Next Patent: XAF genes and polypeptides: methods and reagents for modulating apoptosis
Next Patent: XAF genes and polypeptides: methods and reagents for modulating apoptosis
The present patent document claims the benefit of the filing date of Indian Patent Application No. 1975/DEL/2005, filed Jul. 26, 2005, which is hereby incorporated by reference.
1. Technical Field
The present invention relates to a method for identifying the type of glioblastoma multiforme in mammals, preferably human subjects. More particularly, it relates to a kit for characterizing progressive glioma in mammals, preferably human subjects. More particularly, it relates to a kit for distinguishing primary and secondary glioblastoma multiforme in mammals, preferably human subjects.
2. Background Information
Gliomas are the most common primary brain tumors and occur at an incidence of almost 12 per 100,000 people (Landis et al., 1999). Diffuse astrocytoma may be classified (as per WHO classification) as low-grade diffuse (DA; Grade II), anaplastic (AA; Grade III) and glioblastoma multiforme (Grade IV; GBM), in the order of increasing malignancy (Mischel et al., 2001). Currently, these classifications are based on the observed histopathological characteristics of the tumor, which are sometimes subjective and inconsistent. GBM constitutes more than 80% of malignant gliomas (DeAngelis et al., 2001) and patients with GBM have a median survival of less than one year. Current treatments, including surgery, radiation therapy, and chemotherapy, unfortunately have not changed the natural history of these incurable neoplasms; and the prognosis of patients with GBMs has not improved significantly in the past 30 years (Davis et al., 1998). To find new diagnostic and therapeutic strategies, a better understanding of the biological pathway(s) leading to glial tumorigenesis is warranted.
Astrocytoma development is known to involve accumulation of a series of genetic alterations (Nagane et al., 1997) similar to other cancers. Identification of many of the genes involved in astrocytoma development, using standard molecular approaches, has helped to understand the process of astrocytomagenesis and progression (Louis and Gusella, 1995). Frequent amplification of epidermal growth factor receptor (EGFR) (Hill et al., 1999; Brock and Bower, 1997), platelet derived growth factor receptor (PDGFR) (Hermanson et al., 1992; Hermanson et al., 1996; Maxwell et al., 1990; Westermark et al., 1995; Fleming et al., 1992), amplification of chromosome 12q region, which carries the cdk4 gene (Nagane et al., 1997; Hill et al., 1999) and alterations in chromosomes 1p, 9p, 10, 17p, 19q, and 22q have frequently been found in these tumors. In addition, mutations in the tumor suppressor gene p53 were found to be associated with chromosome 17p alterations in low grade and progressive astrocytoma (Maher et al., 2001; Phatak et al., 2002). Inactivation of the cdk inhibitor p16 INK4a residing in chromosome 9p, is very common in sporadic astrocytoma, occurring in 50-70% of high-grade gliomas and 90% of GBM cell lines (James et al., 1991; Olopade et al., 1992). LOH in chromosome 10 is one of the most frequent alterations in GBM and is accompanied by the loss of PTEN/MMAC gene (Hill et al., 1999; Li et al., 1997).
GBMs are of two types: primary GBM (de novo type), which manifests in older patients (mean age: 55 yrs) as an aggressive, highly invasive tumor, usually without any evidence of prior clinical disease after a short clinical history of less than 3 months; secondary GBM (progressive type) is usually seen in younger patients (mean age: 40 yrs) and develops more slowly by malignant progression from diffuse (WHO grade II) or anaplastic astrocytoma (WHO grade III). Although some differences in the genetic lesions between these two GBMs have been identified, they are not sufficient enough to be used as differentiating markers considering the fact that the two types of GBMs have comparable clinical, genetic and biological characteristics (Kleihues et al., 2002). However, it is likely that these subtypes would respond differently to specific novel therapies as they are developed in the future (Kleihues and Ohgaki, 1999).
Previously, cancer classification has been based primarily on the morphological appearance of tumor cells. But this has serious limitations, because tumors with similar histopathgological appearance can follow significantly different clinical courses and show different responses to therapy. For example, based on histopathological appearance, astrocytoma grade IV cannot consistently be distinguished from astrocytoma grade III.
Immunophenotyping for brain tumors has defined and refmed diagnosis, e.g., distinguishing oligoastrocytoma from malignant astrocytomas, and high-grade from low-grade astrocytomas. However, differential protein expression (GFAP, vimentin, synaptophysin, nestin) has not helped to improve therapeutic approaches. Prediction of transitions from low- to high-grade astrocytomas is difficult to make with currently available markers (De Girolami et al., 1994).
However, these and other molecular markers currently in use are not capable of unambiguously identifying the subtypes of GBM. Mutations in p53 gene are reported to be associated with about 50% of grade II/III astrocytomas and secondary glioblastomas, but are seen only in 10-20% of primary glioblastoma (Campomenosi et al., 1996; Watanabe et al., 1997; Schmidt et al., 2002). Similarly, Epidermal growth factor receptor (EGFR), another marker routinely used in the classification of GBMs is found to be amplified in only 40% of all primary GBM cases and is rarely reported in secondary GBMs (Frederick et al., 2000).
Thus, secondary GBMs, which progress from less malignant grades, cannot readily be distinguished from progressive GBMs by current histopathological methods.
Despite all this information about glioma, our understanding of astrocytoma development is not sufficient enough to improve prognosis for GBM patients. A more global, systematic understanding of expression patterns of various genes and their downstream gene products in astrocytoma will hopefully provide new diagnostic and therapeutic targets. Towards this, a number of studies have reported the gene expression profile of astrocytoma (Liau et al., 2000; Sallinen et al., 2000; Rickman et al., 2001; Ljubimova et al., 2001; Watson et al., 2001; Tanwar et al., 2002; Fathallah-Shaykh et al., 2002; Nutt et al., 2003; Wang et al., 2003; Godard et al., 2003).
