REGULATOR FOR FLOWERING TIME, TRANSGENIC PLANT TRANSFORMED WITH THE SAME, AND METHOD FOR REGULATING FLOWERING TIME
Kind Code:
A1
The present invention relates to a flowering-time and/or stem elongation regulator isolated from rice, which is selected from OsMADS50, OsMADSS1, OsMADS56, OsMADS14, OsTRX1, OsVIN1, OsCOL4 and OsCOLS, a DNA construct containing the regulator, a transgenic plant, a part thereof, and plant cell transformed with the DNA construct, and method to control flowering-time and/or stem elongation using the regulator. In the present invention, the flowering-time and/or stem elongation can be controlled, and thereby, various agricultural benefits obtained.

Inventors:
AN, Gynheung (POHANG-CITY, KR)
Lee, Shinyoung (KWANGJU, KR)
Jeong, Dong-hoon (POHANG-CITY, KR)
Yoo, Jihye (SEOUL, KR)
Ryu, Choong-hwan (POHANG-CITY, KR)
Jeon, Jong-seong (POHANG-CITY, KR)
Kim, Sung-ryul (POHANG-CITY, KR)
Kim, Young-ock (POHANG-CITY, KR)
Kim, Joonyul (POHANG-CITY, KR)
AN, Suyoung (POHANG-CITY, KR)
Han, Jong-jin (POHANG-CITY, KR)
Han, Min-jung (POHANG-CITY, KR)
Application Number:
11/767193
Publication Date:
05/14/2009
Filing Date:
06/22/2007
View Patent Images:
Export Citation:
Assignee:
POSCO (Pohang, KR)
POSTECH Foundation (Pohang, KR)
Primary Class:
Other Classes:
536/23.6, 800/290, 435/468, 530/370, 435/419, 435/320.1, 800/298
International Classes:
C12N15/82; C12N15/29; A01H5/00; A01H1/06; C07K14/00
Attorney, Agent or Firm:
Jhk, Law (P.O. BOX 1078, LA CANADA, CA, 91012-1078, US)
Claims:
1. A flowering-time regulator having a gene selected form the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5; truncated OsMADS14 gene of SEQ ID NO: 17 wherein the 3′-terminal region containing the C domain coding sequence is deleted; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 1; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13.

2. The flowering-time regulator according to claim 1, which has a gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, and which has a function of activating flowering.

3. The flowering-time regulator according to claim 1, which has a gene selected from the group consisting of OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5; and OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11, and which has a function of inhibiting flowering.

4. The flowering-time regulator according to claim 1, which has truncated OsMADS14 gene of SEQ ID NO: 17 wherein the 3′-terminal region containing the C domain coding sequence is deleted, and which has an activity to activate flowering under short-day conditions and to inhibit flowering under long-day conditions.

5. A flowering-time regulator of monocotyledon, which has a counterpart gene corresponding to a rice gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5; Truncated OsMADS14 gene of SEQ ID NO: 17 wherein the 3′-terminal region containing the C domain coding sequence is deleted; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13.

6. A stem elongation regulator of rice which has OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1.

7. A flowering-time regulating protein, which is encoded by the regulator of claim 1, and has an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, and SEQ ID NO: 18.

8. A DNA construct containing a flowering-time regulator having a gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5; Truncated OsMADS14 gene of SEQ ID NO: 17 wherein the 3′-terminal region containing the C domain coding sequence is deleted; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, wherein the flowering-time regulator is overexpressed by operable linkage to a strong promoter operable in plants, or an enhancer, or is suppressed by insertion of a foreign gene which can be inserted into a plant gene, or an endogenous transposon, or by deletion of the whole or part of the sequence.

9. The DNA construct according to claim 8, wherein the flowering-time regulator is overexpressed by operable linkage to maize ubiquitin (ubi) promoter.

10. The DNA construct according to claim 8, wherein the flowering-time regulator is overexpressed by insertion of T-DNA containing 35S enhancer into the promoter region of the regulator.

11. The DNA construct according to claim 8, wherein the flowering-time regulator is suppressed by insertion of T-DNA or an endogenous transposon.

12. The DNA construct according to claim 8, wherein the flowering-time regulator is suppressed by deletion of the whole or part of the sequence.

13. The DNA construct according to claim 8, containing the flowering-time regulator having the OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1, wherein the OsMADS50 gene is suppressed by insertion of T-DNA into the fourth intron.

14. The DNA construct according to claim 8, containing the flowering-time regulator having the gene selected from the group consisting of OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, wherein the flowering-time regulator is suppressed by insertion of T-DNA into the first exon or 3′ UTR region.

15. A transgenic plant, a part thereof, or a plant cell transformed by a DNA construct containing a flowering-time regulator having a gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5; Truncated OsMADS14 gene of SEQ ID NO: 17 wherein the 3′-terminal region containing the C domain coding sequence is deleted; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, wherein the flowering-time regulator is overexpressed by operable linkage with a strong promoter workable in plant, or an enhancer, or is suppressed by insertion of a foreign gene which can be inserted into a plant gene, or an endogenous transposon, or by deletion of the whole or part of the sequence, to exhibit late- or early-flowering phenotype.

16. The transgenic plant, a part thereof or a plant cell according to claim 15, which transformed with the DNA construct containing the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, wherein the flowering-time regulator is overexpressed by operable linkage with maize ubiquitin (ubi) promoter, to exhibit early-flowering phenotype.

17. The transgenic plant, a part thereof or a plant cell according to claim 15, which transformed with the DNA construct containing the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, wherein the flowering-time regulator is overexpressed by insertion of T-DNA containing a 35S enhancer into the promoter region, to exhibit early-flowering phenotype.

18. The transgenic plant, a part thereof or a plant cell according to claim 15, which is transformed with the DNA construct containing the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, wherein the flowering-time regulator is suppressed by insertion of T-DNA or an endogenous transposon, to exhibit a late-flowering phenotype.

19. The transgenic plant, a part thereof or a plant cell according to claim 15, which is transformed with the DNA construct containing the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, wherein the flowering-time regulator is suppressed by modification of the whole or part of the gene, to exhibit a late-flowering phenotype.

20. The transgenic plant, a part thereof or a plant cell according to claim 15, which is transformed with the DNA construct containing the flowering-time regulator having OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1, wherein the OsMADS50 gene is suppressed by insertion of T-DNA into the fourth intron, or transformed with the DNA construct containing the flowering-time regulator having OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, wherein the OsCOL8 gene is suppressed by insertion of T-DNA into the first exon or 3′ UTR region, to exhibit a late-flowering phenotype.

21. The transgenic plant, a part thereof or a plant cell according to claim 15, which is transformed with the DNA construct containing the flowering-time regulator having the gene selected from the group consisting of OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5 and OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11, wherein the flowering-time regulator is overexpressed by operable linkage with a strong promoter, or insertion of a foreign gene containing an enhancer which can be inserted into a plant gene into a promoter region, to exhibit a late-flowering phenotype.

22. The transgenic plant, a part thereof or a plant cell according to claim 15, which is transformed with the DNA construct containing the flowering-time regulator having the gene selected from the group consisting of OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5 and OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11, the flowering-time regulator is suppressed by insertion of T-DNA or an endogenous transposon, or modification of the whole or part of the sequence, to exhibit an early-flowering phenotype.

23. The transgenic plant, a part thereof or a plant cell according to claim 15, which is transformed with the DNA construct containing the flowering-time regulator having truncated OsMADS14 gene of SEQ ID NO: 17 wherein the 3′-terminal region containing the C domain coding sequence is deleted, wherein the C domain region deleted partial OsMADS14 protein is overexpressed, to exhibit an early-flowering phenotype.

24. The transgenic plant, a part thereof or a plant cell according to claim 1, wherein the plant is rice.

25. A method to regulate flowering-time, comprising the step of inducing overexpression of a flowering-time regulator by operable linkage with a strong promoter workable in plant or an enhancer workable in plant, or inducing suppression by insertion of a foreign gene which can be inserted into a plant gene or an endogenous transposon, or by deletion of the whole or part of the following sequence, to activate or inhibit flowering of plant, wherein the flowering-time regulator has a gene selected from the OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5; Truncated OsMADS14 gene of SEQ ID NO: 17 wherein the 3′-terminal region containing the C domain coding sequence is deleted; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13.

26. The method according to claim 25, comprising the step of inducing overexpression of the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, by operably linking with maize ubiquitin (ubi) promoter, to activate flowering of plant.

27. The method according to claim 25, comprising the step of inducing overexpression of the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, by insertion T-DNA containing a 35S enhancer into the promoter region of the regulator, to activate flowering of plant.

28. The method according to claim 25, comprising the step of inducing suppression of the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, by insertion of T-DNA or an endogenous transposon, to inhibit flowering of plant.

29. The method according to claim 25, comprising the step of inducing suppression of the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, by modification of the whole or part of the sequence, to inhibit flowering of plant.

30. The method according to claim 25, comprising the step of inducing suppression of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1 by insertion of T-DNA into the fourth intron, or inducing suppression of OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13 by insertion of T-DNA into the first exon or 3′ UTR region, to inhibit flowering of plant.

31. The method according to claim 25, comprising the step of inducing overexpression of the flowering-time regulator having the gene selected from the group consisting of OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5 and OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11, by operably linking with a strong promoter, or inserting a foreign gene containing an enhancer which can be inserted into a plant gene into a promoter region, to inhibit flowering of plant.

