666). An alteration, e.g., an increase or decrease in the level of expression of a gene as compared to a normal control level of the gene, indicates that the subject suffers from or is at risk of developing BLC.

In the context of the present invention, the phrase “control level” refers to a protein expression level detected in a control sample and includes both a normal control level and a bladder cancer control level. A control level can be a single expression pattern derived from a single reference population or a value derived from a plurality of expression patterns. For example, the control level can be obtained from a database of expression patterns from previously tested cells. A “normal control level” refers to a level of gene expression detected in a normal, healthy individual or in a population of individuals known not to be suffering from bladder cancer. A normal individual is one with no clinical symptoms of bladder cancer. On the other hand, a “BLC control level” refers to an expression profile of BLC-associated genes found in a population suffering from BLC.

An increase in the expression level of one or more BLC-associated genes listed in Table 4 (i.e., the over-expressed or up-regulated genes of BLC Nos. 1-394) detected in a test sample as compared to a normal control level indicates that the subject (from which the sample was obtained) suffers from or is at risk of developing BLC. In contrast, a decrease in the expression level of one or more BLC-associated genes listed in Table 5 (i.e., the under-expressed or down-regulated genes of BLC Nos. 395-1666) detected in a test sample compared to a normal control level indicates said subject suffers from or is at risk of developing BLC.

Alternatively, expression of a panel of BLC-associated genes in a sample can be compared to a BLC control level of the same panel of genes. A similarity between sample expression and BLC control expression indicates that the subject (from which the sample was obtained) suffers from or is at risk of developing BLC.

According to the present invention, a gene expression level is deemed “altered” when expression of the gene is increased or decreased by at least 10%, preferably at least 25%, more preferably 50% or more as compared to the control level. Alternatively, an expression level is deemed “increased” or “decreased” when gene expression is increased or decreased by at least 0.1, at least 0.2, at least 1, at least 2, at least 5, or at least 10 or more fold as compared to a control level. Expression is determined by detecting hybridization, e.g., on an array, of a BLC-associated gene probe to a gene transcript of the patient-derived tissue sample.

In the context of the present invention, the patient-derived tissue sample may be any tissue obtained from a test subject, e.g., a patient known to or suspected of having BLC. For example, the tissue may contain an epithelial cell. More particularly, the tissue may be an epithelial cell from a bladder ductal carcinoma.

The present invention further provides a method for the diagnosis of bladder cancer which includes the step of determining an expression level of a C2093, B5860Ns or C6055s gene in a biological sample from a subject, comparing the expression level of the gene with that in a normal sample, and defining that a high expression level of the C2093, B5860Ns or C6055s gene in the sample indicates that the subject suffers from or is at risk of developing bladder cancer.

The present invention also provides a BLC reference expression profile, comprising a gene expression level of two or more of BLC-associated genes listed in Tables 4-5. Alternatively, the BLC reference expression profile may comprise the levels of expression of two or more of the BLC-associated genes listed in Table 4, or the BLC-associated genes listed in Table 5.

The present invention further provides methods of identifying an agent that inhibits or enhances the expression or activity of a BLC-associated gene, e.g. a BLC-associated gene listed in Tables 4-5, by contacting a test cell expressing a BLC-associated gene with a test compound and determining the expression level of the BLC-associated gene or the activity of its gene product. The test cell may be an epithelial cell, such as an epithelial cell obtained from a bladder carcinoma. A decrease in the expression level of an up-regulated BLC-associated gene or the activity of its gene product as compared to a normal control level or activity of the gene or gene product indicates that the test agent is an inhibitor of the BLC-associated gene and may be used to reduce a symptom of BLC, e.g. the expression of one or more BLC-associated genes listed in Table 4. Alternatively, an increase in the expression level of a down-regulated BLC-associated gene or the activity of its gene product as compared to a normal control level or activity of the gene or gene product indicates that the test agent is an enhancer of expression or function of the BLC-associated gene and may be used to reduce a symptom of BLC, e.g., the under-expression of one or more BLC-associated genes listed in Table 5.

Further, a method of screening for a compound for treating or preventing bladder cancer is provided by the present invention. The method includes contacting a C2093, B5860Ns or C6055s polypeptide with test compounds, and selecting test compounds that bind to or that alter the biological activity of the C2093, B5860Ns or C6055s polypeptide.

The present invention further provides a method of screening for a compound for treating or preventing bladder cancer, wherein the method includes contacting a test compound with a cell expressing a C2093, B5860Ns or C6055s polypeptide or introduced with a vector comprising a transcriptional regulatory region of C2093, B5860Ns or C6055s upstream of a reporter gene, and selecting the test compound that suppresses the expression level or activity of the C2093, B5860Ns or C6055s polypeptide or a reporter gene product.

The present invention also provides a kit comprising a detection reagent which binds to one or more BLC nucleic acids or BLC polypeptides. Also provided is an array of nucleic acids that binds to one or more BLC nucleic acids.

Therapeutic methods of the present invention include a method of treating or preventing BLC in a subject, including the step of administering to the subject an antisense composition. In the context of the present invention, the antisense composition reduces the expression of the specific target gene. For example, the antisense composition may contain a nucleotide which is complementary to a BLC-associated gene sequence selected from the group consisting of the up-regulated BLC-associated genes listed in Table 4. Alternatively, the present method may include the steps of administering to a subject a small interfering RNA (siRNA) composition. In the context of the present invention, the siRNA composition reduces the expression of a BLC nucleic acid selected from the group consisting of the BLC-associated genes listed in Table 4. In yet another method, the treatment or prevention of BLC in a subject may be carried out by administering to a subject a ribozyme composition. In the context of the present invention, the nucleic acid-specific ribozyme composition reduces the expression of a BLC nucleic acid selected from the group consisting of the BLC-associated genes listed in Table 4. Thus, in the present invention, the BLC-associated genes listed in Table 4 are preferred therapeutic targets for bladder cancer. Other therapeutic methods include those in which a subject is administered a compound that increases the expression of one or more of the down-regulated BLC-associated genes listed in Table 5 or the activity of a polypeptide encoded by one or more of the BLC-associated genes listed in Table 5.

The present invention further provides methods for treating or preventing bladder cancer using the pharmaceutical composition provided by the present invention.

In addition, the present invention provides methods for treating or preventing cancer, which comprise the step of administering a C2093, B5860Ns or C6055s polypeptide. It is expected that anti-tumor immunity will be induced by the administration of a C2093, B5860Ns or C6055s polypeptide. Thus, the present invention also provides a method for inducing anti-tumor immunity, which method comprises the step of administering a C2093, B5860Ns or C6055s polypeptide, as well as pharmaceutical compositions for treating or preventing cancer comprising a C2093, B5860Ns or C6055s polypeptide.

The present invention also includes vaccines and vaccination methods. For example, a method of treating or preventing BLC in a subject may involve administering to the subject a vaccine containing a polypeptide encoded by a nucleic acid selected from the group consisting of the BLC-associated genes listed in Table 4 or an immunologically active fragment of such a polypeptide. In the context of the present invention, an immunologically active fragment is a polypeptide that is shorter in length than the full-length naturally-occurring protein, yet which induces an immune response analogous to that induced by the full-length protein. For example, an immunologically active fragment should be at least 8 residues in length and capable of stimulating an immune cell, such as a T cell or a B cell. Immune cell stimulation can be measured by detecting cell proliferation, elaboration of cytokines (e.g., IL-2), or production of an antibody.

The present application also provides a pharmaceutical composition for treating or preventing bladder cancer. The pharmaceutical composition may be, for example, an anti-cancer agent. The pharmaceutical composition can comprise at least a portion of antisense S-oligonucleotides, siRNA molecules or ribozymes against the C2093, B5860Ns or C6055s polynucleotide sequences shown and described in SEQ ID NOs: 1, 3, 5, 129, 131, 133 and 135 respectively. A suitable siRNA targets a sequence of SEQ ID NO: 21, 25 or 144. Thus, an siRNA of the invention comprises a nucleotide sequence selected from SEQ ID NO: 21, 25 or 144. This may be preferably selected as targets for treating or preventing bladder cancer according to the present invention. The pharmaceutical compositions may be also those comprising the compounds selected by the present methods of screening for compounds for treating or preventing cell proliferative diseases, such as bladder cancer.

The course of action of the pharmaceutical composition is desirably to inhibit growth of the cancerous cells, such as bladder cancer cells. The pharmaceutical composition may be applied to mammals, including humans and domesticated mammals. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described herein below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference herein in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

One advantage of the methods described herein is that the disease is identified prior to detection of overt clinical symptoms of bladder cancer. Other features and advantages of the invention will become more fully apparent when the following detailed description is read in conjunction with the accompanying figures and examples, as well as the claims appended hereto.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1a is a photograph of a DNA agarose gel showing expression of representative 44 genes and GAPDH examined by semi-quantitative RT-PCR using cDNA prepared from amplified RNA. The first 10 lanes show the expression level of the genes in different bladder cancer patients. The next 2 lanes show the expression level of the genes in bladder from a normal individual; normal transitional cells and bulk. The last 4 lanes show the expression level of the genes in a normal human tissues; Heart, Lung, Liver and Kidney. (b) C2093 and (c) B5860N in tumor cells from 21 bladder cancer patients (1001, 1009, 1010, 1012, 1013, 1014, 1015, 1016, 1017, 1018, 1019, 1020, 1021, 1022, 1023, 1024, 2003, 2014, 3001, 5001, 5002) (upper and middle panel), bladder cancer cell lines (HT1197, UMUC3, J82, HT1376, SW780 and RT4) (lower panel), and normal human tissues (normal bulk; normal bladder, TC; microdissected transitional cells, heart, lung, liver, kidney).

FIG. 2 depicts the results of Northern blot analysis with bladder cancer cell lines and normal human tissues including normal bladder using A0576N (a), C5509 (b), F1653 (c), B9838 (d), C2093 (e), B5860N (f), C6055 (g,h) DNA fragment as each probe.

FIG. 3 shows Genomic structure of (a) C2093, (b) B5860N and (c) C6055. B5860N has two different variants, designated V1 and V2. C6055 has four different variants, designed MGC34032, Genbank Accession No. AK128063, C6055V1 and C6055V2.

FIG. 4 depicts the exogenous expression and subcellular localization of C2093, B5860Ns and C6055s. (a) Exogenous expression of C2093 protein by Western blot at 24 and 48 hours after transfection, (b) Subcellular localization of C2093 protein, (c) Cell cycle dependent localization of C2093, (d) Exogenous expression of B5860N V1 (left panel) and B5860N V2 (right panel) proteins by Western blot analysis at 24 and 48 hours after transfection. Subcellular localization of (e) B5860N V1 and (f) B5860N V2 proteins, Cell cycle dependent localization of (g) B5860N V1 proteins, and (h) B5860N V2. (i) Co-transfection with B5860N V1 and B5860N V2 into COS7 cells. (j) Subcellular localization of C2093 during cell cycle progression. (k) Subcellular localization of B5860N during cell cycle progression. (l) Expression of C6055 protein by Western blot at 36 hours after transfection, (m) Post-translational modification of C6055 protein (n) Subcellular localization of exogenous C6055 protein.

FIG. 5 depicts the growth-inhibitory effects of small-interfering RNAs (siRNAs) designed to reduce the expression of C2093 in bladder cancer cells. (a) Semi-quantitative RT-PCR showing suppression of endogenous expression of C2093 in bladder cancer cell line, UMUC3 cells. GAPDH was used as an internal control. EGFP; EGFP sequence and SCR; scramble sequence as control (see Materials and Methods) (b) Colony-formation assay demonstrating a decrease in the numbers of colonies by knockdown of C2093 in UMUC3 cells. (c) MTT assay demonstrating a decrease in the numbers of colonies by knockdown of C2093 in UMUC3 cells. (d) Semi-quantitative RT-PCR showing suppression of endogenous expression of C2093 in bladder cancer cell line, J82 cells. GAPDH was used as an internal control. (e) Colony-formation assay demonstrating a decrease in the numbers of colonies by knockdown of C2093 in J82 cells. (f) MTT assay demonstrating a decrease in the numbers of colonies by knockdown of C2093 in J82 cells.

FIG. 6 depicts the growth-inhibitory effects of small-interfering RNAs (siRNAs) designed to reduce the expression of B5860N in bladder cancer cells. (a) Semi-quantitative RT-PCR showing suppression of endogenous expression of B5860N in bladder cancer cell line, J82 cells. GAPDH was used as an internal control. EGFP; EGFP sequence and SCR; scramble sequence as controls (see Materials and Methods) (b) Colony-formation assay demonstrating a decrease in the numbers of colonies by knockdown of B5860N in J82 cells. (c) MTT assay demonstrating a decrease in the numbers of colonies by knockdown of B5860N in J82 cells.

FIG. 7 depicts the growth-inhibitory effects of small-interfering RNAs (siRNAs) designed to reduce expression of C6055 in bladder cancer cells. (a) Semi-quantitative RT-PCR showing suppression of endogenous expression of C6055 in bladder cancer cell line, SW780 cells. ACTB was used as an internal control. SCR; scramble sequence as a control (see Materials and Methods) (b) Colony-formation assay demonstrating a decrease in the numbers of colonies by knockdown of C6055 in SW780 cells. (c) MTT assay demonstrating a decrease in the numbers of colonies by knockdown of C6055 in SW780 cells.

FIG. 8 (a) Multi-nucleated cells by treatment of C2093-siRNA. (b) western blotting analysis using anti-C2093 antibody. (c) cell morphology with microscopy.

FIG. 9 (a) Expression of C2093 in bladder cancer tissue sections (right panel ×200; left panel ×100), (b) Expression of B5860N in bladder cancer tissue sections (right panel ×200; left panel ×100), normal bladder tissues (bottom panel).

DETAILED DESCRIPTION OF THE INVENTION

The words “a”, “an” and “the” as used herein mean “at least one” unless otherwise specifically indicated.

Generally bladder cancer cells exist as a solid mass having a highly inflammatory reaction and containing various cellular components. Therefore, previous published microarray data are likely to reflect heterogenous profiles.

With these issues in view, the present inventors prepared purified populations of bladder cancer cells by a method of laser-microbeam microdissection (LMM), and analyzed genome-wide gene-expression profiles of 33 BLCs, using a cDNA microarray representing 27,648 genes. These data not only should provide important information about bladder carcinogenesis, but should also facilitate the identification of candidate genes whose products may serve as diagnostic markers and/or as molecular targets for the treatment of patients with bladder cancer and provide clinically relevant information.

The present invention is based, in part, on the discovery of changes in expression patterns of multiple nucleic acids between epithelial cells and carcinomas of patients with BLC. The differences in gene expression were identified using a comprehensive cDNA microarray system.

The gene-expression profiles of cancer cells from 33 BLCs were analyzed using a cDNA microarray representing 27,648 genes coupled with laser microdissection. By comparing expression patterns between cancer cells from patients diagnosed with BLC and normal ductal epithelial cells purely selected with Laser Microdissection, 394 genes (shown in Table 4) were identified as commonly up-regulated in BLC cells. Similarly, 1272 genes (shown in Table 5) were also identified as being commonly down-regulated in BLC cells. In addition, selection was made of candidate molecular markers having the potential to detect cancer-related proteins in serum or sputum of patients, and some potential targets for development of signal-suppressing strategies in human BLC were discovered. Among them, Tables 4 and 5 provide a list of genes whose expression is altered between BLC and normal tissue.

The differentially expressed genes identified herein find diagnostic utility as markers of BLC and as BLC gene targets, the expression of which may be altered to treat or alleviate a symptom of BLC. The genes whose expression level is modulated (i.e., increased or decreased) in BLC patients are summarized in Tables 4-5 and are collectively referred to herein as “BLC-associated genes”, “BLC nucleic acids” or “BLC polynucleotides” and the corresponding encoded polypeptides are referred to as “BLC polypeptides” or “BLC proteins.” Unless otherwise indicated, the term “BLC” refers to any of the sequences disclosed herein (e.g., BLC-associated genes listed in Tables 4-5). Genes that have been previously described are presented along with a database accession number.

By measuring the expression of the various genes in a sample of cells, BLC can be diagnosed. Similarly, measuring the expression of these genes in response to various agents can identify agents for treating BLC.

The present invention involves determining (e.g., measuring) the expression of at least one, and up to all, of the BLC-associated genes listed in Tables 4-5. Using sequence information provided by the GenBank™ database entries for known sequences, the BLC-associated genes can be detected and measured using techniques well known to one of ordinary skill in the art. For example, sequences within the sequence database entries corresponding to BLC-associated genes can be used to construct probes for detecting RNA sequences corresponding to BLC-associated genes in, e.g., Northern blot hybridization analyses. Probes typically include at least 10, at least 20, at least 50, at least 100, or at least 200 nucleotides of a reference sequence. As another example, the sequences can be used to construct primers for specifically amplifying one or more BLC nucleic acid in, e.g., amplification-based detection methods, such as reverse-transcription based polymerase chain reaction.

Expression level of one or more of BLC-associated gene in a test cell population, e.g., a patient-derived tissues sample, is then compared to the expression level(s) of the same gene(s) in a reference population. The reference cell population includes one or more cells for which the compared parameter is known, i.e., bladder ductal carcinoma cells (e.g., BLC cells) or normal bladder ductal epithelial cells (e.g., non-BLC cells).

Whether or not a pattern of gene expression in a test cell population as compared to a reference cell population indicates BLC or a predisposition thereto depends upon the composition of the reference cell population. For example, if the reference cell population is composed of non-BLC cells, a similarity in gene expression pattern between the test cell population and the reference cell population indicates that the test cell population is non-BLC. Conversely, if the reference cell population is made up of BLC cells, a similarity in gene expression profile between the test cell population and the reference cell population indicates that the test cell population includes BLC cells.

A level of expression of a BLC marker gene in a test cell population is considered “altered” if it varies from the expression level of the corresponding BLC marker gene in a reference cell population by more than 1.1, more than 1.5, more than 2.0, more than 5.0, or more than 10.0 fold.

Differential gene expression between a test cell population and a reference cell population can be normalized to a control nucleic acid, e.g. a housekeeping gene. For example, a control nucleic acid is one which is known not to differ depending on the cancerous or non-cancerous state of the cell. The expression level of a control nucleic acid can be used to normalize signal levels in the test and reference populations. Exemplary control genes include, but are not limited to, e.g., β-actin, glyceraldehyde 3-phosphate dehydrogenase and ribosomal protein P1.

The test cell population can be compared to multiple reference cell populations. Each of the multiple reference populations may differ in the known parameter. Thus, a test cell population may be compared to a first reference cell population known to contain, e.g., BLC cells, as well as a second reference population known to contain, e.g., non-BLC cells (e.g., normal cells). The test cell may be included in a tissue type or cell sample from a subject known to contain, or suspected of containing, BLC cells.

The test cell is preferably obtained from a bodily tissue or a bodily fluid, e.g., biological fluid (such as blood, sputum or urine, for example). For example, the test cell may be purified from bladder tissue. Preferably, the test cell population comprises an epithelial cell. The epithelial cell is preferably from a tissue known to be or suspected to be a bladder ductal carcinoma.

Cells in the reference cell population should be derived from a tissue type similar to that of the test cell. Optionally, the reference cell population is a cell line, e.g. a BLC cell line (i.e., a positive control) or a normal non-BLC cell line (i.e., a negative control). Alternatively, the control cell population may be derived from a database of molecular information derived from cells for which the assayed parameter or condition is known.

The subject is preferably a mammal. Exemplary mammals include, but are not limited to, e.g., a human, non-human primate, mouse, rat, dog, cat, horse, or cow.

Expression of the genes disclosed herein can be determined at the protein or nucleic acid level, using methods known in the art. For example, Northern hybridization analysis, using probes which specifically recognize one or more of these nucleic acid sequences, can be used to determine gene expression. Alternatively, gene expression may be measured using reverse-transcription-based PCR assays, e.g., using primers specific for the differentially expressed gene sequences. Expression may also be determined at the protein level, i.e., by measuring the level of a polypeptide encoded by a gene described herein, or the biological activity thereof. Such methods are well known in the art and include, but are not limited to, e.g., immunoassays that utilize antibodies to proteins encoded by the genes. The biological activities of the proteins encoded by the genes are generally well known.

To disclose the mechanism of bladder cancer and identify novel diagnostic markers and/or drug targets for the treatment and/or prevention of these tumors, the present inventors analyzed the expression profiles of genes in bladder cancer using a genome-wide cDNA microarray combined with laser microbeam microdissection. As a result, C2093, B5860N and C6055 specifically over-expressed in bladder cancer cells were identified. Furthermore, suppression of the expression of C2093, B5860N or C6055 gene with small interfering RNAs (siRNAs) resulted in a significant growth-inhibition of cancerous cells. These findings suggest that C2093, B5860N and/or C6055 render oncogenic activities to cancer cells, and that inhibition of the activity of one or more of these proteins could be a promising strategy for the treatment and prevention of proliferative diseases such as bladder cancers.

B5860N:

According to the present invention, a cDNA with a similar sequence was identified and encode variants of B5860N. The cDNA of the longer variant consists of 5318 nucleotides and contains an open reading frame of 2436 nucleotides (SEQ ID NO: 3). The open reading frame of known B5860N consists of 1584 nucleotide and encodes a 527 amino acid-protein (GeneBank Accession Number NM017779). Therefore, the longer variant, consisting of 5318 nucleotide, is novel to the instant invention. Furthermore, the known sequence of the B5860N cDNA encoding the 527 amino acid-protein consists of 3338 nucleotides. However, in the present invention, a full length cDNA of B5860N consisting of 4466 nucleotide was isolated. The nucleotide sequence of this shorter variant comprises a novel sequence of 3′-UTR as compared with the known nucleotide sequence, although both of the amino acid sequences encoded thereby were identical. In the present specification, the transcripts of the shorter variant, encoding the known 527 amino acid-protein, and the longer variant, encoding the novel 811 amino acid-protein, are described herein as B5860NV2 and B5860NV1, respectively. The nucleotide sequence of B5860NV1 and B5860NV2, and amino acid sequence encoded thereby are set forth in the following SEQ ID NOs.

nucleotide sequenceamino acid sequence
B5860NV1SEQ ID NO: 3SEQ ID NO: 4
B5860NV2SEQ ID NO: 5SEQ ID NO: 6

Thus, the present invention provides substantially pure polypeptides encoded by the longer variant B5860NV1, including polypeptides comprising the amino acid sequence of SEQ ID NO: 4, as well as functional equivalents thereof, to the extent that they encode a B5860NV1 protein. Examples of polypeptides functionally equivalent to B5860NV1 include, for example, homologous proteins of other organisms corresponding to the human B5860NV1 protein, as well as mutants of human B5860NV1 proteins.

C6055:

According to the present invention, a cDNA with a similar sequence was identified and encode variants of C6055. According to the database from NCBI, C6055 consists of 24 exons, designated MGC34032, located on the chromosome 1p31.3. Because C6055 is not included within last exon (exon24) of MGC34032 on database, we performed RT-PCR as EST-walking, and 5′RACE and 3′RACE experiments using bladder cancer cell line, SW780, as a template to obtain the entire cDNA sequence of C6055 (see Materials and Methods). As a result, we found two novel transcripts, C6055V1 and C6055V2. Eventually, this gene has four different splicing variants consisting of 24, 25, 22 and 22 exons, corresponding to MGC34032, Genbank Accession No. AK128063, C6055V1 and C6055V2, respectively (FIG. 3c). There were alternative splicing in exon 1, 2, 3, 4 and 24 of MGC34032, and the other remaining exons were common among four transcripts. C6055V1 and C6055V2 transcripts have no exon 1, 2 and 3 of MGC34032, generating same stop codon within last exon. In particular, the ORF of C6055V1 and C6055V2 transcripts start at within each exon 4, indicating C6055V1 and C6055V2 transcripts have same ORF. The full-length cDNA sequences of MGC34032, Genbank Accession No. AK128063, C6055V1 and C6055V2 transcripts consist of 2302, 3947, 3851, and 3819 nucleotides, respectively. Eventually, MGC34032, Genbank Accession No. AK128063, C6055V1 and C6055V2 transcripts encode 719, 587, 675 and 675 amino acids, respectively. The nucleotide sequence of C6055V1 and C6055V2, and amino acid sequence encoded thereby are set forth in the following SEQ ID NOs.

nucleotide sequenceamino acid sequence
C6055V1SEQ ID NO: 129SEQ ID NO: 130
C6055V2SEQ ID NO: 131SEQ ID NO: 132

Thus, the present invention provides substantially pure polypeptides encoded by the longer variant C6055V1 or C6055V2, including polypeptides comprising the amino acid sequence of SEQ ID NO: 130 or SEQ ID NO: 132, as well as functional equivalents thereof, to the extent that they encode a Genbank Accession No. AK128063 protein. Examples of polypeptides functionally equivalent to C6055V1 or C6055V2 include, for example, homologous proteins of other organisms corresponding to the human C6055V1 or C6055V2 protein, as well as mutants of human C6055V1 or C6055V2 proteins.

In the present invention, the term “functionally equivalent” means that the subject polypeptide has the activity to promote cell proliferation like the B5860NV1 protein and to confer oncogenic activity to cancer cells. Whether the subject polypeptide has a cell proliferation activity or not can be judged by introducing the DNA encoding the subject polypeptide into a cell, expressing the respective polypeptide and detecting promotion of proliferation of the cells or increase in colony forming activity. Such cells include, for example, NIH3T3, COS7 and HEK293.

Methods for preparing polypeptides functionally equivalent to a given protein are well known by a person skilled in the art and include known methods of introducing mutations into the protein. For example, one skilled in the art can prepare polypeptides functionally equivalent to the human B5860NV1 protein by introducing an appropriate mutation in the amino acid sequence of this protein by site-directed mutagenesis (Hashimoto-Gotoh et al., (1995) Gene 152:271-5; Zoller and Smith, (1983) Methods Enzymol 100: 468-500; Kramer et al., (1984) Nucleic Acids Res. 12:9441-56; Kramer and Fritz, (1987) Methods Enzymol 154: 350-67; Kunkel, (1985) Proc Natl Acad Sci USA 82: 488-92; Kunkel, (1991) Methods Enzymol; 204:125-39). Amino acid mutations can occur in nature, too. The polypeptide of the present invention includes those proteins having the amino acid sequences of the human B5860NV1 protein in which one or more amino acids are mutated, provided the resulting mutated polypeptides are functionally equivalent to the human B5860NV1 protein. In the present invention, the number of mutation is generally no more than 35%, preferably no more than 30%, even more preferably no more than 25%, 20%, 10%, 5%, 2% or 1% of all amino acids. Specifically, the number of amino acids to be mutated in such a mutant is generally 200 or 100 amino acids or less, typically 10 amino acids or less, preferably 6 amino acids or less, and more preferably 3 amino acids or less.

Mutated or modified proteins, proteins having amino acid sequences modified by substituting, deleting, inserting and/or adding one or more amino acid residues of a certain amino acid sequence, have been known to retain the original biological activity (Mark et al., (1984) Proc Natl Acad Sci USA 81: 5662-6; Zoller and Smith, (1982) Nucleic Acids Res 10:6487-500; Dalbadie-McFarland et al., (1982) Proc Natl Acad Sci USA 79: 6409-13).

To that end, the amino acid residue to be mutated is preferably mutated into a different amino acid in which the properties of the amino acid side-chain are conserved (a process known as conservative amino acid substitution). Examples of properties of amino acid side chains are hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), and side chains having the following functional groups or characteristics in common: an aliphatic side-chain (G, A, V, L, I, P); a hydroxyl group containing side-chain (S, T, Y); a sulfur atom containing side-chain (C, M); a carboxylic acid and amide containing side-chain (D, N, E, Q); a base containing side-chain (R, K, H); and an aromatic containing side-chain (H, F, Y, W). Note, the parenthetic letters indicate the one-letter codes of amino acids.

An example of a polypeptide in which one or more amino acids residues are added to the amino acid sequence of human B5860NV1 protein is a fusion protein containing the human B5860NV1 protein. Fusion proteins, fusions of the human B5860NV1 protein and other peptides or proteins, are included in the present invention. Fusion proteins can be made by techniques well known to a person skilled in the art, such as by linking the DNA encoding the human B5860NV1 protein of the invention with DNA encoding other peptides or proteins, so that the frames match, inserting the fusion DNA into an expression vector and expressing it in a host. There is no restriction as to the peptides or proteins that may be fused to the protein of the present invention.

Known peptides that can be used as peptides that are fused to a protein of the present invention include, for example, FLAG (Hopp et al., (1988) Biotechnology 6: 1204-10), 6×His containing six His (histidine) residues, 10×His, Influenza agglutinin (HA), human c-myc fragment, VSP-GP fragment, p18HIV fragment, T7-tag, HSV-tag, E-tag, SV40T antigen fragment, lck tag, α-tubulin fragment, B-tag, Protein C fragment and the like. Examples of proteins that may be fused to a protein of the invention include GST (glutathione-S-transferase), Influenza agglutinin (HA), immunoglobulin constant region, β-galactosidase, MBP (maltose-binding protein) and such.

Fusion proteins can be prepared by fusing commercially available DNA, encoding the fusion peptides or proteins discussed above, with a DNA encoding a polypeptide of the present invention and expressing the fused DNA prepared.

Alternatively, functionally equivalent polypeptides may be isolated using methods known in the art, for example, using a hybridization technique (Sambrook et al., (1989) Molecular Cloning 2nd ed. 9.47-9.58, Cold Spring Harbor Lab. Press). One skilled in the art can readily isolate a DNA having high homology with a whole or part of the DNA sequence encoding the human B5860NV1 protein (i.e., SEQ ID NO: 3), and isolate functionally equivalent polypeptides to the human B5860NV1 protein from the isolated DNA. The polypeptides of the present invention include those that are encoded by DNA that hybridize with a whole or part of the DNA sequence encoding the human B5860NV1 protein and are functionally equivalent to the human B5860NV1 protein. These polypeptides include mammalian homologues corresponding to the human-derived protein (for example, a polypeptide encoded by a monkey, rat, rabbit and bovine gene). In isolating a cDNA highly homologous to the DNA encoding the human B5860NV1 protein from animals, it is particularly preferable to use tissues from testis or bladder cancer tissue.

The condition of hybridization for isolating a DNA encoding a polypeptide functionally equivalent to the human B5860NV1 protein can be routinely selected by a person skilled in the art. For example, hybridization may be performed by conducting pre-hybridization at 68° C. for 30 min or longer using “Rapid-hyb buffer” (Amersham LIFE SCIENCE), adding a labeled probe, and warming at 68° C. for 1 hour or longer. The following washing step can be conducted, for example, in a low stringency condition. A low stringency condition is, for example, 42° C., 2×SSC, 0.1% SDS, or preferably 50° C., 2×SSC, 0.1% SDS. More preferably, high stringency conditions are used. A high stringency condition is, for example, washing 3 times in 2×SSC, 0.01% SDS at room temperature for 20 min, then washing 3 times in 1×SSC, 0.1% SDS at 37° C. for 20 min, and washing twice in 1×SSC, 0.1% SDS at 50° C. for 20 min. However, several factors, such as temperature and salt concentration, can influence the stringency of hybridization and one skilled in the art can suitably select the factors to achieve the requisite stringency.

In place of hybridization, a gene amplification method, for example, the polymerase chain reaction (PCR) method, can be utilized to isolate a DNA encoding a polypeptide functionally equivalent to the human B5860NV1 protein, using a primer synthesized based on the sequence information of the protein encoding DNA (SEQ ID NO: 3).

Polypeptides that are functionally equivalent to the human B5860NV1 protein, encoded by the DNA isolated through the above hybridization techniques or gene amplification techniques, normally have a high homology to the amino acid sequence of the human B5860NV1 protein. As used herein, the term “high homology” typically refers to a homology of 40% or higher, preferably 60% or higher, more preferably 80% or higher, even more preferably 85%, 90%, 93%, 95%, 98%, 99% or higher between a polypeptide sequence or a polynucleotide sequence and a reference sequence. Percent homology (also referred to as percent identity) is typically determined between two optimally aligned sequences. Methods of aligning sequences for comparison are well-known in the art. Optimal alignment of sequences and comparison can be conducted, e.g., using the algorithm in “Wilbur and Lipman, (1983) Proc Natl Acad Sci USA 80: 726-30”.

A polypeptide of the present invention may have variations in amino acid sequence, molecular weight, isoelectric point, the presence or absence of sugar chains, or form, depending on the cell or host used to produce it or the purification method utilized. Nevertheless, so long as it has a function equivalent to that of the human B5860NV1 protein of the present invention, it is within the scope of the present invention.

The polypeptides of the present invention can be prepared as recombinant proteins or natural proteins, using methods well known to those skilled in the art. A recombinant protein can be prepared, for example, by inserting a DNA, which encodes a polypeptide of the present invention (for example, the DNA comprising the nucleotide sequence of SEQ ID NO: 3), into an appropriate expression vector, introducing the vector into an appropriate host cell, obtaining the extract, and purifying the polypeptide by subjecting the extract to chromatography, e.g., ion exchange chromatography, reverse phase chromatography, gel filtration or affinity chromatography utilizing a column to which antibodies against the protein of the present invention is fixed or by combining more than one of aforementioned columns.

In addition, when the polypeptide of the present invention is expressed within host cells (for example, animal cells and E. coli) as a fusion protein with glutathione-S-transferase protein or as a recombinant protein supplemented with multiple histidines, the expressed recombinant protein can be purified using a glutathione column or nickel column. Alternatively, when the polypeptide of the present invention is expressed as a protein tagged with c-myc, multiple histidines or FLAG, it can be detected and purified using antibodies to c-myc, His or FLAG, respectively.

After purifying the fusion protein, it is also possible to exclude regions other than the objective polypeptide by cutting the fusion protein with thrombin or factor-Xa as required.

A natural protein can be isolated by methods known to a person skilled in the art, for example, by contacting the affinity column, in which antibodies binding to the B5860NV1 protein described below are bound, with the extract of tissues or cells expressing the polypeptide of the present invention. The antibodies can be polyclonal antibodies or monoclonal antibodies.

The present invention also encompasses partial peptides of the polypeptides of the present invention. Preferably, the partial peptides of the present invention comprise an amino acid sequence selected from positions 304 to 588 of the amino acid sequence of SEQ ID NO: 4, or a part thereof. The amino acid sequence extending between positions 304 and 588 is a B5860NV1-specific region, as compared to B5860NV2. The partial peptide has an amino acid sequence specific to the polypeptide of the present invention and consists of at least 7 amino acids, preferably 8 amino acids or more, and more preferably 9 amino acids or more. The partial peptide can be used, for example, for preparing antibodies against the polypeptide of the present invention, screening for a compound that binds to the polypeptide of the present invention, and screening for inhibitors of the polypeptide of the present invention.

A partial peptide of the invention can be produced by genetic engineering, by known methods of peptide synthesis or by digesting the polypeptide of the invention with an appropriate peptidase. For peptide synthesis, for example, solid phase synthesis or liquid phase synthesis may be used.

The present invention further provides polynucleotides that encode such B5860NV1 polypeptides described above. The polynucleotides of the present invention can be used for the in vivo or in vitro production of a polypeptide of the present invention as described above, or can be applied to gene therapy for diseases attributed to genetic abnormality in the gene encoding the protein of the present invention. Any form of the polynucleotide of the present invention can be used, so long as it encodes a polypeptide of the present invention, including mRNA, RNA, cDNA, genomic DNA, chemically synthesized polynucleotides. The polynucleotide of the present invention includes a DNA comprising a given nucleotide sequences as well as its degenerate sequences, so long as the resulting DNA encodes a polypeptide of the present invention.

A polynucleotide of the present invention can be prepared by methods known to a person skilled in the art. For example, a polynucleotide of the present invention can be prepared by: preparing a cDNA library from cells which express a polypeptide of the present invention, and conducting hybridization using a partial sequence of the DNA of the present invention (for example, SEQ ID NO: 3) as a probe. A cDNA library can be prepared, for example, by the method described in Sambrook et al., (1989) Molecular Cloning, Cold Spring Harbor Laboratory Press; alternatively, commercially available cDNA libraries may be used. A cDNA library can be also prepared by: extracting RNAs from cells expressing the polypeptide of the present invention, synthesizing oligo DNAs based on the sequence of the DNA of the present invention (for example, SEQ ID NO: 3), conducting PCR using the oligo DNAs as primers, and amplifying cDNAs encoding the protein of the present invention.

In addition, by sequencing the nucleotides of the obtained cDNA, the translation region encoded by the cDNA can be routinely determined, and the amino acid sequence of the polypeptide of the present invention can be easily obtained. Moreover, by screening the genomic DNA library using the obtained cDNA or parts thereof as a probe, the genomic DNA can be isolated.

More specifically, mRNAs may first be prepared from a cell, tissue or organ (e.g., testis) or bladder cancer cell line in which the object polypeptide of the invention is expressed. Known methods can be used to isolate mRNAs; for instance, total RNA may be prepared by guanidine ultracentrifugation (Chirgwin et al., (1979) Biochemistry 18:5294-9) or AGPC method (Chomczynski and Sacchi, (1987) Anal Biochem 162:156-9). In addition, mRNA may be purified from total RNA using mRNA Purification Kit (Pharmacia) and such. Alternatively, mRNA may be directly purified by QuickPrep mRNA Purification Kit (Pharmacia).

The obtained mRNA is used to synthesize cDNA using reverse transcriptase. cDNA may be synthesized using a commercially available kit, such as the AMV Reverse Transcriptase First-strand cDNA Synthesis Kit (Seikagaku Kogyo). Alternatively, cDNA may be synthesized and amplified following the 5′-RACE method (Frohman et al., (1988) Proc Natl Acad Sci USA 85: 8998-9002; Belyavsky et al., (1989) Nucleic Acids Res 17: 2919-32), which uses a primer and such, described herein, the 5′-Ampli FINDER RACE Kit (Clontech), and polymerase chain reaction (PCR).

A desired DNA fragment is prepared from the PCR products and ligated with a vector DNA. The recombinant vectors are used to transform E. coli and such, and a desired recombinant vector is prepared from a selected colony. The nucleotide sequence of the desired DNA can be verified by conventional methods, such as dideoxynucleotide chain termination.

The nucleotide sequence of a polynucleotide of the invention may be designed to be expressed more efficiently by taking into account the frequency of codon usage in the host to be used for expression (Grantham et al., (1981) Nucleic Acids Res 9: 43-74). The sequence of the polynucleotide of the present invention may be altered by a commercially available kit or a conventional method. For instance, the sequence may be altered by digestion with restriction enzymes, insertion of a synthetic oligonucleotide or an appropriate polynucleotide fragment, addition of a linker, or insertion of the initiation codon (ATG) and/or the stop codon (TAA, TGA or TAG).

Specifically, the polynucleotide of the present invention encompasses the DNA comprising the nucleotide sequence of SEQ ID NO: 3.

Furthermore, the present invention provides a polynucleotide that hybridizes under stringent conditions with a polynucleotide having a nucleotide sequence of SEQ ID NO: 3, and encodes a polypeptide functionally equivalent to the B5860NV1 protein of the invention described above. One skilled in the art may appropriately choose the appropriately stringent conditions. For example, low stringency condition can be used. More preferably, high stringency condition can be used. These conditions are the same as that described above. The hybridizing DNA above is preferably a cDNA or a chromosomal DNA.

The present invention also provides a polynucleotide which is complementary to the polynucleotide encoding human B5860NV1 protein (SEQ ID NO: 3) or the complementary strand thereof, and which comprises at least 15 nucleotides, wherein the polynucleotide hybridizes with the nucleotide sequence extending between positions 988 and 1842 of SEQ ID NO:3. The polynucleotide of the present invention is preferably a polynucleotide which specifically hybridizes with the DNA encoding the B5860NV1 polypeptide of the present invention. The term “specifically hybridize” as used herein, means that significant cross-hybridization does not occur with DNA encoding other proteins, under the usual hybridizing conditions, preferably under stringent hybridizing conditions. Such polynucleotides include, probes, primers, nucleotides and nucleotide derivatives (for example, antisense oligonucleotides and ribozymes), which specifically hybridize with DNA encoding the polypeptide of the invention or its complementary strand. Moreover, such polynucleotide can be utilized for the preparation of DNA chip.

Vectors and Host Cells

The present invention also provides a vector and host cell into which a polynucleotide of the present invention is introduced. A vector of the present invention is useful to keep a polynucleotide, especially a DNA, of the present invention in host cell, to express the polypeptide of the present invention, or to administer the polynucleotide of the present invention for gene therapy.