It is also desirable to be able to target specific therapeutic modalities to pathogenetically distinct tumor types to maximize efficacy and minimize toxicity to the patient. (Golub et al., 1999; Kudoh et al., 2000). Previously, cancer classification has been based primarily on the morphological appearance of tumor cells. But this has serious limitations, because tumors with similar histopathgological appearance can follow significantly different clinical courses and show different responses to therapy. For example, based on histopathological appearance, astrocytoma grade IV cannot consistently be distinguished from astrocytoma grade III.
Immunophenotyping for brain tumors has defined and refined diagnosis, e.g., distinguishing oligoastrocytoma from malignant astrocytomas, and high-grade from low-grade astrocytomas. However, differential protein expression (GFAP, vimentin, synaptophysin, nestin) has not helped to improve therapeutic approaches. Prediction of transitions from low- to high-grade astrocytomas is difficult to make with currently available markers (De Girolami et al., 1994).
Tews et al. reported that immunohistochemical detection of various cancer-associated markers failed to reveal significant differential expression patterns among primary and secondary glioblastomas and precursor tumors; there was also no intra-individual constant expression pattern during glioma progression or correlation with malignancy (Tews and Nissen, 1998-99). In contrast, class prediction for leukemia has been described based on monitoring gene expression profiles with DNA microarrays (Golub et al., 1999).
But no class prediction capability, based on gene expression profiles, has been available heretofore for classifying gliomas to allow for optimizing treatment regimens. The molecular markers currently in use are not capable of unambiguously identifying the subtypes of GBM. Mutations in p53 gene are reported to be associated with about 50% of grade II/III astrocytomas and secondary glioblastoma, but are seen only in 10-20% of primary glioblastoma (Campomenosi et al.,1996: Watanabe et al., 1997: Schmidt et al., 2002). Similarly, Epidermal growth factor receptor (EGFR), another marker routinely used in the classification of GBMs is found to be amplified in only 40% of all primary GBM cases and is rarely reported in secondary GBMs (Frederick et al., 2000). Clearly, these markers used alone or in combination lack the ability to robustly classify gliomas into the progressive and de novo types. The immunohistochemical determination of the proliferative nature of tumors with the monoclonal antibody MIB-1 against Ki-67, a nuclear antigen, has been used widely for establishing the grade for many tumors (Schiffer at al., 1997, Di et al, 1997). Thus, secondary GBMs, which progress from less malignant grades, cannot readily be distinguished from de novo GBMs by current histopathological methods.
Therefore, it is also a desideratum to be able to predict the subtype of glioblastoma multiforme and, thus, to be able to administer appropriate treatment. These and other benefits are provided by the present invention.
The main object of the present invention is to provide a method for identifying the type of glioblastoma multiforme in mammals, preferably human subjects.
Another object of the present invention is to provide a kit for characterizing progressive glioma in mammals, preferably human subjects.
Further, object of the present invention is to provide a kit for distinguishing primary and secondary glioblastoma multiforme in mammals, preferably human subjects.
The present invention deals with a method for identifying the type of glioblastoma multiforme in mammals preferably human subjects the expression level of a single or combination of genes selected from notch signaling pathway such as Achaete-scute complex-like 1 (ASCL1) having accession number NM — 004316, Hairy and Enhancer of Split 1 (HES 1) having accession number NM — 0055246, Hairy and Enhancer of Split 6 (HES 6) having accession number: NM — 018645 and Delta-like 1 (DLL1) having accession number NM — 005618 in a test sample of brain tissue cells obtained from a mammals preferably human subject and in a control sample of known normal brain tissue cells, wherein the higher level of expression of Achaete-scute complex-like 1, Hairy and Enhancer of Split 6 and Delta-like 1 in the test sample indicates the presence of primary glioblastoma multiforme as compared to the control sample and lower level of expression of Hairy and Enhancer of Split 1 in the test sample as compared to the control sample indicates the presence of secondary glioblastoma multiforme in a mammals preferably human subject from which the test sample is obtained. It also deals with a kit for characterizing progressive glioma in mammals, preferably human subjects, and a kit for distinguishing primary and secondary glioblastoma multiforme in mammals, preferably human subject.
FIG. 1 represents Scatter-plots of differentially regulated notch pathway genes during astrocytoma: Log2-transformed gene expression ratios obtained from real-time quantitative PCR analysis are plotted for ASCL1(A), HES1 (B), HES6 (C), and DLL1 (D). Each dot represents a data derived from one sample. A change in gene expression by 2 fold or more over its mean expression in normal brain sample was considered significant except in the case of HES1 where a cutoff of 1.5 fold was used. Fold change cutoffs are represented by dashed lines.
FIG. 2 represents Immunohistochemical validation of ASCL1 overexpression in progressive astrocytoma. Sections from normal brain (A and B), grade II diffuse astrocytoma (C and D), grade III anaplastic astrocytoma (E and F), secondary GBMs (G and H) and Primary GBMs (I and J) were stained with H & E (A, C, E, G and I) and for ASCL1 (B, D, F, H and J).
Note that grade II diffuse astrocytoma, grade III anaplastic astrocytoma, secondary GBM but not Primary GBM samples are positive for ASCL1 staining.
FIG. 3 represents Immunohistochemical validation of ASCL1 overexpression in progressive astrocytoma. Sections from normal brain (A and B), grade II diffuse astrocytoma (C and D), grade III anaplastic astrocytoma (E and F), secondary GBMs (G and H) and Primary GBMs (I and J) were stained with H & E (A, C, E, G and I) and for ASCL1 (B, D, F, H and J).