32. The method according to claim 25, comprising the step of inducing suppression of the flowering-time regulator having the gene selected from the group consisting of OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5 and OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11, by insertion of T-DNA or an endogenous transposon, or deletion of the whole or part of the sequence, to activate flowering of plant.

33. The method according to claim 25, comprising the steps of deleting 3′-terminal region having a nucleotide sequence of SEQ ID NO: 14 or SEQ ID NO: 15, and overexpressing C domain deleted partial OsMADS14 protein having an amino acid sequence of SEQ ID NO: 18, to activate flowering of plant.

34. The method according to claim 25, wherein the plant is rice.

35. A method to prepare a flowering-time regulated transgenic plant, a part thereof, or a plant cell, comprising the steps of: providing a plant cell; transforming the plant cell with the DNA construct of claim 8 and cultivating the transformed cell.

36. A method to regulate stem elongation, comprising the step of inducing overexpression or suppression of OsMADS50 gene having a nucleotide sequence of SEQ ID NO: 1.

Description:

FIELD OF THE INVENTION

The present invention relates to a regulator for flowering-time and/or internodes elongation, a transgenic plant transformed with the regulator, and a method to regulate flowering-time and/or stein elongation in plant.

BACKGROUND OF THE INVENTION

The growth phase of plants generally includes a vegetative growth phase and a reproductive growth phase. The transition from vegetative to reproductive growth is affected by various flowering signals. The flowering signals are affected by various factors, such as genetic factors such as genotype, and environmental factors such as photoperiod and light intensity, etc. (Dung et al., 1998; Yamamoto et al., 1998). The transition in the growth phase leads to various morphological changes of plant, which is interesting from a scientific viewpoint. Furthermore, due to the economic benefits gained by flowering regulation, many studies on flowering mechanisms have been carried out.

In particular, molecular genetic studies of Arabidopsis (hereafter, Arabidopsis ) have shown the functions of the flowering regulatory genes and their interrelationships, elucidating the signaling pathway of flowering. In Arabidopsis , the flowering is affected by external signals, such as light, temperature, photoperiod, etc., and internal signals such as nutritive conditions, hormones, etc. The flowering pathway generally includes the photoperiod-dependent pathway, the vernalization-dependent pathway, the GA (gibberellin)-dependent pathway, and the endogenous pathway.

In rice, it has been reported that flowering-time is mainly controlled by the photoperiod-dependent pathway and the endogenous pathway (Yamamoto et al., 1998). Recently, several genes which are thought to be involved in the photoperiod-dependent pathway in rice have been isolated and identified, characterizing the photoperiod-dependent pathway to some degree. (Yano et al., 2001 Mouradov et al., 2002). Firstly, several specific gene loci which are involved in controlling photoperiod sensitivity, such as Se (Photoperiodic sensitivity)1 (Se1), Se3-Se7, and EE1-E3, have been identified (Poonyarit et al., 1989; Sano, 1992; Tsai, 1995; Yokoo et al., 1980; Yokoo and Okuno, 1993). (Furthermore, by quantitative trait loci (QTL) analyses using molecular level markers, several tens of gene loci involved in controlling heading date, such as Heading date 1 (Hd1), Heading date 6 (Hd6), Heading date 3a (Hd3a), etc., have been detected (Li et al., 1995; Lin et al., 1996, 1998; Maheswaran et al., 2000; Yano et al., 1997; Xiao et al., 1995). Among the above genes, Se5, Hd1, Hd6 and Hd3a are counterparts of LONG HYPOCOTYL 1 (HY1), CONSTANS (CO), CASEIN KINASE 2 (CK2) and FLOWERING LOCUS T (FT) of Arabidopsis , respectively, and they are expected to have biochemical functions similar to the counterparts in Arabidopsis.

However, in some cases, the above genes of rice and Arabidopsis show different responses to photoperiod. CO of Arabidopsis is a gene which is involved in long-day (LD) promotion pathway to activate flowering. There are orthologs of CONSTANS in rice, and among them, Hd1 (Heading date1) gene regulates the flowering-time. Hd1 gene of rice, which encodes a protein containing a zinc finger domain and a nuclear localization signal, increases expression of Hd3a gene to activate flowering under short-day (SD) conditions, whereas it decreases expression of Hd3a gene to inhibit flowering under LD conditions (Izawa et al., 2002). In Arabidopsis , the CO gene, which is an ortholog of Hd1 of rice, increases expression of the FT gene (an ortholog of Hd3a of rice) to activate flowering under long-day conditions. However, the CO does not act as a flowering inhibitor under short-day conditions (Putterill et al., 1995). The molecular level understanding of such different photoperiod reactions depending on plant species is expected to provide a clue for understanding the differences between LD plants and SD plants.

Although flowering-relating genes such as the above have been discovered, they are few in number. Furthermore, rice-specific genes distinguished from Arabidopsis genes have been mostly unknown, and long-day specific flowering regulators and regulators for controlling the endogenous pathway which is different from the photoperiod pathway also have been mostly unknown. Considering that flowering-time is a key trait in determining cropping season and regional adaptability, and that significant agricultural profit can be obtained by controlling flowering-time, it is necessary to elucidate the flowering-time regulating pathway in rice and to find the genes involved in the pathway.

The present inventors identified useful flowering regulators in rice and investigated the characteristics thereof, to achieve the present invention. In the present invention, previously unknown flowering regulators have been, found, as well as the fact that their functions are specifically differentiated in rice.

DETAILED DESCRIPTION OF THE ILLUSTRATED EMBODIMENTS

The object of the present invention is to find the genes involved in regulating flowering-time in rice, and their working conditions, for agricultural benefit.

To achieve this object, the present inventors screened rice mutant lines exhibiting early- or late-flowering phenotype from T-DNA-inserted lines of rice, and analyzed genotypes of the screened mutant lines, to isolate flowering-time regulators of rice including the counterparts of flowering-time regulators of Arabidopsis , such AGL20, CONSTANS, etc., and elucidated the functions and working conditions of the isolated regulators by additional transformation analyses, to complete the present invention. Furthermore, some of the regulators are found to stimulate internodes elongation in rice. The flowering-time regulators of rice are expected to exhibit similar effects in other monocotyledons which are developmentally homologous, such as corn, barley, wheat, etc., as in rice.

More specifically, the present invention provides 1) flowering-time and/or internodes elongation regulators; 2) flowering-time regulating proteins encoded by the regulators; 3) constructs wherein the regulator is overexpressed or suppressed; 4) transgenic plants, parts thereof, or plant cells transformed with the construct; 5) methods to prepare the transgenic plants; and 6) methods to regulate flowering-time and/or internodes elongation using the regulators.

The present invention provides a regulator involved in a regulating mechanism of flowering-time and/or internodes elongation.

In the present invention, the mutant lines exhibiting alteration in flowering-time, such as those exhibiting early- or late-flowering phenotypes, are screened from T-DNA-tagged transgenic plants, and the nucleotide sequence of the regions adjacent to the inserted T-DNA is analyzed, to find several flowering-time regulators as described below.

One such flowering-time regulator is Oryza stavis MADS50 (hereinafter, referred to as “OsMADS50”), which is one of the MADS-box genes of rice. The nucleotide sequence thereof is shown in SEQ ID NO: 1.

Said regulator is isolated by PCR from the gene having Accession No. AB003328 registered at the NCBI (National Center for Biotechnology Information) database, using a pair of primers specific thereto. The nucleotide sequence of the isolated regulator is analyzed and the regulator is named OsMADS50. OsMADS50 is one of the MADS-box genes, and a conventional MIKC [(MAPS, intervening, Keratin-like, and C-terminal domain)]-type MADS-box gene. The sequence of the genomic DNA of the OsMADS50 gene has been registered to have the Accession No. AC098695. The OsMADS50 gene is present in chromosome 3, and has seven (7) exons and six (6) introns (see FIG. 2 a , and alvarez-Buylla et al., 2000; Lee et al., 2003). Among the MIKC-type MADS-box proteins present in rice (Lee et al., 2003), the OsMADS50 protein is the most homologous (60.8%) to the OsMADS56 protein.

OsMADS50 is found to be a flowering activator (accelerating factor) in rice, acting as a rice ortholog of SUPPRESSOR OF OVEREXPRESSION OF CO1/AGAMOUS-LIKE 20 (SOC1/AGL20) in Arabidopsis . Such a flowering accelerating effect of OsMADS50 can be shown by the fact that in a OsMADS50 knockout (KO) line wherein the OsMADS50 function is suppressed by T-DNA insertion, etc., a OsMADS50 RNAi (interference) line wherein OsMADS50 region, or a part or all of M, I, K and C domains of MADS-box present in OsMADS50 are deleted, or a modified line wherein a part or all of the above domains are modified by nt substitution, etc., flowering is delayed, whereas in a OsMADS50 overexpressed line (e.g., ubi:OsMADS50) with a strong promoter which is operable in plant, such as actin, cytochrome C, or maize ubiquitin (ubi) promoters, flowering is extremely accelerated at the callus stage.

In the present invention, the overexpression of a gene may be induced by being operably linked to a strong promoter operable in plants, such as actin promoter, cytochrome C, ubiquitin (ubi) promoter (Pubi), etc., or inserting a DNA fragment containing an enhancer into a proper site. The suppression of a gene may be performed by a foreign gene which can be inserted in to a plant gene, such as T-DNA, an endogeneous transposon such as TOS17, a mutation induced by X-ray or gamma-ray irradiation, or by RNAi or anti-sense methods. The overexpression and suppression methods above are also applied to the genes of the present invention.