When E. coli is the host cell and the vector is amplified and produced in a large amount in E. coli (e.g., JM109, DH5α, HB101 or XL1Blue), the vector should have “ori” to be amplified in E. coli and a marker gene for selecting transformed E. coli (e.g., a drug-resistance gene selected by a drug such as ampicillin, tetracycline, kanamycin, chloramphenicol or the like). For example, the M13-series vectors, pUC-series vectors, pBR322, pBluescript, pCR-Script, etc. can be used. In addition, pGEM-T, pDIRECT and pT7 can also be used for subcloning and extracting cDNA as well as the vectors described above. When a vector is used to produce a protein of the present invention, an expression vector is especially useful. For example, an expression vector to be expressed in E. coli should have the above characteristics to be amplified in E. coli. When E. coli, such as JM109, DH5α, HB101 or XL1 Blue, are used as a host cell, the vector should have a promoter, for example, lacZ promoter (Ward et al., (1989) Nature 341: 544-6; (1992) FASEB J 6: 2422-7), araB promoter (Better et al., (1988) Science 240: 1041-3), T7 promoter or the like, that can efficiently express the desired gene in E. coli. In that respect, pGEX-5X-1 (Pharmacia), “QIAexpress system” (Qiagen), pEGFP and pET (in this case, the host is preferably BL21 which expresses T7 RNA polymerase), for example, can be used instead of the above vectors. Additionally, the vector may also contain a signal sequence for polypeptide secretion. An exemplary signal sequence that directs the polypeptide to be secreted to the periplasm of the E. coli is the pelB signal sequence (Lei et al., (1987) J Bacteriol 169: 4379-83). Means for introducing of the vectors into the target host cells include, for example, the calcium chloride method, and the electroporation method.

In addition to E. coli, for example, expression vectors derived from mammals (for example, pcDNA3 (Invitrogen) and pEF-BOS (Mizushima S and Nagata S, (1990) Nucleic Acids Res 18(17): 5322), pEF, pCDM8), expression vectors derived from insect cells (for example, “Bac-to-BAC baculovirus expression system” (GIBCO BRL), pBacPAK8), expression vectors derived from plants (e.g., pMH1, pMH2), expression vectors derived from animal viruses (e.g., pHSV, pMV, pAdexLcw), expression vectors derived from retroviruses (e.g., pZIpneo), expression vector derived from yeast (e.g., “Pichia Expression Kit” (Invitrogen), pNV11, SP-Q01) and expression vectors derived from Bacillus subtilis (e.g., pPL608, pKTH50) can be used for producing the polypeptide of the present invention.

In order to express the vector in animal cells, such as CHO, COS or NIH3T3 cells, the vector should have a promoter necessary for expression in such cells, for example, the SV40 promoter (Mulligan et al., (1979) Nature 277: 108), the MMLV-LTR promoter, the EF1α promoter (Mizushima et al., (1990) Nucleic Acids Res 18: 5322), the CMV promoter and the like, and preferably a marker gene for selecting transformants (for example, a drug resistance gene selected by a drug (e.g., neomycin, G418)). Examples of known vectors with these characteristics include, for example, pMAM, pDR2, pBK-RSV, pBK-CMV, pOPRSV and pOP13.

Producing Polypeptides

In addition, the present invention provides methods for producing a polypeptide of the present invention. The polypeptides may be prepared by culturing a host cell which harbors an expression vector comprising a gene encoding the polypeptide. According to needs, methods may be used to express a gene stably and, at the same time, to amplify the copy number of the gene in cells. For example, a vector comprising the complementary DHFR gene (e.g., pCHO I) may be introduced into CHO cells in which the nucleic acid synthesizing pathway is deleted, and then amplified by methotrexate (MTX). Furthermore, in case of transient expression of a gene, the method wherein a vector comprising a replication origin of SV40 (pcD, etc.) is transformed into COS cells comprising the SV40 T antigen expressing gene on the chromosome can be used.

A polypeptide of the present invention obtained as above may be isolated from inside or outside (such as medium) of host cells and purified as a substantially pure homogeneous polypeptide. The term “substantially pure” as used herein in reference to a given polypeptide means that the polypeptide is substantially free from other biological macromolecules. The substantially pure polypeptide is at least 75% (e.g., at least 80, 85, 95, or 99%) pure by dry weight. Purity can be measured by any appropriate standard method, for example by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis. The method for polypeptide isolation and purification is not limited to any specific method; in fact, any standard method may be used.

For instance, column chromatography, filter, ultrafiltration, salt precipitation, solvent precipitation, solvent extraction, distillation, immunoprecipitation, SDS-polyacrylamide gel electrophoresis, isoelectric point electrophoresis, dialysis, and recrystallization may be appropriately selected and combined to isolate and purify the polypeptide.

Examples of chromatography include, for example, affinity chromatography, ion-exchange chromatography, hydrophobic chromatography, gel filtration, reverse phase chromatography, adsorption chromatography, and such (Strategies for Protein Purification and Characterization: A Laboratory Course Manual. Ed. Daniel R. Marshak et al., (1996) Cold Spring Harbor Laboratory Press). These chromatographies may be performed by liquid chromatography, such as HPLC and FPLC. Thus, the present invention provides for highly purified polypeptides prepared by the above methods.

A polypeptide of the present invention may be optionally modified or partially deleted by treating it with an appropriate protein modification enzyme before and/or after purification. Useful protein modification enzymes include, but are not limited to, trypsin, chymotrypsin, lysylendopeptidase, protein kinase, glucosidase and so on.

Diagnosing Bladder Cancer:

In the context of the present invention, BLC is diagnosed by measuring the expression level of one or more BLC nucleic acids from a test population of cells, (i.e., a patient-derived biological sample). Preferably, the test cell population contains an epithelial cell, e.g., a cell obtained from bladder tissue. Gene expression can also be measured from blood or other bodily fluids such as urine. Other biological samples can be used for measuring protein levels. For example, the protein level in blood or serum derived from a subject to be diagnosed can be measured by immunoassay or other conventional biological assay.

Expression of one or more BLC-associated genes, e.g., genes listed in Tables 4-5, is determined in the test cell or biological sample and compared to the normal control expression level associated with the one or more BLC-associated gene(s) assayed. A normal control level is an expression profile of a BLC-associated gene typically found in a population known not to be suffering from BLC. An alteration (e.g., an increase or decrease) in the level of expression in the patient-derived tissue sample of one or more BLC-associated genes indicates that the subject is suffering from or is at risk of developing BLC. For example, an increase in the expression of one or more up-regulated BLC-associated genes listed in Table 4 in the test population as compared to the normal control level indicates that the subject is suffering from or is at risk of developing BLC. Conversely, a decrease in expression of one or more down-regulated BLC-associated genes listed in Table 5 in the test population as compared to the normal control level indicates that the subject is suffering from or is at risk of developing BLC.

Alteration of one or more of the BLC-associated genes in the test population as compared to the normal control level indicates that the subject suffers from or is at risk of developing BLC. For example, alteration of at least 1%, at least 5%, at least 25%, at least 50%, at least 60%, at least 80%, or at least 90% or more of the panel of BLC-associated genes (genes listed in Tables 4-5) indicates that the subject suffers from or is at risk of developing BLC.

Moreover, the present invention provides a method for diagnosing cell proliferative disease such as bladder cancer using the expression level of the genes of the present invention as a diagnostic marker. This diagnostic method comprises the steps of: (a) detecting the expression level of one or more of C2093, B5860Ns and C6055s gene; and (b) relating an elevation of the expression level to bladder cancer. In the context of the present invention, the transcript of the B5860N gene includes B5860NV1 and B5860NV2. In the context of the present invention, the transcript of the C6055 gene includes MGC34032, Genbank Accession No. AK128063, C6055V1 and C6055V2.

The expression levels of the C2093, B5860Ns or C6055s gene in a biological sample can be estimated by quantifying mRNA corresponding to or protein encoded by the C2093, B5860Ns or C6055s gene. Quantification methods for mRNA are known to those skilled in the art. For example, the levels of mRNAs corresponding to the C2093, B5860Ns or C6055s gene can be estimated by Northern blotting or RT-PCR. Since the full-length nucleotide sequences of the C2093 gene is shown in SEQ ID NO: 1. Alternatively, the full-length nucleotide sequences of two variant forms of B5860N gene transcripts are also shown in SEQ ID NO: 3 and 5. Alternatively, the full-length nucleotide sequences of four variant forms of C6055 gene transcripts are also shown in SEQ ID NO: 129, 131, 133 and 135. Accordingly, anyone skilled in the art can design the nucleotide sequences for probes or primers to quantify the C2093, B5860N or C6055 gene.

Also, the expression level of the C2093, B5860Ns or C6055s gene can be analyzed based on the activity or quantity of protein encoded by the gene. A method for determining the quantity of the C2093, B5860N or C6055 protein is shown in below. For example, immunoassay methods are useful for the determination of the proteins in biological materials. Any biological materials can be used as the biological sample for the determination of the protein or its activity, so long as the marker gene (i.e, the C2093, B5860Ns or C6055s gene) is expressed in the sample of a bladder cancer patient. For example, in the context of the present invention, bladder tissue is a preferred biological sample. However, bodily fluids, such as blood and urine, may be also analyzed. On the other hand, a suitable method can be selected for the determination of the activity of a protein encoded by the C2093, B5860Ns or C6055s gene according to the activity of a protein to be analyzed.

Expression levels of the C2093, B5860Ns or C6055s gene in a biological sample are estimated and compared with those in a normal sample (e.g., a sample derived from a non-diseased subject). When such a comparison shows that the expression level of the target gene is higher than those in the normal sample, the subject is judged to be affected with bladder cancer. The expression level of the C2093, B5860Ns or C6055s gene in the biological samples from a normal subject and subject to be diagnosed may be determined at the same time. Alternatively, normal ranges of the expression levels can be determined by a statistical method based on the results obtained by analyzing the expression level of the gene in samples previously collected from a control group. A result obtained by comparing the sample of a subject is compared with the normal range; when the result does not fall within the normal range, the subject is judged to be affected with or is at risk of developing bladder cancer.

In the present invention, a diagnostic agent for diagnosing cell proliferative disease, such as bladder cancer, is also provided. The diagnostic agent of the present invention comprises a compound that binds to C2093, B5860Ns or C6055s gene transcript or polypeptide encoded thereby. Preferably, an oligonucleotide that hybridizes to the polynucleotide comprising the nucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 129, 131, 133 and 135, or an antibody that binds to the polypeptide consisting of amino acid sequence selected from the group consisting of SEQ ID NOs:2, 4, 6, 130, 132, 134 and 136 may be used as such a compound.

Identifying Agents that Inhibit or Enhance BLC-Associated Gene Expression:

An agent that inhibits the expression of a BLC-associated gene or the activity of its gene product can be identified by contacting a test cell population expressing a BLC-associated up-regulated gene with a test agent and then determining the expression level of the BLC-associated gene or the activity of its gene product. A decrease in the level of expression of the BLC-associated gene or in the level of activity of its gene product in the presence of the agent as compared to the expression or activity level in the absence of the test agent indicates that the agent is an inhibitor of a BLC-associated up-regulated gene and useful in inhibiting BLC.

Alternatively, an agent that enhances the expression of a BLC-associated down-regulated gene or the activity of its gene product can be identified by contacting a test cell population expressing a BLC-associated gene with a test agent and then determining the expression level or activity of the BLC-associated down-regulated gene. An increase in the level of expression of the BLC-associated gene or in the level of activity of its gene product as compared to the expression or activity level in the absence of the test agent indicates that the test agent augments expression of the BLC-associated down-regulated gene or the activity of its gene product.

The test cell population may be any cell expressing the BLC-associated genes. For example, the test cell population may contain an epithelial cell, such as a cell derived from bladder tissue. Furthermore, the test cell may be an immortalized cell line derived from a carcinoma cell. Alternatively, the test cell may be a cell which has been transfected with a BLC-associated gene or which has been transfected with a regulatory sequence (e.g., a promoter sequence) from a BLC-associated gene operably linked to a reporter gene.

Assessing Efficacy of Treatment of BLC in a Subject:

The differentially expressed BLC-associated genes identified herein also allow for the course of treatment of BLC to be monitored. In this method, a test cell population is provided from a subject undergoing treatment for BLC. If desired, test cell populations are obtained from the subject at various time points, for example, before, during, and/or after treatment. Expression of one or more of the BLC-associated genes in the cell population is then determined and compared to a reference cell population which includes cells whose BLC state is known. In the context of the present invention, the reference cells should have not been exposed to the treatment of interest.

If the reference cell population contains no BLC cells, a similarity in the expression of a BLC-associated gene in the test cell population and the reference cell population indicates that the treatment of interest is efficacious. However, a difference in the expression of a BLC-associated gene in the test population and a normal control reference cell population indicates a less favorable clinical outcome or prognosis. Similarly, if the reference cell population contains BLC cells, a difference between the expression of a BLC-associated gene in the test cell population and the reference cell population indicates that the treatment of interest is efficacious, while a similarity in the expression of a BLC-associated gene in the test population and a bladder cancer control reference cell population indicates a less favorable clinical outcome or prognosis.

Additionally, the expression level of one or more BLC-associated genes determined in a subject-derived biological sample obtained after treatment (i.e., post-treatment levels) can be compared to the expression level of the one or more BLC-associated genes determined in a subject-derived biological sample obtained prior to treatment onset (i.e., pre-treatment levels). If the BLC-associated gene is an up-regulated gene, a decrease in the expression level in a post-treatment sample indicates that the treatment of interest is efficacious while an increase or maintenance in the expression level in the post-treatment sample indicates a less favorable clinical outcome or prognosis. Conversely, if the BLC-associated gene is an down-regulated gene, an increase in the expression level in a post-treatment sample may indicate that the treatment of interest is efficacious while an decrease or maintenance in the expression level in the post-treatment sample indicates a less favorable clinical outcome or prognosis.

As used herein, the term “efficacious” indicates that the treatment leads to a reduction in the expression of a pathologically up-regulated gene, an increase in the expression of a pathologically down-regulated gene or a decrease in size, prevalence, or metastatic potential of bladder ductal carcinoma in a subject. When a treatment of interest is applied prophylactically, the term “efficacious” means that the treatment retards or prevents a bladder tumor from forming or retards, prevents, or alleviates a symptom of clinical BLC. Assessment of bladder tumors can be made using standard clinical protocols. In addition, efficaciousness can be determined in association with any known method for diagnosing or treating BLC. BLC can be diagnosed, for example, by identifying symptomatic anomalies, e.g., weight loss, abdominal pain, back pain, anorexia, nausea, vomiting and generalized malaise, weakness, and jaundice.

The present method of diagnosing bladder cancer may be applied for assessing the efficacy of treatment of bladder cancer in a subject. According to the method, a biological sample, such as a test cell population, is obtained from a subject undergoing treatment for bladder cancer. The method for assessment can be conducted according to conventional methods of diagnosing bladder cancer.

If desired, biological samples are obtained from the subject at various time points before, during or after the treatment. The expression level of the C2093, B5860Ns or C6055s gene, in the biological sample is then determined and compared to a control level derived, for example, from a reference cell population which includes cells whose state of bladder cancer (i.e., cancerous cell or non-cancerous cell) is known. The control level is determined in a biological sample that has not been exposed to the treatment. If the control level is derived from a biological sample which contains no cancerous cell, a similarity between the expression level in the subject-derived biological sample and the control level indicates that the treatment is efficacious. A difference between the expression level of the C2093, B5860Ns or C6055s gene in the subject-derived biological sample and the control level indicates a less favorable clinical outcome or prognosis.

The term “efficacious” refers that the treatment leads to a reduction in the expression of a pathologically up-regulated gene (e.g., the C2093, B5860Ns and C6055s gene) or a decrease in size, prevalence or proliferating potential of bladder cancer cells in a subject. When a treatment is applied prophylactically, “efficacious” indicates that the treatment retards or prevents occurrence of bladder cancer. The assessment of bladder cancer can be made using standard clinical protocols. Furthermore, the efficaciousness of a treatment may be determined in association with any known method for diagnosing or treating bladder cancer. Moreover, the present method of diagnosing bladder cancer may also be applied for assessing the prognosis of a subject with bladder cancer by comparing the expression level of the C2093, B5860Ns or C6055s gene in a patient-derived biological sample, such as test cell population, to a control level. Alternatively, the expression level of the C2093, B5860Ns or C6055s gene in a biological sample derived from patients may be measured over a spectrum of disease stages to assess the prognosis of the patient.

An increase in the expression level of the C2093, B5860Ns or C6055s gene as compared to a normal control level indicates less favorable prognosis. A similarity in the expression level of the C2093, B5860Ns or C6055s gene compared to a normal control level indicates a more favorable prognosis for the patient.

Selecting a Therapeutic Agent for Treating BLC that is Appropriate for a Particular Individual:

Differences in the genetic makeup of individuals can result in differences in their relative abilities to metabolize various drugs. An agent that is metabolized in a subject to act as an anti-BLC agent can manifest itself by inducing a change in a gene expression pattern in the subject's cells from that characteristic of a cancerous state to a gene expression pattern characteristic of a non-cancerous state. Accordingly, the differentially expressed BLC-associated genes disclosed herein allow for a putative therapeutic or prophylactic inhibitor of BLC to be tested in a test cell population from a selected subject in order to determine if the agent is a suitable inhibitor of BLC in the subject.

To identify an inhibitor of BLC that is appropriate for a specific subject, a test cell population from the subject is exposed to a therapeutic agent, and the expression of one or more of BLC-associated genes listed in Table 4-5 is determined.

In the context of the method of the present invention, the test cell population contains a BLC cell expressing a BLC-associated gene. Preferably, the test cell is an epithelial cell. For example, a test cell population may be incubated in the presence of a candidate agent and the pattern of gene expression of the test cell population may be measured and compared to one or more reference profiles, e.g., a BLC reference expression profile or a non-BLC reference expression profile.

A decrease in expression of one or more of the BLC-associated genes listed in Table 4 or an increase in expression of one or more of the BLC-associated genes listed in Table 5 in a test cell population relative to a reference cell population containing BLC indicates that the agent has therapeutic potential.

In the context of the present invention, the test agent can be any compound or composition. Exemplary test agents include, but are not limited to, immunomodulatory agents.

Screening Assays for Identifying Therapeutic Agents:

The differentially expressed BLC-associated genes disclosed herein can also be used to identify candidate therapeutic agents for treating BLC. The method of the present invention involves screening a candidate therapeutic agent to determine if it can convert an expression profile of one or more BLC-associated genes listed in Tables 4-5 characteristic of a BLC state to a gene expression pattern characteristic of a non-BLC state.

In the instant method, a cell is exposed to a test agent or a plurality of test agents (sequentially or in combination) and the expression of one or more of the BLC-associated genes listed in Tables 4-5 in the cell is measured. The expression profile of the BLC-associated gene(s) assayed in the test population is compared to expression level of the same BLC-associated gene(s) in a reference cell population that is not exposed to the test agent.

An agent capable of stimulating the expression of an under-expressed gene or suppressing the expression of an over-expressed genes has potential clinical benefit. Such agents may be further tested for the ability to prevent bladder ductal carcinomal growth in animals or test subjects.

In a further embodiment, the present invention provides methods for screening candidate agents which act on the potential targets in the treatment of BLC. As discussed in detail above, by controlling the expression levels of marker genes or the activities of their gene products, one can control the onset and progression of BLC. Thus, candidate agents, which act on the potential targets in the treatment of BLC, can be identified through screening methods that use such expression levels and activities as indices of the cancerous or non-cancerous state. In the context of the present invention, such screening may comprise, for example, the following steps:

    • a) contacting a test compound with a polypeptide encoded by a polynucleotide selected from the group consisting of the genes listed in Table 4 or 5;
    • b) detecting the binding activity between the polypeptide and the test compound; and
    • c) selecting the test compound that binds to the polypeptide.

Alternatively, the screening method of the present invention may comprise the following steps:

    • a) contacting a candidate compound with a cell expressing one or more marker genes, wherein the one or more marker genes are selected from the group consisting of the genes listed in Table 4 or 5; and
    • b) selecting the candidate compound that reduces the expression level of one or more marker genes selected from the group consisting of the genes listed in Table 4, or elevates the expression level of one or more marker genes selected from the group consisting of the genes listed in Table 5.

Cells expressing a marker gene include, for example, cell lines established from BLC; such cells can be used for the above screening of the present invention.

Alternatively, the screening method of the present invention may comprise the following steps:

    • a) contacting a test compound with a polypeptide encoded by a polynucleotide selected from the group consisting of the genes listed in Table 4 or 5;
    • b) detecting the biological activity of the polypeptide of step (a); and
    • c) selecting a compound that suppresses the biological activity of the polypeptide encoded by the polynucleotide selected from the group consisting of the genes listed in Table 4 as compared to the biological activity detected in the absence of the test compound, or enhances the biological activity of the polypeptide encoded by the polynucleotide selected from the group consisting of the genes listed in Table 5 as compared to the biological activity detected in the absence of the test compound.

A protein for use in the screening method of the present invention can be obtained as a recombinant protein using the nucleotide sequence of the marker gene. Based on the information regarding the marker gene and its encoded protein, one skilled in the art can select any biological activity of the protein as an index for screening and any suitable measurement method to assay for the selected biological activity.

Alternatively, the screening method of the present invention may comprise the following steps:

    • a) contacting a candidate compound with a cell into which a vector, comprising the transcriptional regulatory region of one or more marker genes and a reporter gene that is expressed under the control of the transcriptional regulatory region, has been introduced, wherein the one or more marker genes are selected from the group consisting of the genes listed in Table 4 or 5;
    • b) measuring the expression or activity of said reporter gene; and
    • c) selecting the candidate compound that reduces the expression level or activity of said reporter gene when said marker gene is an up-regulated marker gene selected from the group consisting of the genes listed in Table 4, or that enhances the expression level or activity of said reporter gene when said marker gene is a down-regulated marker gene selected from the group consisting of the genes listed in Table 5, as compared to the expression level or activity detected in the absence of the test compound.

Suitable reporter genes and host cells are well known in the art. A reporter construct suitable for the screening method of the present invention can be prepared by using the transcriptional regulatory region of a marker gene. When the transcriptional regulatory region of the marker gene is known to those skilled in the art, a reporter construct can be prepared by using the previous sequence information. When the transcriptional regulatory region of the marker gene remains unidentified, a nucleotide segment containing the transcriptional regulatory region can be isolated from a genome library based on the nucleotide sequence information of the marker gene.

Using the C2093, B5860Ns or C6055s gene and/or proteins encoded by the genes or transcriptional regulatory region of the genes, compounds can be screened that alter the expression of the gene or the biological activity of a polypeptide encoded by the gene. Such compounds are used as pharmaceuticals for treating or preventing bladder cancer.

Therefore, the present invention provides a method of screening for a compound for treating or preventing bladder cancer using the polypeptide of the present invention. An embodiment of this screening method comprises the steps of: (a) contacting a test compound with a polypeptide encoded by C2093, B5860Ns or C6055s, or an equivalent thereof; (b) detecting the binding activity between the polypeptide and the test compound; and (c) selecting the compound that binds to the polypeptide. In the present invention the polypeptide encoded by C2093, B5860Ns or C6055s, or equivalent thereof may be selected from the group consisting of:

(1) a polypeptide comprising the amino acid sequence of selected from the group consisting of SEQ ID NOs: 2, 4, 6, 130, 132, 134 and 136;
(2) a polypeptide that comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 130, 132, 134 and 136 or a sequence having at least about 80% homology to said sequence; and
(3) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence selected from the group consisting of SEQ ID NOs:1, 3, 5, 129, 131, 133 and 135, wherein the polypeptide has a biological activity equivalent to a polypeptide consisting of the amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 130, 132, 134 and 136;

The polypeptide of the present invention to be used for screening may be a recombinant polypeptide or a protein derived from the nature or a partial peptide thereof. The polypeptide of the present invention to be contacted with a test compound can be, for example, a purified polypeptide, a soluble protein, a form bound to a carrier or a fusion protein fused with other polypeptides.

As a method of screening for proteins, for example, that bind to the polypeptide of the present invention using the polypeptide encoded by C2093, B5860Ns or C6055s of the present invention, many methods well known by a person skilled in the art can be used. Such a screening can be conducted by, for example, immunoprecipitation method, specifically, in the following manner. The C2093, B5860Ns or C6055s gene encoding the polypeptide of the present invention is expressed in host (e.g., animal) cells and so on by inserting the gene to an expression vector for foreign genes, such as pSV2neo, pcDNA I, pcDNA3.1, pCAGGS and pCD8. The promoter to be used for the expression may be any promoter that can be used commonly and include, for example, the SV40 early promoter (Rigby in Williamson (ed.), (1982) Genetic Engineering, vol. 3. Academic Press, London, 83-141), the EF-α promoter (Kim et al., Gene 91: 217-23 (1990)), the CAG promoter (Niwa et al., (1991) Gene 108: 193-9), the RSV LTR promoter (Cullen, (1987) Methods in Enzymology 152: 684-704) the SRα promoter (Takebe et al., (1988) Mol Cell Biol 8: 466-72), the CMV immediate early promoter (Seed and Aruffo, (1987) Proc Natl Acad Sci USA 84: 3365-9), the SV40 late promoter (Gheysen and Fiers, (1982) J Mol Appl Genet. 1: 385-94), the Adenovirus late promoter (Kaufman et al., (1989) Mol Cell Biol 9: 946-58), the HSV TK promoter and so on. The introduction of the gene into host cells to express a foreign gene can be performed according to any methods, for example, the electroporation method (Chu et al., (1987) Nucleic Acids Res 15: 1311-26), the calcium phosphate method (Chen and Okayama, (1987) Mol Cell Biol 7: 2745-52), the DEAE dextran method (Lopata et al., (1984) Nucleic Acids Res 12: 5707-17; Sussman and Milman, (1984) Mol Cell Biol 4: 1641-3), the Lipofectin method (Derijard B, et al., (1994) Cell 76: 1025-37; Lamb et al., (1993) Nature Genetics 5: 22-30: Rabindran et al., (1993) Science 259: 230-4) and so on. The polypeptide to be used for screening of the present invention can be expressed as a fusion protein comprising a recognition site (epitope) of a monoclonal antibody by introducing the epitope of the monoclonal antibody, whose specificity has been revealed, to the N- or C-terminus of the polypeptide of the present invention. A commercially available epitope-antibody system can be used (Experimental Medicine 13: 85-90 (1995)). Vectors which can express a fusion protein with, for example, β-galactosidase, maltose binding protein, glutathione S-transferase, green florescence protein (GFP) and so on by the use of its multiple cloning sites are commercially available.

A fusion protein prepared by introducing only small epitopes consisting of several to a dozen amino acids so as not to change the property of the polypeptide to be used for screening of the present invention by the fusion is also reported. Epitopes, such as polyhistidine (His-tag), influenza aggregate HA, human c-myc, FLAG, Vesicular stomatitis virus glycoprotein (VSV-GP), T7 gene 10 protein (T7-tag), human simple herpes virus glycoprotein (HSV-tag), E-tag (an epitope on monoclonal phage) and such, and monoclonal antibodies recognizing them can be used as the epitope-antibody system for screening proteins binding to the polypeptide to be used for screening of the present invention (Experimental Medicine 13: 85-90 (1995)).

In immunoprecipitation, an immune complex is formed by adding these antibodies to cell lysate prepared using an appropriate detergent. The immune complex consists of the polypeptide to be used for screening of the present invention, a polypeptide comprising the binding ability with the polypeptide, and an antibody. Immunoprecipitation can be also conducted using antibodies against the polypeptide to be used for screening of the present invention, besides using antibodies against the above epitopes, which antibodies can be prepared as described above.

An immune complex can be precipitated, for example by Protein A sepharose or Protein G sepharose when the antibody is a mouse IgG antibody. If the polypeptide to be used for screening of the present invention is prepared as a fusion protein with an epitope, such as GST, an immune complex can be formed in the same manner as in the use of the antibody against the polypeptide to be used for screening of the present invention, using a substance specifically binding to these epitopes, such as glutathione-Sepharose 4B.

Immunoprecipitation can be performed by following or according to, for example, the methods in the literature (Harlow and Lane, (1988) Antibodies, 511-52, Cold Spring Harbor Laboratory publications, New York).

SDS-PAGE is commonly used for analysis of immunoprecipitated proteins and the bound protein can be analyzed by the molecular weight of the protein using gels with an appropriate concentration. Since the protein bound to the polypeptide to be used for screening of the present invention is difficult to detect by a common staining method, such as Coomassie staining or silver staining, the detection sensitivity for the protein can be improved by culturing cells in culture medium containing radioactive isotope, 35S-methionine or 35S-cysteine, labeling proteins in the cells, and detecting the proteins. The target protein can be purified directly from the SDS-polyacrylamide gel and its sequence can be determined, when the molecular weight of a protein has been revealed.

As a method for screening for proteins that bind to a polypeptide of the present invention using the polypeptide, for example, West-Western blotting analysis (Skolnik et al., (1991) Cell 65: 83-90) can be used. Specifically, a protein binding to the polypeptide to be used for screening of the present invention can be obtained by preparing a cDNA library from cells, tissues, organs (for example, tissues such as testis), or cultured cells (e.g., HT1197, UMUC3, J82, HT1376, SW780, RT4 PC3, DU145, or HT1376) expected to express a protein binding to the polypeptide of the present invention using a phage vector (e.g., ZAP), expressing the protein on LB-agarose, fixing the protein expressed on a filter, reacting the purified and labeled polypeptide of the present invention with the above filter, and detecting the plaques expressing proteins bound to the polypeptide of the present invention according to the label. The polypeptide to be used for screening of the invention may be labeled by utilizing the binding between biotin and avidin, or by utilizing an antibody that specifically binds to the polypeptide to be used for screening of the present invention, or a peptide or polypeptide (for example, GST) that is fused to the polypeptide of the present invention. Methods using radioisotope or fluorescence and such may be also used.

Alternatively, in another embodiment of the screening method of the present invention, a two-hybrid system utilizing cells may be used (“MATCHMAKER Two-Hybrid system”, “Mammalian MATCHMAKER Two-Hybrid Assay Kit”, “MATCHMAKER one-Hybrid system” (Clontech); “HybriZAP Two-Hybrid Vector System” (Stratagene); the references “Dalton and Treisman, (1992) Cell 68: 597-612”, “Fields and Sternglanz, (1994) Trends Genet. 10: 286-92”).

In the two-hybrid system, the polypeptide to be used for screening of the invention is fused to the SRF-binding region or GAL4-binding region and expressed in yeast cells. A cDNA library is prepared from cells expected to express a protein binding to the polypeptide to be used for screening of the invention, such that the library, when expressed, is fused to the VP16 or GAL4 transcriptional activation region. The cDNA library is then introduced into the above yeast cells and the cDNA derived from the library is isolated from the positive clones detected (when a protein binding to the polypeptide to be used for screening of the invention is expressed in yeast cells, the binding of the two activates a reporter gene, making positive clones detectable). A protein encoded by the cDNA can be prepared by introducing the cDNA isolated above to E. coli and expressing the protein.

As a reporter gene, for example, Ade2 gene, lacZ gene, CAT gene, luciferase gene and such can be used in addition to the HIS3 gene.

A compound binding to the polypeptide to be used for screening of the invention can also be screened using affinity chromatography. For example, the polypeptide to be used for screening of the invention may be immobilized on a carrier of an affinity column, and a test compound, containing a protein capable of binding to the polypeptide to be used for screening of the invention, is applied to the column. A test compound herein may be, for example, cell extracts, cell lysates, etc. After loading the test compound, the column is washed, and compounds bound to the polypeptide to be used for screening of the invention can be prepared.

When the test compound is a protein, the amino acid sequence of the obtained protein is analyzed, an oligo DNA is synthesized based on the sequence, and cDNA libraries are screened using the oligo DNA as a probe to obtain a DNA encoding the protein.

A biosensor using the surface plasmon resonance phenomenon may be used as a mean for detecting or quantifying the bound compound in the present invention. When such a biosensor is used, the interaction between the polypeptide to be used for screening of the invention and a test compound can be observed real-time as a surface plasmon resonance signal, using only a minute amount of polypeptide and without labeling (for example, BIAcore, Pharmacia). Therefore, it is possible to evaluate the binding between the polypeptide to be used for screening of the invention and a test compound using a biosensor such as BIAcore.

The methods of screening for molecules that bind when the immobilized polypeptide to be used for screening of the invention is exposed to synthetic chemical compounds, or natural substance banks or a random phage peptide display library, and the methods of screening using high-throughput based on combinatorial chemistry techniques (Wrighton et al., (1996) Science 273: 458-64; Verdine, (1996) Nature 384: 11-13; Hogan, (1996) Nature 384: 17-9) to isolate not only proteins but chemical compounds that bind to the protein to be used for screening of the invention (including agonist and antagonist) are well known to one skilled in the art.

Alternatively, the present invention provides a method of screening for a compound for treating or preventing bladder cancer using the polypeptide of the present invention encoded by C2093, B5860Ns or C6055s, or an equivalent thereof, comprising the steps as follows:

(a) contacting a test compound with the polypeptide or equivalent thereof;
(b) detecting the biological activity of the polypeptide or equivalent thereof of step (a); and
(c) selecting a compound that suppresses the biological activity of the polypeptide or equivalent thereof in comparison with the biological activity detected in the absence of the test compound.

Since the C2093, B5860Ns and C6055s proteins of the present invention have the activity of promoting cell proliferation of bladder cancer cells, a compound which inhibits this activity can be screened using this activity as an index.

Any polypeptides can be used for screening, so long as they comprise the biological activity of the C2093, B5860Ns or C6055s protein. Such biological activities include the cell-proliferating activity of the human C2093, B5860Ns or C6055s protein. For example, a human C2093, B5860Ns or C6055s protein can be used and polypeptides functionally equivalent to these proteins can also be used. Such polypeptides may be expressed endogenously or exogenously by cells.

The compound isolated by this screening is a candidate for agonists or antagonists of the C2093, B5860Ns or C6055s polypeptide of the present invention. The term “agonist” refers to molecules that activate the function of the polypeptide of the present invention by binding thereto. Likewise, the term “antagonist” refers to molecules that inhibit the function of the polypeptide of the present invention by binding thereto. Moreover, a compound isolated by this screening as “antagonist” is a candidate for compounds which inhibit the in vivo interaction of the polypeptide to be used for screening of the present invention with molecules (including DNAs and proteins).

When the biological activity to be detected in the present method is cell proliferation, it can be detected, for example, by preparing cells which express the polypeptide to be used for screening of the present invention, culturing the cells in the presence of a test compound, and determining the speed of cell proliferation, measuring the cell cycle and such, as well as by measuring the colony forming activity as described in the Examples.

In a further embodiment, the present invention provides methods for screening compounds for treating or preventing bladder cancer. As discussed in detail above, by controlling the expression levels of the C2093, B5860Ns and/or C6055s genes, one can control the onset and progression of bladder cancer. Thus, compounds that may be used in the treatment or prevention of bladder cancer can be identified through screenings that use the expression levels of C2093, B5860Ns or C6055s as indices. In the context of the present invention, such screening may comprise, for example, the following steps:

a) contacting a test compound with a cell expressing one or more of the C2093, B5860Ns or C6055s gene; and
b) selecting a compound that reduces the expression level of one or more of the C2093, B5860Ns or C6055s gene in comparison with the expression level detected in the absence of the test compound.

Cells expressing at least one of the one or more of the C2093, B5860Ns or C6055s gene include, for example, cell lines established from bladder cancers; such cells can be used for the above screening of the present invention (e.g., HT1197, UMUC3, J82, HT1376, SW780, RT4 and HT1376). The expression level can be estimated by methods well known to one skilled in the art. In the method of screening, a compound that reduces the expression level of the C2093, B5860N or C6055 genes can be selected as candidate agents to be used for the treatment or prevention of bladder cancer.

Alternatively, the screening method of the present invention may comprise the following steps:

    • a) contacting a test compound with a cell into which a vector comprising the transcriptional regulatory region of one or more marker genes and a reporter gene that is expressed under the control of the transcriptional regulatory region has been introduced, wherein the one or more marker genes are C2093, B5860Ns or C6055s,
    • b) measuring the expression level or activity of said reporter gene; and
    • c) selecting a compound that reduces the expression level or activity of said reporter gene as compared to the expression level or activity detected in the absence of the test compound.

Suitable reporter genes and host cells are well known in the art. The reporter construct required for the screening can be prepared by using the transcriptional regulatory region of a marker gene. When the transcriptional regulatory region of a marker gene has been known to those skilled in the art, a reporter construct can be prepared by using the previous sequence information. When the transcriptional regulatory region of a marker gene remains unidentified, a nucleotide segment containing the transcriptional regulatory region can be isolated from a genome library based on the nucleotide sequence information of the marker gene.

Examples of supports that may be used for binding proteins include insoluble polysaccharides, such as agarose, cellulose and dextran; and synthetic resins, such as polyacrylamide, polystyrene and silicon; preferably commercial available beads and plates (e.g., multi-well plates, biosensor chip, etc.) prepared from the above materials may be used. When using beads, they may be filled into a column.

The binding of a protein to a support may be conducted according to routine methods, such as chemical bonding and physical adsorption. Alternatively, a protein may be bound to a support via antibodies specifically recognizing the protein. Moreover, binding of a protein to a support can be also conducted by means of avidin and biotin. The binding between proteins is carried out in buffer, for example, but are not limited to, phosphate buffer and Tris buffer, as long as the buffer does not inhibit the binding between the proteins.

In the present invention, a biosensor using the surface plasmon resonance phenomenon may be used as a mean for detecting or quantifying the bound protein. When such a biosensor is used, the interaction between the proteins can be observed real-time as a surface plasmon resonance signal, using only a minute amount of polypeptide and without labeling (for example, BIAcore, Pharmacia).

Alternatively, a C2093, B5860N or C6055 polypeptides may be labeled, and the label of the bound protein may be used to detect or measure the bound protein. Specifically, after pre-labeling one of the proteins, the labeled protein is contacted with the other protein in the presence of a test compound, and then bound proteins are detected or measured according to the label after washing.

Labeling substances such as radioisotope (e.g., 3H, 14C, 32P, 33P, 35S, 125I, 131I), enzymes (e.g., alkaline phosphatase, horseradish peroxidase, β-galactosidase, β-glucosidase), fluorescent substances (e.g., fluorescein isothiocyanate (FITC), rhodamine) and biotin/avidin, may be used for the labeling of a protein in the present method. When the protein is labeled with radioisotope, the detection or measurement can be carried out by liquid scintillation. Alternatively, proteins labeled with enzymes can be detected or measured by adding a substrate of the enzyme to detect the enzymatic change of the substrate, such as generation of color, with absorptiometer. Further, in case where a fluorescent substance is used as the label, the bound protein may be detected or measured using fluorophotometer.

In case of using an antibody in the present screening, the antibody is preferably labeled with one of the labeling substances mentioned above, and detected or measured based on the labeling substance. Alternatively, the antibody against the C2093, B5860Ns or C6055s polypeptide may be used as a primary antibody to be detected with a secondary antibody that is labeled with a labeling substance. Furthermore, the antibody bound to the protein in the screening of the present invention may be detected or measured using protein G or protein A column.

Any test compound, including but not limited to, cell extracts, cell culture supernatant, products of fermenting microorganism, extracts from marine organism, plant extracts, purified or crude proteins, peptides, non-peptide compounds, syntheticmicromolecular compounds and natural compounds, can be used in the screening methods of the present invention. The test compound of the present invention can be also obtained using any of the numerous approaches in combinatorial library methods known in the art, including (1) biological libraries, (2) spatially addressable parallel solid phase or solution phase libraries, (3) synthetic library methods requiring deconvolution, (4) the “one-bead one-compound” library method and (5) synthetic library methods using affinity chromatography selection. The biological library methods using affinity chromatography selection is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12: 145-67). Examples of methods for the synthesis of molecular libraries can be found in the art (DeWitt et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6909-13; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91: 11422-6; Zuckermann et al. (1994) J. Med. Chem. 37: 2678-85; Cho et al. (1993) Science 261: 1303-5; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33: 2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33: 2061; Gallop et al. (1994) J. Med. Chem. 37: 1233-51). Libraries of compounds may be presented in solution (see Houghten (1992) Bio/Techniques 13: 412-21) or on beads (Lam (1991) Nature 354: 82-4), chips (Fodor (1993) Nature 364: 555-6), bacteria (U.S. Pat. No. 5,223,409), spores (U.S. Pat. Nos. 5,571,698; 5,403,484, and 5,223,409), plasmids (Cull et al. (1992) Proc. Natl. Acad. Sci. USA 89: 1865-9) or phage (Scott and Smith (1990) Science 249: 386-90; Devlin (1990) Science 249: 404-6; Cwirla et al. (1990) Proc. Natl. Acad. Sci. USA 87: 6378-82; Felici (1991) J. Mol. Biol. 222: 301-10; US Pat. Application 2002103360).

A compound isolated by the screening serves as a candidate for the development of drugs that inhibit the expression of the marker gene or the activity of the protein encoded by the marker gene and can be applied to the treatment or prevention of bladder cancer.

Moreover, compounds in which a part of the structure of the compound inhibiting the activity of proteins encoded by marker genes is converted by addition, deletion and/or replacement are also included as the compounds obtainable by the screening method of the present invention.