Note that grade II diffuse astrocytoma, grade III anaplastic astrocytoma, secondary GBM but not Primary GBM samples are positive for ASCL1 staining.
Accordingly, the present invention provides a method for identifying the type of glioblastoma multiforme in mammals preferably human subjects, comprising determining the expression level of a single or combination of genes selected from notch signaling pathway such as Achaete-scute complex-like 1 (ASCL1) having accession number NM — 004316, Hairy and Enhancer of Split 1 (HES1) having accession number NM — 0055246, Hairy and Enhancer of Split 6 (HES6) having accession number: NM — 018645 and Delta-like 1 (DLL1) having accession number NM — 005618 in a test sample of brain tissue cells obtained from a mammals preferably human subject and in a control sample of known normal brain tissue cells, wherein the higher level of expression of Achaete-scute complex-like 1, Hairy and Enhancer of Split 6 and Delta-like 1 in the test sample indicates the presence of primary glioblastoma multiforme as compared to the control sample and lower level of expression of Hairy and Enhancer of Split 1 in the test sample as compared to the control sample indicates the presence of secondary glioblastoma multiforme in a mammals preferably human subject from which the test sample is obtained.
In an embodiment of the present invention, the expression level of said genes is determined by checking the level of RNA transcripts of the said genes by employing an oligonucleotide in nucleic acid-based detection methods such as in situ hybridisation, RT-PCR analysis etc. or optionally the expression level of said genes is determined by checking the level of respective proteins of said genes by employing an antibody in protein-based detection methods such as immunohistochemistry, Western blot analysis etc.
In another embodiment of the present invention, the presence of secondary glioblastoma multiforme is identified using the said genes in combination with known markers selected from the group consisting of EGFR, p53, Ki-67 etc.
Further, the present invention provides a kit for characterizing progressive glioma in a mammals preferably human subject, wherein the said kit comprising:
a) reagent capable of specifically detecting the presence or absence of the combination of genes of the Notch signaling pathway such as Achaete-scute complex-like 1, Hairy and Enhancer of Split 1, Hairy and Enhancer of Split 6 and Delta-like 1;
b) instructions for using said kit for characterizing progressive glioma in said mammals, preferably human subject.
In an embodiment of the present invention, the reagent used comprises a nucleic acid probes selected from the group comprising of probe of SEQ ID No. 14 complementary to mRNAs of the hairy and enhancer of split 1 (HES) gene of SEQ ID No. 1 having accession no. NM — 005524, probe of SEQ ID No. 11 complementary to mRNAs of the achaete-scute complex like 1 (ASCL1) gene of SEQ ID No. 3 having accession no. NM — 004316, probe of SEQ ID No. 17 complementary to mRNAs of the hairy and enhancer of split 6 (HES6) gene of SEQ ID No. 5 having accession no. NM — 018645, probe of SEQ ID No. 20 complementary to mRNAs of the delta-like 1 (DLL1) gene having accession no. NM — 005618 of the Notch signaling pathway.
In another embodiment of the present invention, the reagent used comprises an antibody that specifically binds to proteins encoded by the genes of the Notch signaling pathway selected from the group comprising of as Achaete-scute complex-like 1 (ASCL1) having accession number NM — 004316, Hairy and Enhancer of Split l(HES1) having accession number NM — 0055246, Hairy and Enhancer of Split 6 (HES6) having accession number: NM — 018645 and Delta-like 1 (DLL1) having accession number NM — 005618.
The present invention also provides a kit for distinguishing primary and secondary glioblastoma multiforme in a mammals preferably human subject, wherein the said kit comprising:
a) a reagent capable of specifically detecting the presence or absence of the combination of said genes such as Achaete-scute complex-like 1, Hairy and Enhancer of Split 1, Hairy and Enhancer of Split 6, and Delta-like 1;
b) instructions for using said kit for characterizing secondary glioblastoma multiforme in said mammals, preferably human subject.
In an embodiment of the present invention, the reagent used comprises a nucleic acid probes selected from the group comprising of probe of SEQ ID No. 14 complementary to mRNAs of the hairy and enhancer of split 1 (HES) gene of SEQ ID No. 1 having accession no. NM — 005524, probe of SEQ ID No. 11 complementary to mRNAs of the achaete-scute complex like 1 (ASCL1) gene of SEQ ID No. 3 having accession no. NM — 004316, probe of SEQ ID No. 17 complementary to mRNAs of the hairy and enhancer of split 6 (HES6) gene of SEQ ID No. 5 having accession no. NM — 018645, probe of SEQ ID No. 20 complementary to mRNAs of the delta-like 1 (DLL1) gene having accession no. NM — 005618 of the Notch signaling pathway.
In another embodiment of the present invention, the said reagent comprises an antibody that specifically binds to proteins encoded by the said genes of the Notch signaling pathway selected from the group comprising of as Achaete-scute complex-like 1 (ASCL1) having accession number NM — 004316, Hairy and Enhancer of Split 1 (HES1) having accession number NM — 0055246, Hairy and Enhancer of Split 6 (HES6) having accession number: NM — 018645 and Delta-like 1 (DLL1) having accession number NM — 005618.
Gliomas include any malignant glial tumor, i.e., a tumor derived from a transformed glial cell. A glial cell includes a cell that has one or more glial-specific features, associated with a glial cell type, including a morphological, physiological and/or immunological feature specific to a glial cell (e.g. astrocytes or oligodendrocytes), for example, expression of the astroglial marker fibrillary acidic protein (GFAP) or the oligodendroglial marker O4. Gliomas include, but are not limited to, astrocytoma grade II, anaplastic astrocytoma grade III, astrocytoma with oligodendrogliomal component, oligodendroglioma, and glioblastoma multiforme (GBM; astrocytoma grade IV).