The analyses of OsMADS50 KO, OsMADS50 RNAi, and ubi:OsMADS50 plants shows that OsMADS50 is an upstream regulator of OsMADS1, OsMADS14, OsMADS15, OsMADS18 and Hd3a, which are involved in the flowering mechanism in rice. This result shows that the OsMADS50 gene regulates flowering of rice not through an independent and direct way, but by controlling various genes involved in flowering mechanisms in rice in a more fundamental way.

Further, it is observed that an OsMADS50 suppressed line displays considerable internode elongation compared with wild type, which shows that the OsMADS50 gene controls stein elongation as well as flowering-time. That is, in the present invention, it is observed that the mutant line having a suppressed OsMADS50 gene exhibits late-flowering but elongated-internode phenotype, whereby it is established that the OsMADS50 gene is involved in stem elongation as well as control of flowering-time.

Further, it is also observed that in the mutant line with suppressed OsMADS50 gene, flowering-time is delayed under long-day conditions only, which shows that the OsMADS50 gene is a flowering activator working under long-day conditions.

In addition to the OsMADs50 gene, OsMADS51, OsMADS56, OsTRX1 and OsVIN2 genes are segregated as a flowering-time regulator working by overexpression or suppression.

The OsMADS51 gene has been registered in the NCBI database under Accession No. AB003327 (SEQ ID NO: 3). The organ-dependent expression profiles of the gene have been known, but its function is not yet known (Shinozuka et al., 1999). The sequence of the genomic DNA of the OsMADS51 gene has been registered under Accession No. AP008207. In the present invention, the OsMADS51 gene was sought out as a gene which alters flowering-time by overexpression or suppression, and isolated by PCR. In the present invention, it is shown that in a line overexpressing OsMADS51, flowering-time is accelerated by 1 to 2 weeks under field conditions, and in a OsMADS51 knockout line, flowering-time is delayed under short-day conditions (see FIG. 11), suggesting that the OsMADS51 gene is also a flowering-time regulator.

As another gene which alters flowering-time by overexpression or suppression, the OsMADS56 gene was isolated, characterized, and registered at NCBI with the Accession No. AY345224 (SEQ ID NO: 5). The genomic DNA sequence of the OsMADS56 gene has been registered under Accession No. AC092697. In the present invention, the flowering-time is delayed by 1 to 2 weeks in an OsMADS56 overexpressed mutant. When the photoperiod condition is controlled, flowering-time is not altered under short-day conditions, whereas it is delayed by approximately one month under long-day conditions (see FIG. 12).

As another gene which alters flowering-time by suppression due to T-DNA insertion, OsTRX1 and OsVIN2 genes were studied, and their nucleotide sequences are shown in SEQ ID NO: 7 (OsTRX1) and SEQ ID NO: 9 (OsVIN2), respectively. The genomic DNA sequences of these genes have been registered under Accession Nos. AP008215 (OsTRX1) and AP008208 (OsVIN2), respectively. In the present invention, the flowering is delayed by at least one month in an OsTRX1 knockout line under field conditions. In an OsVIN2 knockout line, flowering-time is delayed by approximately 32 days under long-day conditions, and delayed by approximately 10 days under short-day conditions. These results show that OsTRX1 and OsVIN2 genes also act as flowering regulators (see FIG. 13).

As another gene which alters flowering-time by suppression due to T-DNA insertion, the OsCOL4 ( Oryza satvia CONSTANS Like 4) gene was investigated. The nucleotide sequence of the OsCOL4 gene has been known through the Rice Genome Project (SEQ ID NO: 11). The gene has been known as a rice homolog of the CONSTANS gene of Arabidopsis , but its function has been unknown. Its genomic DNA sequence has been registered under Accession No. AP004063.

In the present invention, the OsCOL4 activated mutant line (by induction of overexpression, etc.) exhibits delayed flowering-time phenotype with a delay of 15 or more days compared with wild-type (see FIG. 14), whereas the OsCOL4 suppressed mutant line exhibits early flowering-time phenotype which is early by approximately 10 days compared with wild-type. These results show that the OsCOL4 gene acts as a flowering inhibitor. The OsCOL4 gene only has a flowering inhibiting function, and has no effect on vegetative growth such as stem elongation. Upon investigating the alteration of flowering-time of OsCOL4 modified mutants depending on photoperiod conditions, it is found that the OsCOL4 overexpressed mutant exhibits a late-flowering phenotype compared with a wild-type line under both long-day and short-day conditions, whereas the OsCOL4 suppressed mutant exhibits an early-flowering phenotype compared with wild-type under both long-day and short-day conditions. These results show that the OsCOL4 gene acts as a flowering inhibitor in rice, regardless of the photoperiod conditions.

In all embodiment of the present invention, the activation of the OsCOL4 gene may be induced by a 35S enhancer in T-DNA inserted into a promoter region of OsCOL4 gene (see FIGS. 15 and 16), or by a ubiquitin (ubi) promoter (Pubi) operably linked thereto (see FIG. 17). The suppression of the OsCOL4 gene may be induced by an insertion of T-DNA into the first exon or 3′UTR region of the OsCOL4 gene (see FIG. 18).

Many flowering regulators of plants have been known, most of which are flowering-time activators, but only few of them are flowering inhibitors. Therefore, it is very valuable to find flowering inhibitors such as OsMADS56 and OsCOL4. In activating flowering, the flowering inhibitor suppressed mutants can be more stably inherited than the flowering activator overexpressed mutants. Further, the OsCOL4 suppressed mutants can be obtained by ways other than transformation, such as mutation by an endogenous transposon of rice, Tos17, and thus, problems of genetically modified organisms (GMO) can be avoided.

As another flowering regulator, OsCOL8 ( Oryza sativa CONSTANS Like 8) is investigated, which is a CONSTANS like gene present in rice, and similar to the VRN2 gene controlling flowering-time in wheat by vernalization treatment. The nucleotide sequence of the OsCOL8 gene has been known through the Rice Genome Project (SEQ ID NO: 13), but the function thereof has been unknown. The genomic DNA sequence of the gene has been registered under Accession No. AC079874. In the present invention, it is found that an OsCOL8 suppressed mutant shows no alteration in flowering-time under long-day conditions, whereas it shows late-flowering phenotype under short-day conditions. These results show that the OsCOL8 gene is a flowering activator in plants under short-day conditions.

The flowering regulators of the present invention may act independently from each other. Further, each of the regulators may more effectively control flowering-time by acting in association with another regulator with a similar or opposed regulation activity to create offset or synergy of the flowering regulating action.

In addition to the above genes, OsMADS14 is investigated as another flowering regulator. The genomic DNA sequence and cDNA sequence of the OsMADS14 gene are shown in SEQ ID NO: 15 and SEQ ID NO: 16, respectively. APETALA1 (AP1) gene of Arabidopsis has been known- to be involved in the formation of floral organs and regulation of flowering-time. At least four (4) genes have been known as AP1 like genes present in rice. The four genes have been named OsMADS14, OsMADS15, OsMADS18 and OsMADS20, respectively. Among them, the OsMADS14 gene has been first cloned as a coding gene of a reciprocally binding partner of an OsMADS6 protein, and it has been known that the overexpression of the gene induces early flowering, but the details of the mechanism and conditions for such a function have been unknown.

In the present invention, it is observed that the mutants wherein T-DNA or Tos17 is inserted into the OsMADS14 gene exhibit no particular change in flowering-time and floral development (see FIG. 21). This result shows that other genes besides the OsMADS14 gene act redundantly in regulating flowering-time. Overexpression of the modified OsMADS14 protein, wherein among M, I, K (KI, KII, KIII, KIV) and C domains present in the MADS-box of OsMADS14, the terminus containing the C domain is deleted, leads to early-flowering by approximately one-month under short-day conditions, whereas it leads to late-flowering by approximately 2 weeks under long-day conditions. The partial OsMADS14 protein wherein the C domain is deleted may be obtained by deletion of the 3′-terminal region containing the C-domain coding sequence of the OsMADS14 gene and expression thereof. In an embodiment of the present invention, such C domain deleted partial OsMADS14 protein may be obtained by inserting a stop codon between the K and C domains. The nucleotide sequence of the OsMADS14 gene with the C domain coding region deleted is shown in SEQ ID NO: 17, and the amino acid sequence of the C domain deleted partial OsMADS14 protein encoded thereby is shown in SEQ ID NO: 18. The above results show that the C domain deleted partial OsMADS14 protein activates flowering-time under short-day conditions, while it inhibits flowering by interaction with the flowering activators under long-day conditions.

In corn, wheat, etc., which are monocotyledons like rice, counterparts of OsMADS50, OsMADS51, OsMADS56, OsMADS14, OsTRX1, OsVIN2, OSCOL4 and OsCOL8 of rice are also expected to act as regulators in flowering and/or stem elongation.

Another aspect of the present invention provides a flowering regulating protein encoded by OsMADS50; OsMADS51; OsMADS56; truncated OsMADS14 wherein a C domain coding sequence containing the 3′-terminal region is deleted; OsTRX1; OsVIN2; OSCOL4; or OsCOL8 genes. The flowering regulating protein may have an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 and SEQ ID NO: 18.