When administrating a compound isolated by the method of the present invention as a pharmaceutical for humans and other mammals, including, but not limited to, mice, rats, guinea-pigs, rabbits, cats, dogs, sheep, pigs, cattle, monkeys, baboons, and chimpanzees, the isolated compound can be directly administered or can be formulated into a dosage form using known pharmaceutical preparation methods. Pharmaceutical compositions and preparations contemplated by the present invention, as well as methods of making and using same, are described in detail below.

Assessing the Prognosis of a Subject with Bladder Cancer:

The present invention also provides a method of assessing the prognosis of a subject with BLC, including the step of comparing the expression of one or more BLC-associated genes in a test cell population to the expression of the same BLC-associated genes in a reference cell population derived from patients over a spectrum of disease stages. By comparing the gene expression of one or more BLC-associated genes in the test cell population and the reference cell population(s), or by comparing the pattern of gene expression over time in test cell populations derived from the subject, the prognosis of the subject can be assessed.

For example, an increase in the expression of one or more of up-regulated BLC-associated genes, such as those listed in Table 4, as compared to a normal control or a decrease in the expression of one or more of down-regulated BLC-associated genes, such as those listed in Table 5, as compared to a normal control indicates less favorable prognosis. Conversely, a similarity in the expression of one or more of BLC-associated genes listed in Tables 4-5 as compared to normal control indicates a more favorable prognosis for the subject. Preferably, the prognosis of a subject can be assessed by comparing the expression profile of the one or more genes selected from the group consisting of genes listed in Table 4 and 5.

Kits:

The present invention also includes a BLC-detection reagent, e.g., a nucleic acid that specifically binds to or identifies one or more BLC nucleic acids, such as oligonucleotide sequences which are complementary to a portion of a BLC nucleic acid, or an antibody that bind to one or more proteins encoded by a BLC nucleic acid. The detection reagents may be packaged together in the form of a kit. For example, the detection reagents may be packaged in separate containers, e.g., a nucleic acid or antibody (either bound to a solid matrix or packaged separately with reagents for binding them to the matrix), a control reagent (positive and/or negative), and/or a detectable label. Instructions (e.g., written, tape, VCR, CD-ROM, etc.) for carrying out the assay may also be included in the kit. The assay format of the kit may be a Northern hybridization or a sandwich ELISA, both of which are known in the art.

For example, a BLC detection reagent may be immobilized on a solid matrix, such as a porous strip, to form at least one BLC detection site. The measurement or detection region of the porous strip may include a plurality of sites, each containing a nucleic acid. A test strip may also contain sites for negative and/or positive controls. Alternatively, control sites may be located on a separate strip from the test strip. Optionally, the different detection sites may contain different amounts of immobilized nucleic acids, i.e., a higher amount in the first detection site and lesser amounts in subsequent sites. Upon the addition of test sample, the number of sites displaying a detectable signal provides a quantitative indication of the amount of BLC present in the sample. The detection sites may be configured in any suitably detectable shape and are typically in the shape of a bar or dot spanning the width of a test strip.

Alternatively, the kit may contain a nucleic acid substrate array comprising one or more nucleic acids. The nucleic acids on the array specifically identify one or more nucleic acid sequences represented by the BLC-associated genes listed in Tables 4-5. The expression of 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 40 or 50 or more of the nucleic acids represented by the BLC-associated genes listed in Tables 4-5 may be identified by virtue of the level of binding to an array test strip or chip. The substrate array can be on, e.g., a solid substrate, such as a “chip” described in U.S. Pat. No. 5,744,305, the contents of which are incorporated by reference herein in its entirety.

Arrays and Pluralities:

The present invention also includes a nucleic acid substrate array comprising one or more nucleic acids. The nucleic acids on the array specifically correspond to one or more nucleic acid sequences represented by the BLC-associated genes listed in Tables 4-5. The level of expression of 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 40 or 50 or more of the nucleic acids represented by the BLC-associated genes listed in Tables 4-5 may be identified by detecting nucleic acid binding to the array.

The present invention also includes an isolated plurality (i.e., a mixture of two or more nucleic acids) of nucleic acids. The nucleic acids may be in a liquid phase or a solid phase, e.g., immobilized on a solid support such as a nitrocellulose membrane. The plurality includes one or more of the nucleic acids represented by the BLC-associated genes listed in Tables 4-5. In various embodiments, the plurality includes 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 40 or 50 or more of the nucleic acids represented by the BLC-associated genes listed in Tables 4-5.

Methods of Inhibiting Bladder Cancer:

The present invention further provides a method for treating or alleviating a symptom of BLC in a subject by decreasing the expression of one or more of the up-regulated BLC-associated genes listed in Table 4 (or the activity of its gene product) or increasing the expression of one or more of the down-regulated BLC-associated genes listed in Table 5 (or the activity of its gene product). Suitable therapeutic compounds can be administered prophylactically or therapeutically to a subject suffering from or at risk of (or susceptible to) developing BLC. Such subjects can be identified using standard clinical methods or by detecting an aberrant level of expression of one or more of the BLC-associated genes listed in Tables 4-5 or aberrant activity of its gene product. In the context of the present invention, suitable therapeutic agents include, for example, inhibitors of cell cycle regulation, and cell proliferation.

The therapeutic method of the present invention includes the step of increasing the expression, activity, or both of one or more genes or gene products whose expression is decreased (“down-regulated” or “under-expressed” genes) in a BLC cell relative to normal cells of the same tissue type from which the BLC cells are derived. In these methods, the subject is treated with an effective amount of a compound that increases the amount of one or more of the under-expressed (down-regulated) genes in the subject. Administration can be systemic or local. Suitable therapeutic compounds include a polypeptide product of an under-expressed gene, a biologically active fragment thereof, and a nucleic acid encoding an under-expressed gene and having expression control elements permitting expression in the BLC cells; for example, an agent that increases the level of expression of such a gene endogenous to the BLC cells (i.e., which up-regulates the expression of the under-expressed gene or genes). Administration of such compounds counters the effects of aberrantly under-expressed gene or genes in the subject's bladder cancer cells and improves the clinical condition of the subject.

Alternatively, the therapeutic method of the present invention may include the step of decreasing the expression, activity, or both, of one or more genes or gene products whose expression is aberrantly increased (“up-regulated” or “over-expressed” gene) in bladder cancer cells. Expression may be inhibited in any of several ways known in the art. For example, expression can be inhibited by administering to the subject a nucleic acid that inhibits, or antagonizes the expression of the over-expressed gene or genes, e.g., an antisense oligonucleotide or small interfering RNA which disrupts expression of the over-expressed gene or genes.

In yet another embodiment, the therapeutic method includes the step of decreasing the expression or function of the C2093, B5860Ns or C6055s gene. In these methods, the subject is treated with an effective amount of a compound, which decreases the expression and/or activity of one or more of the over-expressed genes (i.e., the C2093, B5860Ns or C6055s gene) in the subject. Administration can be systemic or local. Therapeutic compounds include compounds that decrease the expression level of such gene endogenously existing in the bladder cancerous cells (i.e., compounds that down-regulate the expression of the over-expressed gene(s)). Administration of such therapeutic compounds counter the effects of aberrantly-over expressed gene(s) in the subject's cells and are expected to improve the clinical condition of the subject. Such compounds can be obtained by the screening method of the present invention described above.

The expression of the C2093, B5860Ns or C6055s gene may be also inhibited in any of several ways known in the art including administering to the subject a nucleic acid that inhibits or antagonizes the expression of the gene(s). Antisense oligonucleotides, siRNA or ribozymes which disrupts expression of the gene(s) can be used for inhibiting the expression of the genes.

As noted above, antisense-oligonucleotides corresponding to the nucleotide sequence of the C2093, B5860Ns or C6055s gene can be used to reduce the expression level of the C2093, B5860Ns or C6055s gene. Specifically, the antisense-oligonucleotides of the present invention may act by binding to any of the polypeptides encoded by the C2093, B5860Ns or C6055s gene, or mRNAs corresponding thereto, thereby inhibiting the transcription or translation of the genes, promoting the degradation of the mRNAs, and/or inhibiting the expression of proteins encoded by the genes, and finally inhibiting the function of the C2093, B5860Ns or C6055s proteins. An antisense-oligonucleotides and derivatives thereof can be made into an external preparation, such as a liniment or a poultice, by mixing with a suitable base material which is inactive against the derivative and used in the method for treating or preventing bladder cancer of the present invention.

The nucleic acids that inhibit one or more gene products of over-expressed genes also include small interfering RNAs (siRNA) comprising a combination of a sense strand nucleic acid and an antisense strand nucleic acid of the nucleotide sequence encoding the C2093, B5860Ns or C6055s gene. Standard techniques of introducing siRNA into the cell can be used in the treatment or prevention of the present invention, including those in which DNA is a template from which RNA is transcribed. The siRNA is constructed such that a single transcript has both the sense and complementary antisense sequences from the target gene, e.g., a hairpin.

Antisense Polynucleotides, Small Interfering RNAs and Ribozymes

As noted above, antisense nucleic acids corresponding to the nucleotide sequence of the BLC-associated genes listed in Table 4 can be used to reduce the expression level of the genes. Antisense nucleic acids corresponding to the BLC-associated genes listed in Table 4 that are up-regulated in bladder cancer are useful for the treatment of bladder cancer. Specifically, the antisense nucleic acids of the present invention may act by binding to the BLC-associated genes listed in Table 4, or mRNAs corresponding thereto, thereby inhibiting the transcription or translation of the genes, promoting the degradation of the mRNAs, and/or inhibiting the expression of proteins encoded by the BLC-associated genes listed in Table 4, thereby, inhibiting the function of the proteins.

The present invention includes an antisense oligonucleotide that hybridizes with any site within the nucleotide sequence of SEQ ID NO: 3. Specifically, the present invention provides an antisense polynucleotide that hybridizes with nucleic acid comprising the nucleotide sequence from 988 to 1842 of SEQ ID NO: 3, i.e., the region that is specific to the B5860NV1 sequence. This antisense oligonucleotide is preferably against at least about 15 continuous nucleotides of the nucleotide sequence of SEQ ID NO: 3. The above-mentioned antisense oligonucleotide, which contains an initiation codon in the above-mentioned at least 15 continuous nucleotides, is even more preferred.

Derivatives or modified products of antisense oligonucleotides can also be used as antisense oligonucleotides. Examples of such modified products include lower alkyl phosphonate modifications such as methyl-phosphonate-type or ethyl-phosphonate-type, phosphorothioate modifications and phosphoroamidate modifications.

The term “antisense nucleic acids” as used herein encompasses both nucleotides that are entirely complementary to the target sequence and those having a mismatch of one or more nucleotides, so long as the antisense nucleic acids can specifically hybridize to the target sequences. For example, the antisense nucleic acids of the present invention include polynucleotides that have a homology of at least about 70% or higher, preferably at least about 80% or higher, more preferably at least about 90% or higher, even more preferably at least about 95% or higher over a span of at least 15 continuous nucleotides. Algorithms known in the art can be used to determine the homology. Furthermore, derivatives or modified products of the antisense-oligonucleotides can also be used as antisense-oligonucleotides in the present invention. Examples of such modified products include, but are not limited to, lower alkyl phosphonate modifications such as methyl-phosphonate-type or ethyl-phosphonate-type, phosphorothioate modifications and phosphoroamidate modifications.

Such antisense polynucleotides are useful as probes for the isolation or detection of DNA encoding the polypeptide of the invention or as a primer used for amplifications.

The antisense nucleic acids of the present invention act on cells producing the proteins encoded by BLC-associated marker genes by binding to the DNAs or mRNAs encoding the proteins, inhibiting their transcription or translation, promoting the degradation of the mRNAs, and inhibiting the expression of the proteins, thereby resulting in the inhibition of the protein function.

An antisense nucleic acid of the present invention can be made into an external preparation, such as a liniment or a poultice, by admixing it with a suitable base material which is inactive against the nucleic acid.

Also, as needed, the antisense nucleic acids of the present invention can be formulated into, for example, tablets, powders, granules, capsules, liposome capsules, injections, solutions, nose-drops and freeze-drying agents by adding excipients, isotonic agents, solubilizers, stabilizers, preservatives, pain-killers, and such. These can be prepared by following known methods.

The antisense nucleic acids of the present invention can be given to the patient by direct application onto the ailing site or by injection into a blood vessel so that it will reach the site of ailment. An antisense-mounting medium can also be used to increase durability and membrane-permeability. Examples include, but are not limited to, liposomes, poly-L-lysine, lipids, cholesterol, lipofectin or derivatives of these.

The dosage of the antisense nucleic acid derivative of the present invention can be adjusted suitably according to the patient's condition and used in desired amounts. For example, a dose range of 0.1 to 100 mg/kg, preferably 0.1 to 50 mg/kg can be administered.

The antisense nucleic acids of the present invention inhibit the expression of a protein of the present invention and are thereby useful for suppressing the biological activity of the protein of the invention. In addition, expression-inhibitors, comprising antisense nucleic acids of the present invention, are useful in that they can inhibit the biological activity of a protein of the present invention.

The method of the present invention can be used to alter the expression in a cell of an up-regulated BLC-associated gene, e.g., up-regulation resulting from the malignant transformation of the cells. Binding of the siRNA to a transcript corresponding to one of the BLC-associated genes listed in Table 4 in the target cell results in a reduction in the protein production by the cell. The length of the oligonucleotide is at least 10 nucleotides and may be as long as the naturally-occurring transcript. Preferably, the oligonucleotide is 75, 50, or 25 nucleotides or less in length. Most preferably, the oligonucleotide is about 19 to 25 nucleotides in length.

The antisense nucleic acids of present invention include modified oligonucleotides. For example, thiolated oligonucleotides may be used to confer nuclease resistance to an oligonucleotide.

Also, an siRNA against a marker gene can be used to reduce the expression level of the marker gene. Herein, term “siRNA” refers to a double stranded RNA molecule which prevents translation of a target mRNA. Standard techniques for introducing siRNA into the cell may be used, including those in which DNA is a template from which RNA is transcribed. In the context of the present invention, the siRNA comprises a sense nucleic acid sequence and an anti-sense nucleic acid sequence against an up-regulated marker gene, such as a BLC-associated gene listed in Table 4. The siRNA is constructed such that a single transcript has both the sense and complementary antisense sequences from the target gene, e.g., a hairpin.

An siRNA of a BLC-associated gene, such as listed in Table 4, hybridizes to target mRNA and thereby decreases or inhibits production of the polypeptides encoded by the BLC-associated gene listed in Table 4 by associating with the normally single-stranded mRNA transcript, thereby interfering with translation and thus, expression of the protein. Thus, siRNA molecules of the invention can be defined by their ability to hybridize specifically to mRNA or cDNA listed in Table 4 under stringent conditions. For the purposes of this invention the terms “hybridize” or “hybridize specifically” are used interchangeably to refer the ability of two nucleic acid molecules to hybridize under “stringent hybridization conditions.” The phrase “stringent hybridization conditions” is discussed above and refers to conditions under which a nucleic acid molecule will hybridize to its target sequence, typically in a complex mixture of nucleic acids, but not detectably to other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Probes, “Overview of principles of hybridization and the strategy of nucleic acid assays” (1993). Generally, stringent conditions are selected to be about 5-10° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably 10 times background hybridization. Exemplary stringent hybridization conditions can be as following: 50% formamide, 5×SSC, and 1% SDS, incubating at 42° C., or, 5×SSC, 1% SDS, incubating at 65° C., with wash in 0.2×SSC, and 0.1% SDS at 50° C.

In the context of the present invention, an siRNA is preferably 500, 200, 100, 50, or 25 nucleotides or less in length. More preferably an siRNA is about 19 to about 25 nucleotides in length. In order to enhance the inhibition activity of the siRNA, nucleotide “u” can be added to 3′ end of the antisense strand of the target sequence. The number of “u”s to be added is at least about 2, generally about 2 to about 10, preferably about 2 to about 5. The added “u”s form single strand at the 3′ end of the antisense strand of the siRNA.

An siRNA of a BLC-associated gene, such as listed in Table 4, can be directly introduced into the cells in a form that is capable of binding to the mRNA transcripts. In these embodiments, the siRNA molecules of the invention are typically modified as described above for antisense molecules. Other modifications are also possible, for example, cholesterol-conjugated siRNAs have shown improved pharmacological properties. Song et al. Nature Med. 9:347-51 (2003): Alternatively, a DNA encoding the siRNA may be carried in a vector.

Vectors may be produced, for example, by cloning a BLC-associated gene target sequence into an expression vector having operatively-linked regulatory sequences flanking the sequence in a manner that allows for expression (by transcription of the DNA molecule) of both strands (Lee, N. S., et al., (2002) Nature Biotechnology 20:500-5). An RNA molecule that is antisense strand for mRNA of a BLC-associated gene is transcribed by a first promoter (e.g., a promoter sequence 3′ of the cloned DNA) and an RNA molecule that is the sense strand for the mRNA of a BLC-associated gene is transcribed by a second promoter (e.g., a promoter sequence 5′ of the cloned DNA). The sense and antisense strands hybridize in vivo to generate siRNA constructs for silencing of the BLC-associated gene. Alternatively, the two constructs can be utilized to create the sense and antisense strands of an siRNA construct. Cloned BLC-associated genes can encode a construct having secondary structure, e.g., hairpins, wherein a single transcript has both the sense and complementary antisense sequences from the target gene.

A loop sequence, consisting of an arbitrary nucleotide sequence, can be located between the sense and antisense sequence in order to form the hairpin loop structure. Thus, the present invention also provides siRNA having the general formula 5′-[A]-[B]-[A′]-3′, wherein [A] is a ribonucleotide sequence corresponding to a sequence that specifically hybridizes to an mRNA or a cDNA listed in Table 4. In preferred embodiments, [A] is a ribonucleotide sequence corresponding a sequence of gene selected from Table 4,

[B] is a ribonucleotide sequence consisting of about 3 to about 23 nucleotides, and

[A′] is a ribonucleotide sequence consisting of the complementary sequence of [A]. The region [A] hybridizes to [A′], and then a loop consisting of region [B] is formed. The loop sequence may be preferably 3 to 23 nucleotide in length. The loop sequence, for example, can be selected from group consisting of following sequences (http://www.ambion.com/techlib/tb/tb506.html). Furthermore, loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque, J.-M., et al., (2002) Nature 418: 435-8).

CCC, CCACC or CCACACC: Jacque, J. M, et al., (2002) Nature, 418: 435-8.

UUCG: Lee, N. S., et al., (2002) Nature Biotechnology 20:500-5. Fruscoloni, P., et al., (2003) Proc. Natl. Acad. Sci. USA 100(4): 1639-44.

UUCAAGAGA: Dykxhoorn, D. M., et al., (2002) Nature Reviews Molecular Cell Biology 4: 457-67.

For example, preferable siRNAs having hairpin structure of the present invention are shown below. In the following structure, the loop sequence can be selected from group consisting of, CCC, UUCG, CCACC, CCACACC, and UUCAAGAGA. Preferable loop sequence is UUCAAGAGA (“ttcaagaga” in DNA).

The nucleotide sequence of suitable siRNAs can be designed using an siRNA design computer program available from the Ambion website (http://www.ambion.com/techlib/misc/siRNA_finder.html). The computer program selects nucleotide sequences for siRNA synthesis based on the following protocol.

Selection of siRNA Target Sites:

  • 1. Beginning with the AUG start codon of the object transcript, scan downstream for AA dinucleotide sequences. Record the occurrence of each AA and the 3′ adjacent 19 nucleotides as potential siRNA target sites. Tuschl, et al. (1999) Genes Dev 13(24): 3191-7, don't recommend against designing siRNA to the 5′ and 3′ untranslated regions (UTRs) and regions near the start codon (within 75 bases) as these may be richer in regulatory protein binding sites. UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNA endonuclease complex.
  • 2. Compare the potential target sites to the human genome database and eliminate from consideration any target sequences with significant homology to other coding sequences. The homology search can be performed using BLAST, which can be found on the NCBI server at: www.ncbi.nlm.nih.gov/BLAST/.
  • 3. Select qualifying target sequences for synthesis. At Ambion, preferably several target sequences can be selected along the length of the gene to evaluate.

The regulatory sequences flanking the BLC-associated gene sequences can be identical or different, such that their expression can be modulated independently, or in a temporal or spatial manner. siRNAs are transcribed intracellularly by cloning the BLC-associated gene templates, respectively, into a vector containing, e.g., a RNA polymerase III transcription unit from the small nuclear RNA (snRNA) U6 or the human H1 RNA promoter. For introducing the vector into the cell, transfection-enhancing agent can be used. FuGENE (Rochediagnostices), Lipofectamine 2000 (Invitrogen), Oligofectamine (Invitrogen), and Nucleofector (Wako pure Chemical) are useful as the transfection-enhancing agent.

Oligonucleotides and oligonucleotides complementary to various portions of C2093, B5860Ns, or C6055s mRNA were tested in vitro for their ability to decrease production of C2093, B5860Ns, or C6055s in tumor cells (e.g., using the HT1197, UMUC3, J82, HT1376, SW780, RT4 or HT1376 bladder cancer cell line) according to standard methods. A reduction in product of C2093, B5860Ns, or C6055s transcript in cells contacted with the candidate siRNA composition compared to cells cultured in the absence of the candidate composition is detected using C2093, B5860Ns, or C6055s-specific antibodies or other detection strategies. Sequences which decrease production of C2093, B5860Ns, or C6055s in in vitro cell-based or cell-free assays are then tested for there inhibitory effects on cell growth. Sequences which inhibit cell growth in in vitro cell-based assay are test in in vivo in rats or mice to confirm decreased C2093, B5860Ns, or C6055s production and decreased tumor cell growth in animals with malignant neoplasms.

Also included in the invention are double-stranded molecules that include the nucleic acid sequence of target sequences, for example, nucleotides 2543-2561 (SEQ ID NO: 21) of SEQ ID NO: 1, nucleotides 2491-2509 of SEQ ID NO: 3 or nucleotides 1639-1657 of SEQ ID NO: 5(SEQ ID NO: 25), or nucleotides 1905-1923 of SEQ ID NO: 129, nucleotides 1873-1891 of SEQ ID NO: 131, nucleotides 1921-1939 of SEQ ID NO: 133 or nucleotides 2001-2019 of SEQ ID NO: 135(SEQ ID NO: 144). In the present invention, the double-stranded molecule comprising a sense strand and an antisense strand, wherein the sense strand comprises a ribonucleotide sequence corresponding to SEQ ID NO: 21, 25 or 144, and wherein the antisense strand comprises a ribonucleotide sequence which is complementary to said sense strand, wherein said sense strand and said antisense strand hybridize to each other to form said double-stranded molecule, and wherein said double-stranded molecule, when introduced into a cell expressing the C2093, B5860Ns, or C6055s gene, inhibits expression of said gene. In the present invention, when the isolated nucleic acid is RNA or derivatives thereof, base “t” should be replaced with “u” in the nucleotide sequences. As used herein, the term “complementary” refers to Watson Crick or Hoogsteen base pairing between nucleotides units of a nucleic acid molecule, and the term “binding” means the physical or chemical interaction between two nucleic acids or compounds or associated nucleic acids or compounds or combinations thereof.

Complementary nucleic acid sequences hybridize under appropriate conditions to form stable duplexes containing few or no mismatches. Furthermore, the sense strand and antisense strand of the isolated nucleotide of the present invention, can form double stranded nucleotide or hairpin loop structure by the hybridization. In a preferred embodiment, such duplexes contain no more than 1 mismatch for every 10 matches. In an especially preferred embodiment, where the strands of the duplex are fully complementary, such duplexes contain no mismatches. The nucleic acid molecule is less than 6319 nucleotides (for SEQ ID NO: 1), 5318 nucleotides (for SEQ ID NO: 3), 3851 nucleotides (for SEQ ID NO: 129), 3819 nucleotides (for SEQ ID NO: 131), 3851 nucleotides (for SEQ ID NO: 133) or 3819 nucleotides (for SEQ ID NO: 135) in length. For example, the nucleic acid molecule is 500, 200, or 75 nucleotides or less in length. Also included in the invention is a vector containing one or more of the nucleic acids described herein, and a cell containing the vectors. The isolated nucleic acids of the present invention are useful for siRNA against C2093, B5860Ns, or C6055s or DNA encoding the siRNA. When the nucleic acids are used for siRNA or coding DNA thereof, the sense strand is preferably longer than about 19 nucleotides, and more preferably longer than about 21 nucleotides.

The antisense oligonucleotide or siRNA of the present invention inhibits the expression of a polypeptide of the present invention and is thereby useful for suppressing the biological activity of a polypeptide of the invention. Also, expression-inhibitors, comprising the antisense oligonucleotide or siRNA of the invention, are useful in the point that they can inhibit the biological activity of the polypeptide of the invention.

Therefore, a composition comprising an antisense oligonucleotide or siRNA of the present invention is useful for treating a bladder cancer. Furthermore, in order to enhance the inhibition activity of the siRNA, nucleotide “u” can be added to 3′ end of the antisense strand of the target sequence. The number of “u”s to be added is at least about 2, generally about 2 to about 10, preferably about 2 to about 5. The added “u”s form single strand at the 3′ end of the antisense strand of the siRNA.

Also, expression-inhibitors, comprising the antisense oligonucleotide or siRNA of the invention, are useful in the point that they can inhibit the biological activity of the polypeptide of the invention. Therefore, a composition comprising the antisense oligonucleotide or siRNA of the present invention is useful in treating a cell proliferative disease such as bladder cancer.

Furthermore, the present invention provides ribozymes that inhibit the expression of the C2093, B5860Ns, or C6055s polypeptide of the present invention.

Generally, ribozymes are classified into large ribozymes and small ribozymes. A large ribozyme is known as an enzyme that cleaves the phosphate ester bond of nucleic acids. After the reaction with the large ribozyme, the reacted site consists of a 5′-phosphate and 3′-hydroxyl group. The large ribozyme is further classified into (1) group I intron RNA catalyzing transesterification at the 5′-splice site by guanosine; (2) group II intron RNA catalyzing self-splicing through a two step reaction via lariat structure; and (3) RNA component of the ribonuclease P that cleaves the tRNA precursor at the 5′ site through hydrolysis. On the other hand, small ribozymes have a smaller size (about 40 bp) compared to the large ribozymes and cleave RNAs to generate a 5′-hydroxyl group and a 2′-3′ cyclic phosphate. Hammerhead type ribozymes (Koizumi et al., (1988) FEBS Lett 228: 228-30) and hairpin type ribozymes (Buzayan, (1986) Nature 323: 349-53; Kikuchi and Sasaki, (1991) Nucleic Acids Res 19: 6751-5) are included in the small ribozymes. Methods for designing and constructing ribozymes are known in the art (see Koizumi et al., (1988) FEBS Lett 228: 228-30; Koizumi et al., (1989) Nucleic Acids Res 17: 7059-71; Kikuchi and Sasaki, (1991) Nucleic Acids Res 19: 6751-5). Thus, ribozymes inhibiting the expression of the polypeptides of the present invention can also be constructed based on their sequence information (SEQ ID NO:1, 3, 5, 129, 131, 133 or 135) and these conventional methods.

Ribozymes against the C2093, B5860Ns, or C6055s transcript inhibit the expression of the over-expressed C2093, B5860Ns, or C6055s protein and can suppress the biological activity of the protein. Therefore, the ribozymes are useful in treating or preventing bladder cancer.

Antibodies:

Alternatively, function of one or more gene products of the genes over-expressed in BLC can be inhibited by administering a compound that binds to or otherwise inhibits the function of the gene products. For example, the compound is an antibody which binds to the over-expressed gene product or gene products.

The present invention refers to the use of antibodies, particularly antibodies against a protein encoded by an up-regulated marker gene, or a fragment of such an antibody. As used herein, the term “antibody” refers to an immunoglobulin molecule having a specific structure, that interacts (i.e., binds) only with the antigen that was used for synthesizing the antibody (i.e., the gene product of an up-regulated marker) or with an antigen closely related thereto.

The present invention provides an antibody that binds to the polypeptide of the invention. Specifically, the present invention provides an antibody which binds to antigenic determinant comprising the amino acid sequence from 304 to 588 of SEQ ID NO:4, which is the B5860NV1 specific sequence. The antibody of the invention can be used in any form, such as monoclonal or polyclonal antibodies, and includes antiserum obtained by immunizing an animal such as a rabbit with the polypeptide of the invention, all classes of polyclonal and monoclonal antibodies, human antibodies and humanized antibodies produced by genetic recombination.

A polypeptide of the invention used as an antigen to obtain an antibody may be derived from any animal species, but preferably is derived from a mammal such as a human, mouse, or rat, more preferably from a human. A human-derived polypeptide may be obtained from the nucleotide or amino acid sequences disclosed herein.

According to the present invention, the polypeptide to be used as an immunization antigen may be a complete protein or a partial peptide of the protein. A partial peptide may comprise, for example, the partial amino acid sequence selected from the B5860NV1 specific sequence (positions from 304 to 588 of SEQ ID NO:4).

Herein, an antibody is defined as a protein that reacts with either the full length or a fragment of a polypeptide of the present invention.

A gene encoding a polypeptide of the invention or its fragment may be inserted into a known expression vector, which is then used to transform a host cell as described herein. The desired polypeptide or its fragment may be recovered from the outside or inside of host cells by any standard method, and may subsequently be used as an antigen. Alternatively, whole cells expressing the polypeptide or their lysates or a chemically synthesized polypeptide may be used as the antigen.

Any mammalian animal may be immunized with the antigen, but preferably the compatibility with parental cells used for cell fusion is taken into account. In general, animals of Rodentia, Lagomorpha or Primates are used. Animals of Rodentia include, for example, mouse, rat and hamster. Animals of Lagomorpha include, for example, rabbit. Animals of Primates include, for example, a monkey of Catarrhini (old world monkey) such as Macaca fascicularis, rhesus monkey, sacred baboon and chimpanzees.

Methods for immunizing animals with antigens are known in the art. Intraperitoneal injection or subcutaneous injection of antigens is a standard method for immunization of mammals. More specifically, antigens may be diluted and suspended in an appropriate amount of phosphate buffered saline (PBS), physiological saline, etc. If desired, the antigen suspension may be mixed with an appropriate amount of a standard adjuvant, such as Freund's complete adjuvant, made into emulsion and then administered to mammalian animals. Preferably, it is followed by several administrations of antigen mixed with an appropriately amount of Freund's incomplete adjuvant every 4 to 21 days. An appropriate carrier may also be used for immunization. After immunization as above, serum is examined by a standard method for an increase in the amount of desired antibodies.

Polyclonal antibodies against the polypeptides of the present invention may be prepared by collecting blood from the immunized mammal examined for the increase of desired antibodies in the serum, and by separating serum from the blood by any conventional method. Polyclonal antibodies include serum containing the polyclonal antibodies, as well as the fraction containing the polyclonal antibodies may be isolated from the serum. Immunoglobulin G or M can be prepared from a fraction which recognizes only the polypeptide of the present invention using, for example, an affinity column coupled with the polypeptide of the present invention, and further purifying this fraction using protein A or protein G column.

To prepare monoclonal antibodies, immune cells are collected from the mammal immunized with the antigen and checked for the increased level of desired antibodies in the serum as described above, and are subjected to cell fusion. The immune cells used for cell fusion are preferably obtained from spleen. Other preferred parental cells to be fused with the above immunocyte include, for example, myeloma cells of mammalians, and more preferably myeloma cells having an acquired property for the selection of fused cells by drugs.

The above immunocyte and myeloma cells can be fused according to known methods, for example, the method of Milstein et al. (Galfre and Milstein, (1981) Methods Enzymol 73: 3-46).

Resulting hybridomas obtained by the cell fusion may be selected by cultivating them in a standard selection medium, such as HAT medium (hypoxanthine, aminopterin and thymidine containing medium). The cell culture is typically continued in the HAT medium for several days to several weeks, the time being sufficient to allow all the other cells, with the exception of the desired hybridoma (non-fused cells), to die. Then, the standard limiting dilution is performed to screen and clone a hybridoma cell producing the desired antibody.

In addition to the above method, in which a non-human animal is immunized with an antigen for preparing hybridoma, human lymphocytes such as those infected by EB virus may be immunized with a polypeptide, polypeptide expressing cells or their lysates in vitro. Then, the immunized lymphocytes are fused with human-derived myeloma cells that are capable of indefinitely dividing, such as U266, to yield a hybridoma producing a desired human antibody that is able to bind to the polypeptide can be obtained (Unexamined Published Japanese Patent Application No. (JP-A) Sho 63-17688).

The obtained hybridomas are subsequently transplanted into the abdominal cavity of a mouse and the ascites are extracted. The obtained monoclonal antibodies can be purified by, for example, ammonium sulfate precipitation, a protein A or protein G column, DEAE ion exchange chromatography or an affinity column to which the polypeptide of the present invention is coupled. The antibody of the present invention can be used not only for purification and detection of the polypeptide of the present invention, but also as a candidate for agonists and antagonists of the polypeptide of the present invention. In addition, this antibody can be applied to the antibody treatment for diseases related to the polypeptide of the present invention. When the obtained antibody is to be administered to the human body (antibody treatment), a human antibody or a humanized antibody is preferable for reducing immunogenicity.

For example, transgenic animals having a repertory of human antibody genes may be immunized with an antigen selected from a polypeptide, polypeptide expressing cells or their lysates. Antibody producing cells are then collected from the animals and fused with myeloma cells to obtain hybridoma, from which human antibodies against the polypeptide can be prepared (see WO92-03918, WO94-02602, WO94-25585, WO96-33735 and WO96-34096).

Alternatively, an immune cell, such as an immunized lymphocyte, producing antibodies may be immortalized by an oncogene and used for preparing monoclonal antibodies.

Monoclonal antibodies thus obtained can be also recombinantly prepared using genetic engineering techniques (see, for example, Borrebaeck and Larrick, (1990) Therapeutic Monoclonal Antibodies, published in the United Kingdom by MacMillan Publishers LTD). For example, a DNA encoding an antibody may be cloned from an immune cell, such as a hybridoma or an immunized lymphocyte producing the antibody, inserted into an appropriate vector, and introduced into host cells to prepare a recombinant antibody. The present invention also provides recombinant antibodies prepared as described above.

Furthermore, an antibody of the present invention may be a fragment of an antibody or modified antibody, so long as it binds to one or more of the polypeptides of the invention. For instance, the antibody fragment may be Fab, F(ab′)2, Fv or single chain Fv (scFv), in which Fv fragments from H and L chains are ligated by an appropriate linker (Huston et al., (1988) Proc Natl Acad Sci USA 85: 5879-83). More specifically, an antibody fragment may be generated by treating an antibody with an enzyme, such as papain or pepsin. Alternatively, a gene encoding the antibody fragment may be constructed, inserted into an expression vector and expressed in an appropriate host cell (see, for example, Co et al., (1994) J Immunol 152: 2968-76; Better and Horwitz, (1989) Methods Enzymol 178: 476-96; Pluckthun and Skerra, (1989) Methods Enzymol 178: 497-515; Lamoyi, (1986) Methods Enzymol 121: 652-63; Rousseaux et al., (1986) Methods Enzymol 121: 663-9; Bird and Walker, (1991) Trends Biotechnol 9: 132-7).

An antibody may be modified by conjugation with a variety of molecules, such as, for example, polyethylene glycol (PEG). The present invention provides for such modified antibodies. The modified antibody can be obtained by chemically modifying an antibody. These modification methods are conventional in the field.

Alternatively, an antibody of the present invention may be obtained as a chimeric antibody, between a variable region derived from a nonhuman antibody and the constant region derived from human antibody, or as a humanized antibody, comprising the complementarity determining region (CDR) derived from a nonhuman antibody, the frame work region (FR) and the constant region derived from a human antibody. Such antibodies can be prepared according to known technology. Humanization can be performed by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody (see e.g., Verhoeyen et al., (1988) Science 239:1534-6). Accordingly, such humanized antibodies are chimeric antibodies, wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.

Fully human antibodies comprising human variable regions in addition to human framework and constant regions can also be used. Such antibodies can be produced using various techniques known in the art. For example, in vitro methods involve use of recombinant libraries of human antibody fragments displayed on bacteriophage (e.g., Hoogenboom & Winter, (1992) J. Mol. Biol. 227:381-8, Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. This approach is described, e.g., in U.S. Pat. Nos. 6,150,584, 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016.

Antibodies obtained as above may be purified to homogeneity. For example, the separation and purification of the antibody can be performed according to separation and purification methods used for general proteins. For example, the antibody may be separated and isolated by the appropriately selected and combined use of column chromatographies, such as affinity chromatography, filter, ultrafiltration, salting-out, dialysis, SDS polyacrylamide gel electrophoresis and isoelectric focusing (Antibodies: A Laboratory Manual. Ed Harlow and David Lane, (1988) Cold Spring Harbor Laboratory), but are not limited thereto. A protein A column and protein G column can be used as the affinity column. Exemplary protein A columns to be used include, for example, Hyper D, POROS and Sepharose F. F. (Pharmacia).

Exemplary chromatography, with the exception of affinity includes, for example, ion-exchange chromatography, hydrophobic chromatography, gel filtration, reverse-phase chromatography, adsorption chromatography and the like (Strategies for Protein Purification and Characterization: A Laboratory Course Manual. Ed Daniel R. Marshak et al., (1996) Cold Spring Harbor Laboratory Press). The chromatographic procedures can be carried out by liquid-phase chromatography, such as HPLC and FPLC.

For example, measurement of absorbance, enzyme-linked immunosorbent assay (ELISA), enzyme immunoassay (EIA), radioimmunoassay (RIA) and/or immunofluorescence may be used to measure the antigen binding activity of the antibody of the invention. In ELISA, the antibody of the present invention is immobilized on a plate, a polypeptide of the invention is applied to the plate, and then a sample containing a desired antibody, such as culture supernatant of antibody producing cells or purified antibodies, is applied. Then, a secondary antibody that recognizes the primary antibody and is labeled with an enzyme, such as alkaline phosphatase, is applied, and the plate is incubated. Next, after washing, an enzyme substrate, such as p-nitrophenyl phosphate, is added to the plate, and the absorbance is measured to evaluate the antigen binding activity of the sample. A fragment of the polypeptide, such as a C-terminal or N-terminal fragment, may be used as the antigen to evaluate the binding activity of the antibody. BIAcore (Pharmacia) may be used to evaluate the activity of the antibody according to the present invention.

The above methods allow for the detection or measurement of a polypeptide of the invention, by exposing the antibody of the invention to a sample assumed to contain the polypeptide of the invention, and detecting or measuring the immune complex formed by the antibody and the polypeptide.

Because the method of detection or measurement of the polypeptide according to the invention can specifically detect or measure a polypeptide, the method may be useful in a variety of experiments in which the polypeptide is used.

Cancer therapies directed at specific molecular alterations that occur in cancer cells have been validated through clinical development and regulatory approval of anti-cancer drugs such as trastuzumab (Herceptin) for the treatment of advanced breast cancer, imatinib methylate (Gleevec) for chronic myeloid leukemia, gefitinib (Iressa) for non-small cell lung cancer (NSCLC), and rituximab (anti-CD20 mAb) for B-cell lymphoma and mantle cell lymphoma (Ciardiello F and Tortora G. (2001) Clin Cancer Res.; 7(10):2958-70. Review.; Slamon D J, et al., (2001) N Engl J. Med.; 344(11):783-92.; Rehwald U, et al., (2003) Blood.; 101(2):420-4.; Fang G, et al., (2000). Blood, 96, 2246-53). These drugs are clinically effective and better tolerated than traditional anti-cancer agents because they target only transformed cells. Hence, such drugs not only improve survival and quality of life for cancer patients, but also validate the concept of molecularly targeted cancer therapy. Furthermore, targeted drugs can enhance the efficacy of standard chemotherapy when used in combination with it (Gianni L. (2002). Oncology, 63 Suppl 1, 47-56.; Klejman A, et al., (2002). Oncogene, 21, 5868-76). Therefore, future cancer treatments will probably involve combining conventional drugs with target-specific agents aimed at different characteristics of tumor cells such as angiogenesis and invasiveness.

These modulatory methods can be performed ex vivo or in vitro (e.g., by culturing the cell with the agent) or, alternatively, in vivo (e.g., by administering the agent to a subject). The methods involve administering a protein, or combination of proteins, or a nucleic acid molecule, or combination of nucleic acid molecules, as therapy to counteract aberrant expression of the differentially expressed genes or aberrant activity of their gene products.

Diseases and disorders that are characterized by increased (relative to a subject not suffering from the disease or disorder) expression levels or biological activities of genes and gene products, respectively, may be treated with therapeutics that antagonize (i.e., reduce or inhibit) activity of the over-expressed gene or genes. Therapeutics that antagonize activity can be administered therapeutically or prophylactically.