The inventive method involves collecting or otherwise obtaining a sample of a bodily substance derived from the mammals preferably human subject, which sample contains mammals preferably human nucleic acid or protein originating from the subject, and quantitatively or semi-quantitatively detecting therein over expression or lack thereof of the combination of genes of the Notch pathway including, but not limited to, Achaete-scute complex-like 1, Hairy and Enhancer of Split 1, Hairy and Enhancer of Split 6 and Delta-like 1. This includes detection by means of measuring of proteins or specific nucleic acids, such as RNA or cDNA. A characteristic expression pattern of the said genes is diagnostic for the presence of different types of glioma.
The sample is preferably collected directly from the mammals, preferably human subject's body. Preferred and convenient substances for sampling include blood, lymph or plasma, cerebrospinal fluid, other biopsy sample of cellular material from brain tissue. Cellular material includes any sample containing mammals, preferably human cells, including samples of tissue, expressed tissue fluids (e.g., lymph or plasma) or tissue wash and the like. Tissue samples that can be collected include, but are not limited to, cell-containing material from the brain. This includes normal brain tissue, tumor tissue, tumor-adjacent tissue, and/or blood plasma from a site within the brain.
In accordance with the inventive methods, the tissue sample preferably contains cells that express a plurality of protein species and mRNA species, which proteins and/or mRNA species are detectably distinct from one another. “Obtaining” and “collecting” the sample are used interchangeably herein and encompass sampling, resecting, removing from in situ, aspirating, receiving, gathering, and/or transporting the tissue sample or a concentrate, sediment, precipitate, supernatant, filtrate, aspirate, or other fraction of any of these. For example, conventional biopsy methods are useful for obtaining the tissue sample. These include percutaneous biopsy, laparoscopic biopsy, surgical resection, tissue scrapes and swabs, sampling via stents, catheters, endoscopes, needles, surgical resection, and other known means. For example, to obtain a sample from inside the skull of the mammals preferably human subject; typically, Magnetic Resonance Imaging (MRI)-guided stereotactic techniques are employed, but other methods can be used.
The sample is alternatively derived from cultured mammals, preferably human cells, cell-free extracts, or other specimens indirectly derived from a subject's body, as well as from substances taken directly from a subject's body. Samples may be stored before detection methods are applied (for example nucleic acid amplification and/or analysis, or immunochemical detection) by well known storage means that will preserve nucleic acids or proteins in a detectable and/or analyzable condition, such as quick freezing, or a controlled freezing regime, in the presence of a cryoprotectant, for example, dimethyl sulfoxide (DMSO), trehalose, glycerol, or propanediol-sucrose. Samples may also be pooled before or after storage for purposes of amplifying the nucleic acids specific for the said genes for analysis and detection, or for purposes of detecting the respective proteins.
The sample is used immediately or optionally pre-treated by refrigerated or frozen storage overnight, by dilution, by phenol-chloroform extraction, or by other like means, to remove factors that may inhibit various amplification reactions. The level of expression in the sample for the said proteins or their messenger ribonucleic acid (mRNA) is then detected quantitatively or seni-quantitatively.
Polynucleotides specific for the said genes, including mRNA species, are determined by base sequence similarity or homology to known nucleotide sequences. Base sequence homology is determined by conducting a base sequence similarity search of a genomics data base, such as the GenBank database of the National Center for Biotechnology Information (NCBI; www.ncbi.nlm.nih.gov/BLAST/), using a computerized algorithm, such as PowerBLAST, QBLAST, PSI-BLAST, PHI-BLAST, gapped or ungapped BLAST, or the “Align” program through the Baylor College of Medicine server (www.hgsc.bcm.tmc.edu/seq_data) (Altchul, et al., 1997; Zhang and Madden, 1997; Madden et al., 1996; Altschul et al., 1990).
Preferably, polynucleotide sequences specific to the said genes, including an mRNA sequence, is at least 5 to 30 contiguous nucleotides long, more preferably at least 6 to 15 contiguous nucleotides long, and most preferably at least 7 to 10 contiguous nucleotides long. mRNA specific to any of the said genes can be, but is not necessarily, an mRNA species containing a nucleotide sequence that encodes a finctional version of the said genes or fragments thereof. Also included among mRNAs specific to the said genes are splice variants.
Quantitatively or semi-quantitatively detecting the expression levels of mRNAs specific to the said genes or their proteins, or of other proteins or mRNA species of interest in accordance with the present invention, is done by any known method that provides a quantitative or semi-quantitative determination of expression. A “quantitative” detection method provides an absolute value for the amount or level of expression in comparison to a standard, which amount or level is typically a mole, mass, or activity value normalized in terms of a specified mass of protein, mass of nucleic acid, number or mass of cells, body weight, or the like. Additionally, the quantitative or absolute value is optionally normalized in terms of a specified time period, i.e., expression level as a rate. A “semi-quantitative detection method provides a unitless relative value for the amount or level of expression, for example, in terms of a ratio of expression in a given sample relative to a control, such as normal tissue or the expression of a selected “housekeeping” gene. The skilled artisan is aware of other examples of quantitative and semi-quantitative detection methods.
In accordance with the inventive methods, the expression level of the proteins encoded by the said genes is optionally detected by immunochemical means, such as, but not limited to, enzyme-linked immunosorbent assay (ELISA), immunofluorescent assay (IFA), immunoelectrophoresis, immunochromatographic assay or immunohistochemical staining, employing polyclonal or monoclonal antibodies or antibody fragments against the said gene products. Antibodies or antibody fragments that target the said proteins are available commercially or can be produced by conventional means.