Another aspect of the present invention provides DNA constructs containing the overexpressed or suppressed flowering regulators.

The DNA construct may contain a suppressed OsMADS50, OsMADS51, OsMADS56, OsMADS14, OsTRX1 or OsVIN2 gene. More specifically, the DNA construct may contain a knockout variant of OsMADS50, OsMADS51, OsMADS56, OsMADS14, OsTRX1 or OsVIN2 gene induced by insertion of a foreign gene. For example, the DNA construct may contain a knockout variant wherein a DNA fragment which can be inserted in to a plant gene, such as T-DNA, is inserted in a specific site in OsMADS50, OsMADS51, OsMADS56, OsMADS14, OsTRX1 or OsVIN2 gene. Especially, in the case of OsMADS50, T-DNA may be inserted into the fourth (4 th ) intron among six introns (see FIG. 2 a ). Alternatively, the DNA construct of the present invention can contain suppressed OsMADS50, OsMADS51, OsMADS56 or OsMADS14 gene by deletion or nt substitution of the whole or part of OsMADS50, OsMADS51 or OsMADS56 gene, preferably the part containing at least the MADS-box region.

The DNA construct of the present invention can also contain an overexpressed OsMADS50, OsMADS51, OsMADS56, OsTRX1 or OsVIN2 gene. In an embodiment of the present invention, the DNA construct may contain an overexpressed OsMADS50, OsMADS51, OsMADS56, OsTRX1 or OsVIN2 gene wherein a strong promoter operable in plants, such as actin promoter, cytochrome C promoter and maize ubiquitin (ubi) promoter, is operably inked.

The DNA construct of the present invention may contain a truncated OsMADS14 gene producing a C domain deleted partial OsMADS14 protein by deletion of 3′-terminal region containing the C domain coding sequence. The C domain coding sequence containing truncated OsMADS14 with the 3′-terminal region deleted may be linked with a strong promoter operable in plants to induce an overexpression thereof.

The DNA construct may contain an overexpressed OsCOL4 gene. In an embodiment of the present invention, the overexpression of the OsCOL4 may be induced by operable linkage of a strong promoter, such as actin promoter, cytochrome C promoter, maize ubiquitin (ubi) promoter, or insertion of a DNA fragment which can be inserted in to a plant gene, such as T-DNA, into the promoter of the OsCOL4 gene, wherein an enhancer (e.g., 35S enhancer of T-DNA) of the inserted gene induces an overexpression of the gene. The DNA construct of the present invention may contain a suppressed OsCOL4 gene. In an embodiment of the present invention, the OsCOL4 gene may be suppressed by insertion of a DNA fragment which can be inserted into a plant gene, such as T-DNA, into a specific site of the OsCOL4 gene, more specifically, by insertion of T-DNA into the first exon or 3′ UTR region.

The DNA construct of the present invention may contain an overexpressed OsCOL8 gene. In an embodiment of the present invention, the OsCOL8 gene may be overexpressed by operable linkage with a strong promoter, such as maize ubiquitin (ubi) promoter. Further, The DNA construct of the present invention may contain a suppressed OsCOL8 gene. In an embodiment of the present invention, the OsCOL8 gene may be suppressed by insertion of a DNA fragment which can be inserted into a plant gene, such as T-DNA, into a specific site of the OsCOL8 gene, more specifically, by insertion of T-DNA into the first exon region.

Another aspect of the present invention provides a transgenic plant, a part thereof, or a plant cell, wherein an overexpression or suppression of the flowering-time regulator is directly induced as above, or wherein transformation with a DNA construct containing the overexpressed or suppressed flowering-time regulator is performed. There is no limitation of the vector used in the transformation of the plant, part thereof, or plant cell. Any conventional vector which can be used in transformation of plants may be used, and more specifically, a binary vector of pGA1611 family may be used.

More specifically, the transgenic plant, part thereof, or plant cell of the present invention may have overexpression of the OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene directly induced as above, or be transformated with a DNA construct containing the OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene where overexpression is induced, whereby flowering-time is accelerated. In the transgenic plant, part thereof, or plant cell of the present invention, the suppression of OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene may be directly induced as above, or transformation with a DNA construct containing the suppressed OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene may be performed, whereby flowering-time is delayed.

In the transgenic plant, part thereof, or plant cell of the present invention, the overexpression of OsMADS56 or OsCOL4 gene may be directly induced as above, or transformation with a DNA construct containing the overexpressed OsMADS56 or OsCOL4 gene may be performed, whereby flowering-time is delayed. In the transgenic plant, part thereof, or plant cell of the present invention, the suppression of OsMADS56 or OsCOL4 gene may be directly induced as above, or transformation with a DNA construct containing the suppressed OsMADS56 or OsCOL4 gene may be performed, whereby flowering-time is accelerated.

The transgenic plant, part thereof, or plant cell of the present invention may be transformed with a DNA construct containing the OsMADS14 gene having the C domain coding region deleted, to produce a C domain deleted partial OsMADS14 protein, whereby flowering-time is delayed under long-day conditions and accelerated under short-day conditions.

The transgenic plant, part thereof, or plant cell of the present invention may be one wherein the suppression of the OsMADS50 gene is directly induced, or which is transformed with a DNA construct containing the suppressed OsMADS50 gene, to exhibit considerable stem elongation compared with wild type.

Another aspect of the present invention provides a method to regulate flowering-time and/or stem elongation by inducing an overexpression or suppression of the regulators as above.

The flowering-time regulating method of the present invention may comprise the step of inducing a suppression of OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene, to delay flowering-time. More specifically, the flowering-time regulating method of the present invention may comprise the step of directly inducing a suppression of OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene by insertion of a foreign gene, or gene deletion, or transforming with a DNA construct containing a suppressed OsMADS50, OsMADS51, OsTRX7, OsVIN2 or OsCOL8 gene, to delay flowering-time. For example, the suppression of the OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene may be induced by insertion of a DNA fragment which can be inserted into a plant gene, such as T-DNA, into a specific site of the above gene. For example, in the case of the OsMADS50 gene, T-DNA may be inserted into the fourth intron among the six introns, and in the case of the OsCOL8 gene, T-DNA may be inserted into the first exon, to suppress the genes.

Alternatively, the suppression of the OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene may be induced by deletion of the whole or part of the gene. For example, in case of the OsMADS50, OsMADS50 or OsMADS51 gene, at least the MADS-box region may be deleted, to suppress the gene.

The flowering-time regulating method of the present invention may comprise the step of transforming a plant with a DNA construct containing the suppressed OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene as above, to delay flowering-time in the plant.

Further, the present invention provides a method of stimulating stem elongation by inserting a foreign gene into the OsMADS50 gene or deleting the whole or part of the OsMADS50 gene to induce suppression thereof.

The flowering-time regulating method of the present invention may comprise the step of inducing overexpression of the OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene to activate flowering. For example, the flowering-time regulating method of the present invention may comprise the step of inducing overexpression by operably linking a strong promoter operable in plants to the OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene to accelerate flowering-time. The flowering-time regulating method of the present invention may comprise the step of transforming a plant with a DNA construct containing an overexpressed OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene which is operably linked with the above strong promoter, to accelerate flowering-time. The strong promoter includes the actin promoter, cytochrome C promoter, maize ubiquitin (ubi) promoter, etc.

The flowering-time regulating method of the present invention may comprise the step of inducing overexpression of the OsMADS56 or OsCOL4 gene to inhibit flowering, or inducing suppression of the OsMADS56 or OsCOL4 gene to activate flowering.

More specifically, the flowering-time regulating method of the present invention may comprise the step of inducing overexpression of the OsMADS56 or OsCOL4 gene by operable linkage with a strong promoter, or insertion of an enhancer containing foreign gene which can be inserted in a plant genome into the promoter region of the gene, to inhibit flowering. For example, the flowering-time regulating method of the present invention may comprise the step of inducing overexpression of the OsMADS56 by operable linkage with maize ubiquitin (ubi) promoter, or overexpression of the OsCOL4 gene by insertion of T-DNA which contains 35 enhancers into the promoter region of the OsCOL4 gene, to inhibit flowering. The flowering-time regulating method of the present invention may comprise the step of transforming a plant with a DNA construct containing the overexpressed OsMADS56 or OsCOL4 gene as above, to inhibit flowering.

The flowering-time regulating method of the present invention may comprise the step of inducing overexpression of a C domain deleted partial OsMADS14 protein by deletion of the 3′-terminal region containing the C domain coding sequence of the OsMADS14 gene, to delay flowering-time under long-day conditions, and to accelerate the flowering-time under short-day conditions.

The flowering-time regulating method of the present invention may comprise the step of inducing suppression of the OsMADS56 or OsCOL4 gene by insertion of a foreign gene, which can be inserted into a plant gene, into a specific site of the OsMADS56 or OsCOL4 gene, to activate flowering. More specifically, the flowering-time regulating method of the present invention may comprise the step of inducing suppression of the OsCOL4 gene by inserting T-DNA into the first exon or 3′ UTR region of the OsCOL4 gene, to activate flowering. The flowering-time regulating method of the present invention may comprise the step of transforming a plant with a DNA construct containing the suppressed OsMADS56 or OsCOL4 gene as above, to activate flowering.