Accordingly, therapeutics that may be utilized in the context of the present invention include, e.g., (i) a polypeptide of the over-expressed or under-expressed gene or genes, or analogs, derivatives, fragments or homologs thereof; (ii) antibodies to the over-expressed gene or gene products; (iii) nucleic acids encoding the over-expressed or under-expressed gene or genes; (iv) antisense nucleic acids or nucleic acids that are “dysfunctional” (i.e., due to a heterologous insertion within the nucleic acids of one or more over-expressed gene or genes); (v) small interfering RNA (siRNA); or (vi) modulators (i.e., inhibitors, agonists and antagonists that alter the interaction between an over-expressed or under-expressed polypeptide and its binding partner). The dysfunctional antisense molecules are utilized to “knockout” endogenous function of a polypeptide by homologous recombination (see, e.g., Capecchi, (1989) Science 244: 1288-92).

Diseases and disorders that are characterized by decreased (relative to a subject not suffering from the disease or disorder) biological activity may be treated with therapeutics that increase (i.e., are agonists to) activity. Therapeutics that up-regulate activity may be administered in a therapeutic or prophylactic mariner. Therapeutics that may be utilized include, but are not limited to, a polypeptide (or analogs, derivatives, fragments or homologs thereof) or an agonist that increases bioavailability.

Increased or decreased levels can be readily detected by quantifying peptide and/or RNA, by obtaining a patient tissue sample (e.g., from biopsy tissue) and assaying it in vitro for RNA or peptide levels, structure and/or activity of the expressed peptides (or mRNAs of a gene whose expression is altered). Methods that are well-known within the art include, but are not limited to, immunoassays (e.g., by Western blot analysis, immunoprecipitation followed by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis, immunocytochemistry, etc.) and/or hybridization assays to detect expression of mRNAs (e.g., Northern assays, dot blots, in situ hybridization, etc.).

Prophylactic administration occurs prior to the manifestation of overt clinical symptoms of disease, such that a disease or disorder is prevented or, alternatively, delayed in its progression. Therapeutic methods of the present invention may include the step of contacting a cell with an agent that modulates one or more of the activities of the gene products of the differentially expressed genes. Examples of agents that modulate protein activity include, but are not limited to, nucleic acids, proteins, naturally-occurring cognate ligands of such proteins, peptides, peptidomimetics, and other small molecule. For example, a suitable agent may stimulate one or more protein activities of one or more differentially under-expressed genes.

Vaccinating Against Bladder Cancer:

The present invention also relates to a method of treating or preventing bladder cancer in a subject comprising the step of administering to said subject a vaccine comprising a polypeptide encoded by a nucleic acid selected from the group consisting of the BLC-associated genes listed in Table 4 (i.e., up-regulated genes), an immunologically active fragment of said polypeptide, or a polynucleotide encoding such a polypeptide or fragment thereof. Administration of the polypeptide induces an anti-tumor immunity in a subject. To induce anti-tumor immunity, a polypeptide encoded by a nucleic acid selected from the group consisting of the BLC-associated genes listed in Table 4, an immunologically active fragment of said polypeptide, or a polynucleotide encoding such a polypeptide or fragment thereof is administered to subject in need thereof. The polypeptide or the immunologically active fragment thereof are useful as vaccines against BLC. In some cases, the proteins or fragments thereof may be administered in a form bound to the T cell receptor (TCR) or presented by an antigen presenting cell (APC), such as macrophage, dendritic cell (DC), or B-cells. Due to the strong antigen presenting ability of DC, the use of DC is most preferable among the APCs.

In the present invention, a vaccine against BLC refers to a substance that has the ability to induce anti-tumor immunity upon inoculation into animals. According to the present invention, polypeptides encoded by the BLC-associated genes listed in Table 4, or fragments thereof, were suggested to be HLA-A24 or HLA-A*0201 restricted epitopes peptides that may induce potent and specific immune response against BLC cells expressing the BLC-associated genes listed in Table 4. Thus, the present invention also encompasses a method of inducing anti-tumor immunity using the polypeptides. In general, anti-tumor immunity includes immune responses such as follows:

induction of cytotoxic lymphocytes against tumors,

induction of antibodies that recognize tumors, and

induction of anti-tumor cytokine production.

Therefore, when a certain protein induces any one of these immune responses upon inoculation into an animal, the protein is determined to have anti-tumor immunity inducing effect. The induction of the anti-tumor immunity by a protein can be detected by observing in vivo or in vitro the response of the immune system in the host against the protein.

For example, a method for detecting the induction of cytotoxic T lymphocytes is well known. Specifically, a foreign substance that enters the living body is presented to T cells and B cells by the action of antigen presenting cells (APCs). T cells that respond to the antigen presented by the APCs in an antigen specific manner differentiate into cytotoxic T cells (or cytotoxic T lymphocytes; CTLs) due to stimulation by the antigen, and then proliferate (this is referred to as activation of T cells). Therefore, CTL induction by a certain peptide can be evaluated by presenting the peptide to a T cell via an APC, and detecting the induction of CTLs. Furthermore, APCs have the effect of activating CD4+ T cells, CD8+ T cells, macrophages, eosinophils, and NK cells. Since CD4+ T cells and CD8+ T cells are also important in anti-tumor immunity, the anti-tumor immunity-inducing action of the peptide can be evaluated using the activation effect of these cells as indicators.

A method for evaluating the inducing action of CTLs using dendritic cells (DCs) as the APC is well known in the art. DCs are a representative APCs having the strongest CTL-inducing action among APCs. In this method, the test polypeptide is initially contacted with DCs, and then the DCs are contacted with T cells. Detection of T cells having cytotoxic effects against the cells of interest after the contact with DC shows that the test polypeptide has an activity of inducing the cytotoxic T cells. Activity of CTLs against tumors can be detected, for example, using the lysis of 51Cr-labeled tumor cells as the indicator. Alternatively, the method of evaluating the degree of tumor cell damage using 3H-thymidine uptake activity or LDH (lactose dehydrogenase)-release as the indicator is also well known.

Apart from DCs, peripheral blood mononuclear cells (PBMCs) may also be used as the APC. The induction of CTLs has been reported to be enhanced by culturing PBMCs in the presence of GM-CSF and IL-4. Similarly, CTLs have been shown to be induced by culturing PBMCs in the presence of keyhole limpet hemocyanin (KLH) and IL-7.

Test polypeptides confirmed to possess CTL-inducing activity by these methods are deemed to be polypeptides having DC activation effect and subsequent CTL-inducing activity. Therefore, polypeptides that induce CTLs against tumor cells are useful as vaccines against tumors. Furthermore, APCs that have acquired the ability to induce CTLs against tumors through contact with the polypeptides are also useful as vaccines against tumors. Furthermore, CTLs that have acquired cytotoxicity due to presentation of the polypeptide antigens by APCs can be also used as vaccines against tumors. Such therapeutic methods for tumors, using anti-tumor immunity due to APCs and CTLs, are referred to as cellular immunotherapy.

Generally, when using a polypeptide for cellular immunotherapy, efficiency of the CTL-induction is known to be increased by combining a plurality of polypeptides having different structures and contacting them with DCs. Therefore, when stimulating DCs with protein fragments, it is advantageous to use a mixture of multiple types of fragments.

Alternatively, the induction of anti-tumor immunity by a polypeptide can be confirmed by observing the induction of antibody production against tumors. For example, when antibodies against a polypeptide are induced in a laboratory animal immunized with the polypeptide, and when growth of tumor cells is suppressed by those antibodies, the polypeptide is deemed to have the ability to induce anti-tumor immunity.

Anti-tumor immunity is induced by administering the vaccine of this invention, and the induction of anti-tumor immunity enables treatment and prevention of BLC. Therapy against cancer or prevention of the onset of cancer includes any of the following steps, such as inhibition of the growth of cancerous cells, involution of cancer, and suppression of the occurrence of cancer. A decrease in mortality and morbidity of individuals having cancer, decrease in the levels of tumor markers in the blood, alleviation of detectable symptoms accompanying cancer, and such are also included in the therapy or prevention of cancer. Such therapeutic and preventive effects are preferably statistically significant. For example, in observation, at a significance level of 5% or less, wherein the therapeutic or preventive effect of a vaccine against cell proliferative diseases is compared to a control without vaccine administration. For example, Student's t-test, the Mann-Whitney U-test, or ANOVA may be used for statistical analysis.

The above-mentioned proteins having immunological activity or a vector encoding such a protein may be combined with an adjuvant. An adjuvant refers to a compound that enhances the immune response against the protein when administered together (or successively) with the protein having immunological activity. Exemplary adjuvants include, but are not limited to, cholera toxin, salmonella toxin, alum, and such, but are not limited thereto. Furthermore, the vaccine of this invention may be combined appropriately with a pharmaceutically acceptable carrier. Examples of such carriers include, but are not limited to, sterilized water, physiological saline, phosphate buffer, culture fluid, and such. Furthermore, the vaccine may contain as necessary, stabilizers, suspensions, preservatives, surfactants, and such. The vaccine can be administered systemically or locally. Vaccine administration can be performed by single administration, or boosted by multiple administrations.

When using an APC or CTL as the vaccine of this invention, tumors can be treated or prevented, for example, by the ex vivo method. More specifically, PBMCs of the subject receiving treatment or prevention are collected, the cells are contacted with the polypeptide ex vivo, and following the induction of APCs or CTLs, the cells may be administered to the subject. APCs can be also induced by introducing a vector encoding the polypeptide into PBMCs ex vivo. APCs or CTLs induced in vitro can be cloned prior to administration. By cloning and growing cells having high activity of damaging target cells, cellular immunotherapy can be performed more effectively. Furthermore, APCs and CTLs isolated in this manner may be used for cellular immunotherapy not only against individuals from whom the cells are derived, but also against similar types of tumors from other individuals.

Furthermore, a pharmaceutical composition for treating or preventing a cell proliferative disease, such as cancer, comprising a pharmaceutically effective amount of a polypeptide of the present invention is provided. The pharmaceutical composition may be used for raising anti-tumor immunity.

The normal expression of C2093, B5860Ns or C6055s is restricted to testis. Therefore, suppression of this gene may not adversely affect other organs. Thus, the C2093, B5860Ns or C6055s polypeptides are preferable for treating cell proliferative disease, especially bladder cancers. Furthermore, since peptide fragments of proteins specifically expressed in cancerous cells were revealed to induce immune response against the cancer, peptide fragments of C2093, B5860Ns or C6055s can also be used in a pharmaceutical composition for treating or preventing cell proliferative diseases such as bladder cancers. In the present invention, the polypeptide or fragment thereof is administered at a dosage sufficient to induce anti-tumor immunity, which is in the range of 0.1 mg to 10 mg, preferably 0.3 mg to 5 mg, more preferably 0.8 mg to 1.5 mg. The administrations are repeated. For example, 1 mg of the peptide or fragment thereof may be administered 4 times in every two weeks for inducing the anti-tumor immunity.

In addition, polynucleotides encoding C2093, B5860Ns or C6055s, or fragments thereof may be used for raising anti tumor immunity. Such polynucleotides may be incorporated in an expression vector to express C2093, B5860Ns or C6055s, or fragments thereof in a subject to be treated. Thus, the present invention encompasses method for inducing anti tumor immunity wherein the polynucleotides encoding C2093, B5860Ns or C6055s, or fragments thereof are administered to a subject suffering or being at risk of developing cell proliferative diseases such as bladder cancer.

Pharmaceutical Compositions for Inhibiting BLC or Malignant BLC:

The present invention provides compositions for treating or preventing bladder cancer comprising any of the compounds selected by the screening methods of the present invention.

When administrating a compound isolated by the screening methods of the present invention as a pharmaceutical for humans or other mammals, including, but not limited to, mice, rats, guinea-pigs, rabbits, cats, dogs, sheep, pigs, cattle, monkeys, baboons, chimpanzees, for treating a cell proliferative disease (e.g., bladder cancer) the isolated compound can be directly administered or can be formulated into a dosage form using known pharmaceutical preparation methods. For example, according to the need, the drugs can be taken orally, as sugar-coated tablets, capsules, elixirs and microcapsules; or non-orally, in the form of injections of sterile solutions or suspensions with water or any other pharmaceutically acceptable liquid. For example, the compounds can be mixed with pharmacologically acceptable carriers or medium, specifically, sterilized water, physiological saline, plant-oil, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders and such, in a unit dose form required for generally accepted drug implementation. The amount of active ingredients in these preparations makes a suitable dosage within the indicated range acquirable.

Examples of additives that can be mixed to tablets and capsules include, but are not limited to, binders, such as gelatin, corn starch, tragacanth gum and arabic gum; excipients, such as crystalline cellulose; swelling agents, such as corn starch, gelatin and alginic acid; lubricants, such as magnesium stearate; sweeteners, such as sucrose, lactose or saccharin; and flavoring agents, such as peppermint, Gaultheria adenothrix oil and cherry. When the unit dosage form is a capsule, a liquid carrier, such as oil, can also be further included in the above ingredients. Sterile composites for injections can be formulated following normal drug implementations using vehicles such as distilled water used for injections.

Physiological saline, glucose, and other isotonic liquids including adjuvants, such as D-sorbitol, D-mannose, D-mannitol and sodium chloride, can be used as aqueous solutions for injections. These can be used in conjunction with suitable solubilizers, such as alcohol, specifically ethanol, polyalcohols such as propylene glycol and polyethylene glycol, non-ionic surfactants, such as Polysorbate 80™ and HCO-50. Sesame oil or soy-bean oil are examples of oleaginous liquids that may be used in conjunction with benzyl benzoate or benzyl alcohol as a solubilizers and may be formulated with a buffer, such as phosphate buffer and sodium acetate buffer; a pain-killer, such as procaine hydrochloride; a stabilizer, such as benzyl alcohol, phenol; and an anti-oxidant. The prepared injection may be filled into a suitable ampoule.

Methods well known to one skilled in the art may be used to administer the inventive pharmaceutical compound to patients, for example as intraarterial, intravenous, percutaneous injections and also as intranasal, intramuscular or oral administrations. The dosage and method of administration vary according to the body-weight and age of a patient and the administration method; however, one skilled in the art can routinely select them. If said compound is encodable by a DNA, the DNA can be inserted into a vector for gene therapy and the vector administered to perform the therapy. The dosage and method of administration vary according to the body-weight, age, and symptoms of a patient; however, the selection and optimization of these parameters is within the purview of one skilled in the art.

In the context of the present invention, suitable pharmaceutical formulations include those suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), vaginal or parenteral (including intramuscular, sub-cutaneous and intravenous) administration, or for administration by inhalation or insufflation. Preferably, administration is intravenous. The formulations are optionally packaged in discrete dosage units.

Pharmaceutical formulations suitable for oral administration include capsules, cachets or tablets, each containing a predetermined amount of active ingredient. Suitable formulations also include powders, granules, solutions, suspensions and emulsions. The active ingredient is optionally administered as a bolus electuary or paste. Tablets and capsules for oral administration may contain conventional excipients, such as binding agents, fillers, lubricants, disintegrant and/or wetting agents. A tablet may be made by compression or molding, optionally with one or more formulational ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredients in a free-flowing form, such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, lubricating, surface active and/or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may be coated according to methods well known in the art. Oral fluid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives, such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), and/or preservatives. The tablets may optionally be formulated so as to provide slow or controlled release of the active ingredient therein. A package of tablets may contain one tablet to be taken on each of the month.

Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions, optionally contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; as well as aqueous and non-aqueous sterile suspensions including suspending agents and/or thickening agents. The formulations may be presented in unit dose or multi-dose containers, for example as sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition, requiring only the addition of the sterile liquid carrier, for example, saline, water-for-injection, immediately prior to use. Alternatively, the formulations may be presented for continuous infusion. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.

Formulations suitable for rectal administration include suppositories with standard carriers such as cocoa butter or polyethylene glycol. Formulations suitable for topical administration in the mouth, for example, buccally or sublingually, include lozenges, containing the active ingredient in a flavored base such as sucrose and acacia or tragacanth, and pastilles, comprising the active ingredient in a base such as gelatin and glycerin or sucrose and acacia. For intra-nasal administration, the compounds of the invention may be used as a liquid spray, a dispersible powder, or in the form of drops. Drops may be formulated with an aqueous or non-aqueous base also comprising one or more dispersing agents, solubilizing agents and/or suspending agents.

For administration by inhalation the compounds can be conveniently delivered from an insufflator, nebulizer, pressurized packs or other convenient means of delivering an aerosol spray. Pressurized packs may comprise a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount.

Alternatively, for administration by inhalation or insufflation, the compounds may take the form of a dry powder composition, for example a powder mix of the compound and a suitable powder base, such as lactose or starch. The powder composition may be presented in unit dosage form, for example, as capsules, cartridges, gelatin or blister packs, from which the powder may be administered with the aid of an inhalator or insufflators.

Other formulations include implantable devices and adhesive patches which release a therapeutic agent.

When desired, the above described formulations, adapted to give sustained release of the active ingredient, may be employed. The pharmaceutical compositions may also contain other active ingredients, such as antimicrobial agents, immunosuppressants and/or preservatives.

It should be understood that in addition to the ingredients particularly mentioned above, the formulations of this invention may include other agents conventional in the art with regard to the type of formulation in question. For example, formulations suitable for oral administration may include flavoring agents.

For example, although there are some differences according to the symptoms, the dose of a compound that binds with the polypeptide of the present invention and regulates its activity is about 0.1 mg to about 100 mg per day, preferably about 1.0 mg to about 50 mg per day and more preferably about 1.0 mg to about 20 mg per day, when administered orally to a normal adult (weight 60 kg).

When administering parenterally, in the form of an injection to a normal adult (weight 60 kg), although there are some differences according to the patient, target organ, symptoms and method of administration, it is convenient to intravenously inject a dose of about 0.01 mg to about 30 mg per day, preferably about 0.1 to about 20 mg per day and more preferably about 0.1 to about 10 mg per day. Also, in the case of other animals too, it is possible to administer an amount converted to 60 kg of body-weight.

Preferred unit dosage formulations contain an effective dose, as recited below, or an appropriate fraction thereof, of the active ingredient.

For each of the aforementioned conditions, the compositions, e.g., polypeptides and organic compounds, can be administered orally or via injection at a dose ranging from about 0.1 to about 250 mg/kg per day. The dose range for adult humans is generally from about 5 mg to about 17.5 g/day, preferably about 5 mg to about 10 g/day, and most preferably about 100 mg to about 3 g/day. Tablets or other unit dosage forms of presentation provided in discrete units may conveniently contain an amount which is effective at such dosage or as a multiple of the same, for instance, units containing about 5 mg to about 500 mg, more typically from about 100 mg to about 500 mg.

The dose employed will depend upon a number of factors, including the age and sex of the subject, the precise disorder being treated, and its severity. Also the route of administration may vary depending upon the condition and its severity. In any event, appropriate and optimum dosages may be routinely calculated by those skilled in the art, taking into consideration the above-mentioned factors.

Furthermore, the present invention provides pharmaceutical compositions for treating or preventing bladder cancer comprising active ingredients that inhibits the expression of the C2093, B5860Ns or C6055s gene. Such active ingredients include antisense polynucleotides, siRNAs or ribozymes against the C2093, B5860Ns or C6055s gene or derivatives, such as expression vector, of the antisense polynucleotides, siRNAs or ribozymes.

The nucleotide sequence of siRNAs may also be designed in the same manner as mentioned above. Furthermore, oligonucleotides and oligonucleotides complementary to various portions of the C2093, B5860Ns or C6055s mRNA may also be selected in the same manner as mentioned above. Examples of C2093, B5860Ns or C6055s siRNA oligonucleotides which inhibit the expression in mammalian cells include the target sequence containing SEQ ID NO: 21, 25 and 144, respectively. The target sequence of SEQ ID NO: 25 is shared between the two B5860N transcripts, B5860NV1 and B5860NV2. Thus, siRNA comprising SEQ ID NO:25 as sense strand may inhibit the expression of both the B5860NV1 and B5860NV2 transcripts. The target sequence of SEQ ID NO: 144 is shared between the four C6055 transcripts, MGC34032, Genbank Accession NO. AK128063, C6055V1 and 6055V2. Thus, siRNA comprising SEQ ID NO:144 as sense strand may inhibit the expression of all the MGC34032, Genbank Accession NO. AK128063, C6055V1 and 6055V2 transcripts. In the present invention, when the nucleic sequence is RNA or derivatives thereof, base “t” should be replaced with “u” in the nucleotide sequences.

The siRNA is directly introduced into the cells in a form that is capable of binding to the mRNA transcripts. Alternatively, the DNA encoding the siRNA is in a vector in the same manner as in the use of the siRNA against the C2093, B5860N or C6055. Furthermore, a loop sequence consisting of an arbitrary nucleotide sequence can be located between the sense and antisense sequence in order to form the hairpin loop structure. Thus, the present invention also provides siRNA having the general formula 5′-[A]-[B]-[A′]-3′. As mentioned above, in this formula, wherein

[A] is a ribonucleotide sequence corresponding to a sequence that specifically hybridizes to an mRNA or a cDNA of C2093, B5860N or C6055,

[B] is a ribonucleotide sequence consisting of about 3 to about 23 nucleotides, and

[A′] is a ribonucleotide sequence consisting of the complementary sequence of [A].

In the present invention, the siRNA, nucleotide “u” can be added to the 3′ end of [A′], in order to enhance the inhibiting activity of the siRNA. The number of “u”s to be added is at least about 2, generally about 2 to about 10, preferably about 2 to about 5. Furthermore, loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque, J.-M., et. al., (2002) Nature 418: 435-438). For example, preferable siRNAs having hairpin structure of the present invention are shown below. In the following structure, the loop sequence can be selected from the group consisting of CCC, UUCG, CCACC, CCACACC, and UUCAAGAGA. Preferable loop sequence is UUCAAGAGA (“ttcaagaga” in DNA) Exemplary hairpin siRNA suitable for use in the context of the present invention include:

for C2093-siRNA
(for target sequence of
GTGAAGAAGTGCGACCGAA/SEQ ID NO: 21)
(SEQ ID NO: 24)
5′-gugaagaagugcgaccgaa-[B]-uucggucgcacuucuucac-3′,
for B5860N-siRNA
(for target sequence of
CCAAAGTTCCGTAGTCTAA/SEQ ID NO: 25)
(SEQ ID NO: 28)
5′-ccaaaguuccguagucuaa-[B]-uuagacuacggaacuuugg-3′
and
for C6055-siRNA
(for target sequence of
GTTGCAGTTACAGATGAAG/SEQ ID NO: 144)
(SEQ ID NO: 147)
5′-gttgcagttacagatgaag-[B]-cttcatctgtaactgcaac-3′

These active ingredients can be made into an external preparation, such as a liniment or a poultice, by mixing with a suitable base material which is inactive against the derivatives. Also, as needed, they can be formulated into, for example, tablets, powders, granules, capsules, liposome capsules, injections, solutions, nose-drops and freeze-drying agents by adding excipients, isotonic agents, solubilizers, stabilizers, preservatives, pain-killers and such. These can be prepared according to conventional methods.

The active ingredient is given to the patient by directly applying onto the ailing site or by injecting into a blood vessel so that it will reach the site of ailment. A mounting medium can also be used to increase durability and membrane-permeability. Examples of mounting medium includes liposome, poly-L-lysine, lipid, cholesterol, lipofectin or derivatives of these.

The dosage of such compositions of the present invention can be adjusted suitably according to the patient's condition and used in desired amounts. For example, a dose range of 0.1 to 100 mg/kg, preferably 0.1 to 50 mg/kg can be administered. Another embodiment of the present invention is a composition for treating or preventing bladder cancer comprising an antibody against a polypeptide encoded by the C2093, B5860Ns or C6055s gene or fragments of the antibody that bind to the polypeptide.

Although there are some differences according to the symptoms, the dose of an antibody or fragments thereof for treating or preventing bladder cancer is about 0.1 mg to about 100 mg per day, preferably about 1.0 mg to about 50 mg per day and more preferably about 1.0 mg to about 20 mg per day, when administered orally to a normal adult (weight 60 kg).

When administering parenterally, in the form of an injection to a normal adult (weight 60 kg), although there are some differences according to the condition of the patient, symptoms of the disease and method of administration, it is convenient to intravenously inject a dose of about 0.01 mg to about 30 mg per day, preferably about 0.1 to about 20 mg per day and more preferably about 0.1 to about 10 mg per day. Also in the case of other animals too, it is possible to administer an amount converted to 60 kg of body-weight.

Aspects of the present invention are described in the following examples, which are not intended to limit the scope of the invention described in the claims. The following examples illustrate the identification and characterization of genes differentially expressed in BLC cells. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. Any patents, patent applications and publications cited herein are incorporated by reference.

EXAMPLES

Materials and Methods

Patients, Cell Line, Tissue Samples and Neoadjuvant Chemotherapy.

Human-bladder cancer cell lines HT1197, UMUC3, J82, HT1376, SW780 and RT4 were obtained from ATCC. All cells were cultured in appropriate media; i.e. EMEM (Sigma, St. Louis, Mo.) with 0.1 mM essential amino acid (Roche), 1 mM sodium pyruvate (Roche), 0.01 mg/ml Insulin (Sigma) for HT1197, UMUC3, J82 and HT1376; Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, Calif.) for HBL100, COS7; McCoy's 5a (Sigma) for RT-4; L-15 for SW 780. Each medium was supplemented with 10% fetal bovine serum (Cansera) and 1% antibiotic/antimycotic solution (Sigma). SW 780 cells were maintained at 37° C. an atmosphere of humidified air without CO2. Other cell lines were maintained at 37° C. an atmosphere of humidified air with 5% CO2.

Tissue samples from surgically resected bladder cancers and corresponding clinical information were obtained after each patient had provided written informed consent. A total of 33 cancer samples (9 females, 24 males; median age 66.5 in a range of 53-77 years, except one case with unknown years (BC01025)) (Table 1) that had been confirmed histologically as transitional cell carcinoma of the bladder were selected for this study. Clinical stage was judged according to the UICC TNM classification; we enrolled only patients without node metastasis, T2aN0M0 to T3bN0M0, who were expected to undergo radical cystectomy without prior radiation therapy. Participants were required to have no serious abnormality in renal, hepatic, or hematological function, with ECOG performance status (PS) judged to be ≦2.

TABLE 1
Patients Examined
No.IDSexAgeStageGrade
1BC01001M62T3bG3
2BC01004M54T3bG3
3BC01007M75T2bG2 > G3
4BC01009M66T3bG2
5BC01010M77T2bG1
6BC01011M64T3bG2 > G3
7BC01012M72T2bG2 > G3
8BC01013F57T3bG2
9BC01014M64T3bG2
10BC01015M57T3bG3
11BC01016M70T3bG2
12BC01017M65T2bG2
13BC01018M71T3bG2
14BC01019M59T2bG2
15BC01020M72T3bG2
16BC01021F68T2bG2
17BC01022M73T3bG1 > G2
18BC01023F74T3bG3
19BC01024M66T3bG3
20BC01025MunknownT2bG2
21BC01026M58T3bG3
22BC01027M72T2bG2
23BC01028M69T3aG2
24BC01029F67T3aG3
25BC01031M74T3bG2
26BC01032F64T3bG3 >> G2
27BC01033F68T3bG2
28BC02003F53T3aG2
29BC02014M56T3bG2
30BC03001M53T3bG3
31BC04001F70T3bG3
32BC05001F73T3aG1 = G2
33BC05002M60T3bG2

Three to five pieces of cancer tissue were taken from each patient at the time of biopsy prior to neoadjuvant chemotherapy. These samples were immediately embedded in TissueTek OCT medium (Sakura, Tokyo, Japan), frozen, and stored at −80° C. The frozen tissues were sliced into 8-μm sections using a cryostat (Sakura, Tokyo, Japan) and then stained with hematoxylin and eosin for histological examination. Bladder-cancer cells were selectively enriched for our experiments using the EZ-cut system with a pulsed ultraviolet narrow beam-focus laser (SL Microtest GmbH, Germany) according to the manufacturer's protocols. All patients were examined by chest X-ray, computed tomography (CT) and magnetic resonance imaging (MRI) of the abdomen and pelvis, and confirmed to have neither lymph node nor distant metastases.

Extraction of RNA and T7-Based RNA Amplification.

Total RNAs were extracted from each population of microdissected cancer cells, as described previously (Kitahara O, et al., (2001) Cancer Res; 61:3544-9). To guarantee the quality of RNAs, total RNA extracted from the residual tissue of each case were electrophoresed on a denaturing agarose gel, and quality was confirmed by the presence of ribosomal RNA bands. Extraction of total RNA and T7-based RNA amplification were performed as described previously (Okabe H, et al., (2001) Cancer Res; 61:2129-37), except that we used RNeasy Micro Kits (QIAGEN, Valencia, Calif., USA). After two rounds of RNA amplification, we obtained 30-100 μg of amplified RNA (aRNA) for each sample. As a control, normal human bladder poly (A)+ RNA (BD Bioscience, Palo Alto, Calif.), was amplified in the same way. RNA amplified by this method accurately reflects the proportions in the original RNA source, as we had confirmed earlier by semi-quantitative RT-PCR experiments (Kitahara O, et al., (2001) Cancer Res; 61:3544-9), where data from the microarrays were consistent with results from RT-PCR regardless of whether total RNAs or aRNAs were used as templates.

cDNA Microarray.

To obtain cDNAs for spotting on the glass slides, we performed RT-PCR for each gene, as described previously (Kitahara O, et al., (2001) Cancer Res; 61:3544-9). The PCR products were spotted on type VII glass slides (GE Healthcare, Amersham Biosciences, Buckinghamshire UK) with a high-density Microarray Spotter Lucidea (GE Healthcare, Amersham Biosciences); 9,216 genes were spotted in duplicate on a single slide. Three different sets of slides (a total of 27,648 gene spots) were prepared, on each of which the same 52 housekeeping genes and two negative control genes were spotted as well. The cDNA probes were prepared from aRNA in the manner described previously (Okabe H, et al., (2001) Cancer Res; 61:2129-37). For hybridization experiments, 9.0 μg of amplified RNAs (aRNAs) from each cancerous tissue and from the control were reversely transcribed in the presence of Cy5-dCTP and Cy3-dCTP (GE Healthcare, Amersham Biosciences) respectively. Hybridization, washing and detection of signals were carried out as described previously (Okabe H, et al., (2001) Cancer Res; 61:2129-37).

Quantification of Signals.

The signal intensities of Cy3 and Cy5 were quantified from the 27,648 spots and analyzed the signals by substituting backgrounds, using ArrayVision software (Imaging Research, Inc., St. Catharines, Ontario, Canada). Subsequently, the fluorescence intensities of Cy5 (tumor) and Cy3 (control) for each target spot were adjusted so that the mean Cy5/Cy3 ratio of the 52 housekeeping genes became one. Because data derived from low signal intensities are less reliable, we determined a cutoff value on each slide as described previously (Ono K, et al., (2000) Cancer Res; 60:5007-11), and excluded genes from further analysis when both Cy3 and Cy5 dyes yielded signal intensities lower than the cutoff (Saito-Hisaminato A, et al., (2002) DNA Res; 9:35-45). For other genes, the previous method that calculated Cy5/Cy3 as a relative expression ratio using the raw data of each sample was modified, because if either Cy3 or Cy5 signal intensity was lower than the cutoff value the Cy5/Cy3 ratio might provide an extremely high or low reading and lead to selection of false-prediction genes. To reduce that bias, if either Cy3 or Cy5 signal intensity was less than the cutoff value, the Cy5/Cy3 ratios were calculated using half of each cut-off value plus the Cy5 and Cy3 signal intensities of each sample.

Identification of Up- or Down-Regulated Genes in Bladder Cancers.

Up- or down-regulated genes common to bladder cancers were identified and analyzed according to the following criteria. Initially, genes were selected whose relative expression ratio was able to calculate of more than 50% cases and whose expression were up- or down-regulated in more than 50% of cases. Moreover, if the relative expression ratio was able to calculate of 30 to 50% cases, the genes were also evaluated that 80% of cases were up- or down-regulated. The relative expression ratio of each gene (Cy5/Cy3 intensity ratio) was classified into one of four categories as follows: (1) up-regulated (expression ratio was more than 5.0); (2) down-regulated (expression ratio less than 0.2); (3) unchanged expression (expression ratio between 0.2 and 5.0); and (4) not expressed (or slight expression but under the cut-off level for detection). These categories were used to detect a set of genes whose changes in expression ratios were common among samples as well as specific to a certain subgroup. To detect candidate genes that were commonly up- or down-regulated in bladder cancer cell, the overall expression patterns of 27,648 genes were screened to select genes with expression ratios of more than 5.0 or less than 0.2. Among the total of 394 genes that appeared to up-regulated in tumor cells, attention was focused on the ones with in-house identification numbers C2093, B5860N and C6055 because their expression ratios were greater than 5.0 in more than 50% of the informative bladder cancer cases, and showed low expression in normal organs including heart, lung liver and kidney through the expression profiles of normal human tissues.

Semi-Quantitative RT-PCR

The 44 up-regulated genes were selected and examined their expression levels by applying the semi-quantitative RT-PCR experiments. A 3-1 μg aliquot of aRNA from each sample was reverse-transcribed for single-stranded cDNAs using random primer (Roche) and Superscript II (Invitrogen). Each cDNA mixture was diluted for subsequent PCR amplification with the same primer sets that were prepared for the target DNA- or GAPDH-specific reactions. The primer sequences using RT-PCR in FIG. 1a are listed in Table 2. The PCR primer sequences using RT-PCR in FIGS. 1b and 1c are as follows; 5′-TGCTGGTTCAGAACGAACTATG-3′ (SEQ ID NO.9) and 5′-TCCTCGTGGCTAATGAAAGC-3′ (SEQ ID NO.10) for C2093, 5′-GCTACAAGTAAAGAGGGGATGG-3′ (SEQ ID NO.11) and 5′-GGACAGAAAGGTAAGTCAGTGGG-3′ (SEQ ID NO.12) for the common sequence of B5860N V1 and V2. Expression of GAPDH served as an internal control. PCR reactions were optimized for the number of cycles to ensure product intensity within the linear phase of amplification (Table 2).

TABLE 2
Primer Sequence for RT-PCR in FIG. 1a
SEQ IDSEQ ID
LMMIDForward PrimerNoReverse PrimerNoPCR
B5860N5′-ATTGTGGGAATGCACAGG375′-GGACAGAAAGGTAAG1256d
TT-3′TCAGTGGG-3′25cy
B08115′-GATGTACATATGAGGATT385′-GTCAGTGCACATAAT3956d
TCCCG-3′TCCAATAGC-3′25cy
C20935′-TTCTAGCTCCTCAACCAA405′-CCGGGAAAGTAAACT4156d
ATCCT-3′GACTCAC-3′25cy
F60225′-TCTCTTGAGGGCTGCTTT 425′-TCATCCACTGAAATA4356d
GT-3′CCTGGCTT-3′25cy
F75625′-TGGCCATATCAGTTCCAA445′-CTTTGGCATAGCAGC4556d
CA-3′CTGAACT-3′25cy
F49765′-GGAGAATGAGCTGGATCA465′-ATGCTGCAATTCCCA4756d
GG-3′AATCTCT-3′25cy
F61935′-AACTCATTGTGTGGCTGT485′-CATCACAATCCTGGG4956d
GC-3′AATTCAG-3′25cy
F74095′-TCCTGAGGGCCATTTACT505′-TGCATCCAGTAGCTA5156d
CA-3′TTCAGCAA-3′25cy
C60555′-TCCAGTTGGTTACTCAGT525′-CTGTCATGTGCTCAT5356d
GTTTG-3′GTGAGTTT-3′25cy
D54915′-CGTCGACAATATAAACAG545′-CGAGCACAAGATAAT5556d
GGACT-3′TTTTCCC-3′25cy
C50885′-GCAAGTCAGTGCCTAGAT565′-AAAAATTGAGTGTGT5756d
GGATA-3′CTCGGTG-3′25cy
D77465′-TACAGAGAGGATGGGATT585′-CCTAGCAGTTGTTAG5956d
GTGTT-3′AGGCAGAA-3′25cy
A03035′-GGGCTTTTAATTTGTGAA605′-TGAAATAGTCTGGCC6156d
CTTCTG-3′ATTTGAC-3′25cy
C68655′-GTCCCAGACAACAGAAGT625′-AATTTCCTCAGAGCT6356d
TACCA-3′CACATACG-3′25cy
F04115′-TTTATATTGTGCCATGCA645′-ACCAGGATCACAGAG6556d
GTCC-3′AGCTTGA-3′25cy
A82955′-TCAGAGTGAGGACTCATT665′-CACAGGGCAGGTTTT6756d
TATCATTT-3′GATTTAT-3′25cy
F40255′-CCCCTTCAGTGAGCCTCA685′-TGAAATTGACCTGGT6956d
TA-3′AGAGCCTT-3′30cy
B2879N5′-TGTGTTTTCTTTTGGCAC705′-TTACTCCTGGCAAGC7156d
CAT-3′TGTGAG-3′30cy
A0576N5′-ATATCAGCATCACGGCAC725′-GTATGATGTAGCTGA7356d
AA-3′GGTCCGTG-3′30cy
F65075′-TGCTGGCTAACTAAAGAA745′-AAATGAGGCCATTCT7556d
GATGC-3′GTTGAGA-3′30cy
F16535′-TGAGATTCTGGAGAGTGA765′-TCAGATGTTGTAGCA7756d
ATGC-3′GGGACTTT-3′30cy
C22105′-CATTTCTTTATAGTTGCC785′-TTTTGGGTCAGCACT7956d
TCCCC-3′GACAAT-3′30cy
C77575′-GTCTTGGAGGAGCAGATT805′-CTACAATTTATTTCC8156d
CCA-3′GAGTCCCC-3′30cy
F59815′-CCTCAAGGCCATTGATGT825′-ATGGTAACCACATGA8356d
AAA-3′CCCACTG-3′25cy
B98385′-AGATAAATCATGACAAGG845′-GCCTTTTGCTTCTTC8556d
TCCCC-3′TGTCTTCT-3′28cy
F69105′-TTGGTGTAGCACCACACT865′-GCATGACTCAGGGAA8756d
GG-3′GGGTATT-3′30cy
D74435′-AATGGCATGATCTTGTGT885′-AGATCACTGTGGGTC8956d
GAAG-3′TTAAGCAA-3′25cy
C55095′-TCTACACCACAGAAAGCA905′-TACCTGAGGAAATTC9156d
AGTCA-3′CCGTTACT-3′25cy
A8407 5′-ATAGGGATAATGGCCTCC925′-CTCGCACCTAATAAT9356d
AATTC-3′CTGGTCTC-3′28cy
B6283 5′-TGTGTCTCATCTGTGAAC945′-TTCGTGTTACGGTAT9556d
TGCTT-3′ATCCTGCT-3′25cy
D94075′-CCCTAAAGAGTGAGTTTT965′-AAAGGTATTTTCCTG9756d
CCACA-3′CAGTAGCC-3′25cy
B24265′-GGGCCAGTATGTGTAACT985′-TCAGACATCTGCTGA9956d
GACAT-3′CTACAGGA-3′25cy
C18985′-CAACGAGAGCAAAACTCC1005′-ATAGGGTTTTGCAGT10156d
AATAC-3′AGGGAGAG-3′25cy
A7343N5′-CACATGGTGACCACAGTG1025′-AGAGGGTGAGGGCTT10356d
CAT-3′TCATCT-3′25cy
D81505′-CTTGCTATTGTCAGGTTT1045′-CACTGCATTTACTGC10556d
TGGTG-3′TTTTGGA-3′25cy
C77475′-AGGAGAGGGAGAAATCTT1065′-CCAGTTGTATGCCAA10756d
AGCAA-3′CATACTCA-3′27cy
F70165′-CAGGATTCCAAATGTCAG1085′-CCTGCCATTGTCTTT10956d
TGAG-3′CAGGTTT-3′25cy
A8317N5′-CCTATCACAGACGGAAAT1105′-TAGGGCAGTTTCCTG11156d
CCC-3′TGTTCCT-3′25cy
F62255′-TGCTCTGTACATGCCTCT1125′-GCACCCAGAAGGACT11356d
GC-3′TGCTATT-3′25cy
D63115′-CTTCAGAGTGGGTTGGAA1145′-TAGTGTGTAATGCGA11556d
AAAT-3′TCCTGTGA-3′30cy
C69025′-CACTGTGGCAAGATTGCT1165′-TACATCACAGCCTTG11756d
CT-3′TTCTTTCC-3′25cy
F63335′-AAGCGGTCCACAGTCCAA1185′-TCACATTGGAGGATA11956d
TA-3′GCTGGAA-3′30cy
F76365′-GAAGTTTCCTGAGGCTCC1205′-GCCCACAAGAGAAGG121 56d
AA-3′TAGAGGA-3′25cy
F23765′-TCCTCTGTCGGTAGCTGT1225′-ACCCTTCATGTTTCT123 56d
CA-3′AGGGCTG-3′25cy
GAPDH5′-CGACCACTTTGTCAAGCT75′-GGTTGAGCACAGGGT856d
CA-3′ACTTTATT-3′20cy

Northern-Blot Analysis

Northern blots were hybridized with [α32P]-dCTP-labeled amplification products of A0576N, C2093, C5509, B5860N, F1653, B9838 and C6055 prepared by RT-PCR, respectively (Table 3). Specific probes for C6055 were prepared by PCR using a primer set as follows; 5′-CCCCAGTTGAGAGTTTGCTC-3′ (SEQ ID NO: 137) and 5′-CTGTCATGTGCTCATGTGAGTTT-3′ (SEQ ID NO: 53) for the microarray probe of C6055, 5′-TGACATCGGGATTCAGACTAA-3′ (SEQ ID NO: 138) and 5′-AAAGATGCTGGTCCTTGTGC-3′ (SEQ ID NO: 139) for the common region among four transcripts of C6055. Total RNAs were extracted from all bladder cancer cell lines and frozen surgical specimens using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. After treatment with DNase I (Nippon Gene, Osaka, Japan), mRNA was isolated with Micro-FastTrack (Invitrogen) following the manufacturer's instructions. A 1-μg aliquot of each mRNA, along with polyA(+) RNAs isolated from normal adult human heart, lung, liver, kidney, brain, pancreas, testis and bladder (Clontech, Palo Alto, Calif.), were separated on 1% denaturing agarose gels and transferred to nylon membranes. Pre-hybridization, hybridization and washing were performed according to the supplier's recommendations. The blots were autoradiographed with intensifying screens at −80° C. for 14 days.