Similarly, the expression levels of other proteins of interest, in accordance with the inventive methods, can be detected by conventional immunochemical means as described above. These proteins include, but are not limited to, Achaete-scute complex-like 1, Hairy and Enhancer of Split 1, Hairy and Enhancer of Split 6, and Delta-like 1.
Most preferably, quantitative or semi-quantitative detection of the expression level of mRNA species is accomplished by any of numerous methods of nucleic acid amplification (e.g., amplification of specific nucleic acid segments) in the form of RNA or cDNA, which RNA or cDNA amplification product is ultimately measured after amplification. The final amplification product of RNA or cDNA is measured by any conventional means, such as, but not limited to, densitometry, fluorescence detection, or any other suitable biochemical or physical assay system. Before amplification, it is preferable to extract or separate mRNA from genomic DNA in the sample and to amplify nucleic acids remaining in that fraction of the sample separated from the DNA, to avoid false positives that are caused by amplification of contaminating genomic DNA in the original specimen.
Histopathological means of classifying malignant tumors into grades are known for various kinds of malignant tumor, including gliomas (Cotran et al., 1994; Daumas-Duport et al., 1988).
Primary and secondary GBMs are frequently indistinguishable with conventional histopathological methods, but using the inventive method, these types are readily distinguished, since secondary GBMs generally overexpress any or a combination of genes from the group consisting of, but not limited to, Achaete-scute complex-like 1, Hairy and Enhancer of Split 6, and Delta-like 1 and primary GBMs generally overexpress any or a combination of genes from the group consisting of, but not limited to, Hairy and Enhancer of Split 1 (See FIG. 1).
The first group contains the type that arises de novo and are more aggressive (primary GBMs), as described herein; the second group contains the type that progresses from lower grades and are less aggressive (secondary GBMs).
The foregoing descriptions of the methods of the present invention are only illustrative and by no means exhaustive. When these features of the present invention are employed, diagnostic and treatment decisions can be more appropriately optimized for the individual glioma patient, and the prospects for his or her survival can be enhanced.
ASCL1 has been shown to be highly expressed in neuroendocrine cancers, medullary thyroid cancer (MTC) and small cell lung cancer (SCLC) (Ball et al., 1993). We found that ASCL1 to be upregulated in majority of grade II diffuse astrocytomas (85.71%; 6/7), grade III anaplastic astrocytoma (90%; 9/10) and secondary GBMs (87.5%; 7/8) (FIG. 1A). However, among primary GBMs, ASCL1 upregulation was seen only in 33.33% (4/12) of the samples (FIG. 1A). Increase in ASCL1 transcripts also correlated immunohistochemically with increased nuclear staining for ASCL1 in grade II diffuse astrocytoma (FIG. 2D), grade III anaplastic astrocytoma (FIG. 2F), and secondary GBM (FIG. 2H). Most of these samples also showed increased nuclear staining for p53, which is indicative of mutated p53 characterizing progressive astrocytomas and did not show staining for EGFR (Table 1). As expected, primary GBMs did not show detectable staining for ASCL1 (FIG. 2J). Majority of these tumors overexpressed EGFR whilst p53 immunoreactivity was noted in minimal number of cases (Table 1). Normal brain sections did not reveal immunoreactivity for ASCL1 (Fig.2), p53 and EGFR (data not shown). Table 1 describes the details about various astrocytoma samples used in this study, their staining pattern for various markers and their clinical parameters. Since ASCL1 upregulation is seen in majority of secondary, but not in primary, GBMs. ASCL1 status could be used as a marker to differentiate secondary GBM from primary GBM. Mutations in p53 gene are associated with about 50% of grade II/III astrocytomas and secondary glioblastomas, but are seen only in 10-20% of primary glioblastoma (Campomenosi et al., 1996; Watanabe et al., 1997; Schmidt et al., 2002).
Similarly, amplification of epidermal growth factor receptor (EGFR) gene is found in 40% of primary GBMs but it is rare in secondary GBMs (Frederick et al., 2000). These results suggest that the ASCL1 expression could be used differentiate primary from secondary GBMs. Also combined use of ASCL1, p53 and EGFR immunohistochemical staining to differentiate secondary GBMs from Primary GBMs could be considered.
Furthermore, ASCL1 upregulation was found to accompanied by inhibition of notch signaling in grade II diffuse astrocytoma, grade III anaplastic astrocytoma and secondary GBMs, but not in primary GBMs, suggesting that these molecular changes may characterize progressive astrocytoma. We provide below evidence for the regulation of Notch signaling pathway during low grade astrocytoma development from normal astroglial cells and further progression to anaplastic astrocytoma and then to secondary GBM.
During the development of central nervous system (CNS), the neural stem cells, which are common progenitor cells, proliferate and subsequently differentiate into three major cell types of the brain: neurons, astrocytes and oligodendrocytes (Qian et al., 2000). Several molecular mechanisms have been found to be involved in the differentiation of multipotent neural stem cells into different brain cell types. Neurogenic bHLH transcription factors like neurogenin ½ and MASH1, a murine homologue of achaete-scute complex-like 1 (ASCL1), have been shown to inhibit glial differentiation (Furukawa et al., 2000; Nieto et al., 2001; Novitch et al., 2001; Satow et al., 2001; Sun et al., 2001; Zhou et al., 2000). The cytokine leukemia inhibitory factor (LIF) promotes astroglial differentiation through JAK-STAT signaling pathway (Johe et al., 1996; Bonni et al., 1997). Notch signaling has been shown to play a major role in the differentiation of several tissues including nervous tissue in many organisms (Ghysen et al., 1993; Artavanis-Tsakonas et al., 1995, 1999). While the notch signaling inhibits the neuronal and oligodendroglial differentiation, it has recently been reported to instructively drive satellite glial cell differentiation in peripheral neural crest stem cells and to promote astrocyte differentiation in adult hippocampal NSCs (Morrison et al., 2000; Tanigaki et al., 2001).