The flowering-time regulating method of the present invention may comprise the step of inducing overexpression of the OsMADS14 gene, to accelerate flowering under short-day conditions, and to delay flowering under long-day conditions. Such overexpression of the OsMADS14 gene may be performed by overexpressing a partial OsMADS14 protein wherein a C terminal region is deleted.

Another aspect of the present invention provides a method of preparing a flowering-time regulated transgenic plant, a part thereof, or a plant cell, comprising the step of transforming with a DNA constrict containing the overexpressed or suppressed flowering-time regulator. The preparation method of the present invention comprises the steps of providing a plant cell; transforming the plant cell with the DNA construct above; and cultivating the transformed cell. The flowering-time regulator may be selected from the group consisting of OsMADS50, OsMADS51, OsMADS56, OsMADS14, OsTRX1, OsVIN2, OsCOL4 and OsCOL8, which is overexpressed or suppressed through the above method. The transformed plant cell may be cultivated as cells, differentiated to specific tissue by a conventional method of inducing tissue differentiation, or developed to a plant body.

The methods of the present invention to regulate flowering-time or to prepare a transgenic plant may be also applied to monocotyledons other than rice, such as corn and wheat, wherein counterparts of the OsMADS50, OsMADS51, OsMADS56, OsMADS14, OsTRX1, OsVIN2, OsCOL4 and OsCOL8 genes of rice may be used.

BRIEF DESCRIPTION OF FIGURES

FIG. 1 shows the mutant (T/T) wherein T-DNA is inserted into the OsMADS50 gene, and the wild-type control (W/W).

FIG. 2 shows the factors, phenotype and flowering time of OsMADS50 KO (knockout) plants, wherein (a) shows the structure of OsMADS50 and the T-DNA insertion position therein; and (b) shows the phenotype of T-DNA-inserted T2 (generation 2) plants which are suppressed.

FIG. 3 shows the result of analysis of transgenic plants transformed with OsMADS50 RNAi (interference) vector, wherein (a) shows the structure of OsMADS50 RNAi vector; and (b) shows the distribution of flowering-time of rice T1 (generation 1) plants; and (c) shows the distribution of the number of elongated internodes of rice T1 plants.

FIG. 4 shows the result of analysis of the OsMADS50 RNA interference effect, wherein (a) shows the result of RNA gel blot for the expression profile of endogenously expressed OsMADS50 and foreign RNAi gene; and (b) shows the result of RT-PCR of endogenously expressed OsMADS50.

FIG. 5 shows the result of analysis of an OsMADS50 overexpressed mutant, wherein (a) shows the structure of the OsMADS50 overexpressing vector; (b)-(e) show phenotypes of rice T1 plants; and (f) shows the expression profile of OsMADS3 and OsMADS4 in floral-like organs.

FIG. 6 shows the result of the expression profile of OsMADS50 and other flowering regulators, wherein (a) shows the expression profile of OsMADS50 in various organs; and (b) shows the expression profile of flowering-time regulators in various developmental stages of leaf.

FIG. 7 shows the result of analysis of changes of expression of flowering regulators in an OsMADS50 KO mutant and an OsMADS50 overexpressed mutant, wherein (a) shows the result of RT-PCR in the OsMADS50 KO mutant; and (b) shows a schematic representation of the result of RT-PCR obtained above in (a); and (c) shows the result of RT-PCR in the OsMADS50 overexpressed mutant.

FIG. 8 is a graph showing the flowering-time of OsMADS50 KO plants under long-day and short-day conditions.

FIG. 9 shows the expression pattern of flowering-time regulators in the OsMADS50 KO plant.

FIG. 10 shows the late-flowering phenotype of OsTRX1 KO plants.

FIG. 11 is a graph showing delay of flowering-time in OsMADS51 KO plants.

FIG. 12 is a graph showing delay of flowering-time in OsMADS56 overexpressed plants.

FIG. 13 is a graph showing delay of flowering-time in OsVIN2 KO plants.

FIG. 14 shows the late-flowering phenotype of OsCOL4 overexpressed plaints.

FIG. 15 is a schematic view showing that T-DNA containing the 35S enhancer is inserted in the promoter region of OsCOL4.

FIG. 16 is an electrophoresis result showing overexpression of OsCOL4.

FIG. 17 is a photograph showing the late-flowering phenotype of OsCOL4 overexpressed plants.

FIG. 18 is a photograph showing the early-flowering phenotype of OsCOL4 suppressed plants.

FIG. 19 shows the flowering-time alteration in OsCOL4 suppressed plants under long-day, short-day, and field conditions.

FIG. 20 shows the flowering-time alteration in OsCOL8 suppressed plants under long-day, and short-day conditions.

FIG. 21 shows the structure of T-DNA inserted OsMADS14 and the expression profile thereof.

FIG. 22 shows the nucleotide sequence of OsMADS50 cDNA (SEQ ID NO: 1).

FIG. 23 shows the nucleotide sequence of OsMADS51 cDNA (SEQ ID NO: 3).

FIG. 24 shows the nucleotide sequence of OsMADS56 cDNA (SEQ ID NO: 5).

FIG. 25 shows the nucleotide sequence of OsTRX1 cDNA (SEQ ID NO: 7).

FIG. 26 shows the nucleotide sequence of OsVIN2 cDNA (SEQ ID NO: 9).

FIG. 27 shows the nucleotide sequence of OsCOL4 cDNA (SEQ ID NO: 11).

FIG. 28 shows the nucleotide sequence of OsCOL8 cDNA (SEQ ID NO: 13).

FIGS. 29A to 29F show the nucleotide sequence of genomic DNA of OsMADS14 (SEQ ID NO: 15).

FIG. 30A shows the nucleotide sequence of OsMADS4 cDNA (SEQ ID NO: 16).

FIG. 30B shows the nucleotide sequence of truncated OsMADS14 (SEQ ID NO: 17) wherein the 3′-terminal region containing the C domain coding sequence is deleted from the OsMADS14 gene.

EXAMPLE 1

Selection 1 of Flowering-Time Mutants in T-DNA-Tagging Lines

Rice cells ( Oryza sativa var. japonica cv. Dongjin induced calluses) were treated by using Ti plasmid binary vector pGA2144 (Jeon et al., The Plant Journal (2000) 22(6), 561-570), to construct a T-DNA inserted T1 (first generation) mutant lines. The treatment using Ti plasmid binary vector pGA2144 was performed according to “Jeon et al. 2000b”. That is, the rice cells were co-cultivated with agrobacteria, to transport T-DNA into the rice cells, and the T-DNA transported cells were selected by using an antibiotic and re-differentiated. 2933 T1 mutant lines obtained were developed in the field, to produce T2 (second generation) transgenic plants, wherein mutant lines exhibiting alteration in flowering-time were selected. Twenty-five (25) lines exhibiting alteration in flowering-time by at least 2 weeks compared with the flowering-time of the wild-type line were observed, wherein 16 lines exhibited early-flowering phenotype, and 9 lines exhibited late-flowering phenotype.

FIG. 1 shows a phenotype comparison between OsMADS50 knockout (10) plants wherein T-DNA is inserted in the OsMADS50 gene, and wild-type (WT) plants. The photograph was taken when WT plants flowered. However, the OsMADS50 KO plants had not bolted yet.

To analyze of the genotype of flowering-time mutant, the nucleotide sequence of the adjacent region of the insertion region of T-DNA was analyzed by using an inverse PCR method as reported in “An et al. 2003,” wherein the genomic DNA was cleaved by a restriction enzyme, both ends are linked together, and then PCR is performed twice, to identify the nucleotide sequence of the adjacent region of the T-DNA inserted region. Then, the insertion site of T-DNA was confirmed by using the National Center for Biotechnology Information (NCBI) database. As a result, in a line shown at the right side in FIG. 1 (line 0-153-43), the retrieved sequence was the MADS-box gene OsMADS50, and the insertion site of T-DNA was the fourth intron of OsMADS50 (see FIG. 2 a ). The OsMADS50 protein showed 50.6% amino acid sequence identity with SOC1/AGL20 which is a flowering activator of Arabidopsis . Among the 36 MIKC (MAPS, intervening, Keratin-like, and C-terminal domain)-type MADS-box proteins present in rice, the OsMADS50 protein is most homologous (60.8%) to OsMADS56, and also shares homology with maize ZmMADS1 (75.2%), Tobacco TobMADS1 (51.1%) and mustard SaMADSA (50.0%). Full-length protein sequences were aligned to calculate homologies.

As shown in FIG. 1, in the mutant line (T/T) wherein T-DNA is inserted into the OsMADS50 gene, flowering-time was delayed by approximately one month compared with the wild-type (W/W) control. Such delay in flowering caused by the mutation induced in OsMADS50 is considered to be a significant result, because the OsMADS50 gene is thought to be the counterpart corresponding to the flowering-time regulator AGL20 of Arabidopsis.

As shown in FIG. 2 a , one of the MADS-box genes, OsMADS50, is located on Chromosome 3, and is composed of six introns and seven exons that encode a typical MIKC-type MADS-box protein. In T-DNA inserted lines in the present example, the T-DNA was inserted into the fourth intron, and the transcript direction of beta-glucuronidase (gus) gene in the T-DNA was opposite to that of OsMADS50.