TABLE 3
Primer Sequence for production
of Northern probe by RT-PCR
SEQ
SequenceID NO.
C2093_F25′-TGCTGGTTCAGAACGAACTATG-3′9
C2093_R25′-TCCTCGTGGCTAATGAAAGC-3′10
B5860N_F2 5′-AGGCAGGCAACTTTCATTTG-3′13
B5860N_RT5′-GGACAGAAAGGTAAGTCAGTGGG-3′12
A0576N_FT5′-GTCCCTCATGCCATCACAGTAT-3′124
A0576N_RT5′-GTATGATGTAGCTGAGGTCCGTG-3′73
F1653_F15′-AGCAGAGGCTGAGCAAAGAG-3′125
F1653_R15′-CCCCAGTTTCTGGAATGCTA-3′126
C5509_F15′-AGCGGAGTTCATAAGCCAAA-3′127
C5509_R15′-TACCTGAGGAAATTCCCGTTACT-3′91
(RT)
B9838_F2-5′-TCAAGGGACAATGGTGTGAC-3′128
RT
B9838_RT5′-GCCTTTTGCTTCTTCTGTCTTCT-3′85
C6055_F15′-CCCCAGTTGAGAGTTTGCTC-3′137
C6055_R15′-CTGTCATGTGCTCATGTGAGTTT-3′53
C6055_F25′-TGACATCGGGATTCAGACTAA-3′138
C6055_R25′-AAAGATGCTGGTCCTTGTGC-3′139

S′RACE and 3′RACE

The sequence of 5′ end and 3′ end of B5860N and C6055 was determined by performing 5′ rapid amplification of cDNA ends (5′RACE) and 3′ rapid amplification of cDNA ends (3′RACE) using SMART™ RACE cDNA Amplification Kit (Clontech). The cDNA template was synthesized from bladder cancer cell line, SW780 cells, for amplification and the PCR was carried out using B5860N-specific reverse primer (5′-CATTTTCTGATCCCCACCTCCCTTTG-3′ (SEQ ID NO.14)), C6055-specific reverse primer (C6055_GSP1; 5′-GATCCAAATGCTAGGGATCCTGTGTG-3′ (SEQ ID NO: 140) and C6055_NGSP1; 5′-CCTGTGTGATATCGTATGGCTCGTCCA-3′ (SEQ ID NO: 141)) for 5′RACE and B5860N-specific forward primer (5′-AGAGGGGATGGGGAAGGTGTTGC-3′ (SEQ ID NO. 15)) for 3′RACE and the AP1 primer supplied in the kit.

Construction of Expression Vectors

The entire coding sequence of C2093, B5860Ns and C6055s cDNA was amplified by PCR using KOD-Plus DNA polymerase (Toyobo, Osaka, Japan) with primers as follows;

C2093-forward, 5′-ATAAGAATGCGGCCGCAATGGAATCTAATTTTAATCAAGAGG-3′ (SEQ ID NO. 16) (the underline indicates NotI site) and
C2093-reverse, 5′-ATAAGAATGCGGCCGCTTTGGCTGTTTTTGTTCGA-3′ (SEQ ID NO.17) (the underline indicates NotI site),
B5860NV1-forward, 5′-ATAAGAATGCGGCCGCTATGGAGAGTCAGGGTGTGC-3′ (SEQ ID NO. 18) (the underline indicates NotI site) and
B5860NV1-reverse, 5′-CCGCTCGAGTCTTAGACTACGGAACTTTGGT-3′ (SEQ ID NO. 19) (the underline indicates XhoI site),
B5860NV2-forward, 5′-GGAATTCATGGAGAGTCAGGGTGTG-3′ (SEQ ID NO. 20) (the underline indicates EcoRI site) and
B5860NV2-reverse, 5′-CCGCTCGAGTCTTAGACTACGGAACTTTGGT-3′ (SEQ ID NO. 19) (the underline indicates XhoI site),
C6055-forward, 5′-AGAATTCATGATCTTCCTACTGTGTATTATTGGC-3′ (SEQ ID NO: 142) (the underline indicates EcoRI site) and
C6055-reverse, 5′-TATCTCGAGCTGCTTCCTAGTTTGTGGATTTTC-3′; (SEQ ID NO: 143) (the underline indicates XhoI site). The PCR products were inserted into the EcoRI and XhoI, and NotI sites of pCAGGSnHA expression vectors, respectively. These constructs were confirmed by DNA sequencing.

Western Blotting Analysis

COS7 cells were transiently transfected with 1 μg of pCAGGS-C2093-HA, pCAGGS-B5860NV1-HA, pCAGGS-B5860NV2-HA, or pCAGGS-C6055-HA using FuGENE 6 transfection reagent (Roche) according to the manufacturer's instructions, respectively. Cell lysates were separated on 10% SDS-polyacrylamide gels (for pCAGGS-C2093-HA, pCAGGS-B5860NV1-HA, pCAGGS-B5860NV2-HA transfected cells) or 7.5% SDS-polyacrylamide gels (for pCAGGS-C6055-HA transfected cells) and transferred to nitrocellulose membranes, then incubated with a mouse anti-HA antibody (Roche) as primary antibody at 1:1000 dilution. After incubation with sheep anti-mouse IgG-HRP as secondary antibody (Amersham Biosciences), signals were visualized with an ECL kit (Amersham Biosciences).

Immunocytochemical Staining to Detect Exogenous C2093, B5860N and C6055 Proteins in Bladder cancer Cells

To examine the sub-cellular localization of exogenous C2093, B5860NV1 and B5860NV2, or C6055, COS7 cells were seeded at 1×105 cells per well for all three constructs. After 24 hours, we transiently transfected with 1 μg of pCAGGS-C2093-HA, pCAGGS-B5860NV1-HA, pCAGGS-B5860NV2-HA or pCAGGS-C6055-HA into COS7 cells using FuGENE 6 transfection reagent (Roche) according to the manufacturer's instructions, respectively. Then, cells were fixed with PBS containing 4% paraformaldehyde for 15 min, and rendered permeable with PBS containing 0.1% Triton X-100 for 2.5 min at 4° C. Subsequently the cells were covered with 3% BSA in PBS for 12 hours at 4° C. to block non-specific hybridization. Next, each construct-transfected COS7 cells were incubated with a mouse anti-HA antibody (Roche) at 1:1000 dilution. After washing with PBS, both transfected-cells were stained by an Alexa488-conjugated anti-mouse secondary antibody (Molecular Probe) at 1:3000 dilution. Nuclei were counter-stained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI). Fluorescent images were obtained under a TCS SP2 AOBS microscope (Leica, Tokyo, Japan).

Synchronization and Flow Cytometry Analysis

HeLa cells (1×106) are transfected with 8 μg of pCAGGS-C2093-HA, or pCAGGS-B5860NV1-HA, pCAGGS-B5860NV2-HA using FuGENE 6 (Roche) according to supplier's protocol. Cells are arrested in G1 phase 24 hours after transfection with aphidicolin (1 ng/ml) for further 16 hours. Cell cycle is released by washing three times with fresh medium and cells are collected at indicated time points. To arrest cells at mitotic phase, cells are incubated with Nocodazole (250 ng/ml) 16 hours before harvest.

For FACS analysis, 400 ml aliquot of synchronized adherent and detached cells were combined and fixed with 70% ethanol at 4° C. After washing with PBS (−) twice, cells were incubated for 30 min with 1 ml of PBS containing 1 mg of RNase I at 37° C. Cells were then stained in 1 ml of PBS containing 50 mg of propidium iodide (PI). The percentages of each fraction of cell cycle phases were determined from at least 10000 cells in a flow cytometer (FACScalibur; Becton Dickinson, San Diego, Calif.).

Construction of C2093, B5860N and C6055 Specific-siRNA Expression Vector Using psiU6X3.0

A vector-based RNAi system was established using psiU6BX siRNA expression vector according to the previous report (WO2004/076623). siRNA expression vector against C2093 (psiU6BX-C2093), B5860N (psiU6BX-B5860N), C6055 (psiU6BX-C6055) and control plasmids, psiU6BX-EGFP, -SCR were prepared by cloning of double-stranded oligonucleotides into the BbsI site in the psiU6BX vector. Nucleotide sequences of the double-stranded oligonucleotides are shown below.

C2093si#3 for the target sequence of
(SEQ ID NO: 21)
GTGAAGAAGTGCGACCGAA
Sense(SEQ ID NO: 22):
5′-CACCGTGAAGAAGTGCGACCGAATTCAAGAGATTCGGTCGCACTT
CTTCAC-3′
Antisense
(SEQ ID NO: 23)
5′-AAAAGTGAAGAAGTGCGACCGAATCTCTTGAATTCGGTCGCACTT
CTTCAC-3′
B5860Nsi#3 for the target sequence of
(SEQ ID NO: 25)
CCAAAGTTCCGTAGTCTAA
Sense (SEQ ID NO: 26):
5′-CACCCCAAAGTTCCGTAGTCTAATTCAAGAGATTAGACTACGGAA
CTTTGG-3′
Antisense (SEQ ID NO: 27):
5′-AAAACCAAAGTTCCGTAGTCTAATCTCTTGAATTAGACTACGGAA
CTTTGG-3′
C6055si-08 for the target sequence of
(SEQ ID NO: 144)
GTTGCAGTTACAGATGAAG
Sense (SEQ ID NO: 145 :
5′-CACCGTTGCAGTTACAGATGAAGTTCAAGAGACTTCATCTGTAAC
TGCAAC-3′
Antisense (SEQ ID NO: 146):
5′-AAAAGTTGCAGTTACAGATGAAGTCTCTTGAACTTCATCTGTAAC
TGCAAC-3′
siRNA control (SiEGFP) for the target sequence of
(SEQ ID NO: 29)
GAAGCAGCACGACTTCTTC
Sense (SEQ ID NO: 30):
5′-CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGC
TGCTTC-3′
Antisense (SEQ ID NO: 31):
5′-AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGC
TGCTTC-3′
siRNA control (SiSCR) for the target sequence of
(SEQ ID NO: 33)
GCGCGCTTTGTAGGATTCG
Sense (SEQ ID NO: 34):
5′-CACCGCGCGCTTTGTAGGATTCGTTCAAGAGACGAATCCTACAAA
GCGCGC-3′
Antisense (SEQ ID NO: 35):
5′-AAAAGCGCGCTTTGTAGGATTCGTCTCTTGAACGAATCCTACAAA
GCGCGC-3′

These siRNA expression vectors express siRNA having hairpin structure consisting of nucleotide sequence of as follows:

C2093 si#3;
(SEQ ID NO: 24)
GTGAAGAAGTGCGACCGAATTCAAGAGATTCGGTCGCACTTCTTCAC,
B5860N si#3:
(SEQ ID NO: 28)
CCAAAGTTCCGTAGTCTAATTCAAGAGATTAGACTACGGAACTTTGG,
C6055 si-08
(SEQ ID NO: 147)
GTTGCAGTTACAGATGAAGTTCAAGAGACTTCATCTGTAACTGCAAC
EGFP control:
(SEQ ID NO: 32)
GAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTC,
and
SCR control:
(SEQ ID NO: 36)
GCGCGCTTTGTAGGATTCGTTCAAGAGACGAATCCTACAAAGCGCGC

Gene-Silencing Effect of C2093, B5860N and C6055

Human bladder cancer cells lines, UMUC3 and J82 for C2093 and B5860N, or SW780 for C6055, were plated onto 10-cm dishes (1×106 cells/dish) and transfected with psiU6BX-EGFP and psiU6BX-SCR as negative controls, psiU6BX-C2093, psiU6BX-B5860N or psiU6BX-C6055 using FuGENE6 (Roche) and Lipofectamine-2000 (Invitrogen) reagents for C2093 and B5860N, or using Nucleofector (Amaxa) regent for C6055 according to the supplier's recommendations, respectively. Total RNAs were extracted from the cells at 6 days after the transfection of each construct, and then the knockdown effect of siRNAs was confirmed by semi-quantitative RT-PCR using specific primers for common regions of C2093, B5860N and C6055 as above mentioned. The primers for GAPDH and ACTB as internal control is as follows;

GAPDH
5′-CGACCACTTTGTCAAGCTCA-3′(SEQ ID NO. 7)
and
5′-GGTTGAGCACAGGGTACTTTATT-3′.(SEQ ID NO. 8)
ACTB
5′-CATCCACGAAACTACCTTCAACT-3′(SEQ ID NO: 148)
5′ -TCTCCTTAGAGAGAAGTGGGGTG-3′(SEQ ID NO: 149)

Moreover, transfectants expressing siRNAs using UMUC3, J82 and SW780 cell lines were grown for 21, 28 and 24 days in selective media containing 0.6, 1.0 and 0.3 mg/ml of neomycin, respectively. After fixation with 4% paraformaldehyde, transfected cells were stained with Giemsa solution to assess colony formation. MTT assays were performed to quantify cell viability. After 21 and 28 days of culture in the neomycin-containing medium, respectively, MTT solution (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) (Sigma) was added at a concentration of 0.5 mg/ml. Following incubation at 37° C. for 2.5 or 1.5 hours, acid-SDS (0.01N HCl/10% SDS) was added; the suspension was mixed vigorously and then incubated overnight at 37° C. to dissolve the dark blue crystals. Absorbance at 570 nm was measured with a Microplate Reader 550 (BioRad).

Observation of Multi-Nucleated Cells by C2093-siRNA

After UMUC3 cells were transfected with si-EGFP as negative controls, and si-C2093 using FuGENE6 (Roche), they were cultured and their cellular morphology were observed by microscopy on 7 days after transfection. To further confirm suppression of C2093 protein expression, Western blotting was carried out with anti-C2093 antibody according to the standard protocol.

Anti-C2093 and Anti-B5860N Antibodies

Plasmids expressing partial fragments of C2093 (1612-1780 a.a.) (SEQ ID NO: 150) and B5860NV2 (337-527 a.a) or B5860NV1 (621-811a.a.) (SEQ ID NO: 151) that contained His-tag at their COOH-terminals were prepared using pET21 vector, respectively. The recombinant proteins were expressed in Escherichia coli, BL21 codon-plus strain (Stratagene, La Jolla, Calif.), and purified using Ni-NTA resin and TALON according to the supplier's protocols. The proteins were inoculated into rabbits; the immune sera were purified on affinity columns according to standard protocols. Affinity-purified anti-C2093 and anti-B5860N antibodies were used for Western blotting, immunoprecipitation, and immunostaining.

Immunocytochemical Staining to Detect Endogenous C2093 and B5860N Proteins in Bladder Cancer Cells

To examine the subcellular localization of endogenous C2093 or B5860N, we seeded UMUC3 cells that expressed C2093 or B5860N endogenously at 1×105 cells per well, respectively. After 24 hours, cells were fixed with PBS containing 4% paraformaldehyde for 15 min, and rendered permeable with PBS containing 0.1% Triton X-100 for 2 min at 4° C. Subsequently the cells were covered with 3% BSA in PBS for 12 hours at 4° C. to block non-specific hybridization. Next, UMUC3 cells were incubated with affinity-purified anti-C2093 antibody or anti-B5860N antibody at 1:100 dilution. Nuclei were counter-stained with 4′,6′-diamidine-2′-phenylindole dihydrochloride (DAPI). After washing with PBS, UMUC3 cells were stained by an Alexa488-conjugated anti-rabbit secondary antibody (Molecular Probe) at 1:1000 dilution. Fluorescent images were obtained under a confocal microscope (Leica, Tokyo, Japan).

Immunohistochemical Staining to Detect Endogenous C2093 and B5860N Proteins in Normal or Bladder Cancer Tissues

Slides of paraffin-embedded normal adult human tissues (BioChain, Hayward, Calif.) and surgical bladder cancer specimens were stained using ENVISION+ Kit/HRP (DakoCytomation, Glostrup, Denmark) after the sections were deparaffinized and warmed with the microwave oven for 5 minutes at 80° C. in antigen retrieval solution with high pH (DAKO) using anti-C2093 antibody, or the sections were deparaffinized and autoclaved for 15 minutes at 108° C. in antigen retrieval solution with high pH (DAKO) using anti-B5860N antibody, respectively. After blocking of endogenous peroxidase and proteins, these sections were incubated with affinity-purified anti-C2093 or anti-B5860N antibodies at 1:20 dilution. Immunodetection was done with peroxidase-labeled anti-rabbit immunoglobulin (Envision kit, Dako Cytomation, Carpinteria, Calif.). Finally, the reactants were developed with 3,3 V-diaminobenzidine (Dako) and the cells were counterstained with hematoxylin.

Results

To obtain precise expression profiles of bladder cancers, only bladder cancer cells with LMM were collected. The proportion of cancer cells selected by this procedure was estimated to be nearly 100%, as determined by microscopic visualization (data not shown).

394 up-regulated genes whose expression ratio was more than 5.0 were identified (Table 4). Of these genes, the 288 functionally characterized genes that were over-expressed in bladder cancer cells were included, and the other 106 (including 51 ESTs) were currently unknown. These up-regulated elements included significant genes involved in signal transduction pathway, oncogenes, cell cycle, and cell adhesion and cytoskeleton. On the other hand, 1272 down-regulated genes whose expression ratio was less than 0.2 were identified (Table 5). Of these down-regulated genes, the 1026 functionally characterized genes that were down-regulated in bladder cancer cells were included, and the other 246 (including 119 ESTs) were unknown.

To confirm the expression pattern of these up-regulated genes in bladder cancers, semi-quantitative RT-PCR analysis was performed using bladder cancer cell lines and normal human tissues including normal bladder and normal transitional cells. Comparing the ratios of the expression levels of the 44 up-regulated genes whose expression were over-expressed in almost of all informative cases, the results were highly similar to those of the microarray analysis in the great majority of the tested cases (FIG. 1). Particularly, B5860N, B0811, C2093, F6022, F4976, D5491, F0411, D7746, A0576N, F1653, C2210, C7757 and D7443 also showed no expression in normal vital organs. These data verified the reliability of our strategy to identify commonly up-regulated genes in bladder cancer cells.

To further examine the expression pattern of these up-regulated genes, A0576N, C2093, C5509, B5860N, F1653, B9838 and C6055, Northern blot analyses were performed with bladder cancer cell lines using each [α32P]-dCTP-labeled amplification products of A0576N, C2093, C5509, B5860N, F1653, B9838 and C6055 prepared by RT-PCR using each primer set as shown in Table 3 as each probe (FIG. 2). All of them also showed much higher expression in bladder cancer cell lines than that in normal bladder. Particularly, A0576N, C2093, B5860N, B9838 and C6055 were specifically over-expressed in bladder cancer cell lines, but were not expressed in normal human tissues including normal bladder. These suggest that these specifically over-expressed genes might be good candidate for molecular target-therapy.

TABLE 4
Up-regulated gene in bladder cancer
BLC
assignmentLMMIDACCESSIONGENETITLE
1C3760BC008718BIRC5Baculoviral IAP repeat-containing 5
(survivin)
2D9621NM_178229IQGAP3IQ motif containing GTPase
activating protein 3
3F1653BC011621HOOK1Hook homolog 1 (Drosophila)
4C8776AA766028AF15Q14AF15q14 protein
5F6507AL046246PGAP1GPI deacylase
6F3374AF195765RAMPRA-regulated nuclear matrix-
associated protein
7A3555K02581TK1Thymidine kinase 1, soluble
8C5005BX648571FLJ38736Hypothetical protein FLJ38736
9D0006NM_145697CDCA1Cell division cycle associated 1
10B8706R52614CDK5R1Cyclin-dependent kinase 5, regulatory
subunit 1 (p35)
11A4693U42408LAD1Ladinin 1
12E0388BC033193MGC30208Hypothetical protein MGC30208
13B8882BC005832KIAA0101KIAA0101
14D4920AI247180GUCY1B2Guanylate cyclase 1, soluble, beta 2
15F2861CR598555KIF20AKinesin family member 20A
16E1412AI989840
17E1349BC041395Homo sapiens, Similar to diaphanous
homolog 3 (Drosophila), clone
IMAGE: 5277415, mRNA
18A3243CR624652TTKTTK protein kinase
19E1138AF318349LEMD2LEM domain containing 2
20B0259AA234962PKP3Plakophilin 3
21A2921NM_002391MDKMidkine (neurite growth-promoting
factor 2)
22A3058NM_202002FOXM1Forkhead box M1
23B5904BC008947C10orf3Chromosome 10 open reading frame 3
24D6767BM312795Transcribed locus
25A4388NM_001988EVPLEnvoplakin
26D4636AF370395EPS8L1EPS8-like 1
27B4587AB096683MGC57827Similar to RIKEN cDNA
2700049P18 gene
28A1618X70683SOX4SRY (sex determining region Y)-box 4
29F6022AK022479HDHD1AHaloacid dehalogenase-like hydrolase
domain containing 1A
30A0061AF053306BUB1BBUB1 budding uninhibited by
benzimidazoles 1 homolog beta
(yeast)
31E2104CN280172CDNA clone IMAGE: 4734740,
partial cds
32A2254NM_006845KIF2CKinesin family member 2C
33B8870NM_018685ANLNAnillin, actin binding protein (scraps
homolog, Drosophila)
34A3896BC015050OIP5Opa-interacting protein 5
35A8287R87657DKFZp762E1312Hypothetical protein
DKFZp762E1312
36A1835U18018ETV4Ets variant gene 4 (E1A enhancer
binding protein, E1AF)
37D2882AA777954
38A2282BC014039MELKMaternal embryonic leucine zipper
kinase
39C7457W44613LY6KCDNA for differentially expressed
CO16 gene
40E1774AK022881KIAA1272KIAA1272 protein
41E0785BC039269NALP2NACHT, leucine rich repeat and PYD
containing 2
42F1332CR592757BRRN1Barren homolog (Drosophila)
43F7562AI146812
44C2093H93085MPHOSPH1M-phase phosphoprotein 1
45F7083AL044366RUNX1Runt-related transcription factor 1
(acute myeloid leukemia 1; aml1
oncogene)
46F6312AW977404SLC15A2Solute carrier family 15 (H+/peptide
transporter), member 2
47E0954BC021290IMP-2IGF-II mRNA-binding protein 2
48A5657BQ219156HSPC150HSPC150 protein similar to
ubiquitin-conjugating enzyme
49F7407AF095288PTTG2Pituitary tumor-transforming 2
50B2909CR625760TOP2ATopoisomerase (DNA) II alpha
170 kDa
51F2445AK022644MGC3101Hypothetical protein MGC3101
52B9303AK129960LOC92558Hypothetical protein LOC92558
53C6902BC007608HMGB3High-mobility group box 3
54A0499BM912233CKS2CDC28 protein kinase regulatory
subunit 2
55A9518NAA570186Hypothetical gene supported by
AK096951; BC066547
56A2728AK126687LLGL2Lethal giant larvae homolog 2
(Drosophila)
57A5623AF044588PRC1Protein regulator of cytokinesis 1
58B6283AY257469CITCitron (rho-interacting,
serine/threonine kinase 21)
59C8054NM_001445FABP6Fatty acid binding protein 6, ileal
(gastrotropin)
60E0465BC010044CDC20CDC20 cell division cycle 20
homolog (S. cerevisiae)
61B0811AW183154KIF14Kinesin family member 14
62E1010CN3417262′-PDE2′-phosphodiesterase
63F4976AF165527DGCR8DiGeorge syndrome critical region
gene 8
64F2376AK021714CDNA FLJ11652 fis, clone
HEMBA1004461
65C0234NM_020639RIPK4Receptor-interacting serine-threonine
kinase 4
66A5953N24235KIAA0789KIAA0789 gene product
67B7725NM_031966CCNB1Cyclin B1
68A0576NNM_138555KIF23Kinesin family member 23
69B7480AF407165PPP1R14CProtein phosphatase 1, regulatory
(inhibitor) subunit 14C
70B4218BQ052480IFI27Interferon, alpha-inducible protein 27
71F1655AL137343NSE1NSE1
72C9468AA885242KIFC2Kinesin family member C2
73A1787NM_016343CENPFCentromere protein F, 350/400ka
(mitosin)
74D6683NM_003106SOX2SRY (sex determining region Y)-box 2
75A0024AF017790KNTC2Kinetochore associated 2
76D9407CR749484LOC152519Hypothetical protein LOC152519
77F6910BF940192KIAA0776KIAA0776
78A1367D14520KLF5Kruppel-like factor 5 (intestinal)
79C2210AI755171MRCL3Myosin regulatory light chain
MRCL3
80C5088R62589SEMA3CSema domain, immunoglobulin
domain (Ig), short basic domain,
secreted, (semaphorin) 3C
81F1242AB020713NUP210Nucleoporin 210
82C7747CA314541Transcribed locus
83D5753AA971042RHPN1Rhophilin, Rho GTPase binding
protein 1
84E1801AW971869SORL1Sortilin-related receptor, L(DLR
class) A repeats-containing
85A1063BU600928SPRR1BSmall proline-rich protein 1B
(cornifin)
86A8317NBQ013695FLJ10420Hypothetical protein FLJ10420
87B5860NBM683578DEPDC1DEP domain containing 1
88F3847AK027006TNRC9Trinucleotide repeat containing 9
89A0018NM_198433STK6Serine/threonine kinase 6
90A4356Y00503KRT19Keratin 19
91A0004AB003698CDC7CDC7 cell division cycle 7 (S. cerevisiae)
92D7212AA132702XTP2HBxAg transactivated protein 2
93F4584XM_049695VANGL2Vang-like 2 (van gogh, Drosophila)
94E1619BU620217NSNucleostemin
95B6905BU675191CGI-72CGI-72 protein
96C6486X83618HMGCS23-hydroxy-3-methylglutaryl-
Coenzyme A synthase 2
(mitochondrial)
97A3298M91670UBE2SUbiquitin-conjugating enzyme E2S
98C0488AA781195PRAMEPreferentially expressed antigen in
melanoma
99A2691NBC041846CDH3Cadherin 3, type 1, P-cadherin
(placental)
100F0757AK023834CDCP1CUB domain-containing protein 1
101F6193AK026280Transcribed locus, weakly similar to
XP_375099.1 hypothetical protein
LOC283585 [Homo sapiens]
102A0303U79240PASKPAS domain containing
serine/threonine kinase
103C7757AK024506C14orf80Chromosome 14 open reading frame
80
104F2228X51688CCNA2Cyclin A2
105D9210CA844321MGC3196Hypothetical protein MGC3196
106F6225AW970636FOXP1Forkhead box P1
107C7353AK122903EPS8L2EPS8-like 2
108E1776AI138333MAP4K3Mitogen-activated protein kinase
kinase kinase kinase 3
109D5491AA947258Transcribed locus
110E0885NM_183047PRKCBP1Protein kinase C binding protein 1
111B4479AF258572GSDMLGasdermin-like
112C6719BC013892PVRL4Poliovirus receptor-related 4
113A2796NM_006681NMUNeuromedin U
114D8458AA830668
115F6333AW590215SLC4A8Solute carrier family 4, sodium
bicarbonate cotransporter, member 8
116D4789AW070371SIMPSource of immunodominant MHC-
associated peptides
117A4875NM_000336SCNN1BSodium channel, nonvoltage-gated 1,
beta (Liddle syndrome)
118A0143NAJ606319MYBV-myb myeloblastosis viral oncogene
homolog (avian)
119B2426CB116740POGKPogo transposable element with
KRAB domain
120F7685AV699624Transcribed locus
121C5020BC004352KIF22Kinesin family member 22
122C7114BU738386LOC284352Hypothetical protein LOC284352
123F7399AI928242TFCP2L1Transcription factor CP2-like 1
124A6002AA179812FLJ21918Hypothetical protein FLJ21918
125A2439AF053305BUB1BUB1 budding uninhibited by
benzimidazoles 1 homolog (yeast)
126A1591NM_002534OAS12′,5′-oligoadenylate synthetase 1,
40/46 kDa
127F6689AK021848
128C7737AA969163Transcribed locus
129F0411AW898615
130B6548R61700
131A5136NAF133086ST14Suppression of tumorigenicity 14
(colon carcinoma, matriptase, epithin)
132D6877AI002358
133B4478AA910946AP1M2Adaptor-related protein complex 1,
mu 2 subunit
134C9858NM_006892DNMT3BDNA (cytosine-5-)-methyltransferase
3 beta
135B1194AK090897GPATC2G patch domain containing 2
136A4438AF055015EYA2Eyes absent homolog 2 (Drosophila)
137A7602CD359557DAZAP2DAZ associated protein 2
138D7746AI024928C13orf24Chromosome 13 open reading frame
24
139C1901AA649063FLJ21865Endo-beta-N-acetylglucosaminidase
140E0639AK023937THEAThioesterase, adipose associated
141A7322CA314912LOC202451Hypothetical protein LOC202451
142B2879NAA173525Similar to Zinc finger protein Rlf
(Rearranged L-myc fusion gene
protein) (Zn-15 related protein)
143B7367CR616479AMACRAlpha-methylacyl-CoA racemase
144F4070NM_020897HCN3Hyperpolarization activated cyclic
nucleotide-gated potassium channel 3
145C4658AF132541GMIPGEM interacting protein
146B8739AA992910VSIG2V-set and immunoglobulin domain
containing 2
147F7003AW291323
148B2454AL833191SMC2L1SMC2 structural maintenance of
chromosomes 2-like 1 (yeast)
149A1223X73502KRT20Keratin 20
150F0969AK026201RAB3IPRAB3A interacting protein (rabin3)
151F3726AF098668LYPLA2Lysophospholipase II
152A1209NM_001071TYMSThymidylate synthetase
153C3759NM_003072SMARCA4SWI/SNF related, matrix associated,
actin dependent regulator of
chromatin, subfamily a, member 4
154C0328CR592555Full-length cDNA clone
CS0DE011YI04 of Placenta of Homo
sapiens (human)
155B6353R19310RELNReelin
156C1555AK094156Similar to KIAA0454 protein
157D7443AI017753AHI1Abelson helper integration site
158D8001AW976634Transcribed locus
159F7409AI739486MFAP3Microfibrillar-associated protein 3
160F6200AK023542
161B4626BC052574FLJ20171Hypothetical protein FLJ20171
162F7636AI651388
163A2310AF261758DHCR2424-dehydrocholesterol reductase
164C9450AI338875CDK3Cyclin-dependent kinase 3
165F3973AL157504MRNA; cDNA DKFZp586O0724
(from clone DKFZp586O0724)
166C7681AA151182ZNF339Zinc finger protein 339
167D9500AI361654
168C9098AY376439ECT2Epithelial cell transforming sequence
2 oncogene
169B5152NCR618521CSNK1ECasein kinase 1, epsilon
170D4223AK095136RASGEF1ARasGEF domain family, member 1A
171F2073NM_020990CKMT1Creatine kinase, mitochondrial 1
(ubiquitous)
172B7466AA128378KIAA0303KIAA0303 protein
173A7083CR608243ARHGAP8Rho GTPase activating protein 8
174D5363AI419859GALNT7UDP-N-acetyl-alpha-D-
galactosamine:polypeptide N-
acetylgalactosaminyltransferase 7
(GalNAc-T7)
175A9044BC003186Pfs2DNA replication complex GINS
protein PSF2
176C8682NM_005329HAS3Hyaluronan synthase 3
177A1605NM_203401STMN1Stathmin 1/oncoprotein 18
178A4045NBE538546PMCHPro-melanin-concentrating hormone
179A0042AF029082SFNStratifin
180A1524U29344FASNFatty acid synthase
181F3821AL117612MAL2Mal, T-cell differentiation protein 2
182C4276NM_001407CELSR3Cadherin, EGF LAG seven-pass G-
type receptor 3 (flamingo homolog,
Drosophila)
183D7936BQ022849TEX27Testis expressed sequence 27
184A5159BC080193ERBB2V-erb-b2 erythroblastic leukemia
viral oncogene homolog 2,
neuro/glioblastoma derived oncogene
homolog (avian)
185A4542NM_001305CLDN4Claudin 4
186F8586AA579871SMARCC1SWI/SNF related, matrix associated,
actin dependent regulator of
chromatin, subfamily c, member 1
187A7870NM_018492TOPKT-LAK cell-originated protein kinase
188B7330NBM726315GALNT6UDP-N-acetyl-alpha-D-
galactosamine:polypeptide N-
acetylgalactosaminyltransferase 6
(GalNAc-T6)
189A1054M13755G1P2Interferon, alpha-inducible protein
(clone IFI-15K)
190A6139BU730831PAFAH1B3Platelet-activating factor
acetylhydrolase, isoform Ib, gamma
subunit 29 kDa
191A6127AI356291GPT2Glutamic pyruvate transaminase
(alanine aminotransferase) 2
192C8580CR611223CLDN7Claudin 7
193C6055AA001450MGC34032Hypothetical protein MGC34032
194F8392AI432199LMO4LIM domain only 4
195A1970BC000356MAD2L1MAD2 mitotic arrest deficient-like 1
(yeast)
196D8466AI619500Transcribed locus
197C9305AI080640AGR2Anterior gradient 2 homolog
(Xenopus laevis)
198E0170BQ417235Transcribed locus
199F7497AW973864SYNJ2BPSynaptojanin 2 binding protein
200D7200BC069011TRA2ATransformer-2 alpha
201F4522AK023400DCL-1Type I transmembrane C-type lectin
receptor DCL-1
202B8930AA513445RBM21RNA binding motif protein 21
203A4643J05428UGT2B7UDP glycosyltransferase 2 family,
polypeptide B7
204F8409BC041096CLCA2Chloride channel, calcium activated,
family member 2
205A2603NZ46629SOX9SRY (sex determining region Y)-box
9 (campomelic dysplasia, autosomal
sex- reversal)
206A6979AI357616LOC90133Hypothetical protein LOC90133
207E1348BX640908EVI1Ecotropic viral integration site 1
208F5885AK023050
209A3644NM_006949STXBP2Syntaxin binding protein 2
210C5509NM_201269Zep-2Zinc finger motif enhancer binding
protein 2
211B2579NN70341ELAC2ElaC homolog 2 (E. coli)
212D4039CB142087MARVELD2MARVEL domain containing 2
213A1800NM_052987CDK10Cyclin-dependent kinase (CDC2-like)
10
214F3387AK126185PPFIA4Protein tyrosine phosphatase, receptor
type, f polypeptide (PTPRF),
interacting protein (liprin), alpha 4
215A2735BC036811PTHR2Parathyroid hormone receptor 2
216C9937BC013048C8orf20Chromosome 8 open reading frame
20
217F7614AI114655LOC284058Hypothetical protein LOC284058
218B1561AK074562QKIQuaking homolog, KH domain RNA
binding (mouse)
219B4400BX647949FRAS1Fraser syndrome 1
220C4588AA016977MRNA; cDNA DKFZp686F1844
(from clone DKFZp686F1844)
221D3205AY024361MLL3B melanoma antigen family, member 4
222B7272BQ268701
223B7706R22536FLJ13052NAD kinase
224G0074AK127891MGC10744Hypothetical protein MGC10744
225C0909U38276SEMA3FSema domain, immunoglobulin
domain (Ig), short basic domain,
secreted, (semaphorin) 3F
226A8777BM990713IL28RAInterleukin 28 receptor, alpha
(interferon, lambda receptor)
227E1497BU625507SLC16A3Solute carrier family 16
(monocarboxylic acid transporters),
member 3
228C6865BC041417Transcribed locus, moderately similar
to NP_955751.1 potassium channel
regulator [Homo sapiens]
229A0327NNM_002421MMP1Matrix metalloproteinase 1
(interstitial collagenase)
230C8624NM_005858AKAP8A kinase (PRKA) anchor protein 8
231B9838AA018510MGC33382Hypothetical protein MGC33382
232B4649BM996064TJP3Tight junction protein 3 (zona
occludens 3)
233F7985AA682421
234B5490AB014555HIP1RHuntingtin interacting protein-1-
related
235A0959NM_001034RRM2Ribonucleotide reductase M2
polypeptide
236A5644BC015582MGC23280Hypothetical protein MGC23280
237B7163AA262462NT5C25′-nucleotidase, cytosolic II
238F5981AL050119TMEM1Transmembrane protein 1
239F7087AL043093FAM47BFamily with sequence similarity 47,
member B
240C6634AA398740CDNA FLJ41168fis, clone BRACE
2041095
241C0285AK093343FLJ23231Hypothetical protein FLJ23231
242C0417AF311320SLC37A1Solute carrier family 37 (glycerol-3-
phosphate transporter), member 1
243F3641AY099469SLAC2-BSLAC2-B
244C1730BU682808GNASGNAS complex locus
245F2351AL162042
246C3640NM_182641FALZFetal Alzheimer antigen
247B7032NAA398096PFKFB46-phosphofructo-2-kinase/fructose-
2,6-biphosphatase 4
248D8837NM_012189CABYRCalcium-binding tyrosine-(Y)-
phosphorylation regulated
(fibrousheathin 2)
249F6161BF056203ABHD7Abhydrolase domain containing 7
250B5458NAA889610CARHSP1Calcium regulated heat stable protein
1, 24 kDa
251D3452BX482647PARP14Poly (ADP-ribose) polymerase
family, member 14
252B6562CA306079PLEKHJ1Pleckstrin homology domain
containing, family J member 1
253C6789AK125177LOC149134Hypothetical protein LOC149134
254C0485BC064568LOC150223Hypothetical protein LOC150223
255A7343NN68578LIPCLipase, hepatic
256A6349AK095197PAQR6Progestin and adipoQ receptor family
member VI
257A1865U60808CDS1CDP-diacylglycerol synthase
(phosphatidate cytidylyltransferase) 1
258A7352AJ421269TD-60RCC1-like
259F0534NM_004360CDH1Cadherin 1, type 1, E-cadherin
(epithelial)
260F3919AK025341FARP1FERM, RhoGEF (ARHGEF) and
pleckstrin domain protein 1
(chondrocyte-derived)
261F7374AI656728ARIH1Ariadne homolog, ubiquitin-
conjugating enzyme E2 binding
protein, 1 (Drosophila)
262A2822BQ015859CSTACystatin A (stefin A)
263E1344BC064421C2orf29Chromosome 2 open reading frame
29
264A1604X52186ITGB4Integrin, beta 4
265D8789AI025912GLCCI1Glucocorticoid induced transcript 1
266D3350R45979
267F7016BE179023FLJ11142Hypothetical protein FLJ11142
268A0636Z29066NEK2NIMA (never in mitosis gene a)-
related kinase 2
269A5223BC007379MGC16207Hypothetical protein MGC16207
270G0445AK000981
271B0869NAF274048UHRF1Ubiquitin-like, containing PHD and
RING finger domains, 1
272C7864D84454SLC35A2Solute carrier family 35 (UDP-
galactose transporter), member A2
273A2837BU618918CDKN3Cyclin-dependent kinase inhibitor 3
(CDK2-associated dual specificity
phosphatase)
274C7435BC029267MUC20Mucin 20
275A4383Z97029RNASEH2ARibonuclease H2, large subunit
276F7162AK000364CHD7Chromodomain helicase DNA
binding protein 7
277B1819AY165122MYH14Myosin, heavy polypeptide 14
278A0207M73812CCNE1Cyclin E1
279D8150BF965334PRKRAProtein kinase, interferon-inducible
double stranded RNA dependent
activator
280C8051BM685415C10orf116Chromosome 10 open reading frame
116
281A5601H19339MRNA; cDNA DKFZp547G036
(from clone DKFZp547G036)
282B7365BC025755C6orf134Chromosome 6 open reading frame
134
283A1957U20979CHAF1AChromatin assembly factor 1, subunit
A (p150)
284B5103NAI091425VGLL1Vestigial like 1 (Drosophila)
285F2779BC001226PLEK2Pleckstrin 2
286C6110W67193GFPT1Glutamine-fructose-6-phosphate
transaminase 1
287A4616AJ007669FANCGFanconi anemia, complementation
group G
288A1859NNM_001002295GATA3GATA binding protein 3
289A0333NM_002466MYBL2V-myb myeloblastosis viral oncogene
homolog (avian)-like 2
290A6869BC011665TCF3Transcription factor 3 (E2A
immunoglobulin enhancer binding
factors E12/E47)
291C7801AI299827TFCP2L3Transcription factor CP2-like 3
292F8081BF433219
293A3587NM_003088FSCN1Fascin homolog 1, actin-bundling
protein (Strongylocentrotus
purpuratus)
294A6935AA523117DC-TM4F2Tetraspanin similar to TM4SF9
295F3642CR619487DKFZP564C103DKFZP564C103 protein
296F3549AK025185
297F6831AK024988Similar to KIAA0160 gene product is
novel.
298E0499BM906554COX6B1Cytochrome c oxidase subunit Vib
polypeptide 1 (ubiquitous)
299A7770R55185IRX3Iroquois homeobox protein 3
300A2865AJ297436PSCAProstate stem cell antigen
301B3762BC035311ZD52F10Dermokine
302F8140AW976457MBNL1Muscleblind-like (Drosophila)
303A8295AA430571Transcribed locus
304F8687AW081894
305A1166S62028RCV1Recoverin
306B8658CA429220SKP2S-phase kinase-associated protein 2
(p45)
307B6813BX092653Transcribed locus
308E0909BU726646Transcribed locus
309D1287BC012136ISL2ISL2 transcription factor,
LIM/homeodomain, (islet-2)
310A6151BU620959RAPGEFL1Rap guanine nucleotide exchange
factor (GEF)-like 1
311A6486W67936RAIRelA-associated inhibitor
312G0008AK026743C21orf96Chromosome 21 open reading frame
96
313F3089AB046838KIAA1618KIAA1618
314F3293AL389951NUP50Nucleoporin 50 kDa
315B5870AI312573CPNE3Copine III
316A9334BC039343HN1Hematological and neurological
expressed 1
317B9951NM_005556KRT7Keratin 7
318B8627R39044RAB27BRAB27B, member RAS oncogene
family
319D2335BQ018544Hypothetical LOC389908
320B4097CR596974MLPMARCKS-like protein
321F7332AI936859RTKNRhotekin
322B8205AL133100FLJ20531Hypothetical protein FLJ20531
323C2132AW134658MSI2Musashi homolog 2 (Drosophila)
324E0491BC062785CDNA clone IMAGE: 4734740,
partial cds
325A4959AF042282EXO1Exonuclease 1
326A1824NM_002224ITPR3Inositol 1,4,5-triphosphate receptor,
type 3
327A1007Z29093DDR1Discoidin domain receptor family,
member 1
328C4330BC006000CAPNS2Calpain, small subunit 2
329D6311BI771102PHYHIPLFamily with sequence similarity 13,
member C1
330B5994T81301AFURS1ATPase family homolog up-regulated
in senescence cells
331C6374AA493372LOC55971Insulin receptor tyrosine kinase
substrate
332F7512AW978905HNRPKHeterogeneous nuclear
ribonucleoprotein K
333F0864AK025277TNRC6Trinucleotide repeat containing 6
334A9568BC022217C6orf85Chromosome 6 open reading frame
85
335F2807AL080146CCNB2Cyclin B2
336A0587NM_006739MCM5MCM5 minichromosome
maintenance deficient 5, cell division
cycle 46 (S. cerevisiae)
337B1119AI215478HMMRHyaluronan-mediated motility
receptor (RHAMM)
338B7060BC067795MGC11308Hypothetical protein MGC11308
339B8276BC009831RAB25RAB25, member RAS oncogene
family
340A8043W72411TP73LTumor protein p73-like
341B9340T78186DNMT3ADNA (cytosine-5-)-methyltransferase
3 alpha
342B4456BX537652FLJ12892Hypothetical protein FLJ12892
343B3796AA116022USP18Ubiquitin specific protease 18
344E0950BF740209PYGBPhosphorylase, glycogen; brain
345B4409XM_371116MYO5BMyosin VB
346C1898AL713801SLAMF7SLAM family member 7
347F4025AK021428C6orf210Chromosome 6 open reading frame
210
348F0983AL832106MLR2Ligand-dependent corepressor
349A3256L07597RPS6KA1Ribosomal protein S6 kinase, 90 kDa,
polypeptide 1
350A1715M74178MST1Macrophage stimulating 1
(hepatocyte growth factor-like)
351A8407CB988759C2orf33Chromosome 2 open reading frame
33
352A6363CR621577Homo sapiens, clone
IMAGE: 5301514, mRNA
353B4618BM014054LOC339229Hypothetical protein LOC339229
354D9773BC039118STX6Syntaxin 6
355A0309U85658TFAP2CTranscription factor AP-2 gamma
(activating enhancer binding protein 2
gamma)
356F4885NM_003681PDXKPyridoxal (pyridoxine, vitamin B6)
kinase
357A0516BC064662TRAF2TNF receptor-associated factor 2
358B2664AA682861PARD6BPar-6 partitioning defective 6
homolog beta (C. elegans)
359A1874CR617220KRT8Keratin 8
360A2608NM_002230JUPJunction plakoglobin
361A5157AF027153
362A1767M93107BDH3-hydroxybutyrate dehydrogenase
(heart, mitochondrial)
363B4853NCD013889CHRNA1Cholinergic receptor, nicotinic, alpha
polypeptide 1 (muscle)
364A5044AK127479SPINT2Serine protease inhibitor, Kunitz type, 2
365A4467AF038961MPDU1Mannose-P-dolichol utilization defect 1
366B3995BC073757KRT18Keratin 18
367D5376BQ946404CALM2Calmodulin 2 (phosphorylase kinase,
delta)
368A2620NM_001649APXLApical protein-like (Xenopus laevis)
369A0437NM_005782THOC4THO complex 4
370B5141NM_194463RNF128Ring finger protein 128
371B9661BF764924WSB1WD repeat and SOCS box-containing 1
372C8847AA232990Transcribed locus
373C0023NM_002744PRKCZProtein kinase C, zeta
374D6248AW295407FLJ25078Hypothetical protein FLJ25078
375A2088BF131641S100A11S100 calcium binding protein A11
(calgizzarin)
376D8834BM729250GTF3AGeneral transcription factor IIIA
377A1139AF230388TRIM29Tripartite motif-containing 29
378C9024AI678218AE2Hypothetical protein AE2
379E0571BG115155FLJ10726Hypothetical protein FLJ10726
380C4878BC040176LOC130576Hypothetical protein LOC130576
381E0516AK075185KDELR1KDEL (Lys-Asp-Glu-Leu)
endoplasmic reticulum protein
retention receptor 1
382B6529CA314443PLXNA3Plexin A3
383A2111BC062996DBIDiazepam binding inhibitor (GABA
receptor modulator, acyl-Coenzyme
A binding protein)
384A6657BX451670FLJ30525Hypothetical protein FLJ30525
385F5784AK022067KIAA1217KIAA1217
386A7182NM_003731SSNA1Sjogren's syndrome nuclear
autoantigen 1
387A4144BC004376ANXA8Annexin A8
388A2382NM_004456EZH2Enhancer of zeste homolog 2
(Drosophila)
389A9467BC045658LOC57228Hypothetical protein from clone 643
390F6419AW978490SSH2Slingshot homolog 2 (Drosophila)
391B3971AF290612NUSAP1Nucleolar and spindle associated
protein 1
392B4325BC053605LOC440448
393A6441AI279896CGI-69CGI-69 protein
394C7625BU684240EHFEts homologous factor