Since our results show that there is upregulation of ASCL1 in the majority of grade II diffuse astrocytoma, grade III anaplastic astrocytoma and secondary GBMs, we hypothesized that notch signaling may be inhibited during diffuse astrocytoma (grade II) development from astroglial cells, which would further provide suitable environment for progression to anaplastic astrocytoma (grade III) and subsequently to secondary GBM. To test this hypothesis, we analyzed the levels of various notch pathway genes in the same set of samples.
Binding of any of the Notch ligands, which include Delta1, Jagged1, and Jagged2, leads to a complex cleavage and activation of Notch proteins (Artavanis-Tsakonas et al., 1999; Weinmaster, 1997). The released and activated COOH-terminal fragment of Notch translocates to the nucleus where it interacts with the transcription factor CBF 1 (RBPjk) to transactivate target genes including Hairy and enhancer of Split 1 (HES1) (Artavanis-Tsakonas et al., 1999; Weinmaster, 1997). Accordingly, we tested the levels of HES1 in our samples. In our experiments, we found that the transcript levels of the notch target gene HES1, a transcriptional repressor of ASCL1, remain similar to or less than that of normal brain tissue in 52.94% (9/17) of grade II/III astrocytoma (3 out of 7 grade II and 6 out of 10 grade III samples) and 85.7% of (6/7) secondary GBM (FIG. 1B). In contrast to this, the expression of HES1 is increased in most primary GBM samples (75% had more than 1.5 fold transcripts than that of normal; 9/12) (FIG. 1B).
Another member of HES family of genes, HES6, has been shown to functionally antagonize HES1 and relieve positive bHLH factors like ASCL1 from inhibition by HES1 (Bae et al., 2000; Gibert and Simpson, 2003). HES6 actually binds to HES1 and abolishes its ability to repress transcription. In our experiments, We found that the level of HES6 transcripts is increased several fold in majority of samples from grade II diffuse astrocytoma (71.43%; 5/7), grade III anaplastic astrocytoma (66.67%; 6/9) and secondary GBM (71.43%; 5/7) (FIG. 1C). However, the levels of HES6 transcripts did not increase in primary GBMs. The expression levels are in the same range as normal samples in majority of them (75%; 9/12) (FIG. 1C). Thus, the high level of HES6, which is expected to inhibit HES1, gives another explanation for induced expression of ASCL1 in majority of grade II/III astrocytomas and secondary GBMs.
Binding of any of the Notch ligands, which include Delta1, Jagged1, and Jagged2, leads to a complex cleavage and activation of Notch proteins (Artavanis-Tsakonas et al., 1999; Weinmaster, 1997). The released and activated COOH-terminal fragment of Notch translocates to the nucleus where it interacts with the transcription factor CBF1 (RBPjk) to transactivate target genes including Hairy and enhancer of Split 1 (HES1) (Artavanis-Tsakonas et al., 1999; Weinmaster, 1997). Accordingly, we then analyzed levels of expression of notch ligands Delta1 (Delta-like 1; DLL1) in astrocytoma samples. We found very high levels of Delta1 transcripts in majority of samples analyzed belonging to grade II diffuse astrocytoma (71.43%; 5/7), grade III anaplastic astrocytoma (100% (10/10) and secondary GBMs (85.71% 6/7) (FIG. 1D). However, the Deltal transcript levels remain unchanged in majority of primary GBMs (91.67%; 11/12) (FIG. 1D). High levels of Delta1 seen in astrocytoma samples over expressing ASCL1 can be explained by the fact that Delta1 is shown to be transcriptionally activated by ASCL1 (Heitzler et al., 1996). In fact the expression of Delta1 appears to be under the control of MASH1 (Post et al., 2000). MASH1 knockout is associated with a total loss of Delta1 expression in the lung (Apelqvist et al., 1999).
Similarly, MASH1 mutants fail to express Delta1 transcripts (Casarosa et al., 1999). Increased levels of notch ligand Delta1 is expected to activate the notch signaling pathway. On the other hand, the presence of uninduced levels of notch target gene HES1 and very high levels of ASCL1 transcripts in these samples are suggestive of inhibition of notch signaling. Because the activity of notch ligands is known to be regulated by glycosylation of notch receptors by fringes (Haltiwanger and Stanley, 2002), we thought regulation of fringe proteins may explain the fact that notch signaling is appears to be inhibited in progressive astrocytoma in spite of the fact that notch ligand Delta 1 is overexpressed in these set of tumors. On analysis, we found no significant change in the expression levels of Lunatic, Radical and Manic fringe in most samples suggesting that fringe molecules may not have any role in inhibiting notch ligands during progressive astrocytoma development (data not shown). It is reported that notch ligands Delta1 and Jagged 1 sequester Notch proteins in the endoreticulum or golgi apparatus of neuronal precursors as intracellular heteromeric complexes and thus reduce the effective dose of Notch signaling (Sakamoto et al., 2002). Thus the over expression of notch ligands is believed to inhibit notch signaling by forming intracellular cell-autonomus ligand:receptor associations rather than activate the notch pathway. Taken together, these results suggest that notch signaling is inhibited early during the development of diffuse astrocytoma and the consequent elevation of ASCL1 may facilitate further progression to anaplastic astrocytoma and later to secondary GBM. Moreover, our data indicate that notch pathway remains activated in primary GBMs and suggest the possibility that notch pathway has no role in the development of primary GBM.