From FIG. 2 a , the genotype of T2 plants was determined via PCR using the primers located in OsMADS50 and T-DNA. The amplification of the normal OsMADS50 gene (W) was confirmed by PCR using primers F2 (forward primer in the I region: 5′-aaagctgacg ctgatggttt-3′, SEQ ID NO: 23) and R1 (reverse primer at 3′ UTR: 5′-ttgggtaccg agatccagct tattcctgg-3′, SEQ ID NO: 22), and the amplification of the T-DNA inserted OsMADS50 gene (T) was confirmed by PCR using primers F2 and R2 (reverse primer in the hygromycin phosphotransferase (hph).

As a result, among thirteen (13) plants, three (3) were homozygotic (T/T) for the T-DNA insertion (see FIG. 2 b , Samples 4, 10 and 13). All of these plants flowered about 99 days after planting. Whereas the other T2 plants, being either heterozygotic (W/T) or wild-type (W/W) segregants, flowered about 73 days after planting.

FIG. 2 is a schematic diagram of OsMADS50, showing the position of T-DNA insertion and the genotyping of the OsMADS50 KO progeny. FIG. 2 a shows the structure of OsMADS50 and T-DNA insertion. Seven exons (filled boxes) and six introns (lines between the filled boxes) are shown. In FIG. 2 a , the M, I, K and C region indicate exons. The K region consists of four exons, whereas the other regions comprise one exon each. T-DNA was inserted into the fourth intron. Arrows indicate primers. F1 is a forward primer at 5′UTR, F2 is a forward primer in the I region, R1 is a reverse primer at 3′UTR, and R2 is a reverse primer in the hygromycin phosphotransferase (hph) gene in T-DNA.

FIG. 2 b shows the genotyping of the OsMADS50 KO progeny. If no T-DNA insertion occurred, the F2 and R1 primers should be amplified as 1.6 kb genomic DNA. If T-DNA was inserted, the length between the two primers would be too large to be amplified. Furthermore, when the T-DNA is inserted into the fourth intron, the F2 and R2 primers should be amplified as an approximately 2 kb band. Samples 2, 3, 5, 11 and 12 were amplified as only the genomic DNA and therefore, they were considered to be wild-type (W/W); Samples 4, 10 and 13, which were harvested from late-flowering mutants, were amplified only as 2 kb bands, and therefore, they were considered to be heterozygous (T/T); and the other samples showed amplification of both bands and therefore, they were considered to be heterozygous (W/T). Days to heading after planting are indicated for each plant.

As seen from the above, all the late flowering plants included only T-DNA inserted OsMADS50 (T/T), and the normal flowering plants contained at least one normal OsMADS50 gene (W). Therefore, it could be confirmed that a late-flowering mutation is induced by T-DNA insertion.

EXAMPLE 2

Isolation of the OsMADS50 Gene

The nucleotide sequence of the above OsMADS50 gene is shown in SEQ ID NO: 1. The nucleotide sequence of the OsMADS50 gene is also registered in NCBI database under Accession No. AB003328. However, only the expression profiles in various organs is known, whereas its function is yet unknown (Shinozuka et al., 1999). Herein, the present inventors designed two specific primer pairs, isolated this gene through PCR using the primer pairs, and named the gene OsMADS50. The first PCR was performed for the gene using the primer pair having the nucleotide sequences of SEQ ID NO: 19 (F1: forward at 5′ UTR: 5′-atcaagcttt acggccaaac cctacagc-3′) and SEQ ID NO: 20 (R1: reverse primer at 3′ UTR: 5′-ttgggtaccg atgggtagtg gagtctgc-3′), and then, the second PCR was performed using the PCR amplified product as a template and using a primer pair correspondiing to the nucleotide sequences of SEQ ID NO: 21 (5′-atcaagcttg ttggttcatc ggcgatcg-3′) and SEQ ID NO: 22 (5′-ttgggtaccg agatccagct tattcctgg-3′) present inside the PCR product to amplify the desired gene. The PCR amplified product containing the entire coding region of S11905 and the adjacent region was cleaved by HindIII-BamHI (Roche), and cloned into a pBluescript SK (−) vector (Stratagene). The nucleotide sequence thereof was determined by a sequencing machine (AbI3100), and the obtained gene was named OsMADS50. This gene is present in the clone registered as AP004322 positioned at the short arm of Chromosome 3, and this locus is identical to that of the mutation known as Hd9 (Lin et al., 2000).

EXAMPLE 3

Analysis of OsMADS50 RNA Interference (RNAi) Plants

To confirm that the late-flowering phenotype is due to the suppression of OsMDS50 gene expression, transgenic plants were generated by expressing RNAi constructs of the gene as shown in FIG. 3 a . MAD S-box deleted OsMADS50 genes were cloned into pBluescript SK (−) vector (Stratagene) in opposite directions at both sides of the GUS gene, and then inserted in the pGA1611 vector (AY373338) at the position between the maize ubiquitin promoter (Pubi) and the nos terminator (Tnos). Among 82 T1 plants, 76 showed the delayed flowering phenotype delayed by at least one month (FIG. 3 b ). Six plants flowered 74 to 78 days after planting, similarly to the wild type control and transgenic controls; eight did not flower until 140 days after planting. These results show that the OsMADS50 gene is an important flowering activator.

In addition to the late-flowering phenotype, the transgenic plants carried more elongated internodes (FIG. 3 c ). In contrast, most of the OsMADS50 RNAi plants carried six (23.5%) to seven (62.7%) elongated internodes, but with some (13.7%) bearing as many as eight. In contrast, the wild-type (WT) and transgenic control (CON) plants possessed five to six elongated internodes. These results show that the OsMADS50 RNAi plant exhibits an internode elongation phenotype as well as a late-flowering phenotype.

FIG. 3 is a schematic diagram of the OsMADS50 RNAi construct and the phenotypes of the transgenic plants expressing the RNAi construct. FIG. 3 a shows the OsMADS50 RNAi construct, with a GUS spacer inserted between two IKC regions of OsMADS50. The construct was inserted between the maize ubi promoter (Pubi) and the nos terminator (Tnos). FIG. 3 b shows the frequency distribution of days to heading in the OsMADS50 RNAi T1 transgenic Plants, i.e., the number of days required for flowering from the time of transplanting. The wild-type (WT) and other transgenic control plants flowered 74 to 78 days after planting. Nine lines did not flower until 140 days after planting. The broken bar indicates a large gap between two X-axis values. FIG. 3 c shows the proportion of elongated internode numbers in OsMADS50 RNAi plants and WT controls. The values are averages of 63 WT, 152 transgenic control plants, and 102 OsMADS50 RNAi plants. The Y-axis indicates the relative ratio of stems having elongated internodes, ranging from 4 to 8.

RNA gel blot analysis showed that high levels of the OsMADS50 RNAi transcript were present in the transgenic plants that displayed the late-flowering phenotype. Because expression was so high, it was difficult to visualize the endogenous OsMADS50 transcript levels in the blots. Therefore, RT-PCR analyses were employed to verify suppression of OsMADS50 expression (FIG. 4 b ). In the late-flowering transgenic plants, transcript levels (confirmed by F1/R1 primers) were significantly reduced. These results indicate that reducing the expression of OsMADS50 results in late flowering of rice plants. The degree of lateness in flowering was proportional to the RNAi levels since the RNAi plants 9 and 10 flowered later than plants 6 to 8.

FIG. 4 is an analysis of the OsMADS50 RNA interference effect, showing the endogenous level of OsMADS50 in OsMADS50 RNAi Plants. FIG. 4 a is a result of RNA gel blot analysis for OsMADS50 and OsMADS50 RNAi transcripts in transgenic plants expressing OsMADS50 RNAi constructs, showing that the OsMADS50 RNAi gene is strongly expressed in the OsMADS50 RNAi transgenics. Five WT plants (1 to 5) and five independent transgenic plants (6 to 10) were examined. The transgenic plants 6, 7, 8, 9, and 10 flowered 111, 115, 115, 130, and 135 days after planting, respectively. The rRNA level was observed as a control (bottom). “RNAi” refers to an OsMADS50 RNAi transcript: and “sense” refers to an endogenous OsMADS50 transcript. FIG. 4 b shows the results of RT-PCR analyses for OsMADS50 and OsMADS50 RNAi transcripts in WT plants (1 to 5) and transgenic plants (6 to 10). Identical RNA, isolated for RNA gel blot analysis, was reverse transcribed to synthesize cDNA. The primer pair used for detecting full-length OsMADS50 was F1 (SEQ ID NO: 2)/R1 (SEQ ID NO: 5), indicated in FIG. 2 a . Actin was used as a control. PCR cycles for amplifying OsMADS50 and actin were 26 and 23, respectively. The results of RT-PCR analyses using the F1/R1 primer pair show that the OsMADS50 gene which is endogenously expressed is suppressed in the OsMADS50 RNAi transformant.

EXAMPLE 4

Analysis of OsMADS50 Overexpressed Plants

To further study the functional roles of OsMADS50 in flowering time, transgenic rice plants that overexpressed the sense constructs of the gene were generated as shown in FIG. 5 a . The maize ubi promoter was used to drive constitutive expression. That is, the whole coding region of OsMADS50 gene was amplified by using a primer pair having the sequence of SEQ ID NO: 2 and SEQ ID NO: 3, respectively, cleaved by HindIII-Asp718 (Roche), cloned into pBluescript SK (−) vector (Stratagene), to confirm the nucleotide sequence, and inserted between the ubiquitin promoter and the nos terminator of the pGA1611 vector (AY373338).