TABLE 5
Down-regulated gene in bladder cancer
BLC
assignmentLMMIDACCESSIONGENETITLE
395A0898BC011393CHN1Chimerin (chimaerin) 1
396A0944Z24725PLEKHC1Pleckstrin homology domain
containing, family C (with FERM
domain) member 1
397A1750D31716BTEB1Basic transcription element binding
protein 1
398A1852M19713TPM1Tropomyosin 1 (alpha)
399A2460AF000959CLDN5Claudin 5 (transmembrane protein
deleted in velocardiofacial
syndrome)
400A2701NM_003028SHBSHB (Src homology 2 domain
containing) adaptor protein B
401A6184NM_133268OSBPL1AOxysterol binding protein-like 1A
402A3188M27110PLP1Proteolipid protein 1 (Pelizaeus-
Merzbacher disease, spastic
paraplegia 2, uncomplicated)
403A3340M93284PNLIPRP2Pancreatic lipase-related protein 2
404A4189AA922716PRKACBProtein kinase, cAMP-dependent,
catalytic, beta
405A4472AF042081SH3BGRLSH3 domain binding glutamic acid-
rich protein like
406A5084CR614015CD14CD14 antigen
407A5498BX093242Transcribed locus
408A5356NM_001002260C9orf58Chromosome 9 open reading frame
58
409A5795BQ775444CORO1CCoronin, actin binding protein, 1C
410A5704AB018254KIAA0711KIAA0711 gene product
411A0100NM_002006FGF2Fibroblast growth factor 2 (basic)
412A6111NM_018105THAP1THAP domain containing, apoptosis
associated protein 1
413A1365D10653TM4SF2Transmembrane 4 superfamily
member 2
414A1764NM_002526NT5E5′-nucleotidase, ecto (CD73)
415A2964BQ219660GNG11Guanine nucleotide binding protein
(G protein), gamma 11
416A3203NM_002436MPP1Membrane protein, palmitoylated 1,
55 kDa
417A3322M80899AHNAKAHNAK nucleoprotein
(desmoyokin)
418A3739NM_000090COL3A1Collagen, type III, alpha 1 (Ehlers-
Danlos syndrome type IV, autosomal
dominant)
419A3748X51593MYH3Myosin, heavy polypeptide 3,
skeletal muscle, embryonic
420A4630U89281RODH3-hydroxysteroid epimerase
421A4972NM_002487NDNNecdin homolog (mouse)
422A5807W80773CDNA FLJ13601 fis, clone
PLACE1010069
423A5937BC028315GABARAPL1GABA(A) receptor-associated
protein like 1
424A5785CR627469PSMB7Proteasome (prosome, macropain)
subunit, beta type, 7
425A1572NM_015833ADARB1Adenosine deaminase, RNA-
specific, B1 (RED1 homolog rat)
426A1847U31525GYGGlycogenin
427A1879U45955GPM6BGlycoprotein M6B
428A2452BX537488CSRP1Cysteine and glycine-rich protein 1
429A2978X04741UCHL1Ubiquitin carboxyl-terminal esterase
L1 (ubiquitin thiolesterase)
430A3946NM_021738SVILSupervillin
431A4579L29394HPHaptoglobin
432A4473BX648582SPRY2Sprouty homolog 2 (Drosophila)
433A4611S79851TXNRD1Thioredoxin reductase 1
434A5118X17576NCK1NCK adaptor protein 1
435A5888U56417AGPAT11-acylglycerol-3-phosphate O-
acyltransferase 1 (lysophosphatidic
acid acyltransferase, alpha)
436A6099W60630JAM3Junctional adhesion molecule 3
437A1083BX510904MYH2Myosin, heavy polypeptide 2,
skeletal muscle, adult
438A2610NM_020546ADCY2Adenylate cyclase 2 (brain)
439A2972X72475Amyloid immunoglobulin light chain
protein BRE
440A3214X17042PRG1Proteoglycan 1, secretory granule
441A5485NM_018357FLJ11196Acheron
442A0260U47413CCNG1Cyclin G1
443A0232NM_006219PIK3CBPhosphoinositide-3-kinase, catalytic,
beta polypeptide
444A0946U62961OXCT13-oxoacid CoA transferase 1
445A1617NM_133378TTNTitin
446A1855X73114MYBPC1Myosin binding protein C, slow type
447A1891BC038984GAS6Growth arrest-specific 6
448A2372AF458589PPP1R12AProtein phosphatase 1, regulatory
(inhibitor) subunit 12A
449A2739AF073920RGS6Regulator of G-protein signalling 6
450A3733X04665THBS1Thrombospondin 1
451A5211R55332LRIG1Leucine-rich repeats and
immunoglobulin-like domains 1
452A5251NM_025164KIAA0999KIAA0999 protein
453A5694BM996053C10orf9Chromosome 10 open reading frame 9
454A0094NM_002293LAMC1Laminin, gamma 1 (formerly
LAMB2)
455A0383M13690SERPING1Serine (or cysteine) proteinase
inhibitor, clade G (C1 inhibitor),
member 1, (angioedema, hereditary)
456A0791X63556FBN1Fibrillin 1 (Marfan syndrome)
457A1064NM_024164TPSB2Tryptase, alpha
458A0960U60115FHL1Four and a half LIM domains 1
459A1736NM_001456FLNAFilamin A, alpha (actin binding
protein 280)
460A2031NM_003040SLC4A2Solute carrier family 4, anion
exchanger, member 2 (erythrocyte
membrane protein band 3-like 1)
461A2388BC000574PCOLCEProcollagen C-endopeptidase
enhancer
462A2860BC002436STX4ASyntaxin 4A (placental)
463A4328NM_000573CR1Complement component (3b/4b)
receptor 1, including Knops blood
group system
464A4602X63679TRAM1Translocation associated membrane
protein 1
465A4974NM_006063KBTBD10Kelch repeat and BTB (POZ)
domain containing 10
466A5015NM_001451FOXF1Forkhead box F1
467A0941S59049RGS1Regulator of G-protein signalling 1
468A1753BC063289C4AComplement component 4B
469A1882AF018081COL18A1Collagen, type XVIII, alpha 1
470A2595BC010839RPN1Ribophorin I
471A2224NM_004469FIGFC-fos induced growth factor
(vascular endothelial growth factor
D)
472A2740CR607883CDO1Cysteine dioxygenase, type I
473A3089AK091961UMODUromodulin (uromucoid, Tamm-
Horsfall glycoprotein)
474A4193BU737730RBP1Retinol binding protein 1, cellular
475A4841AF037261SCAM-1Vinexin beta (SH3-containing
adaptor molecule-1)
476A5514AA669799ASMTLAcetylserotonin O-
methyltransferase-like
477A1085BQ073704LGALS1Lectin, galactoside-binding, soluble,
1 (galectin 1)
478A0837L02950CRYMCrystallin, mu
479A0961NM_001482GATMGlycine amidinotransferase (L-
arginine:glycine amidinotransferase)
480A1592NM_000177GSNGelsolin (amyloidosis, Finnish type)
481A2043BC005330TFPI2Tissue factor pathway inhibitor 2
482A2272AF195530XPNPEP1X-prolyl aminopeptidase
(aminopeptidase P) 1, soluble
483A6080N99340CLIPR-59CLIP-170-related protein
484A0357X15606ICAM2Intercellular adhesion molecule 2
485A0775L12579CUTL1Cut-like 1, CCAAT displacement
protein (Drosophila)
486A1074D90228ACAT1Acetyl-Coenzyme A
acetyltransferase 1 (acetoacetyl
Coenzyme A thiolase)
487A1610NM_002084GPX3Glutathione peroxidase 3 (plasma)
488A1452CD013947ITGB6Integrin, beta 6
489A1754AB119995CES1Carboxylesterase 1
(monocyte/macrophage serine
esterase 1)
490A3061U07643LTFLactotransferrin
491A2715BC035802GZMKGranzyme K (serine protease,
granzyme 3; tryptase II)
492A2751M68874PLA2G4APhospholipase A2, group IVA
(cytosolic, calcium-dependent)
493A3563NM_021136RTN1Reticulon 1
494A4201CR592913RRAS2Related RAS viral (r-ras) oncogene
homolog 2
495A4237BC058074WISP2WNT1 inducible signaling pathway
protein 2
496A4709BC016952CYR61Cysteine-rich, angiogenic inducer,
61
497A4871Z19002ZBTB16Zinc finger and BTB domain
containing 16
498A6057BC035939MRASMuscle RAS oncogene homolog
499A5773N72174EGFL5EGF-like-domain, multiple 5
500A0533NM_003932ST13Suppression of tumorigenicity 13
(colon carcinoma) (Hsp70
interacting protein)
501A1748U29089PRELPProline arginine-rich end leucine-
rich repeat protein
502A2478Y13647SCDStearoyl-CoA desaturase (delta-9-
desaturase)
503A6225AJ420439MRNA full length insert cDNA
clone EUROIMAGE 1585492
504A3965AF078695REV3LREV3-like, catalytic subunit of DNA
polymerase zeta (yeast)
505A6264BC022522CD200CD200 antigen
506A4365U68494SLC30A1Solute carrier family 30 (zinc
transporter), member 1
507A4491L15388GRK5G protein-coupled receptor kinase 5
508A4983X12830IL6RInterleukin 6 receptor
509A4769AF004563STXBP1Syntaxin binding protein 1
510A4887NM_001173ARHGAP5Rho GTPase activating protein 5
511A6081AK023172C2orf23Chromosome 2 open reading frame
23
512A0090BC040499TGFBR2Transforming growth factor, beta
receptor II (70/80 kDa)
513A0905X14723CLUClusterin (complement lysis
inhibitor, SP-40,40, sulfated
glycoprotein 2, testosterone-
repressed prostate message 2,
apolipoprotein J)
514A0635NM_004329BMPR1ABone morphogenetic protein
receptor, type IA
515A1474M86406ACTN2Actinin, alpha 2
516A1453M37721PAMPeptidylglycine alpha-amidating
monooxygenase
517A1886BC029261MYOCMyocilin, trabecular meshwork
inducible glucocorticoid response
518A1995M14745BCL2B-cell CLL/lymphoma 2
519A3435CR623240PSG9Pregnancy specific beta-1-
glycoprotein 9
520A3866AF080157CHUKConserved helix-loop-helix
ubiquitous kinase
521A4111BC033040SLC1A1Solute carrier family 1
(neuronal/epithelial high affinity
glutamate transporter, system Xag),
member 1
522A3834AB010419CBFA2T3Core-binding factor, runt domain,
alpha subunit 2; translocated to, 3
523A3959AF055081DESDesmin
524A4076BC008837AKR1B10Aldo-keto reductase family 1,
member B10 (aldose reductase)
525A3738NM_002332LRP1Low density lipoprotein-related
protein 1 (alpha-2-macroglobulin
receptor)
526A4586D86977DHX38DEAH (Asp-Glu-Ala-His) box
polypeptide 38
527A5806BC042960Transcribed locus, moderately
similar to NP_787073.2 hypothetical
protein MGC35023 [Homo sapiens]
528A0386K02215AGTAngiotensinogen (serine (or
cysteine) proteinase inhibitor, clade
A (alpha-1 antiproteinase,
antitrypsin), member 8)
529A0415M77349TGFBITransforming growth factor, beta-
induced, 68 kDa
530A0922NM_004394DAPDeath-associated protein
531A1594NM_002422MMP3Matrix metalloproteinase 3
(stromelysin 1, progelatinase)
532A2471NM_001155ANXA6Annexin A6
533A3114M95585HLFHepatic leukemia factor
534A4742AF019214HBP1HMG-box transcription factor 1
535A5262NM_020182TMEPAITransmembrane, prostate androgen
induced RNA
536A5911AK125888FBXO32F-box protein 32
537A6082N66336ALS2CR15Amyotrophic lateral sclerosis 2
(juvenile) chromosome region,
candidate 14
538A0159BC028049PPP3CBProtein phosphatase 3 (formerly 2B),
catalytic subunit, beta isoform
(calcineurin A beta)
539A0423NM_006744RBP4Retinol binding protein 4, plasma
540A0192M62829EGR1Early growth response 1
541A1378NM_000362TIMP3Tissue inhibitor of metalloproteinase
3 (Sorsby fundus dystrophy,
pseudoinflammatory)
542A2275L80005SNRPNSNRPN upstream reading frame
543A2508X03350ADH1BAlcohol dehydrogenase IB (class I),
beta polypeptide
544A2188J02770IFI factor (complement)
545A2542J02874FABP4Fatty acid binding protein 4,
adipocyte
546A3037BC030975IL1RL1Interleukin 1 receptor-like 1
547A6208NM_004264SURB7SRB7 suppressor of RNA
polymerase B homolog (yeast)
548A4040NM_181425FXNFrataxin
549A4254NM_001848COL6A1Collagen, type VI, alpha 1
550A4407AF055872TNFSF13Tumor necrosis factor (ligand)
superfamily, member 12
551A5853N72866MITFMicrophthalmia-associated
transcription factor
552A5740AI304392PTGFRNProstaglandin F2 receptor negative
regulator
553A1150NM_000560CD53CD53 antigen
554A6221N67054RANBP5RAN binding protein 5
555A3680U79751BLZF1Basic leucine zipper nuclear factor 1
(JEM-1)
556A3778BC050277PELOIntegrin, alpha 1
557A4024AK091336STMN2Stathmin-like 2
558A4394AF039701MBD2Methyl-CpG binding domain protein 2
559A4823D50370NAP1L3Nucleosome assembly protein 1-like 3
560A6003BC042605FKBP5FK506 binding protein 5
561A0152M19154TGFB2Transforming growth factor, beta 2
562A6102R71596Transcribed locus
563A0735NM_001847COL4A6Collagen, type IV, alpha 6
564A1010D28475CLCN6Chloride channel 6
565A1387BC038588AEBP1AE binding protein 1
566A1516U24488TNXBTenascin XB
567A1414NM_001855COL15A1Collagen, type XV, alpha 1
568A1815NM_002664PLEKPleckstrin
569A1951AL833268MEF2CMADS box transcription enhancer
factor 2, polypeptide C (myocyte
enhancer factor 2C)
570A2158NM_005410SEPP1Selenoprotein P, plasma, 1
571A2189NM_000112SLC26A2Solute carrier family 26 (sulfate
transporter), member 2
572A2536U48707PPP1R1AProtein phosphatase 1, regulatory
(inhibitor) subunit 1A
573A2518BM557396IGFBP6Insulin-like growth factor binding
protein 6
574A2543NM_213674TPM2Tropomyosin 2 (beta)
575A2625L26081SEMA3ASema domain, immunoglobulin
domain (Ig), short basic domain,
secreted, (semaphorin) 3A
576A3360NM_031850AGTR1Angiotensin II receptor, type 1
577A3631NM_005908MANBAMannosidase, beta A, lysosomal
578A4641J02854MYL9Myosin, light polypeptide 9,
regulatory
579A5991BX537522FLJ34077Weakly similar to zinc finger protein
195
580A1032M87790IGLC2Immunoglobulin lambda constant 2
(Kern-Oz-marker)
581A2074CR594071SERPINA1Serine (or cysteine) proteinase
inhibitor, clade A (alpha-1
antiproteinase, antitrypsin), member 1
582A2291AF003341ALDH1A1Aldehyde dehydrogenase 1 family,
member A1
583A2202AJ001016RAMP3Receptor (calcitonin) activity
modifying protein 3
584A2319AK126978VCLVinculin
585A2182CR749540FAHD1Hydroxyacylglutathione hydrolase
586A2530CA310505APODApolipoprotein D
587A2444AY366508LOH11CR2ALoss of heterozygosity, 11,
chromosomal region 2, gene A
588A2644BC062476ADH1CAlcohol dehydrogenase 1C (class I),
gamma polypeptide
589A3044BC075840IGHG1Immunoglobulin heavy constant
gamma 1 (G1m marker)
590A2693NM_002742PRKCMProtein kinase C, mu
591A3382AF004021PTGFRProstaglandin F receptor (FP)
592A3296M24122MYL3Myosin, light polypeptide 3, alkali;
ventricular, skeletal, slow
593A3412NM_000552VWFVon Willebrand factor
594A4267BU689993NDUFA6NADH dehydrogenase (ubiquinone)
1 alpha subcomplex, 6, 14 kDa
595A0593NM_002290LAMA4Laminin, alpha 4
596A1959U10550GEMGTP binding protein overexpressed
in skeletal muscle
597A2159L10340EEF1A2Eukaryotic translation elongation
factor 1 alpha 2
598A2626NM_004137KCNMB1Potassium large conductance
calcium-activated channel, subfamily
M, beta member 1
599A3499NM_005406ROCK1Rho-associated, coiled-coil
containing protein kinase 1
600A3390BC001093PDLIM7PDZ and LIM domain 7 (enigma)
601A6234NM_000667ADH1AAlcohol dehydrogenase 1A (class I),
alpha polypeptide
602A4545BC056898PLS3Plastin 3 (T isoform)
603A4680NM_004517ILKIntegrin-linked kinase
604A5306AB046764NBEANeurobeachin
605A5720BQ787632SPON1Spondin 1, extracellular matrix
protein
606A0460X55656HBG2Hemoglobin, gamma G
607A0994BC016928OATOrnithine aminotransferase (gyrate
atrophy)
608A1154NM_000784CYP27A1Cytochrome P450, family 27,
subfamily A, polypeptide 1
609A1423L38486MFAP4Microfibrillar-associated protein 4
610A1301AF039018PDLIM3PDZ and LIM domain 3
611A1431L43821NEDD9Neural precursor cell expressed,
developmentally down-regulated 9
612A1966X81438AMPHAmphiphysin (Stiff-Man syndrome
with breast cancer 128 kDa
autoantigen)
613A2075L02321GSTM5Glutathione S-transferase M5
614A2175J03075PRKCSHProtein kinase C substrate 80K-H
615A6159T17385Hypothetical LOC399951
616A2557NM_001928DFD component of complement
(adipsin)
617A3019J00068ACTA1Actin, alpha 1, skeletal muscle
618A3511NM_006200PCSK5Proprotein convertase
subtilisin/kexin type 5
619A3291BM805032PRSS2Protease, serine, 2 (trypsin 2)
620A3903AF026692SFRP4Secreted frizzled-related protein 4
621A4297NM_012205HAAO3-hydroxyanthranilate 3,4-
dioxygenase
622A4403NM_001856COL16A1Collagen, type XVI, alpha 1
623A4695NM_001003395TPD52L1Tumor protein D52-like 1
624A5457AF038193ARL3ADP-ribosylation factor-like 3
625A5849NM_024095ASB8Ankyrin repeat and SOCS box-
containing 8
626A0971AY034086DSCR1L1Down syndrome critical region gene
1-like 1
627A0707NM_000677ADORA3Adenosine A3 receptor
628A0745NM_004024ATF3Activating transcription factor 3
629A1510NM_004385CSPG2Chondroitin sulfate proteoglycan 2
(versican)
630A1693X94991ZYXZyxin
631A3032NM_000055BCHEButyrylcholinesterase
632A2904BM727781PCP4Purkinje cell protein 4
633A4043NM_000304PMP22Peripheral myelin protein 22
634A4136BC035128MXI1MAX interactor 1
635A4263BX647780ITGA5Integrin, alpha 5 (fibronectin
receptor, alpha polypeptide)
636A4390AB007836TGFB1I1Transforming growth factor beta 1
induced transcript 1
637A5442AF105036KLF4Kruppel-like factor 4 (gut)
638A5422W91908GALNAC4S-6STB cell RAG associated protein
639A5834AK025773LMAN1Lectin, mannose-binding, 1
640A1432L47738CYFIP2Cytoplasmic FMR1 interacting
protein 2
641A6243BM564532OPN1SWOpsin 1 (cone pigments), short-
wave-sensitive (color blindness,
tritan)
642A4702NM_014890DOC1Downregulated in ovarian cancer 1
643A5428H05313Transcribed locus
644A5556BC071586TIMP2Tissue inhibitor of metalloproteinase 2
645A6008NM_005504BCAT1Branched chain aminotransferase 1,
cytosolic
646A1553BC023505ECM1Extracellular matrix protein 1
647A2063U47025PYGBPhosphorylase, glycogen; brain
648A3015NM_201442C1SComplement component 1, s
subcomponent
649A3119J04621SDC2Syndecan 2 (heparan sulfate
proteoglycan 1, cell surface-
associated, fibroglycan)
650A3501BC051748TOP3ATopoisomerase (DNA) III alpha
651A3151M83712CHRNA5Cholinergic receptor, nicotinic, alpha
polypeptide 5
652A3373L13858SOS2Son of sevenless homolog 2
(Drosophila)
653A4547NM_004586RPS6KA3Ribosomal protein S6 kinase, 90 kDa,
polypeptide 3
654A5868BC037733SLC40A1Solute carrier family 40 (iron-
regulated transporter), member 1
655A0578NM_004417DUSP1Dual specificity phosphatase 1
656A6152XM_376018KIAA1644KIAA1644 protein
657A3054U01839FYDuffy blood group
658A3550NM_000702ATP1A2ATPase, Na+/K+ transporting, alpha
2 (+) polypeptide
659A3299BM696587CRYABCrystallin, alpha B
660A3783X70991NAB2NGFI-A binding protein 2 (EGR1
binding protein 2)
661A4819D17408CNN1Calponin 1, basic, smooth muscle
662A4917X83688P2RX1Purinergic receptor P2X, ligand-
gated ion channel, 1
663A5597BC012347FGF13Fibroblast growth factor 13
664A6010U79271AKT3V-akt murine thymoma viral
oncogene homolog 3 (protein kinase
B, gamma)
665A6089CR749654PHLDB2Pleckstrin homology-like domain,
family B, member 2
666A0975NM_002037FYNFYN oncogene related to SRC, FGR,
YES
667A0875L13740NR4A1Nuclear receptor subfamily 4, group
A, member 1
668A0597X72760LAMB2Laminin, beta 2 (laminin S)
669A1023X05610COL4A2Collagen, type IV, alpha 2
670A1147NM_000129F13A1Coagulation factor XIII, A1
polypeptide
671A1956NM_004010DMDDystrophin (muscular dystrophy,
Duchenne and Becker types)
672A2404M15395ITGB2Integrin, beta 2 (antigen CD18 (p95),
lymphocyte function-associated
antigen 1; macrophage antigen 1
(mac-1) beta subunit)
673A2675NM_005907MAN1A1Mannosidase, alpha, class 1A,
member 1
674A2641X69090MYOM1Myomesin 1 (skelemin) 185 kDa
675A4175CR594469RHOQRas homolog gene family, member Q
676A4807AJ001515RYR3Ryanodine receptor 3
677A5152AK129891CASQ2Calsequestrin 2 (cardiac muscle)
678A0184NM_000426LAMA2Laminin, alpha 2 (merosin,
congenital muscular dystrophy)
679A6115NM_175709CBX7Chromobox homolog 7
680A2415M15856LPLLipoprotein lipase
681A2442AK074668ISLRImmunoglobulin superfamily
containing leucine-rich repeat
682A2450NM_001740CALB2Calbindin 2, 29 kDa (calretinin)
683A3055AK095384PDE4CPhosphodiesterase 4C, cAMP-
specific (phosphodiesterase E1
dunce homolog, Drosophila)
684A3380L20977ATP2B2ATPase, Ca++ transporting, plasma
membrane 2
685A3181NM_002193INHBBInhibin, beta B (activin AB beta
polypeptide)
686A4053AB005293PLINPerilipin
687A4794AF064493LDB2LIM domain binding 2
688A4830NM_004557NOTCH4Notch homolog 4 (Drosophila)
689A5436BQ009281ELL2Elongation factor, RNA polymerase
II, 2
690A5690AB028952SYNPOSynaptopodin
691A6510AI215810CAPN7Calpain 7
692B1689AL359062COL8A1Collagen, type VIII, alpha 1
693B2439U04735STCHStress 70 protein chaperone,
microsome-associated, 60 kDa
694B6764M14338PROS1Protein S (alpha)
695B8155NM_006873SBLFTFIIA-alpha/beta-like factor
696A6427BC004995MARVELD1MARVEL domain containing 1
697A6436AB014609MRC2Mannose receptor, C type 2
698A7576AI640497C9orf103Chromosome 9 open reading frame
103
699A8863BM678420Transcribed locus
700B1851AA032154FLJ22655Hypothetical protein FLJ22655
701B3746AF311912SFRP2Secreted frizzled-related protein 2
702B3759AF067420MGC27165Hypothetical protein MGC27165
703B4090M34175AP2B1Adaptor-related protein complex 2,
beta 1 subunit
704A6545NM_004613TGM2Transglutaminase 2 (C polypeptide,
protein-glutamine-gamma-
glutamyltransferase)
705A6949AB014733SMAP-5Golgi membrane protein SB140
706A6923AA677283KIRRELKin of IRRE like (Drosophila)
707A9130AF001436CDC42EP2CDC42 effector protein (Rho
GTPase binding) 2
708A9161BC051700PHF10PHD finger protein 10
709B0149AF052090NNTNicotinamide nucleotide
transhydrogenase
710B1400BX538213CPEB4Cytoplasmic polyadenylation
element binding protein 4
711B2148M61900
712B2723AA018259Full-length cDNA clone
CS0DF027YN23 of Fetal brain of
Homo sapiens (human)
713A6778M36172MYL4Myosin, light polypeptide 4, alkali;
atrial, embryonic
714A7349BX647178FILIP1Filamin A interacting protein 1
715B2829AA121865FLJ10081Hypothetical protein FLJ10081
716B2547BM725055Transcribed locus
717A9341BG576897MSRBMethionine sulfoxide reductase B
718B0275AK092204DNAJB9DnaJ (Hsp40) homolog, subfamily
B, member 9
719B2490BX112650RYR2Ryanodine receptor 2 (cardiac)
720B2456AL550901CCNICyclin I
721B3649AI199480WASF2WAS protein family, member 2
722B4064NM_000047ARSEArylsulfatase E (chondrodysplasia
punctata 1)
723A6385AA663484PPP2R2BProtein phosphatase 2 (formerly 2A),
regulatory subunit B (PR 52), beta
isoform
724A8114AL832154CAP2CAP, adenylate cyclase-associated
protein, 2 (yeast)
725B0739AK074209PLEKHA3Pleckstrin homology domain
containing, family A
(phosphoinositide binding specific)
member 3
726B0268AK123393CCDC3Coiled-coil domain containing 3
727B1032NM_172127CAMK2DCalcium/calmodulin-dependent
protein kinase (CaM kinase) II delta
728B4077NM_004099STOMStomatin
729B0283AL832993NDFIP1Nedd4 family interacting protein 1
730B2130NM_000448RAG1Recombination activating gene 1
731B2457NM_007353GNA12Guanine nucleotide binding protein
(G protein) alpha 12
732B4085NM_198098AQP1Aquaporin 1 (channel-forming
integral protein, 28 kDa)
733B4092AB011126FNBP1Formin binding protein 1
734B6287U66680
735A7286NM_021201MS4A7Membrane-spanning 4-domains,
subfamily A, member 7
736A8203AK026966AK3Adenylate kinase 3
737A7795BC044582UBL3Ubiquitin-like 3
738A8531BX537531FBLN5Fibulin 5
739B1081AK096303FLJ38984Hypothetical protein FLJ38984
740B1985AI052390FLJ20071Dymeclin
741B4230AK054596IGBP1Immunoglobulin (CD79A) binding
protein 1
742B4078AK093049SERPINA3Serine (or cysteine) proteinase
inhibitor, clade A (alpha-1
antiproteinase, antitrypsin), member 3
743C0670AK093067CHPT1Choline phosphotransferase 1
744A6409AK091288C9orf19Chromosome 9 open reading frame
19
745A6664H19830DKFZP434G156Hypothetical protein
DKFZp434G156
746A7411BC035028SERPIND1Serine (or cysteine) proteinase
inhibitor, clade D (heparin cofactor),
member 1
747A7145X52005
748A7963AK024964NFIAKIAA0485 protein
749A7972NM_170677MEIS2Meis1, myeloid ecotropic viral
integration site 1 homolog 2 (mouse)
750A8433NM_005843STAM2Signal transducing adaptor molecule
(SH3 domain and ITAM motif) 2
751B2609AL833069KIAA1434Hypothetical protein KIAA1434
752A9305BC035417Transcribed locus, weakly similar to
NP_650255.1 Drosophila
melanogaster CG11670 gene
753A9187BC034222HRLP5H-rev107-like protein 5
754A9801AI350750PDGFDDNA-damage inducible protein 1
755B1288H73979CACNB2Calcium channel, voltage-dependent,
beta 2 subunit
756B2506AL834231MTPNMyotrophin
757B4086NM_006206PDGFRAPlatelet-derived growth factor
receptor, alpha polypeptide
758A6672H27000WBSCR17Williams-Beuren syndrome
chromosome region 17
759A6683AB088477PER1Period homolog 1 (Drosophila)
760A8568BQ071428CUEDC2CUE domain containing 2
761A9468BX110596Homo sapiens, clone
IMAGE: 4799216, mRNA
762B8113BC020848RNASE6Ribonuclease, RNase A family, k6
763B6773BC077077DPYSL3Dihydropyrimidinase-like 3
764A6781CB529051G0S2Putative lymphocyte G0/G1 switch
gene
765A6410XM_496907PEG10Paternally expressed 10
766A6665AW450890LMO3LIM domain only 3 (rhombotin-like
2)
767A6936AI766077FLJ13456Hypothetical protein FLJ13456
768A9993AB007903GPRASP1G protein-coupled receptor
associated sorting protein 1
769B0327NM_144658DOCK11Dedicator of cytokinesis 11
770B4288AK092766OLFML3Olfactomedin-like 3
771A6776BM726594COX7A1Cytochrome c oxidase subunit VIIa
polypeptide 1 (muscle)
772A7599AK095147CDNA FLJ37828 fis, clone
BRSSN2006575
773A7330NM_018434RNF130Ring finger protein 130
774A9462BM474898SLIT2Slit homolog 2 (Drosophila)
775A9042NM_022349MS4A6AMembrane-spanning 4-domains,
subfamily A, member 6A
776A6522BC045177FLJ30046Hypothetical protein FLJ30046
777A6530NM_006988ADAMTS1A disintegrin-like and
metalloprotease (reprolysin type)
with thrombospondin type 1 motif, 1
778A6567AK096428PDK4Pyruvate dehydrogenase kinase,
isoenzyme 4
779A7663BX647421FSTL1Follistatin-like 1
780B2584CR620669PBX3Pre-B-cell leukemia transcription
factor 3
781A8129AB067468KIAA1881KIAA1881
782A8552AK056721LOC56181Hypothetical protein RP1-317E23
783A8591BC078139EIF2C2Eukaryotic translation initiation
factor 2C, 2
784A8744NM_001233CAV2Caveolin 2
785B0328AK094236DDIT4LDNA-damage-inducible transcript 4-
like
786B4847AA490011LTBP1Latent transforming growth factor
beta binding protein 1
787A6611N58556DKFZp547K1113Hypothetical protein
DKFZp547K1113
788A6317AI205684HSPA2Heat shock 70 kDa protein 2
789A7191BC007655PPP1R2Protein phosphatase 1, regulatory
(inhibitor) subunit 2
790A8600CR749355hIAN2Human immune associated
nucleotide 2
791B1649AA244092Chromosome 9 pericentromeric
mRNA sequence
792B4691NM_024605ARHGAP10Rho GTPase activating protein 10
793B6518CA419435GNPDA2Glucosamine-6-phosphate deaminase 2
794B9201BX647427WIF1WNT inhibitory factor 1
795A6458AK127289SLCO2B1Solute carrier organic anion
transporter family, member 2B1
796A6602W87690ITGA9Integrin, alpha 9
797A6863AK027199MGC48972Hypothetical protein MGC48972
798A6906BC050423TMEM22Transmembrane protein 22
799A8147AY422170TP53INP2Tumor protein p53 inducible nuclear
protein 2
800B4154D87074RIMS3Regulating synaptic membrane
exocytosis 3
801B6579AK126500APEG1Aortic preferentially expressed
protein 1
802A6712NM_182643DLC1Deleted in liver cancer 1
803A6993H10356CDNA FLJ36544 fis, clone
TRACH2006378
804A7225NM_002729HHEXHematopoietically expressed
homeobox
805A6837BX412783LOC283140Hypothetical protein LOC283140
806A7425NM_003250THRAThyroid hormone receptor, alpha
(erythroblastic leukemia viral (v-erb-
a) oncogene homolog, avian)
807A8162AL832955TNFAIP9Tumor necrosis factor, alpha-induced
protein 9
808A7679M97675ROR1Receptor tyrosine kinase-like orphan
receptor 1
809B2084S45018CHATCholine acetyltransferase
810A6593AF007150ANGPTL2Angiopoietin-like 2
811A7075NM_004982KCNJ8Potassium inwardly-rectifying
channel, subfamily J, member 8
812A7710AK125609CKIP-1CK2 interacting protein 1; HQ0024c
protein
813A7772BC028314SURF1Surfeit 1
814A9120AF332010CDV-1Carnitine deficiency-associated gene
expressed in ventricle 1
815B0202NM_021914CFL2Cofilin 2 (muscle)
816B0240AA081184TCF4Transcription factor 4
817B5402XM_375377KIAA0513KIAA0513
818B8811D86962GRB10Growth factor receptor-bound
protein 10
819A6613AB018278SV2BSynaptic vesicle glycoprotein 2B
820A6583XM_371114FHOD3Formin homology 2 domain
containing 3
821A6876AA705804DPTDermatopontin
822A7426BG617617SAA2Serum amyloid A2
823A7689X00457HLA-DPA1Major histocompatibility complex,
class II, DP alpha 1
824A8605AK025205DKFZP564O0823DKFZP564O0823 protein
825A8639AI368204ENPP3Ectonucleotide
pyrophosphatase/phosphodiesterase 3
826A8647XM_290734Similar to ataxin 2-binding protein 1
isoform 4; hexaribonucleotide
binding protein 1
827A9250BC062575RHOJRas homolog gene family, member J
828B3940K02765C3Complement component 3
829B3977AI056268PARVAParvin, alpha
830B4699NM_003450ZNF174Zinc finger protein 174
831B8782AK022926CTNNAL1Catenin (cadherin-associated
protein), alpha-like 1
832A6719AI302184SQRDLSulfide quinone reductase-like
(yeast)
833A7464AF081287CTDP1CTD (carboxy-terminal domain,
RNA polymerase II, polypeptide A)
phosphatase, subunit 1
834A7246N75862EYA4Eyes absent homolog 4 (Drosophila)
835A7773NM_002504NFX1Nuclear transcription factor, X-box
binding 1
836A8155CD242398LOC51255Hypothetical protein LOC51255
837B2641BX094063PIN4Protein (peptidyl-prolyl cis/trans
isomerase) NIMA-interacting, 4
(parvulin)
838A9121AB002388ZNF536Zinc finger protein 536
839A9280AW136599HUNKHormonally upregulated Neu-
associated kinase
840B0241BC056414PLVAPPlasmalemma vesicle associated
protein
841B1531BC063304NPR1Natriuretic peptide receptor
A/guanylate cyclase A
(atrionatriuretic peptide receptorA)
842B2663BC009978ACTCActin, alpha, cardiac muscle
843B4213NM_001001937ATP5A1ATP synthase, H+ transporting,
mitochondrial F1 complex, alpha
subunit, isoform 1, cardiac muscle
844A6348AK026653C14orf168Chromosome 14 open reading frame
168
845A6842AB043585RPRMReprimo, TP53 dependant G2 arrest
mediator candidate
846A8761BM984852C6orf166Hypothetical protein PRO2266
847B0337R28608MAPRE2Microtubule-associated protein,
RP/EB family, member 2
848B5155W84893AGTRL1Angiotensin II receptor-like 1
849B7659AF541281LPPR4Plasticity related gene 1
850B6542NM_014819PJA2Praja 2, RING-H2 motif containing
851A7775BC033820FGL2Fibrinogen-like 2
852A8156BQ010373HEGHEG homolog
853B2659AI025259Transcribed locus
854A9282AF086912OGNOsteoglycin (osteoinductive factor,
mimecan)
855B0845H68305PRKAB2Protein kinase, AMP-activated, beta
2 non-catalytic subunit
856B3924AK075151HSPB7Heat shock 27 kDa protein family,
member 7 (cardiovascular)
857B4008XM_167709C10orf38Chromosome 10 open reading frame
38
858C4095NM_002122HLA-DQA1Major histocompatibility complex,
class II, DQ alpha 1
859B9009XM_039796TNIKTRAF2 and NCK interacting kinase
860A6475BC032508FLJ10781Hypothetical protein FLJ10781
861A6358AK056079JAM2Junctional adhesion molecule 2
862A7230NM_001845COL4A1Collagen, type IV, alpha 1
863A9373AK128695COL6A2Collagen, type VI, alpha 2
864A9103AK091635FLJ11200Hypothetical protein FLJ11200
865A9081BC000693ACTR1AARP1 actin-related protein 1
homolog A, centractin alpha (yeast)
866A9381AL117605CDNA: FLJ21418 fis, clone
COL04072
867A9719XM_294521FLJ43950FLJ43950 protein
868B1004NM_004530MMP2Matrix metalloproteinase 2
(gelatinase A, 72 kDa gelatinase,
72 kDa type IV collagenase)
869B4674AA149429ATP10DATPase, Class V, type 10D
870A6856XM_051081TBC1D12TBC1 domain family, member 12
871A7467BC034989P2RY14Purinergic receptor P2Y, G-protein
coupled, 14
872A7088AB031046TCF7L1Transcription factor 7-like 1 (T-cell
specific, HMG-box)
873A7222NM_001911CTSGCathepsin G
874A7893AA417560Transcribed locus
875A8030AL137734DKFZp586C0721Hypothetical protein
DKFZp586C0721
876A8514AL110212H2AFVH2A histone family, member V
877A9870AB040938KIAA1505KIAA1505 protein
878B1676BC025985IGHG4Immunoglobulin heavy constant
gamma 4 (G4m marker)
879A6447AK127088EPB41L2Erythrocyte membrane protein band
4.1-like 2
880A6457AJ318805CDNA FLJ44429 fis, clone
UTERU2015653
881A6360AL390127KLF13Kruppel-like factor 13
882A7000XM_496727DKFZP564J102DKFZP564J102 protein
883A6844AL831898LOC285812Hypothetical protein LOC285812
884A7239AA523541DSIPIDelta sleep inducing peptide,
immunoreactor
885A8482BC047492ADHFE1Alcohol dehydrogenase, iron
containing, 1
886A8493AA780301CTSFCathepsin F
887A9564NM_000076CDKN1CCyclin-dependent kinase inhibitor
1C (p57, Kip2)
888B2874AA883488KIAA0408KIAA0408
889B6561AB014544KIAA0644KIAA0644 gene product
890B7552NM_016143NSFL1CNSFL1 (p97) cofactor (p47)
891A6751NM_002258KLRB1Killer cell lectin-like receptor
subfamily B, member 1
892A8186BM551020SCAMP2Secretory carrier membrane protein 2
893A8159BX537904APG5LAPG5 autophagy 5-like (S. cerevisiae)
894A8823N26005PPP1R3CProtein phosphatase 1, regulatory
(inhibitor) subunit 3C
895B4810BM701072KIAA0103KIAA0103
896B9056AF433662ARHGEF3Rho guanine nucleotide exchange
factor (GEF) 3
897B2978AA442090FLJ10292Hypothetical protein FLJ10292
898B3794NBC033829AKAP12A kinase (PRKA) anchor protein
(gravin) 12
899B3766NM_000933PLCB4Phospholipase C, beta 4
900B4194NBG292094FLJ11000Hypothetical protein FLJ11000
901B6051R32860MOBKL2BMOB1, Mps One Binder kinase
activator-like 2B (yeast)
902B6511AK124739CDNA FLJ36725 fis, clone
UTERU2012230
903B6358AL161983MGC39820Hypothetical protein MGC39820
904B7880NAK125119C6orf68Chromosome 6 open reading frame
68
905B9198AK123132MSRAMethionine sulfoxide reductase A
906B8754AL833264FEM1BFem-1 homolog b (C. elegans)
907B9564CR609948KPNB1Karyopherin (importin) beta 1
908B9394AL117521C20orf77Chromosome 20 open reading frame
77
909A1871NNM_198235RNASE1Ribonuclease, RNase A family, 1
(pancreatic)
910A3439NBM994174HBBHemoglobin, beta
911A7605R15801NRN1Neuritin 1
912B4394N46424RAI14Retinoic acid induced 14
913B3827N20989ANTXR1Anthrax toxin receptor 1
914B4574AK160376FLJ12895Hypothetical protein FLJ12895
915B6373BX423161LHPPPhospholysine phosphohistidine
inorganic pyrophosphate
phosphatase
916B7122AA480009CDNA FLJ13569 fis, clone
PLACE1008369
917B7310R72837DKFZP434F2021DKFZP434F2021 protein
918B8308NM_001001936KIAA1914KIAA1914
919B7903N49237Homo sapiens, clone
IMAGE: 5312516, mRNA
920B8141BC042478DKFZP434F0318Hypothetical protein
DKFZp434F0318
921B9647AK125651FLJ43663Hypothetical protein FLJ43663
922A0925NL42374PPP2R5BProtein phosphatase 2, regulatory
subunit B (B56), beta isoform
923A6533NAL833076FLJ14281Hypothetical protein FLJ14281
924A6272NM_139346BIN1Bridging integrator 1
925B4133BC039740LOC84549RNA binding protein
926B4694AK074046ZNF521Zinc finger protein 521
927B5489NM_003916AP1S2Adaptor-related protein complex 1,
sigma 2 subunit
928B6306AF107454C7orf2Chromosome 7 open reading frame 2
929B7500H14059LOC197336Similar to RIKEN cDNA
3230401M21 [Mus musculus]
930B8069NM_013366ANAPC2Anaphase promoting complex
subunit 2
931B8422CA310622ACTR3ARP3 actin-related protein 3
homolog (yeast)
932B8679NM_030569ITIH5Inter-alpha (globulin) inhibitor H5
933B9427BC047114CDNA clone IMAGE: 5313062,
partial cds
934B9435Z39318SP2Sp2 transcription factor
935A4798NNM_174953ATP2A3ATPase, Ca++ transporting,
ubiquitous
936A0774NBC012613CPA3Carboxypeptidase A3 (mast cell)
937A6640NBC001816RAP1GDS1RAP1, GTP-GDP dissociation
stimulator 1
938A8783NAA621565ENPP1Ectonucleotide
pyrophosphatase/phosphodiesterase 1
939B0870NCR610395ASF1AASF1 anti-silencing function 1
homolog A (S. cerevisiae)
940B5768BX647147Transcribed locus, weakly similar to
XP_375099.1 hypothetical protein
LOC283585 [Homo sapiens]
941B6365AK091292FATJFat-like cadherin FATJ
942B6571BC039332LOC285086Hypothetical protein LOC285086
943B7170NNM_019035PCDH18Protocadherin 18
944B9172AK092542C2orf32Chromosome 2 open reading frame
32
945B9634BX110180Transcribed locus
946B9317N24737Transcribed locus
947B9419BM996307LNXLigand of numb-protein X
948A2660NNM_021023CFHL3Complement factor H-related 3
949A0881NZ21707ZNF197Zinc finger protein 197
950A1816NBC075800PRKAR2BProtein kinase, cAMP-dependent,
regulatory, type II, beta
951A0702NBQ189297FLT1Fms-related tyrosine kinase 1
(vascular endothelial growth
factor/vascular permeability factor
receptor)
952A0936NM86852PXMP3Peroxisomal membrane protein 3,
35 kDa (Zellweger syndrome)
953B4137NM_053025MYLKMyosin, light polypeptide kinase
954B4949R26358SLMAPSarcolemma associated protein
955B5172NNM_001289CLIC2Chloride intracellular channel 2
956B6700AL133579STARD9START domain containing 9
957B6104NBM987057KIAA0563KIAA0563 gene product
958B7105AK055782PDLIM2PDZ and LIM domain 2 (mystique)
959B7930N21096
960B7887BU580616FLJ10159Hypothetical protein FLJ10159
961B8081BM981462FLJ13710Hypothetical protein FLJ13710
962B8438AA403307UBE4BUbiquitination factor E4B (UFD2
homolog, yeast)
963B9300CA446432C6orf66Chromosome 6 open reading frame
66
964A6448NAK127801FLJ46603FLJ46603 protein
965A9346NAY358379PP2135PP2135 protein
966B3779BF966783
967B4396W58589DDR2Discoidin domain receptor family,
member 2
968B4568AK021950PRTFDC1Phosphoribosyl transferase domain
containing 1
969B4956NM_005737ARL7ADP-ribosylation factor-like 7
970B4577AY081219ABCC4ATP-binding cassette, sub-family C
(CFTR/MRP), member 4
971B5199AK098381ADCY5Adenylate cyclase 5
972B5399XM_056455D2S448Melanoma associated gene
973B6366AK130263KIAA1430KIAA1430
974B7304NAA777308C6orf60Chromosome 6 open reading frame
60
975B7312BU738244Hypothetical gene supported by
AK094796
976B7171H75419CYBRD1Cytochrome b reductase 1
977B7708AA938297FLJ20716Hypothetical protein FLJ20716
978B8098R42864PAPOLAPoly(A) polymerase alpha
979B7768BC017032GCNT3Glucosaminyl (N-acetyl) transferase
3, mucin type
980B8770J04605PEPDPeptidase D
981B9603BM679454ASAMAdipocyte-specific adhesion
molecule
982B9803AF414088COL21A1Collagen, type XXI, alpha 1
983A4655NNM_001164APBB1Amyloid beta (A4) precursor
protein-binding, family B, member 1
(Fe65)
984A1818NNM_033138CALD1Caldesmon 1
985A3200NAK122763COL5A1Collagen, type V, alpha 1
986B2864AI088622PRKCDBPProtein kinase C, delta binding
protein
987B4348AK055071PIGKPhosphatidylinositol glycan, class K
988B8670NM_021038MBNL1Muscleblind-like (Drosophila)
989B9836R79561ARRDC3Arrestin domain containing 3
990A1779NAF025534LILRB5Leukocyte immunoglobulin-like
receptor, subfamily B (with TM and
ITIM domains), member 5
991A3034NBC027913PPP3R1Protein phosphatase 3 (formerly 2B),
regulatory subunit B, 19 kDa, alpha
isoform (calcineurin B, type I)
992A3147NU20938DPYDDihydropyrimidine dehydrogenase
993A1963NBC047756QPCTGlutaminyl-peptide cyclotransferase
(glutaminyl cyclase)
994B3829AF091434PDGFCPlatelet derived growth factor C
995B4578AI290343STC2Stanniocalcin 2
996B5151BU6276447h3Hypothetical protein FLJ13511
997B4614AL833852TAZTranscriptional co-activator with
PDZ-binding motif (TAZ)
998B4971NM_020443NAV1Neuron navigator 1
999B6319BX414085ICSBP1Interferon consensus sequence
binding protein 1
1000B7526R40594CYP2U1Cytochrome P450, family 2,
subfamily U, polypeptide 1
1001B9790BC067746CLEC1C-type lectin-like receptor-1
1002B9341BC012984ALS2CR19Amyotrophic lateral sclerosis 2
(juvenile) chromosome region,
candidate 19
1003A0907NNM_016083CNR1Cannabinoid receptor 1 (brain)
1004A5065BC036661CMKOR1Chemokine orphan receptor 1
1005A3369NL13283MUC7Mucin 7, salivary
1006A8391NAA482082FOXK1Forkhead box K1
1007B4364CD365397TRPV2Transient receptor potential cation
channel, subfamily V, member 2
1008B3958AF145713SCHIP1Schwannomin interacting protein 1
1009B5164R37342PARVGParvin, gamma
1010B6108AW409897LOC91461Hypothetical protein BC007901
1011B6565NBC007997RERGRAS-like, estrogen-regulated,
growth inhibitor
1012B7875H17818Transcribed locus
1013B9007BQ028161hSynBrain synembryn
1014A1780NCR606785ENPP2Ectonucleotide
pyrophosphatase/phosphodiesterase
2 (autotaxin)
1015A1151NM55618TNCTenascin C (hexabrachion)
1016A6369NNM_013374PDCD6IPProgrammed cell death 6 interacting
protein
1017B3930XM_290629C14orf78Chromosome 14 open reading frame
78
1018B4217BU608626WFDC2WAP four-disulfide core domain 2
1019B4447NM_032287LDOC1LLeucine zipper, down-regulated in
cancer 1-like
1020B5721NAK024116FLJ14054Hypothetical protein FLJ14054
1021B5949NM_016293BIN2Bridging integrator 2
1022B6719BX537713Homo sapiens, clone
IMAGE: 4150640, mRNA
1023B6738BX640757DRCTNNB1ADown-regulated by Ctnnb1, a
1024A1669M95787TAGLNTransgelin
1025A0919NJ05550MRC1Mannose receptor, C type 1
1026A2753NBC009924NPTX2Neuronal pentraxin II
1027A0969NNM_001873CPECarboxypeptidase E
1028B3911BC038457DKFZP586H2123Regeneration associated muscle
protease
1029B4953AB007960SH3GLB1SH3-domain GRB2-like endophilin
B1
1030B5382NAK125194MAP1BMicrotubule-associated protein 1B