Thus, we present multiple evidences for inhibition of notch signaling pathway during the development of diffuse astrocytoma, which ultimately progresses to secondary GBM. Firstly, the level of ASCL1 transcript is found to be significantly high in majority of grade II/III astrocytoma as well as secondary GBMs. Notch signaling causes transactivation of Hairy and Enhancer of Split (HES) genes, which in turn repress ASCL1 expression through transcriptional mechanisms (Chen et al., 1997). A similar regulation is seen in HES1 −/− mice, where the level of ASCL1 is found to be elevated (Ito et al., 2000). Mash1 and Math3, a murine ato homolog have been shown to play a major role in neuronal versus glial fate determination in the CNS and it is possible that downregulation of the Mash1 and Math3 is one of the mechanisms to initiate gliogenesis (Tomita et al., 2000). Thus the increased level of ASCL1 is suggestive of inhibition of notch signaling in progressive astrocytoma. Secondly, the transcript levels of notch target HES 1, an inhibitor of ASCL1 expression, is not induced in majority of grade II/III astrocytomas and secondary GBMs in comparison to normal brain samples. Thirdly, the levels of HES6 transcripts, a dominant negative inhibitor of notch signaling, is increased several fold in majority of grade II/III astrocytomas and secondary GBMs. HES6 is a dominant negative inhibitor of HES1 and it inhibits the function of HES1 by associating with it and abolishing its ability to repress transcription (Bae et al., 2000; Gibert and Simpson, 2003). Finally, we found high levels of Delta1 transcripts in most samples analyzed belonging to grade II/III astrocytoma and secondary GBM. The reason for increased levels of Delta1 can be explained by the fact that Delta1 is shown to be transcriptionally activated by ASCL1 (Heitzler et al., 1996). In fact the expression of Delta1 appears to be under the control of MASH1 (Post et al., 2000). MASH1 knockout is associated with a total loss of Delta1 expression in the lung (Apelqvist et al., 1999). Similarly, MASH1 mutants fail to express Delta1 transcripts (Casarosa et al., 1999). High levels of notch ligand Delta1 is capable of inhibiting notch signaling by forming intracellular cell-autonomus Notch:Delta1 associations (Sakamoto et al., 2002). Thus our data clearly demonstrate the downregulation of notch signaling during progressive astrocytoma development.
It also provides evidence for the fact that inhibition of notch signaling occurs only in the secondary GBM, which is a progressive type, but not in primary GBM, which arises by a de novo process. While ASCL1 levels are upregulated in majority of grade II/III astrocytoma and secondary GBMs, its levels remain unchanged in majority of primary GBMs. The expression levels of other genes associated with notch signaling correlate with the levels of ASCL1 expression.
We also put forward a hypothesis that notch signaling may have tumor suppressor or growth inhibitory role in astroglial cell type. Although, the mammals preferably human Notch1 was originally isolated as an oncogene in acute lymphoblastic leukemia (T-ALL) (Ellisen et al., 1991), this pathway has been shown to have distinctive roles in cancers arising from different tissues. For example, while the Notch signals are oncogenic in pre-T cells (Ellison et al., 1991) and cervical epithelium (Nair et al., 2003), it suppresses tumor development in keratinocytes (Rangarajan et al., 2001; Nicolas et al., 2003). Since notch signaling promotes differentiation of neural stem cells to astroglial cells (Qian et al., 2000), notch expression is likely to be growth inhibitory rather than oncogenic in normal astroglial cells.
Another interesting finding from this study is the upregulation of HES6 in majority of grade II/III astrocytoma and secondary GBMs. HES6 has been found to be over expressed in mammals preferably human primary tumors derived from breast, lung and kidney suggesting that HES6 overexpression may have an oncogenic role (Swearingen et al., 2003). Indeed, HES6 has been located in chromosome 2q37, a region known to be amplified in common adenocarcinomas such as that of the lung, breast, prostate, kidney and ovary (Mitelman et al., 2002). The ability of HES6 to inhibit HES1 activity could be significant in that notch signaling have tumor suppressor role in certain tissues (Rangarajan et al., 2001; Nicolas et al., 2003) and HES1 has been shown to have to play a role of tumor suppressor in mammary gland carcinoma cells (Strom et al., 2000; Muller et al., 2002). Taken together, our data suggest that notch signaling has a tumor suppressor role in astroglial cell type and is inhibited early during the development of low grade astrocytoma, which may provide a suitable environment for further development to anaplastic astrocytoma and then to secondary GBM.
The following examples are given by way of illustration of the present invention and therefore should not be constructed to limit the scope of the present invention.
Tissue Collection
Glioma tissue samples were collected from patients, who underwent surgery at Sri Satya Sai Institute of Higher Medical Sciences and Manipal Hospital, Bangalore, India at the time of surgical resection. Control samples comprised non-tumorous brain tissue samples (temporal lobe) collected from patients who underwent surgery for intractable epilepsy. A total of thirty-seven glioma samples of different grades were used in this study. Tissues were bisected and one half was snap-frozen in liquid nitrogen and stored at −80° C. until RNA isolation. The other half was fixed in formalin and processed for paraffin sections and these were used to identify the histopathological grade and the type of glioma.
RNA Isolation
Total RNA was extracted from the frozen tissue by a combination of the TRIzol method (Invitrogen, USA) and RNeasy Midi kit (Qiagen) according to the manufacturer's instructions. The RNA samples were quantified by measuring the absorbance using a spectrophotometer and visualized on a MOPS-Formaldehyde gel for quantity and quality assurance.