When transformed calli were transferred onto shoot induction media (MRS media), about 20% of the calli developed into the structures that resembled floral organs, e.g., palea/lemma (FIG. 5 b ), stigmas (FIG. 5 b ), stamens (FIG. 5 c ), ovaries (FIG. 5 c ), and panicles (FIG. 5 d ). A spikelet containing all the floral organs was occasionally observed. Although approximately 80% of the calli developed into shoots, two thirds of those displayed the phenotype of extreme dwarfism and defective growth of the leaf blade (FIG. 5 e ). These plants eventually died. The remaining one third of the shoots differentiated into normal plants. Some then flowered earlier than the controls, while others flowered at the same time as the WT plants.

To examine whether the floral organ-like structures observed from the transgenic calli were indeed reproductive, the transcript levels of the flower-specific MADS-box genes, OsMADS3 and OsMADS4 were determined. The former is the C function gene (involved in development of stamen and pistil), and the latter is the B function gene (involved in development of calyx and stamen). These genes were expressed specifically in the floral organs that developed from the ubi:OsMADS50 transgenic calli, indicating that they were authentic.

FIG. 5 shows the result of analyses of ubi:OsMADS50 plants. FIG. 5 a is a schematic diagram of the OsMADS50 sense construct (Pubi: maize ubi prompter, Tnos: nos terminator). FIG. 5 b shows regenerated shoots with palea/lemma (p/l)- and stigma (s)-like structures. FIG. 5 c shows regenerated shoots with Stamen (st)- and ovary (o)-like structures. FIG. 5 d shows regenerated shoots with panicle (p)-like structures. FIG. 5 e shows regenerated shoots displaying dwarfism and defective growth of the leaf blade. FIG. 5 f shows expression portraits of OsMADS3 and OsMADS4 in the floral organ-like structures (Control leaves: leaves transformed with empty vector; 50S leaves: transgenic leaves overexpressing OsMADS50; and 50S flowers: floral organ-like structures overexpressing OsMADS50). Actin was used as a control. As shown by RT-PCR, the expressions of OsMADS3 and OsMADS4 genes which are expressed specifically in the floral organs were increased in the 50S flower which is a floral organ-like structure. In contrast, expressions of these genes were not detected in control leaves and transgenic leaves (50S leaves).

EXPERIMENTAL EXAMPLE 1

Expression Analysis for Flowering-Time Regulators Including OsMADS50

RNA gel blot analysis revealed that OsMADS50 was variably expressed in most organs (FIG. 6 a ). To perform the analysis, seedling roots, seeding shoots, young leaf blades (LBs) at 9 to 10 leaf stage, leaf blades at 80 DAP (days after planting), leaf blades at 105 DAP, flag leaf blades 105 DAP, panicles <2 cm long, and panicles between 10 and 20 cm were selected. This gene was detected at a low level during the seedling stage, with transcripts increasing as the plant matured. In young particles, expression was initially low, and continued to decline as these organs matured. In the leaf organ, this gene was strongly expressed. Semi-quantitative RT-PCR analysis of leaves at four developmental stages confirmed the RNA gel blot analysis (FIG. 6 b ). The OsMADS50 transcript was detected at all four stages, with the expression level slightly increasing in 49-day-old plants compared with 20-day-old plants. The transcripts of Hd3a, OsMADS14, OsMADS15, and OsMADS18 increased gradually, reaching a maximum at 80 days.

FIG. 6 shows the expression profiles of OsMADS50 and the other flowering-time regulators. FIG. 6 a shows the result of RNA gel blot analysis, with 15 μg of total RNA used in each sample, and the KC region of OsMADS50 serving as a probe. At the bottom are the control ribosomal RNAs. From left, seedling roots and shoots 7 days after germination, young leaf blades (LBs) at the 9 to 10 leaf stage (35 days after planting; DAP), LBs 80 DAP, LBs 105 DAP, flag LBs 105 DAP, panicles <2 cm long, and panicles between 10 and 20 cm were shown. The plants flowered 90 DAP. FIG. 6 b shows the result of RT-PCR analyses of the putative flowering-time regulators at various developmental stages. WT plants were grown under short-day conditions (10 h light/14 h dark, 30° C.) in the growth chamber, and LBs were sampled 20, 49, 80 and 113 DAP. All samples were harvested 6 h after the light was turned on. Days to flowering were 87.

The expression analyses have revealed that this gene acts early in plant development, being more abundantly expressed in the vegetative organs but decreasing to a very low level during the formation of floral organs.

EXPERIMENTAL EXAMPLE 2

Expression Analysis for Flowering-Time Regulators Including OsMADS50 in OsMADS50 Suppressed or Overexpressed Plants

To further investigate the role of OsMADS50, the alterations of expression of OsMADS50 KO mutants and OsMADS50 overexpressed plants were analyzed, and the results are shown in FIG. 7. In the OsMADS50 KO plants prepared in Example 1, RT-PCR analyses were carried out for Hd1, Hd3a, and OsGI, all of which control flowering-time in the photoperiod pathway. Four MADS-box genes (OsMADS1, OsMADS14, OsMADS15, and OsMADS18) that appear to be involved as well were also examined. In these experiments, expression of Hd1 and OsGI was not changed in the OsMADS50 knockout plants (FIG. 7). Interestingly, the Hd3a transcript was not detectable in the OsMADS50 KO mutant, suggesting that Hd3a is downstream of OsMADS50. Expression levels of all the MADS-box genes were significantly decreased in the OsMADS50 KO mutant plants, although the degree of reduction for OsMADS18 transcript was not as significant as for the other genes.

The expression levels of regulatory genes in the leaves of regenerating ubi:OsMADS50 plants were tested (FIG. 7 c ). These plants flowered a few weeks after being transferred to the regeneration media. In contrast to the KO plants, the levels of OsMADS14 and OsMADS18 transcripts were increased in the ubi:OsMADS50 plants while those of OsMADS1, OsGI, and Hd1 were not significantly changed. Expression levels of OsMADS15 and Hd3a were too low to determine any changes in their transcripts.

FIG. 7 shows the expression profiles of MADS-box genes and photoperiod pathway genes in OsMADS50 KO and ubi:OsMADS50 leaves. FIG. 7 a shows the results of RT-PCR analyses in OsMADS50 KO leaves. Seventy-three (73) days after planting, leaf blades were harvested 2 h before sunset from KO plants. After RT-PCR, DNA gel blot analyses were performed with specific probes. Two independent WT segregants and two independent OsMADS50 KO plants were examined. FIG. 7 b shows a schematic representation of RT-PCR results in OsMADS50 KO plants. DNA band intensity was measured and normalized against the actin transcript level. Results are an average of three independent experiments for each plant. Average values of two WT and two KO plants are represented. Bars, SDs. FIG. 7 c shows the expression profiles in ubi:OsMADS50 plants. Leaf blades were sampled from transgenic plants overexpressing OsMADS50, and control plants, and were assayed for transcript levels of genes by quantitative RT-PCR analyses. Data are average of two to three independent samples. Con: T1 control transformed with empty vector; 5OS: Ubi:OsMADS50 leaves. Bars, SDs. PCR primers and number of cycles for amplification of each gene are listed in Table 1 below.

TABLE 1
Primers and PCR cycles used in RT-PCR analyses
PCR PCR
cycles cycles
Gene Forward primer Reverse primer 50 KO a 50 S b
OsMADS1 tccatatgtcctggcaagat aagagagcacgcacgtactt 28 32
OsMADS14 tcctatgcagaaaaggtcctt ggacgaagccaaaatatacac 36 36
OsMADS15 gctcttatttcagctgaa tcatatgtagcctgtagg 36 36
OsMADS18 ccaaactggatgcacttcag atcaatatcgctggaagatg 23 32
OsGl tggagaaaggttgtggatgc gatagacggcacttcagcagat 23 26
Hd1 ttctcctctccaaagattc catacgcctttcttgtttca 28 26
Hd3a atggccggaagtggcagggac atcgatcgggatcatcgttag 36 36
Actin gtatccatgagactacatacaact tactcagccttggcaatccaca 23 26
a PCR cycles used for OsMADS50 KO plants and WT segregants.
b PCR cycles used for ubi: OsMADS50 plants and WT controls.

In RT-PCT for OsMADS50 KO mutants, it was observed that the expressions of OsMADS1, OsMADS14, OsMADS15, OsMADS18 and Hd3a are significantly decreased compared with wild-type (WT), while no outstanding change was observed in the expression of Hd1 and OsGI. Further, in RT-PCT for an OsMADS50 overexpressed mutant, it was observed that the expressions of OsMADS14 and OsMADS18 increased, whereas no outstanding change was observed in the expressions of OsMADS1, OsMADS15, Hd3a, Hd1 and OsGI. From the above results, it is presumed that the OsMADS50 gene acts upstream of the other flowering-time regulators such as OsMADS14 or OsMADS15 to control the expression thereof, whereas it acts in parallel (independently) or downstream of Hd1 or OsGI.