1031B6568AK091271GPR161G protein-coupled receptor 161
1032B7877AB029033IQSEC3IQ motif and Sec7 domain 3
1033B9777NM_030781COLEC12Collectin sub-family member 12
1034A3079J04599BGNBiglycan
1035A3160NNM_000125ESR1Estrogen receptor 1
1036A1981U58514CHI3L2Chitinase 3-like 2
1037A6696NM_012072C1QR1Complement component 1, q
subcomponent, receptor 1
1038A8809NNM_000755CRATCarnitine acetyltransferase
1039B1090NAF361473ROBO4Roundabout homolog 4, magic
roundabout (Drosophila)
1040B3933AY358360ELTD1EGF, latrophilin and seven
transmembrane domain containing 1
1041B3966BC047724C10orf128Chromosome 10 open reading frame
128
1042B3831AK125356KLHL13Kelch-like 13 (Drosophila)
1043B4450BC048969TSPYL1TSPY-like 1
1044B5396AF208863C6orf209Chromosome 6 open reading frame
209
1045B5410BC033183CHST3Carbohydrate (chondroitin 6)
sulfotransferase 3
1046B6082BX537781FNDC5Fibronectin type III domain
containing 5
1047B7003NAF045584SLC43A1Solute carrier family 43, member 1
1048B7922NM_181844BCL6BB-cell CLL/lymphoma 6, member B
(zinc finger protein)
1049B8790AK123915ZBED3Zinc finger, BED domain containing 3
1050A0055NAF058925JAK2Janus kinase 2 (a protein tyrosine
kinase)
1051A7633AL136578MGC3040Hypothetical protein MGC3040
1052B5842NAF545852MK2S4Protein kinase substrate MK2S4
1053B7363AL832469Hypothetical gene supported by
BX647608
1054B9053AB023158RAB11FIP2RAB11 family interacting protein 2
(class I)
1055A0560NNM_000618IGF1Insulin-like growth factor 1
(somatomedin C)
1056A1624NNM_003034SIAT8ASialyltransferase 8A (alpha-N-
acetylneuraminate: alpha-2,8-
sialyltransferase, GD3 synthase)
1057A7760NBC047390ARID5AAT rich interactive domain 5A
(MRF1-like)
1058A8879NCR597401HCA112Hepatocellular carcinoma-associated
antigen 112
1059A5504NAK056479SPRED2Sprouty-related, EVH1 domain
containing 2
1060B2957CR599541TFIP11Tuftelin interacting protein 11
1061B3586AA748009PPP2R5EProtein phosphatase 2, regulatory
subunit B (B56), epsilon isoform
1062B4320N56931C5orf4Chromosome 5 open reading frame 4
1063B4277AJ420529STX7Syntaxin 7
1064B3893AY549722ITLN1Intelectin 1 (galactofuranose
binding)
1065B7204NAK074765CA14Carbonic anhydrase XIV
1066B7444AW452608C9orf87Chromosome 9 open reading frame
87
1067B8593BU624282KIAA0779KIAA0779 protein
1068B9132AA455877MRVI1Murine retrovirus integration site 1
homolog
1069B9504AA521163PTENPhosphatase and tensin homolog
(mutated in multiple advanced
cancers 1)
1070A8864NN93511FLJ10853Hypothetical protein FLJ10853
1071B2559CA426475HBE1Hemoglobin, epsilon 1
1072B4235NAK095908MFGE8Milk fat globule-EGF factor 8
protein
1073B4291AK025198XISTX (inactive)-specific transcript
1074B4245AF034176NUDT3Nudix (nucleoside diphosphate
linked moiety X)-type motif 3
1075B7559AB073386SGEFSrc homology 3 domain-containing
guanine nucleotide exchange factor
1076B8203NM_018325C9orf72Chromosome 9 open reading frame
72
1077B8035AL834240KIAA1576KIAA1576 protein
1078B8212AK023159LSM11LSM11, U7 small nuclear RNA
associated
1079A0085ND37965PDGFRLPlatelet-derived growth factor
receptor-like
1080A4391NNM_003155STC1Stanniocalcin 1
1081A1437NNM_002210ITGAVIntegrin, alpha V (vitronectin
receptor, alpha polypeptide, antigen
CD51)
1082A7247NAL133118EMCNEndomucin
1083A8289NAK127420Transcribed locus, weakly similar to
XP_375268.2 similar to FLJ43276
protein [Homo sapiens]
1084B3883BC027937RAI2Retinoic acid induced 2
1085B4321BX648583EDIL3EGF-like repeats and discoidin I-like
domains 3
1086B4684BC036485Homo sapiens, clone
IMAGE: 5261213, mRNA
1087B5442AK124604LOC283537Hypothetical protein LOC283537
1088B6492AK057151CDNA FLJ32589 fis, clone
SPLEN2000443
1089B7082AK055323CDNA clone IMAGE: 5263177,
partial cds
1090B9505NM_004796NRXN3Neurexin 3
1091A3538J03464COL1A2Collagen, type I, alpha 2
1092A7704NNM_003749IRS2Insulin receptor substrate 2
1093B3059NM_004755RPS6KA5Ribosomal protein S6 kinase, 90 kDa,
polypeptide 5
1094B3834AB033040RNF150Ring finger protein 150
1095B4237XM_290941PRNPIPPrion protein interacting protein
1096B4498NBX648979SLC41A1Solute carrier family 41, member 1
1097B4661AI765053PTPRDProtein tyrosine phosphatase,
receptor type, D
1098B4633AL162008CLIC4Chloride intracellular channel 4
1099B5019BQ574410Full-length cDNA clone
CS0DI014YH21 of Placenta Cot 25-
normalized of Homo sapiens
(human)
1100B7429BM723215SMARCE1SWI/SNF related, matrix associated,
actin dependent regulator of
chromatin, subfamily e, member 1
1101B8028AK057742C10orf46Chromosome 10 open reading frame
46
1102B8036R20340ATP5SATP synthase, H+ transporting,
mitochondrial F0 complex, subunit s
(factor B)
1103B8213AA729769LOC112476Similar to lymphocyte antigen 6
complex, locus G5B; G5b protein;
open reading frame 31
1104B9470N29574RRAGDRas-related GTP binding D
1105A2632NNM_003816ADAM9A disintegrin and metalloproteinase
domain 9 (meltrin gamma)
1106B0081NAB040962KIAA1529KIAA1529
1107B3699NM_006617NESNestin
1108B8411BX412247EFHD1EF hand domain containing 1
1109A2019NAA442410EMP1Epithelial membrane protein 1
1110B4240BC018652FXYD6FXYD domain containing ion
transport regulator 6
1111B4249BC070071RBM16RNA binding motif protein 16
1112B3721AB023177KIAA0960KIAA0960 protein
1113B5418BQ573990ZNF148Zinc finger protein 148 (pHZ-52)
1114B5464AK127355SEC23ASec23 homolog A (S. cerevisiae)
1115B7185W61217RAB23RAB23, member RAS oncogene
family
1116B7996NBQ445850CDNA clone IMAGE: 5561426,
partial cds
1117B8341BC043003NEK7NIMA (never in mitosis gene a)-
related kinase 7
1118B8547BC033746PNCKPregnancy upregulated non-
ubiquitously expressed CaM kinase
1119B8351R26919DSCR1L2Down syndrome critical region gene
1-like 2
1120B8389AK095203PDE3APhosphodiesterase 3A, cGMP-
inhibited
1121B9722BQ773658Hypothetical LOC402560
1122A1600NNM_001844COL2A1Collagen, type II, alpha 1 (primary
osteoarthritis, spondyloepiphyseal
dysplasia, congenital)
1123A1471NM83772FMO3Flavin containing monooxygenase 3
1124A1634NBC026324MMDMonocyte to macrophage
differentiation-associated
1125A2633NBX648814ANGPT1Angiopoietin 1
1126B4030AK055793C20orf129Chromosome 20 open reading frame
129
1127B4339W73738TMEM25Transmembrane protein 25
1128B4891W19216PKIGProtein kinase (cAMP-dependent,
catalytic) inhibitor gamma
1129B5059NT88953Transcribed locus
1130B6284AK096240Similar to protein of fungal
metazoan origin like (11.1 kD)
(2C514)
1131B7814BC039414Homo sapiens, clone
IMAGE: 5302158, mRNA
1132B8234AF070632Clone 24405 mRNA sequence
1133B8924AI357442SPARCSecreted protein, acidic, cysteine-
rich (osteonectin)
1134A0038NW73825TCF21Transcription factor 21
1135B3584AA917358Transcribed locus
1136B6250N30317LOC91526Hypothetical protein
DKFZp434D2328
1137B7018R00826RAB3GAPRAB3 GTPase-ACTIVATING
PROTEIN
1138B7435AK093246RPL13Ribosomal protein L13
1139B8344AB019210PGM2L1Phosphoglucomutase 2-like 1
1140B8850Z30256KIF1BKinesin family member 1B
1141A2087NBC012617ACTG2Actin, gamma 2, smooth muscle,
enteric
1142A4459NBC013188TPST1Tyrosylprotein sulfotransferase 1
1143A7346NN70296ANK3Ankyrin 3, node of Ranvier (ankyrin
G)
1144B3695BC017312MGC3047Hypothetical protein MGC3047
1145B3889BC013042MGC7036Hypothetical protein MGC7036
1146B4032AF545571SULF1Sulfatase 1
1147B5618AA502764RKHD1Ring finger and KH domain
containing 1
1148B6405AA045332ME1Malic enzyme 1, NADP(+)-
dependent, cytosolic
1149B6035NAF205632SH3BP3SH3-domain binding protein 3
1150B7441AA994299C16orf30Chromosome 16 open reading frame
30
1151B7274BM671249BAZ2ABromodomain adjacent to zinc finger
domain, 2A
1152B8865N66810Homo sapiens, clone
IMAGE: 4690669, mRNA
1153B8404AF173389EEA1Early endosome antigen 1, 162 kD
1154A4381NU81523EBAFEndometrial bleeding associated
factor (left-right determination,
factor A; transforming growth factor
beta superfamily)
1155A6909NM_018667SMPD3Sphingomyelin phosphodiesterase 3,
neutral membrane (neutral
sphingomyelinase II)
1156A7232NBX648421IGJImmunoglobulin J polypeptide,
linker protein for immunoglobulin
alpha and mu polypeptides
1157B4665NAA045171
1158B4638BX648635LIFRLeukemia inhibitory factor receptor
1159B5081NAL832416C9orf13Chromosome 9 open reading frame
13
1160B5460BX537492FLJ23091Putative NFkB activating protein
373
1161B5427CR600360DNAJA2DnaJ (Hsp40) homolog, subfamily
A, member 2
1162B5292BQ574739SMAPSmall acidic protein
1163B7193NBX109986Transcribed locus
1164B7424CA503060FLJ21069Hypothetical protein FLJ21069
1165B8040AJ420553ID4Inhibitor of DNA binding 4,
dominant negative helix-loop-helix
protein
1166B8354NM_003387WASPIPWiskott-Aldrich syndrome protein
interacting protein
1167B8628AA658236HECTD2HECT domain containing 2
1168B9368AF504647Cilia-associated protein (CYS1)
1169B9749BQ575959HTRA3Serine protease HTRA3
1170A1397NAK091875PPP2CBProtein phosphatase 2 (formerly 2A),
catalytic subunit, beta isoform
1171A1485NBC050283WASF3WAS protein family, member 3
1172A6126NH11384CDC42EP3CDC42 effector protein (Rho
GTPase binding) 3
1173B4330AB020637KIAA0830KIAA0830 protein
1174B4491BX537444ATP2B4ATPase, Ca++ transporting, plasma
membrane 4
1175B5815T72611Transcribed locus
1176B6819NAL542335EEF1A1Eukaryotic translation elongation
factor 1 alpha 1
1177B7058BX094037Transcribed locus
1178B8051AK094950CDNA FLJ37631 fis, clone
BRCOC2015944
1179B8866CR749586FLJ11088GGA binding partner
1180B8599R37079PDZRN4PDZ domain containing RING finger 4
1181B9502AL050227PTGER3Prostaglandin E receptor 3 (subtype
EP3)
1182C0213BX110085Transcribed locus
1183C0226AK074924KIAA0853KIAA0853
1184C3653BC066956VIMVimentin
1185C4908BX118828Transcribed locus
1186C6830R49122FLJ14800Hypothetical protein FLJ14800
1187C7111T15991Transcribed locus
1188C8074X79204ATXN1Ataxin 1
1189C9718W94051DTNADystrobrevin, alpha
1190C0685H27764SLC18A2Solute carrier family 18 (vesicular
monoamine), member 2
1191C3767BC018128FGFR1Fibroblast growth factor receptor 1
(fms-related tyrosine kinase 2,
Pfeiffer syndrome)
1192C4060N35250
1193C7466NM_003480MFAP5Microfibrillar associated protein 5
1194C8953AL136678DEPDC6DEP domain containing 6
1195C9351AA195210DKFZP761M1511Hypothetical protein
DKFZP761M1511
1196C3791BU170801PAI-RBP1PAI-1 mRNA-binding protein
1197C4729N70455FBXO31F-box protein 31
1198C6623AA102332MLSTD1Male sterility domain containing 1
1199C8039Z22970CD163CD163 antigen
1200C8442AB011151ZCCHC14Zinc finger, CCHC domain
containing 14
1201C8606BC063430CPXMCarboxypeptidase X (M14 family)
1202C9730BQ448187Transcribed locus
1203C0791BC051340CD164L1CD164 sialomucin-like 1
1204C0830AA012832IRS1Insulin receptor substrate 1
1205C3778NM_003617RGS5Regulator of G-protein signalling 5
1206C4735AL136805ZNF537Zinc finger protein 537
1207C4765CR626993MRNA; cDNA DKFZp686N07104
(from clone DKFZp686N07104)
1208C4743AL137554CDADC1Cytidine and dCMP deaminase
domain containing 1
1209C6116W67536FLJ31204Hypothetical protein FLJ31204
1210C7126NM_020871LRCH2Leucine-rich repeats and calponin
homology (CH) domain containing 2
1211C7172AF377960CTTNBP2Cortactin binding protein 2
1212C8260BM981111MEF2DMADS box transcription enhancer
factor 2, polypeptide D (myocyte
enhancer factor 2D)
1213C2020CA420307SF3B1Splicing factor 3b, subunit 1,
155 kDa
1214C2324BQ182775ECRG4Esophageal cancer related gene 4
protein
1215C3763AF480883PPAP2BPhosphatidic acid phosphatase type
2B
1216C4549N64370TMOD2Tropomodulin 2 (neuronal)
1217C6059AK096344FLJ35220Hypothetical protein FLJ35220
1218C6234AI247176TARSHTarget of Nesh-SH3
1219C7503N90724IGSF4Immunoglobulin superfamily,
member 4
1220C7652AA142913ARGBP2Arg/Abl-interacting protein ArgBP2
1221C7256NM_021963NAP1L2Nucleosome assembly protein 1-like 2
1222C8088D87465SPOCK2Sparc/osteonectin, cwcv and kazal-
like domains proteoglycan (testican) 2
1223C8286AY369207RBPMS2RNA-binding protein with multiple
splicing 2
1224C8659BF673156MYL1Myosin, light polypeptide 1, alkali;
skeletal, fast
1225D0785AA936292Transcribed locus
1226C0678AI796508Transcribed locus
1227C0274NM_005157ABL1V-abl Abelson murine leukemia viral
oncogene homolog 1
1228C4258AK092045C3orf6Chromosome 3 open reading frame 6
1229C6974AK124567HIBCH3-hydroxyisobutyryl-Coenzyme A
hydrolase
1230C7876AW023627Transcribed locus
1231C8066NM_014279OLFM1Olfactomedin 1
1232C9569H18926Full-length cDNA clone
CS0DK010YA20 of HeLa cells Cot
25-normalized of Homo sapiens
(human)
1233D1322BX647857ASB5Ankyrin repeat and SOCS box-
containing 5
1234C0219AJ303079PALM2-AKAP2PALM2-AKAP2 protein
1235C1520BC014640COL14A1Collagen, type XIV, alpha 1
(undulin)
1236C2029H14510LOC286191Hypothetical protein LOC286191
1237C7654BC060868BMPERBMP-binding endothelial regulator
precursor protein
1238C8228AK124641CXCL12Chemokine (C—X—C motif) ligand 12
(stromal cell-derived factor 1)
1239C8438NM_002827PTPN1Protein tyrosine phosphatase, non-
receptor type 1
1240C8274AK056736MBTPS2Membrane-bound transcription
factor protease, site 2
1241D0735AA740582Transcribed locus
1242D1185AA451886CYP1B1Cytochrome P450, family 1,
subfamily B, polypeptide 1
1243D1161BX537988ST7LSuppression of tumorigenicity 7 like
1244C0787AL832207PLEKHH2Pleckstrin homology domain
containing, family H (with MyTH4
domain) member 2
1245C3772U70063ASAH1N-acylsphingosine amidohydrolase
(acid ceramidase) 1
1246C3780AK055619GNAQGuanine nucleotide binding protein
(G protein), q polypeptide
1247C4232AI668702Transcribed locus
1248C4884AA036952Gup1GRINL1A complex upstream protein
1249C6084W60379Transcribed locus
1250C7138BM678096TNATetranectin (plasminogen binding
protein)
1251C7919X79981CDH5Cadherin 5, type 2, VE-cadherin
(vascular epithelium)
1252C8117BE905862SPAG9Sperm associated antigen 9
1253C9367AL558594PRKAG2Protein kinase, AMP-activated,
gamma 2 non-catalytic subunit
1254C1466H03229GAB1GRB2-associated binding protein 1
1255C4732CR595618BRMS1LBreast cancer metastasis-suppressor
1-like
1256C5118AL137572C1orf24Chromosome 1 open reading frame
24
1257C6476AA001390KIAA1463KIAA1463 protein
1258C8044NM_004430EGR3Early growth response 3
1259C7793BX648935TBL1XR1Transducin (beta)-like 1X-linked
receptor 1
1260C8090NM_032088PCDHGC3Protocadherin gamma subfamily C, 3
1261C4066AF303058NP25Neuronal protein
1262C3648AK023450ANTXR2Anthrax toxin receptor 2
1263C8253BC017021MEOX2Mesenchyme homeo box 2 (growth
arrest-specific homeo box)
1264C8456AB032954KIAA1128KIAA1128
1265C7882NM_013261PPARGC1APeroxisome proliferative activated
receptor, gamma, coactivator 1,
alpha
1266C8636CR607734DKK3Dickkopf homolog 3 (Xenopus
laevis)
1267C0671NM_007197FZD10Frizzled homolog 10 (Drosophila)
1268C1984W92438Hypothetical gene supported by
BX647608
1269C2154AF007144DIO2Deiodinase, iodothyronine, type II
1270C4105XM_376503ENPP4Ectonucleotide
pyrophosphatase/phosphodiesterase
4 (putative function)
1271C4755Z30137LDB3LIM domain binding 3
1272C4873BX537721CMYA5Cardiomyopathy associated 5
1273C7657AI219521AP1G1Adaptor-related protein complex 1,
gamma 1 subunit
1274C8046NM_002864PZPPregnancy-zone protein
1275C9503AA621124LOC338773Hypothetical protein LOC338773
1276C3775BQ003524KCTD12Potassium channel tetramerisation
domain containing 12
1277C4082BC041798POLKPolymerase (DNA directed) kappa
1278C4778N67331SEC63SEC63-like (S. cerevisiae)
1279C6278BC039245SART2Squamous cell carcinoma antigen
recognized by T cells 2
1280C6460W96022Transcribed locus
1281C8119NM_002775PRSS11Protease, serine, 11 (IGF binding)
1282C9118BX114286CD99CD99 antigen
1283C8687NM_006166NFYBNuclear transcription factor Y, beta
1284C9565AK129819LHFPLipoma HMGIC fusion partner
1285C0284AK123940MGC34648Hypothetical protein MGC34648
1286C0728AK095472DKFZp762C1112Hypothetical protein
DKFZp762C1112
1287B9925BC039242TM4SF10Transmembrane 4 superfamily
member 10
1288C0579BX648468DKFZP564J0863DKFZP564J0863 protein
1289C1100BG257592FAIMFas apoptotic inhibitory molecule
1290C7731AF245505DKFZp564I1922Adlican
1291C7977AL833463LOC283658Hypothetical protein LOC283658
1292C7992AL833291CMYA3Cardiomyopathy associated 3
1293C9580AK057189NOX4NADPH oxidase 4
1294C9221CR613361RNF24Ring finger protein 24
1295B9888AB023155NAV3Neuron navigator 3
1296C4526N63752MPHOSPH1M-phase phosphoprotein 1
1297C4850BC040502BVESBlood vessel epicardial substance
1298C8203NM_012180FBXO8F-box protein 8
1299D1419NM_018328MBD5Methyl-CpG binding domain protein 5
1300C0544BX640884C14orf24Chromosome 14 open reading frame
24
1301C1403N49231KIAA1345KIAA1345 protein
1302C6728AK000337GFOD1Glucose-fructose oxidoreductase
domain containing 1
1303C7585AK095271LOC128977Hypothetical protein LOC128977
1304C7687CB119523IL6STInterleukin 6 signal transducer
(gp130, oncostatin M receptor)
1305C9008D82786TA-PP2CT-cell activation protein phosphatase
2C
1306C0893BC052210GARPGlycoprotein A repetitions
predominant
1307C2259CA436350Transcribed locus
1308C3895BC035090KPNA3Karyopherin alpha 3 (importin alpha
4)
1309C4350BX089823FRMD3FERM domain containing 3
1310C7057H22566DACH1Dachshund homolog 1 (Drosophila)
1311C7574AB028993NLGN1Neuroligin 1
1312C0371CA431042Transcribed locus
1313C0844BC009951COLEC11Collectin sub-family member 11
1314C1091AI263903SIAT10Sialyltransferase 10 (alpha-2,3-
sialyltransferase VI)
1315C0922AF378757PLXDC2Plexin domain containing 2
1316C4175BM683457EPHA7EphA7
1317C4681XM_071793C14orf28Chromosome 14 open reading frame
28
1318C6523NM_198968DZIP1DAZ interacting protein 1
1319C6706BC033034DIXDC1DIX domain containing 1
1320C6572NM_005197CHES1Checkpoint suppressor 1
1321C8146BF697545MGPMatrix Gla protein
1322C7994NM_016150ASB2Ankyrin repeat and SOCS box-
containing 2
1323C8744NM_152309PIK3AP1Phosphoinositide-3-kinase adaptor
protein 1
1324D0018BX091065Transcribed locus
1325D1273AJ001015RAMP2Receptor (calcitonin) activity
modifying protein 2
1326B9880CR749402NFASCNeurofascin
1327C2088AF161423COMMD10COMM domain containing 10
1328C4351CN430728Transcribed locus
1329C6723AA028127CD209CD209 antigen
1330C7059XM_059702FLJ36748Hypothetical protein FLJ36748
1331C7375CA312122PSMC2Proteasome (prosome, macropain)
26S subunit, ATPase, 2
1332D0007CR596214HNRPA0Heterogeneous nuclear
ribonucleoprotein A0
1333C0318M16451CKBCreatine kinase, brain
1334C0912BQ071673RAMP1Receptor (calcitonin) activity
modifying protein 1
1335C1412BX648776LOC253827Hypothetical protein LOC253827
1336C1603BQ446275HBDHemoglobin, delta
1337C4170AB007884ARHGEF9Cdc42 guanine nucleotide exchange
factor (GEF) 9
1338C4318AI275068Transcribed locus
1339C5860BU683028CDNA FLJ10151 fis, clone
HEMBA1003402
1340C5950CF146489NKX3-1NK3 transcription factor related,
locus 1 (Drosophila)
1341C6708BQ003734Mesenchymal stem cell protein
DSC96
1342C7078AK130067ADAMTS15A disintegrin-like and
metalloprotease (reprolysin type)
with thrombospondin type 1 motif,
15
1343C9587H17302LRRC3BLeucine rich repeat containing 3B
1344D1274BF435815MRNA; cDNA DKFZp564O0862
(from clone DKFZp564O0862)
1345B9884BX641069FLJ20481Hypothetical protein FLJ20481
1346C1622AK074184FLJ34922Hypothetical protein FLJ34922
1347C1902CR591938WDR33WD repeat domain 33
1348C4861BX647931Similar to ENSANGP00000004103
1349C6042H25761
1350C6718AK124339GJA7Gap junction protein, alpha 7, 45 kDa
(connexin 45)
1351C7105R50993
1352C7439AA102033BMPR2Bone morphogenetic protein
receptor, type II (serine/threonine
kinase)
1353D1423AK055040MRNA; cDNA DKFZp313C0240
(from clone DKFZp313C0240)
1354C0357BC035779SLC9A9Solute carrier family 9
(sodium/hydrogen exchanger),
isoform 9
1355C1604AA044381
1356C1422AA095034GK001GK001 protein
1357C2068XM_375527LOC339290Hypothetical protein LOC339290
1358C3978BC030112HIPK3Homeodomain interacting protein
kinase 3
1359C4287CR621395BAG2BCL2-associated athanogene 2
1360C6143NM_001496GFRA3GDNF family receptor alpha 3
1361C5014AI185804FN1Fibronectin 1
1362C6748AF487514GEFTRAC/CDC42 exchange factor
1363C7089H14263GAS1Growth arrest-specific 1
1364C8384X98834SALL2Sal-like 2 (Drosophila)
1365C7744AF196185PARD3Par-3 partitioning defective 3
homolog (C. elegans)
1366D0657AB058780ST6GalIIBeta-galactoside alpha-2,6-
sialyltransferase II
1367D0995BC040983PCDH7BH-protocadherin (brain-heart)
1368C0335CR590615ACTA2Actin, alpha 2, smooth muscle, aorta
1369C2131BQ014434PIAS1Protein inhibitor of activated STAT, 1
1370C3746NM_199511URBSteroid sensitive gene 1
1371C4184NM_020482FHL5Four and a half LIM domains 5
1372C4700AA934589MGC45780Hypothetical protein MGC45780
1373C7603AA292234CDNA FLJ14942 fis, A-
PLACE1011185
1374D1435T15727DNCI1Dynein, cytoplasmic, intermediate
polypeptide 1
1375C2085AA400893PDE1APhosphodiesterase 1A, calmodulin-
dependent
1376C4971BC000234NNMTNicotinamide N-methyltransferase
1377C7050AA084479DNAJC9DnaJ (Hsp40) homolog, subfamily
C, member 9
1378C9868AL136646ARHGAP24Rho GTPase activating protein 24
1379B9970AB014540SWAP70SWAP-70 protein
1380C4998CR591834DSTNDestrin (actin depolymerizing factor)
1381C5058N62595KBTBD7Kelch repeat and BTB (POZ)
domain containing 7
1382C6217NM_001448GPC4Glypican 4
1383C8023M81141HLA-DQB1Major histocompatibility complex,
class II, DQ beta 1
1384D0533AF180681ARHGEF12Rho guanine nucleotide exchange
factor (GEF) 12
1385D2960NM_033281MRPS36Mitochondrial ribosomal protein S36
1386D4169AK128510GOLPH3Golgi phosphoprotein 3 (coat-
protein)
1387E0537BX647115DPYSL2Dihydropyrimidinase-like 2
1388E0690AI743134SERPINE2Serine (or cysteine) proteinase
inhibitor, clade E (nexin,
plasminogen activator inhibitor type
1), member 2
1389D4142AK091311JAZF1Juxtaposed with another zinc finger
gene 1
1390D4211BC069830LETM2Leucine zipper-EF-hand containing
transmembrane protein 2
1391D4328AK021601FLJ11539Hypothetical protein FLJ11539
1392E1219AB011175TBC1D4TBC1 domain family, member 4
1393E0783NM_139033MAPK7Mitogen-activated protein kinase 7
1394D3166AK097340RPESPRPE-spondin
1395D3356NM_014829DDX46DEAD (Asp-Glu-Ala-Asp) box
polypeptide 46
1396D7420AK124757SHPRHSNF2 histone linker PHD RING
helicase
1397D6809AA927082Transcribed locus
1398D4165AK123831LOC149832Hypothetical protein LOC149832
1399D4020AA858162C18orf4Chromosome 18 open reading frame 4
1400D8933BX538309MAMDC2MAM domain containing 2
1401E0644NM_000610CD44CD44 antigen (homing function and
Indian blood group system)
1402D4215AB096175SP5Sp5 transcription factor
1403D5074AA044778CDNA FLJ38215 fis, clone
FCBBF2000291
1404D7205AI040887ARHGEF7Rho guanine nucleotide exchange
factor (GEF) 7
1405D8143AK075059GLIS3GLIS family zinc finger 3
1406E1492AY326464TXNDC5Thioredoxin domain containing 5
1407D4128NM_173060CASTCalpastatin
1408D4739BC022957C9orf102Chromosome 9 open reading frame
102
1409E0358AK021543DNM3Dynamin 3
1410E1300BC040974PDE2APhosphodiesterase 2A, cGMP-
stimulated
1411D9372AI034385SORBS1Sorbin and SH3 domain containing 1
1412E0240NM_020433JPH2Junctophilin 2
1413E0721AW024176FBLN1Fibulin 1
1414D7305BX092512SCNN1ASodium channel, nonvoltage-gated 1
alpha
1415E0139AL390147FAM20CFamily with sequence similarity 20,
member C
1416D1798AK074734FCGRTFc fragment of IgG, receptor,
transporter, alpha
1417D3702AL096748ARMC8Armadillo repeat containing 8
1418D4501CA447839FAM49AFamily with sequence similarity 49,
member A
1419D5553AA031882Transcribed locus
1420D9082NM_052954CYYR1Cysteine and tyrosine-rich 1
1421E0475CR627373EIF4EBP2Eukaryotic translation initiation
factor 4E binding protein 2
1422D6213AK123531CDNA FLJ41537 fis, clone
BRTHA2017985
1423D9915BM463727MEIS4Meis1, myeloid ecotropic viral
integration site 1 homolog 4 (mouse)
1424E0985NM_001343DAB2Disabled homolog 2, mitogen-
responsive phosphoprotein
(Drosophila)
1425D1810NM_002373MAP1AMicrotubule-associated protein 1A
1426D4231C05897ARL5ADP-ribosylation factor-like 5
1427D8491NM_001122ADFPAdipose differentiation-related
protein
1428D9934CA450275FREQFrequenin homolog (Drosophila)
1429E0476AF000984DDX3YDEAD (Asp-Glu-Ala-Asp) box
polypeptide 3, Y-linked
1430E0733NM_004684SPARCL1SPARC-like 1 (mast9, hevin)
1431E0861BX648282ATP2A2ATPase, Ca++ transporting, cardiac
muscle, slow twitch 2
1432D1811AK128814CDNA FLJ25106 fis, clone
CBR01467
1433D4059BF512606Transcribed locus
1434D5243AK074301FAM8A1Family with sequence similarity 8,
member A1
1435D6180AK096674C14orf32Chromosome 14 open reading frame
32
1436D7516AI074524DKFZp434H2111Hypothetical protein
DKFZp434H2111
1437E0726AB023199WDR37WD repeat domain 37
1438E1622NM_001753CAV1Caveolin 1, caveolae protein, 22 kDa
1439E1419AL833496TAF10TAF10 RNA polymerase II, TATA
box binding protein (TBP)-
associated factor, 30 kDa
1440D7796CR613362ALDH6A1Aldehyde dehydrogenase 6 family,
member A1
1441D8862NM_032105PPP1R12BProtein phosphatase 1, regulatory
(inhibitor) subunit 12B
1442E0880AK000617LOC92912Hypothetical protein LOC92912
1443D5244BF510155GPR155G protein-coupled receptor 155
1444D7997AW152624AKAP13A kinase (PRKA) anchor protein 13
1445D8515CR591759LUMLumican
1446E0237AI093257Transcribed locus
1447E0764AF087902TDE2Tumor differentially expressed 2
1448E0896BC045606NIDNidogen (enactin)
1449D1767BC014357CCND2Cyclin D2
1450D4996NM_001001927MTUS1Mitochondrial tumor suppressor 1
1451D9075AL832156CPEB1Cytoplasmic polyadenylation
element binding protein 1
1452E0623AL162079SLC16A1Solute carrier family 16
(monocarboxylic acid transporters),
member 1
1453D6606AI733562Transcribed locus
1454E0082AI082254Transcribed locus
1455E1421BC044777DJ971N18.2Hypothetical protein DJ971N18.2
1456D5395BX094351Transcribed locus
1457F0968AK025758NFATC2Nuclear factor of activated T-cells,
cytoplasmic, calcineurin-dependent 2
1458F1046NM_014583LMCD1LIM and cysteine-rich domains 1
1459F1770AK025713DHX40DEAH (Asp-Glu-Ala-His) box
polypeptide 40
1460F3132AL133095C14orf103Chromosome 14 open reading frame
103
1461F3574NM_016377AKAP7A kinase (PRKA) anchor protein 7
1462F3080NM_006633IQGAP2IQ motif containing GTPase
activating protein 2
1463F9005D50406RECKReversion-inducing-cysteine-rich
protein with kazal motifs
1464F2203AK024352EPHA3EphA3
1465A7714AB002351DMNDesmuslin
1466C6534AI057000Transcribed locus
1467F1119U27460UGP2UDP-glucose pyrophosphorylase 2
1468F1176AY368150KIAA1228KIAA1228 protein
1469F5819BQ671518EEF2KSimilar to NAD(P) dependent steroid
dehydrogenase-like
1470F6592AY358353STK32BSerine/threonine kinase 32B
1471A6371BU681010Full length insert cDNA clone
YT94E02
1472F0018NM_000963PTGS2Prostaglandin-endoperoxide synthase
2 (prostaglandin G/H synthase and
cyclooxygenase)
1473C0081NM_182485CPEB2Cytoplasmic polyadenylation
element binding protein 2
1474F3496AB023148KIAA0931KIAA0931 protein
1475F4227AK001050C10orf118Chromosome 10 open reading frame
118
1476F8898BE841307HRMT1L1HMT1 hnRNP methyltransferase-
like 1 (S. cerevisiae)
1477F3184NM_033380COL4A5Collagen, type IV, alpha 5 (Alport
syndrome)
1478A1331NNM_199072HICI-mfa domain-containing protein
1479A2869AF054839TSPAN-2Tetraspan 2
1480B4350NAF037364PNMA1Paraneoplastic antigen MA1
1481F1120L13463RGS2Regulator of G-protein signalling 2,
24 kDa
1482F4886AK026403TLN2Talin 2
1483F6054AA905353NCBP1Nuclear cap binding protein subunit
1, 80 kDa
1484F6595AW938336CDNA FLJ26188 fis, clone
ADG04821
1485F6738AK022173LAF4Lymphoid nuclear protein related to
AF4
1486B2123NM_005912MC4RMelanocortin 4 receptor
1487C8826AI091545SYNCRIPSynaptotagmin binding, cytoplasmic
RNA interacting protein
1488F0480NM_015635DKFZP434C212DKFZP434C212 protein
1489F2307AF010236SGCDSarcoglycan, delta (35 kDa
dystrophin-associated glycoprotein)
1490F2424AF111783MYH4Myosin, heavy polypeptide 4,
skeletal muscle
1491F4281AF199023PLSCR4Phospholipid scramblase 4
1492F4410AK026500HPCAL1Hippocalcin-like 1
1493F7115AF230201C20orf17Chromosome 20 open reading frame
17
1494F0344AL049957CD59CD59 antigen p18-20 (antigen
identified by monoclonal antibodies
16.3A5, EJ16, EJ30, EL32 and
G344)
1495A7732BC017984ARG99ARG99 protein
1496A3113M60445HDCHistidine decarboxylase
1497B8326AK125533BNIP2BCL2/adenovirus E1B 19 kDa
interacting protein 2
1498B7331H45412EHD2EH-domain containing 2
1499F0196AL050224PTRFPolymerase I and transcript release
factor
1500F0299NM_145693LPIN1Lipin 1
1501F0211BC032379TMEM18Transmembrane protein 18
1502F0307D86425NID2Nidogen 2 (osteonidogen)
1503F3849AF302502PELI2Pellino homolog 2 (Drosophila)
1504F5852AL137573
1505F9522AB011141ZFHX1BZinc finger homeobox 1b
1506A0029NBC063856SPRY1Sprouty homolog 1, antagonist of
FGF signaling (Drosophila)
1507B6193NNM_030806C1orf21Chromosome 1 open reading frame
21
1508C9234AK093732CDNA FLJ36413 fis, clone
THYMU2010816
1509F0121AF089854TU3ATU3A protein
1510F0862AK023375CDNA FLJ13313 fis, clone
OVARC1001489
1511F1093AY029191ASPNAsporin (LRR class 1)
1512F3501AK021708PDZRN3PDZ domain containing RING finger 3
1513F8152AI022632RAB7RAB7, member RAS oncogene
family
1514A3817NAB000114OMDOsteomodulin
1515B3754BC011561HEPHHephaestin
1516C6614AK074076USP47Ubiquitin specific protease 47
1517F0343AK025548TLOC1Translocation protein 1
1518F0615NM_007173PRSS23Protease, serine, 23
1519F2076AL162032GPR133G protein-coupled receptor 133
1520F3313AK025164FLJ21511Hypothetical protein FLJ21511
1521A6689BU741863SPOCKSparc/osteonectin, cwcv and kazal-
like domains proteoglycan (testican)
1522B6462NM_032515BOKBCL2-related ovarian killer
1523C9237XM_211958
1524C0484NM_005472KCNE3Potassium voltage-gated channel,
Isk-related family, member 3
1525F0482AK000008BHMT2Betaine-homocysteine
methyltransferase 2
1526F0528AK025661LIMS1LIM and senescent cell antigen-like
domains 1
1527F0920AF098269PCOLCE2Procollagen C-endopeptidase
enhancer 2
1528F2225AF188700AFAPHypothetical protein LOC254848
1529F1525M24736SELESelectin E (endothelial adhesion
molecule 1)
1530F2310AB002367DCAMKL1Doublecortin and CaM kinase-like 1
1531F3502X05409ALDH2Aldehyde dehydrogenase 2 family
(mitochondrial)
1532F5279L76566HLA-DRB6Major histocompatibility complex,
class II, DR beta 6 (pseudogene)
1533F6175AV700633FLJ10404Hypothetical protein FLJ10404
1534F6365AL080114C10orf72Chromosome 10 open reading frame
72
1535F3573NM_172171CAMK2GCalcium/calmodulin-dependent
protein kinase (CaM kinase) II
gamma
1536D8979AA740585
1537F1289CR623543SC4MOLSterol-C4-methyl oxidase-like
1538F1221AL109700CDNA FLJ37610 fis, clone
BRCOC2011398
1539F3457AB020630PPP1R16BProtein phosphatase 1, regulatory
(inhibitor) subunit 16B
1540F6060AK023814FLJ41603FLJ41603 protein
1541A1022NM98399CD36CD36 antigen (collagen type I
receptor, thrombospondin receptor)
1542B6200NM79123NAP1L5Nucleosome assembly protein 1-like 5
1543F0927AK021823TRIM44Tripartite motif-containing 44
1544A1403J05401CKMT2Creatine kinase, mitochondrial 2
(sarcomeric)
1545B4088NNM_000311PRNPPrion protein (p27-30) (Creutzfeld-
Jakob disease, Gerstmann-Strausler-
Scheinker syndrome, fatal familial
insomnia)
1546F0304NM_002510GPNMBGlycoprotein (transmembrane) nmb
1547F1405AF131837SIAT7ESialyltransferase 7 ((alpha-N-
acetylneuraminyl-2,3-beta-
galactosyl-1,3)-N-acetyl
galactosaminide alpha-2,6-
sialyltransferase) E
1548F1225AF118108XLKD1Extracellular link domain containing 1
1549F4131AF389429SEMA6DSema domain, transmembrane
domain (TM), and cytoplasmic
domain, (semaphorin) 6D
1550C8476R59552CHRDL1Chordin-like 1
1551C1827BC008703TCEAL3Transcription elongation factor A
(SII)-like 3
1552D6878AI002365PDGFRBPlatelet-derived growth factor
receptor, beta polypeptide
1553D7732CB242274Transcribed locus
1554F2379AB002365KIAA0367KIAA0367
1555F1446AJ277587SPIRE1Spire homolog 1 (Drosophila)
1556F3692NM_004673ANGPTL1Angiopoietin-like 1
1557A1101NNM_022977ACSL4Acyl-CoA synthetase long-chain
family member 4
1558B7430NAA522674LIMS2LIM and senescent cell antigen-like
domains 2
1559B7571NBU619137TGFBR3Transforming growth factor, beta
receptor III (betaglycan, 300 kDa)
1560F1143AF070543ODZ2Odz, odd Oz/ten-m homolog 2
(Drosophila)
1561F1241AF114263HH114Hypothetical protein HH114
1562F2686CR616854EVI2BEcotropic viral integration site 2B
1563F2462NM_182734PLCB1Phospholipase C, beta 1
(phosphoinositide-specific)
1564F2715BC035776CILPCartilage intermediate layer protein,
nucleotide pyrophosphohydrolase
1565F4824U82319YDD19YDD19 protein
1566A0203NNM_000043TNFRSF6Tumor necrosis factor receptor
superfamily, member 6
1567A5933XM_059689Similar to CG4502-PA
1568C0524BM724780Transcribed locus, weakly similar to
XP_375099.1 hypothetical protein
LOC283585 [Homo sapiens]
1569C8150NM_014335CRI1CREBBP/EP300 inhibitor 1
1570C9677AL832661LOC143381Hypothetical protein LOC143381
1571E2113BC005248EIF1AYEukaryotic translation initiation
factor 1A, Y-linked
1572F0821AL050030
1573F2190AK021985FBXL7F-box and leucine-rich repeat protein 7
1574F1447NM_014629ARHGEF10Rho guanine nucleotide exchange
factor (GEF) 10
1575F2205AF052181EPIMEpimorphin
1576F0092AK001789SMUG1Single-strand selective
monofunctional uracil DNA
glycosylase
1577A3258U19487PTGER2Prostaglandin E receptor 2 (subtype
EP2), 53 kDa
1578B4152NW89185SET7SET domain-containing protein 7
1579B8840BX648004SPG20Spastic paraplegia 20, spartin
(Troyer syndrome)
1580F1146AK025893RBPMSRNA binding protein with multiple
splicing
1581F0597AK000146CGI-30CGI-30 protein
1582F2464AK027243BBS1Bardet-Biedl syndrome 1
1583F2803AF170562USP25Ubiquitin specific protease 25
1584F4063AL109779HDGFRP3Hepatoma-derived growth factor,
related protein 3
1585F4950NM_194430RNASE4Angiogenin, ribonuclease, RNase A
family, 5
1586F7716BE178490Hypothetical gene supported by
AK093334; AL833330; BC020871;
BC032492
1587A0095J03241TGFB3Transforming growth factor, beta 3
1588A0217M83233TCF12Transcription factor 12 (HTF4,
helix-loop-helix transcription factors
4)
1589F0001NNM_153831PTK2PTK2 protein tyrosine kinase 2
1590A0375NBC057815RRADRas-related associated with diabetes
1591A0911NM63256CDR2Cerebellar degeneration-related
protein 2, 62 kDa
1592C1400BC007632KIAA0318RIM binding protein 2
1593C0661H18687CLDN11Claudin 11 (oligodendrocyte
transmembrane protein)
1594C8718AA206141PRICKLE1Prickle-like 1 (Drosophila)
1595D6726AA897762PPM1AProtein phosphatase 1A (formerly
2C), magnesium-dependent, alpha
isoform
1596F3564CR749667PDE4BPhosphodiesterase 4B, cAMP-
specific (phosphodiesterase E4
dunce homolog, Drosophila)
1597F4186AB023168NLGN4YNeuroligin 4, Y-linked
1598F6116BC030244TNNC1Troponin C, slow
1599F7080AW973637GGTA1Glycoprotein, alpha-
galactosyltransferase 1
1600F7477AW868740SYNPO2Synaptopodin 2
1601F0520BC041337RHOBTB3Rho-related BTB domain containing 3
1602B4181AK021510KCNMB3Potassium large conductance
calcium-activated channel, subfamily
M beta member 3
1603B5089NAA828067C1QBComplement component 1, q
subcomponent, beta polypeptide
1604B7158NXM_085175TTC7BTetratricopeptide repeat domain 7B
1605E1632BU633335SMAD4SMAD, mothers against DPP
homolog 4 (Drosophila)
1606F0174AK024029MOAP1Modulator of apoptosis 1
1607F1147AK125336LOC90167Hypothetical protein LOC90167
1608F4952AL080082MRNA; cDNA DKFZp564G1162
(from clone DKFZp564G1162)
1609B3745N92541Transcribed locus
1610A0270NAF241831HABP4Hyaluronan binding protein 4
1611B6485BC009753ACACBAcetyl-Coenzyme A carboxylase
beta
1612F0416AF082557TNKSTankyrase, TRF1-interacting
ankyrin-related ADP-ribose
polymerase
1613F0470AJ250865TESTestis derived transcript (3 LIM
domains)
1614F0911L08177EBI2Epstein-Barr virus induced gene 2
(lymphocyte-specific G protein-
coupled receptor)
1615F2392NM_001901CTGFConnective tissue growth factor
1616F3618AK172810SLC39A14Solute carrier family 39 (zinc
transporter), member 14
1617F4440AB032773TU12B1-TYTU12B1-TY protein
1618F6326NM_015458MTMR9Myotubularin related protein 9
1619F7458AK123706ADAMTS8A disintegrin-like and
metalloprotease (reprolysin type)
with thrombospondin type 1 motif, 8
1620A1666NNM_000176NR3C1Nuclear receptor subfamily 3, group
C, member 1 (glucocorticoid
receptor)
1621A3471NM_006281STK3Serine/threonine kinase 3 (STE20
homolog, yeast)
1622B7499BX641020ARID5BAT rich interactive domain 5B
(MRF1-like)
1623B8216CR623023Full-length cDNA clone
CS0DC029YI23 of Neuroblastoma
Cot 25-normalized of Homo sapiens
(human)
1624F0286NM_000132F8Coagulation factor VIII,
procoagulant component
(hemophilia A)
1625F1338AF056195NAGNeuroblastoma-amplified protein
1626F2115AK021795BNC2Basonuclin 2
1627F2699AF022789USP12Ubiquitin specific protease 12
1628F5702AK024358MPEG1Macrophage expressed gene 1
1629A0279NM_005257GATA6GATA binding protein 6
1630A3940AF048722PITX2Paired-like homeodomain
transcription factor 2
1631F0004NM_005252FOSV-fos FBJ murine osteosarcoma
viral oncogene homolog
1632G2550NM_000962PTGS1Prostaglandin-endoperoxide synthase
1 (prostaglandin G/H synthase and
cyclooxygenase)
1633B2787CR619015MRGPRFMAS-related GPR, member F
1634B6424AL049313CLIC5Chloride intracellular channel 5
1635C0810AK123757EBFEarly B-cell factor
1636F2322AL080213PDE4DIPPhosphodiesterase 4D interacting
protein (myomegalin)
1637F1600AB038523MBIPMAP3K12 binding inhibitory protein 1
1638F2393M14091SERPINA7Serine (or cysteine) proteinase
inhibitor, clade A (alpha-1
antiproteinase, antitrypsin), member 7
1639F2908AK023821MACF1Microtubule-actin crosslinking factor 1
1640A8838AK075242MGC45438Hypothetical protein MGC45438
1641B4271AB011121ALS2CR3Amyotrophic lateral sclerosis 2
(juvenile) chromosome region,
candidate 3
1642B7509CN268436CDNA clone IMAGE: 5263177,
partial cds
1643B9025BU537728HSA9761Putative dimethyladenosine
transferase
1644F0288BC080187LMOD1Leiomodin 1 (smooth muscle)
1645F0333AK026095SNTB1Syntrophin, beta 1 (dystrophin-
associated protein A1, 59 kDa, basic
component 1)
1646F0728NM_021614KCNN2Potassium intermediate/small
conductance calcium-activated
channel, subfamily N, member 2
1647F1259AK000776Full-length cDNA clone
CS0DD009YB17 of Neuroblastoma
Cot 50-normalized of Homo sapiens
(human)
1648F2702AL049990MRNA; cDNA DKFZp564G112
(from clone DKFZp564G112)
1649F4940BC035161CRY2Cryptochrome 2 (photolyase-like)
1650A4080AF054992PKD2Polycystic kidney disease 2
(autosomal dominant)
1651A9898BC010353PTPLAProtein tyrosine phosphatase-like
(proline instead of catalytic
arginine), member a
1652B1461NCR744550MYO9AMyosin IXA
1653C0591AB014523ULK2Unc-51-like kinase 2 (C. elegans)
1654C1450AB075828ZNF545Zinc finger protein 545
1655F0518AF035307PLXNC1Plexin C1
1656F2283AJ276316ZNF304Zinc finger protein 304
1657F2335AK001832FLJ10970Hypothetical protein FLJ10970
1658F5448AK023831FLJ13769Hypothetical protein FLJ13769
1659F2161AF116646GALNACT-2Chondroitin sulfate GalNAcT-2
1660A1157NNM_002667PLNPhospholamban
1661B4276AK056725CDNA FLJ32163 fis, clone
PLACE6000371
1662B5186NAK056963Full length insert cDNA clone
ZE03F06
1663C6412BX090035Transcribed locus
1664F0182BC009203LOC90355Hypothetical gene supported by
AF038182; BC009203
1665F1343BC032404DKFZp434D0215SH3 domain protein D19
1666F4628AF119893