Quantitative RT-PCR
The relative quantitation of expression levels of selected genes was carried out using a two-step strategy: in the first step, cDNA was generated from RNA derived from different tissue samples using the High-capacity cDNA archive kit (ABI PRISM); subsequently real-time quantitative PCR was carried out with the cDNA as template using the following gene-specific primer sets and DyNAmo HS SYBR Green qPCR kit (Finnzymes, Finland):
| ASCL1_Forward: | ||
| 5′CTCAACTTCAGCGGCTTTGG3′, | (SEQ ID NO: 21) | |
| ASCL1_Reverse: | ||
| 5′GCTCGCCGGTCTCATCCTAC3′, | (SEQ ID NO: 22) | |
| HES1_Forward: | ||
| 5′ATGGAGAAAAATTCCTCGTCCC3′, | (SEQ ID NO: 23) | |
| HES1_Reverse: | ||
| 5′TTCAGAGCATCCAAAATCAGTGT3′, | (SEQ ID NO: 24) | |
| HES6_Forward: | ||
| 5′CCTTGGTGACCAATGCCAG3′, | (SEQ ID NO: 25) | |
| HES6_Reverse: | ||
| 5′CCTGCAAGCCATCCATCAG3′, | (SEQ ID NO: 26) | |
| DLL1_Forward: | ||
| 5′TCCTGATGACCTCGCAACAGA3′, | (SEQ ID NO: 27) | |
| DLL1_Reverse: | ||
| 5′ACACACGAAGCGGTAGGAGT3′. | (SEQ ID NO: 28) |
The reactions were carried out in the ABI PRISM 7000/7900 (Applied Biosystems) Sequence Detection Systems. Data was analyzed as per the relative quantification model proposed by Pfaff1, which includes efficiency correction (Pfaff1, 2001). All measurements were made in duplicate, and for each qRT-PCR primer set, reaction efficiency estimates were derived from standard curves that were generated using serial dilutions of the pool of cDNA set used for the study. Ribosomal protein L35a was used as internal control as its expression level was found to be unaltered in the previous microarray experiments. Normal brain tissue samples from four different epilepsy patients were used as reference. An increase or decrease in gene expression by 2 fold or more over its mean expression in reference samples was considered significant. For certain samples, data was obtained by semi-quantitative end-point RT-PCR.
Immunohistochemistry
Paraffin sections (5 □m) from the tumor and control tissues were collected on chrome-alum coated slides and subjected for immunohistochemistry using the streptavidin-biotin complex/immunoperoxidase method using the following monoclonal (Mab)/polyclonal antibodies: MIB-1 (Ki-67 monoclonal antibody, DAKO, Denmark; 1:50); p53 (DO-1, Oncogene; 1:100); EGFR (Oncogene, 1:25); ASCL1 (Polyclonal, SIGMA; 1:50). Briefly, 5 μm paraffin sections were deparaffinized in xylene, dehydrated in graded alcohol series and rinsed in Tris buffer (50 mM pH 7.6) for 15 minutes. The sections were then microwaved for 15-20 minutes at 700 W in sodium citrate buffer (10 mM pH 6.0) to retrieve antigenicity from paraffin sections. For EGFR staining, the sections were pretreated with 0.05% trypsin at 37° C. for 30 minutes. All sections were further treated with methanol and 3% hydrogen peroxide to block endogenous peroxidase followed by washes with Tris buffer. Milk powder (3%) or bovine serum albumin was used to block background staining for 30 minutes. The sections were then incubated with the primary antibody for 2 hours followed by the linked streptavidin-biotinylated secondary antibody (Universal LSAB, DAKO). 3′3-diaminobenzidine (Sigma) was used as the chromogenic substrate.
Brain tumor samples previously characterized for over expression of p53 and EGFR were used as positive controls. For ASCL1, the tumor sample, which showed marked upregulation by RT-PCR, was taken as the positive control. A negative control slide in which the primary antibody was excluded was used with each batch of slides. For MIB-1 and p53 immunostaining only nuclear staining was regarded as positive where as with EGFR, positive sample showed cytoplasmic and cell surface membrane staining.
For ASCL1 immunostaining, only nuclear staining was considered as positive signal. Tumors were considered ASCL1 positive when more than 5% of tumor cells showed nuclear staining. Regarding p53 and EGFR also, specimens with less than 5% immunopositive tumor cells were scored as negative. The MIB-1 labeling index (LI) was expressed as the percentage of tumor cell nuclei stained, in areas of maximum staining and calculated in at least 1000 tumor cells.
MIB-1 LI was used for accurate grading of astrocytomas. The mean cut-off LI for Grade II astrocytomas was 2.14%±1.042; 7.68%±1.786 for Grade III anaplastic astrocytoma; 19.6%±7.578 for GBM, which more or less corresponded to mean values laid down by the WHO grading scheme (Kleihues et al., 2000).
GBMs were classified as primary or secondary taking into consideration the clinical profile of patients, expression of p53 and EGFR. The mean age of patients with primary GBMs was 50.6 years and mean duration of symptoms was 2.7 months. All tumors showed highly pleomorphic, histomorphological features and evidence of “field necrosis”. Uniform staining for EGFR by immunohistochemistry was evident in all cases and five revealed additionally p53 expression. Among secondary GBMs, the mean age of the patients was 33.8 years and mean duration of symptoms was 5.3 months. p53 immunoreactivity was uniformly evident in all cases and two revealed additionally EGFR over-expression. Histological evidence of progression from grades II or III astrocytoma was clearly seen in 5/8 cases.
Advantages:
The main advantages of the present invention are:
(1 ) The method is useful both before and after clinical symptoms have appeared, and the method can also be applied to monitor the effectiveness of anti-cancer treatments.
(2) It provides a useful method for distinguishing between the two types of Glioblastoma multiforme—the progressive and de novo types.