EXPERIMENTAL EXAMPLE 3

Analysis of Flowering-Time of OsMADS50 KO Mutant Depending on Photoperiod Conditions

The flowering-times in two independent T2 OsMADS50 KO lines (named 50KO23 and 50KO24, respectively) isolated from T-DNA inserted lines of Example 1, and in wild-type lines (control) were observed under various photoperiod conditions. The photoperiod conditions were short-day conditions (SD: 10 h L/14 h D) and long-day conditions (LD: 14 h L/10 h D). The result of the above observation was shown in FIG. 8. As shown in FIG. 8, under short-day conditions, no outstanding difference was observed between the control and the OsMADS50 KO lines. However, under long-day conditions, the control flowered about 78 days after planting, while the OsMADS50 KO lines did not flower until 140 days after planting. Accordingly, it confirms that the OsMADS50 is a flowering-time regulator which acts under long-day conditions.

EXPERIMENTAL EXAMPLE 4

Analysis of the Expression Pattern of Flowering-Time Regulators in OsMADS50 KO Lines

Sixty (60) days after planting, leaf blades were sampled from the OsMADS50 KO lines of Example 1 and wild-type lines (control). The expressions of the flowering-time regulators such as OsMADS14, OsMADS18, Hd3a, Hd1 and OsGI, in addition to OsMADS50 were analyzed in the obtained samples, and the result is shown in FIG. 9. As shown in FIG. 9, under long-day conditions, the expression of OsMADS14, OsMADS18 and Hd3a were downregulated in the OsMADS50 KO lines, while the expression of Hd1 and OsGI were not considerably changed. Therefore, it confirms that OsMADS50 is an upstream flowering-time regulator of other regulators such as OsMADS14, OsMADS18 and Hd3a.

EXAMPLE 5

Isolation of OsMADS51, OsMADS56, OsTRX1 and OsVIN2

Among the T-DNA tagging lines prepared as disclosed in Example 1, the lines wherein T-DNA is respectively inserted in OsMADS51, OsMADS56, OsTRX1 and OsVIN2, were isolated.

The nucleotide sequence of the OsMADS51 gene was isolated and identified, then shown in SEQ ID NO: 2. The OsMADS51 gene has been registered in the NCBI database as AB003327. However, only the expression profiles in various organs is known, while its function is yet unknown (Shinozuka et al., 1999). In the present invention, this gene was isolated through PCR and its function was determined.

Furthermore, the nucleotide sequence of the OsMADS56 gene was isolated and identified, then shown in SEQ ID NO: 3. This was isolated through PCR and its nucleotide sequence was registered in the NCBI database as AY345224 by the present inventors.

Additionally, the nucleotide sequences of OsTRX1 and OsVIN2 are shown in SEQ ID NO: 4 and SEQ ID NO: 5.

EXPERIMENTAL EXAMPLE 5

Analysis of Flowering-Time in OverExpressed or Suppressed Mutants of OsMADS51, OsMADS56, OsTRX1 and OsVIN2

To further examine the functional role of the genes isolated in Example 5 in regulating the flowering-time, a transgenic nice was prepared which overexpresses the sense construct of OsMADS51 or OsMADS56 using the pGA1611 vector (AY373338) prepared in the laboratory, wherein constitutive expression was induced using the maize ubiquitin (ubi) promoter [see, FIG. 5( a )]. It was observed that in the OsMADS51 overexpressed mutants, the flowering-time was accelerated by 1 to 2 weeks under field conditions, while in the OsMADS56 overexpressed mutants, the flowering-time was delayed by 1 to 2 weeks under field conditions (see FIG. 12).

In the experiments under short-day conditions (SD: 10 h L/14 h D) and long-day conditions (LD: 14 h L/10 h D), interestingly, it was observed that in OsMADS51 KO mutants, the flowering-time was delayed by about one month only under short-day conditions (see FIG. 11), and in OsMADS56 overexpressed mutants, the flowering-time was delayed only under long-day conditions (see FIG. 12). In case of the OsMADS56 mutants, two independent lines (named Nos. 8 and 10, respectively) were tested. Furthermore, the OsMADS51 KO line showed a delayed-aging phenotype under field conditions.

Furthermore, OsTRX1 and OsVIN2 were respectively knocked-out to prepare OsTRX1 KO lines and OsVIN2 KO lines by the same method as that of the OsMADS50 KO line. The OsTRX7 KO lines showed a late-flowering phenotype late by at least one month under field conditions (see FIG. 10), and the OsVIN2 KO lines showed a late-flowering phenotype late by about 32 days under long-day conditions, and about 10 days under short-day conditions (see FIG. 13).

EXAMPLE 6

Isolation of OsCOL4

To research further flowering-time regulators, lines exhibiting alteration in flowering-time were screened from the rice mutant population wherein an activation tagging vector (pGA2715; Joeng et al, Plant Physiology , December 2002, Vol. 130, pp. 1636-1644) is inserted. Among them, the line named 1B-00735 is a late-flowering phenotype late by at least 15 days compared with the wild-type line (see FIG. 14). The analysis of the genotype of the mutant line revealed that T-DNA is inserted in the promoter region of OsCOL4 gene, and the OsCOL4 gene is overexpressed due to 35S enhancers present in T-DNA (see FIGS. 15 and 16). The T-DNA insertion position in the OsCOL4 gene and the function of the 35S enhancers present in T-DNA are shown in FIG. 15. Based on such results, the OsCOL4 gene was isolated and its nucleotide sequence is shown in SEQ ID NO: 6.

EXPERIMENTAL EXAMPLE 6

Analysis of Flowering-Time in OsCOL4 Overexpressed or Suppressed Mutants

As disclosed above, T-DNA was inserted in the promoter region of the OsCOL4 gene, and the obtained OsCOL4 overexpressed mutants exhibited a late-flowering phenotype caused by the 35S enhancers present in T-DNA. Furthermore, such late-flowering due to the overexpression (activation tagging) of the OsCOL4 gene was re-confirmed by observing that the mutant, wherein the OsCOL4 gene is operably linked to a strong promoter, pUbi, to be overexpressed, showed delayed-flowering phenotype delayed by about 2 week (see FIG. 17). In FIG. 17, Act1 indicates the actin gene of rice used as a control.

In contrast, the OsCOL4 suppressed mutant line exhibited an early-flowering phenotype early by about 2 weeks (see FIG. 18). Such an OsCOL4 suppression was confirmed in both the mutant wherein T-DNA is inserted in the first exon of the OsCOL4 gene (OsCOL4-1 shown in FIG. 18) and the mutant wherein T-DNA is inserted in the 3′UTR region (OsCOL4-2 shown in FIG. 18).

In experiments with changing photoperiod conditions, the OsCOL4 activation tagging lines displayed late flowering compared with wild-type lines regardless of the photoperiod conditions, while the OsCOL4 suppressed lines displayed early flowering regardless of the photoperiod conditions (see FIG. 19). In FIG. 19, ‘OsCOL4-D’ indicates the OsCOL4 activation tagging mutant.

EXAMPLE 7

Isolation of OsCOL8

The OsCOL8 gene is a CONSTANS-like gene present in rice, and is similar to VRN2 which regulates flowering-time in wheat by vernalization treatment. Through the analysis of T-DNA inserted mutant line according to the present invention, the OsCOL8 gene was isolated as a flowering-time regulator inducing alteration in flowering-time by T-DNA insertion therein, and its nucleotide sequence is shown in SEQ ID NO: 7.

EXPERIMENTAL EXAMPLE 7

Analysis of Flowering-Time in OsCOL8 Suppressed Mutant

To examine the regulation in flowering-time by the OsCOL8 gene, the mutant wherein T-DNA is inserted in the first exon of the OsCOL8 gene was analyzed. The result of the analysis revealed that the flowering-time in the mutant is similar to the wild-type under long-day conditions, while it was delayed under short-day conditions (see FIG. 20). Accordingly, the OsCOL8 gene is expected to work as a flowering activator under short-day conditions.

EXAMPLE 8

Isolation of OsMADS14

Four (4) genes have been known as rice orthologs of APETALA1 (AP1) of Arabidopsis (APETALA1-like gene in rice) involved in formation of floral organs and regulation of flowering-time, each of which was named OsMADS14, OsMADS15, OsMADS18, and OsMADS20, respectively. Among them, the OsMADS14 gene was the first to be cloned as a binding partner of the OsMADS6 protein, however its specific function has been unknown. In the present example, based on the observation that the flowering-time is altered when a DNA fragment such as T-DNA is inserted in the OsMADS14 gene, the gene was isolated as a flowering-time regulator. The nucleotide sequence of the gene is shown in SEQ ID NO: 8.

EXPERIMENTAL EXAMPLE 3

Analysis of Flowering-Time in OsMADS14 Suppressed or Overexpressed Mutants

The result of analysis for the mutants wherein T-DNA or Tos17 is inserted inside the OsMADS14 gene showed no outstanding change in flowering-time and floral development (see FIG. 21). The insertion positions of T-DNA and Tos17 in the OsMADS14 gene are shown in FIG. 21. The above result suggests that other genes besides the OsMADS14 gene work redundantly.

The gene wherein the stop codon was artificially inserted between the last K domain and C domain of the OsMADS14 gene was introduced into the pGA1611(AY373338) vector to induce overexpression of OsMADS14 partial protein wherein the terminal region containing the C domain is deleted. The observation of overexpression of OsMADS14 partial protein wherein the terminal region containing the C domain is deleted as above showed that the flowering-time is accelerated by about one month under short-day conditions, and the flowering-time is delayed by about two weeks under long-day conditions. Such a result reveals that the overexpression of the 3, region deleted OsMADS14 partial gene results in flowering activation under short-day conditions, and in flowering inhibition by interaction with other flowering activators under long-day conditions.