Identification of C2093, B5860N and C6055 as Up-Regulated Genes in Bladder Cancer Cells

When gene-expression profiles of cancer cells from 33 bladder cancer patients were analyzed using a cDNA microarray representing 27,648 human genes, 394 genes that were commonly up-regulated in bladder cancer cells were identified. Among them, attention was focused on the genes with the in-house codes C2093, which designated M-phase phosphoprotein 1 (MPHOSPH1) (Genebank Accession NM016195 (SEQ ID NO.1, encoding SEQ ID NO.2)), B5860N, designated DEP domain containing 1 (DEPDC1) (SEQ ID NO.3, encoding SEQ ID NO.4), and C6055, designated MGC34032 hypothetical protein, (Genebank Accession NM152697 SEQ ID NO: 133, encoding SEQ ID NO: 134). Expression of the C2093, B5860N and C6055 genes were elevated in 24 of 25, 17 of 20 and 21 of 32 bladder cancer cases which were able to obtain expression data, respectively. To confirm the expression of these up-regulated genes, semi-quantitative RT-PCR analysis was performed to compare the expression level between bladder cancer specimens and normal human tissues including normal bladder cancer cells. Firstly, it was discovered that C2093 showed the elevated expression in 17 of 21 clinical bladder cancer samples, as compared to normal bladder cells and normal human tissues including lung, heart, liver and kidney (FIGS. 1a and b). In addition, this gene was overexpressed in all of six bladder cancer cell lines as well (FIG. 1b). Next, it was discovered that B5860N showed the elevated expression in 20 of 21 clinical bladder cancer specimens compared to normal human tissues, especially normal bladder mRNA (FIGS. 1a and c), and was overexpressed in all of six bladder cancer cell lines we examined (FIG. 1c).

To further examine the expression pattern of these genes, northern blot analyses were performed with multiple-human tissues and bladder cancer cell lines using cDNA fragments of C2093, B5860N and C6055 as probes (see Material and Method). Expression of C2093 was no or undetectable in normal human tissues except testis (FIG. 2e; the upper panel), while was surprisingly overexpressed in all of bladder cancer cell lines (FIG. 2e; the bottom panel). B5860N was also exclusively expressed in testis (FIG. 2f, the upper panel), while was significantly overexpressed in all of bladder cancer cell lines, compared to in other normal tissues, especially in normal human bladder (FIG. 2f, the bottom panel). C6055 was also no or undetectable in normal human tissues (FIG. 2g; the upper panel), while was overexpressed in three of six bladder cancer cell lines (FIG. 2g; the bottom panel). Thus, attention was focused the bladder cancer specifically expressed transcripts.

Genomic Structure of C2093, B5860N and C6055

To obtain the entire cDNA sequences of C2093, B5860N and C6055, RT-PCR was performed as EST-walking, and 5′RACE and 3′RACE experiments using bladder cancer cell line, SW780, as template (see Materials and Methods) because C2093 initially was not full length on database. C2093 consists of 31 exons, designated M-phase phosphoprotein 1 (MPHOSPH1), located on the chromosome 10q23.31. The full-length mRNA sequences of C2093 contained 6319 nucleotides, encoding 1780 amino acids. The ORF of this transcript starts at within each exon 1.

B5860N, designated DEP domain containing 1 (DEPDC1), located on the chromosome 1p31.2. This gene has also two different transcriptional variants consisting of 12 and 11 exons, corresponding to B5860N V1 (SEQ ID NO.3, encoding SEQ ID NO.4) and B5860N V2 (SEQ ID NO.5, encoding SEQ ID NO.6), respectively (FIG. 3b). There were alternative variations in exon 8 of V1, and the other remaining exons were common to both variants. V2 variant has no exon 8 of the V1, generating same stop codon within last exon. The full-length cDNA sequences of B5860NV1 and B5860NV2 variants consist of 5318 and 4466 nucleotides, respectively. The ORF of these variants start at within each exon 1. Eventually, V1 and V2 transcripts encode 811 and 527 amino acids, respectively. To further confirm the expression pattern of each variant in bladder cancer cell lines and normal human tissues including bladder, heart, lung, liver, kidney, brain, pancreas, northern blot analysis was performed. As a result, it was discovered that both variants were highly overexpressed in bladder cancer cells, but no or undetectable expression in normal human tissues (FIG. 2f, lower panel) except testis. In particular, V2 transcript was expressed exclusively in testis. Therefore, functional analysis for both variants of B5860N were further performed.

According to the database from NCBI, C6055 consists of 24 exons, designated MGC34032, located on the chromosome 1p31.3. Because C6055 is not included within last exon (exon 24) of MGC34032 on database, we performed RT-PCR as EST-walking, and 5′RACE experiments using bladder cancer cell line, SW780, as a template to obtain the entire cDNA sequence of C6055 (see Materials and Methods). As a result, we found two novel transcripts, C6055V1 (SEQ ID NO: 129, encoding SEQ ID NO: 130) and C6055V2 (SEQ ID NO: 131, encoding SEQ ID NO: 132). Eventually, this gene has four different splicing variants consisting of 24, 25, 22 and 22 exons, corresponding to MGC34032, Genbank Accession No. AK128063, C6055V1 and C6055V2, respectively (FIG. 3c). There were alternative splicing in exon 1, 2, 3, 4 and 24 of MGC34032, and the other remaining exons were common among four transcripts. C6055V1 and C6055V2 transcripts have no exon 1, 2 and 3 of MGC34032, generating same stop codon within last exon. In particular, the ORF of C6055V1 and C6055V2 transcripts start at within each exon 4, indicating C6055V1 and C6055V2 transcripts have same ORF. The full-length cDNA sequences of MGC34032, Genbank Accession No. AK128063, C6055V1 and C6055V2 transcripts consist of 2302, 3947, 3851, and 3819 nucleotides, respectively. Eventually, MGC34032, Genbank Accession No. AK128063, C6055V1 and C6055V2 transcripts encode 719, 587, 675 and 675 amino acids, respectively. To further confirm the expression pattern of each variant in bladder cancer cell lines and normal human tissues including bladder, heart, lung, liver, kidney, brain, testis, pancreas, we performed northern blot analysis using a cDNA fragment C6055 for microarray as a probe. As a result, approximately 3.9 kb transcripts were highly overexpressed in some bladder cancer cells (HT-1376, SW780 and RT4), but no or undetectable expression in normal human tissues (FIG. 2g upper panel). In addition, 7.5 kb transcript was specifically expressed only in HT1376 cells, but we have not yet identified the entire mRNA sequence of this transcript. Furthermore, when we performed northern blot analysis using the common region among these transcripts as a probe, we detected 2.3 kb transcript exclusively in normal testis, corresponding to MGC34032 (FIG. 2g middle and lower panel). Therefore, we further perform functional analysis for C6055V1 gene product.

Subcellular Localization of C2093, B5860N and C6055

To further examine the characterization of C2093, B5860N and C6055, the sub-cellular localization of these gene products was examined in COS7 cells. Firstly, when plasmids expressing the C2093 protein (pCAGGS-C2093-HA) were transiently transfected into COS7 cells, the 210 KDa-C2093 protein was observed as an expected size by Western blot analysis (FIG. 4a). Immunocytochemical staining reveals exogenous C2093 mainly localized to the nucleus apparatus in COS7 cells, but in some cells was observed to be accumulated around chromosome (FIG. 4b). Therefore, the cells were synchronized using aphidicolin and examine C2093 protein localization during cell-cycle progression. Notably the protein was located in nuclei at G1/G0 and S phases, and, especially, accumulated around chromosome during G2/M phase (FIG. 4c).

Next, when plasmids expressing B5860NV1 or V2 proteins (pCAGGS-B5860NV1-HA or pCAGGS-B5860NV2-HA) were transiently transfected into COS7, respectively, exogenous B5860NV1 and V2 proteins were observed as each expected size by Western blot analysis at 24 and 48 hours after transfection (FIG. 4d, V1; left panel, V2 right panel). Moreover, immunocytochemical staining reveals that B5860NV1 localized to the cytoplasm (FIG. 4e, upper panel), but some cells was also observed to be nuclei apparatus (FIG. 4e, bottom panel), ant that B5860NV2 mainly localized to the cytoplasm (FIG. 4f, upper panel), and some cells was also observed under cytoplasmic membrane (FIG. 4f, bottom panel). Therefore, the cells were synchronized using aphidicolin and examined B5860NV1 and V2 proteins localization during cell-cycle progression. B5860NV1 protein was located in nuclei at G1/G0 and S phases, but localized under cytoplasmic membrane during G2/M phases (FIG. 4g), but B5860NV2 protein was located under cytoplasmic membrane during G2/M phase (FIG. 4h). Furthermore, when both plasmids expressing B5860NV1 and V2 proteins were transiently co-transfected into COS7, it was observed that B5860NV1 protein located in nuclei and cytoplasm apparatus, and B5860NV2 located nuclei and translocated to under cytoplasmic membrane during G2/M phase (FIG. 4i).

To further determine the subcellular localization of endogenous C2093 localization during cell cycle progression by immunocytochemical analysis using affinity-purified anti-C2093 antibodies. Endogenous C2093 protein was localized in the nucleus during interphase, but in the cytoplasm during prophase, metaphase and early anaphase, especially located in the midbody in late anaphase, and then near the contractile ring in telophase (FIG. 4j). Therefore, C2093 may play an important role in the cytokinesis.

Next, we examined endogenous B5860N in bladder cancer cells during cell cycle progression as well as C2093, we performed immunocytochemical analysis using affinity-purified B5860N polyclonal antibodies. Endogenous B5860N protein was localized mainly in the nucleus during interphase, but in the cytoplasm during M-phase (FIG. 4k).

The SMART and SOSUI computer predictions revealed that the predicted C6055 protein contained 8th, 9th or 10th transmembrane domains. To confirm this prediction, we examined the sub-cellular localization of this gene product in COS7 cells at 36 and 60 hours after transfection. Firstly, when we transiently transfected plasmids expressing C6055 protein (pCAGGS-C6055-HA) into COS7 cells, we performed Western blot analysis using an anti-HA tag antibody. The results showed a 67 KDa-band corresponding to the predicted size of the C6055 protein as well as an additional 75 KDa band (FIG. 4l). To verify whether the 75 KDa band represented a form of C6055 modified by phosphorylation or glycosylation, we treated the cellular extracts with λ-phosphatase, O-glycosidase or N-glycosidase and O-glycosidase before immunoblotting. Although the 75-kDa band did not disappear after phosphatase and O-glycosidase, it disappeared after O-glycosidase treatment, suggesting that C6055 protein was O-glycosylated only in living cells (FIG. 4m). To investigate the subcellular localization of C6055 protein, we performed fluorescent immunohistochemical staining in C6055-transfected COS7 cells. The results revealed exogenous C6055 mainly localized to cytoplasmic membrane in COS7 cells at 60 hours although we observed C6055 localization in cytoplasm at 36 hours (FIG. 4n).

Growth-Inhibitory Effects of Small-Interfering RNA (siRNA) Designed to Reduce Expression of C2093, B5860N and C6055

To assess the growth-promoting role of C2093, B5860N and C6055, the expression of endogenous C2093, B5860N and C6055 was knocked down in bladder cancer lines, J82, UMUC3 and SW780 that have shown the overexpression of C2093, B5860N and C6055, by means of the mammalian vector-based RNA interference (RNAi) technique (see Materials and Methods). Expression levels of C2093, B5860N and C6055 were examined by semi-quantitative RT-PCR experiments. As shown in FIGS. 5 to 7 C2093, B5860N and C6055-specific siRNAs significantly suppressed expression of each gene, compared with control siRNA constructs (psiU6BX-EGFP and SCR) (FIG. 5a, 5d, 6a, 7a). To confirm the cell growth inhibition with C2093, B5860N and C6055-specific siRNAs, we performed colony-formation and MTT assays were performed, respectively. Introduction of C2093-si3 constructs suppressed growth of J82 and UMUC3 cells (FIG. 5 b, c, e, f), B5860N-si3 constructs suppressed growth of J82 cells (FIG. 6b, c) and C6055-si-08 constructs suppressed growth of SW780 cells (FIG. 7b, c), consisting with the result of above reduced expression. Each result was verified by three independent experiments. These findings suggest that C2093, B5860N and C6055 have a significant function in the cell growth of the bladder cancer.

In particular, to further elucidate the role of C2093 in cytokinesis, we transfected C2093-siRNA into bladder cancer cell line UMUC3 cells and then observed cell morphology by microscopy on 7 days after transfection. We confirmed expression of C2093 protein was knockdowned by C2093-siRNA (FIG. 8b), and observed multi-nucleated cells in siRNA-transfected cells (FIG. 8a, c), indicating si-C2093 knockdown cells failed in cytokinesis.

Expression of C2093 and B6850N Proteins in Clinical Samples.

We performed immunohistochemical analysis of C2093 or B5860N in surgically resected invasive bladder cancer tissue and normal bladder tissue sections and various normal tissues (kidney, heart, lung and liver), respectively. Strong staining against both proteins were observed only in bladder cancer tissues (FIG. 9a, b), and undetectable staining of C2093 was observed normal bladder tissue (FIG. 9a).

Discussion:

In this report, through the precise expression profiles of bladder cancer by means of genome wide cDNA microarray, novel genes, C2093, B5860N and C6055 that were significantly overexpressed in bladder cancer cells, as compared to normal human tissues, were isolated.

The B5860N protein was observed to localize in cytoplasm as intermediate filaments by immunochemical staining, suggesting that B5860N may play a key role of interaction of cell to cell.

Furthermore, it was demonstrated that treatment of bladder cancer cells with siRNA effectively inhibited expression of all three target genes, C2093, B5860N and C6055 and significantly suppressed cell/tumor growth of bladder cancer. These findings suggest that C2093, B5860N and C6055 might play key roles in tumor cell growth proliferation, and may be promising targets for development of anti-cancer drugs.

INDUSTRIAL APPLICABILITY

The gene-expression analysis of bladder cancer described herein, obtained through a combination of laser-capture dissection and genome-wide cDNA microarray, has identified specific genes as targets for cancer prevention and therapy. Based on the expression of a subset of these differentially expressed genes, the present invention provides molecular diagnostic markers for identifying and detecting bladder cancer.

The methods described herein are also useful in the identification of additional molecular targets for prevention, diagnosis and treatment of bladder cancer. The data reported herein add to a comprehensive understanding of bladder cancer, facilitate development of novel diagnostic strategies, and provide clues for identification of molecular targets for therapeutic drugs and preventative agents. Such information contributes to a more profound understanding of bladder tumorigenesis, and provide indicators for developing novel strategies for diagnosis, treatment, and ultimately prevention of bladder cancer.

The expression of human genes C2093, B5860Ns and C6055s are markedly elevated in bladder cancer as compared to non-cancerous bladder tissue. Accordingly, these genes are useful as a diagnostic marker of bladder cancer and the proteins encoded thereby are useful in diagnostic assays of bladder cancer.

The present inventors have also shown that the expression of the C2093, B5860Ns or C6055s proteins promote cell growth whereas cell growth is suppressed by small interfering RNAs corresponding to the C2093, B5860Ns or C6055s genes. These findings show that C2093, B5860Ns and C6055s proteins stimulates oncogenic activity. Thus, each of these oncoproteins is a useful target for the development of anti-cancer pharmaceuticals. For example, agents that block the expression of C2093, B5860Ns or C6055s, or prevent its activity find therapeutic utility as anti-cancer agents, particularly anti-cancer agents for the treatment of bladder cancers. Examples of such agents include antisense oligonucleotides, small interfering RNAs, and ribozymes against the C2093, B5860Ns or C6055s gene, and antibodies that recognize C2093, B5860Ns or C6055s.

All patents, patent applications, and publications cited herein are incorporated by reference in their entirety.

Furthermore, while the invention has been described in detail and with reference to specific embodiments thereof, it is to be understood that the foregoing description is exemplary and explanatory in nature and is intended to illustrate the invention and its preferred embodiments. Through routine experimentation, one skilled in the art will readily recognize that various changes and modifications can be made therein without departing from the spirit and scope of the invention. Thus, the invention is intended to be defined not by the above description, but by the following claims and their equivalents.