20090215150 | Sample container and filtration apparatus and method of filtration using the same | August, 2009 | Kane et al. |
20090093045 | ORGANISM TESTING APPARATUS | April, 2009 | Takenaka et al. |
20080038771 | Quantifiable Internal Reference Standards for Immunohistochemistry and Uses Thereof | February, 2008 | Taylor et al. |
20090215663 | SAVINASE VARIANTS HAVING AN IMPROVED WASH PERFORMANCE ON EGG STAINS | August, 2009 | Minning et al. |
20060280723 | Interferon for treating or preventing a coronaviral infection | December, 2006 | Jervis |
20080096240 | NOVEL PROSTAMIDE RECEPTOR ANTAGONISTS | April, 2008 | Woodward et al. |
20020106625 | Bioreactor for generating functional cartilaginous tissue | August, 2002 | Hung et al. |
20090297506 | Classification of cancer | December, 2009 | Orntoft et al. |
20090148926 | HON-SHIMEJI MUSHROOM-FUNGAL BED CULTURE | June, 2009 | Kawai et al. |
20090104160 | Mobilization of Stem Cells After Trauma and Methods Therefor | April, 2009 | Young et al. |
20070219134 | LYMPHATIC ZIP CODES IN TUMORS AND PRE-MALIGNANT LESIONS | September, 2007 | Ruoslahti et al. |
This application claims benefit of priority from U.S. Provisional Patent Application 60/577,084, filed Jun. 4, 2004
This invention relates to the use of gene expression to classify human tumors. The classification is performed by use of gene expression profiles, or patterns, of 50 or more expressed sequences that are correlated with tumors arising from certain tissues as well as being correlated with certain tumor types. The invention also provides for the use of 50 or more specific gene sequences, the expression of which are correlated with tissue source and tumor type in various cancers. The gene expression profiles, whether embodied in nucleic acid expression, protein expression, or other expression formats, may be used to determine a cell containing sample as containing tumor cells of a tissue type or from a tissue origin to permit a more accurate identification of the cancer and thus treatment thereof as well as the prognosis of the subject from whom the sample was obtained.
This invention relates to the use of gene expression measurements to classify or identify tumors in cell containing samples obtained from a subject in a clinical setting, such as in cases of formalin fixed, paraffin embedded (FFPE) samples. The invention provides the ability to classify tumors in the real-world conditions faced by hospital and other laboratories which have to conduct testing on clinical FFPE samples. The invention may also be applied to other samples, such as fresh samples, that have undergone none to little or minimal treatment (such as simply storage at a reduced, non-freezing, temperature), and frozen samples. The samples may be of a primary tumor sample or of a tumor that has resulted from a metastasis of another tumor. Alternatively, the sample may be a cytological sample, such as, but not limited to, cells in a blood sample. In some cases of a tumor sample, the tumors may not have undergone classification by traditional pathology techniques, may have been initially classified but confirmation is desired, or have been classified as a “carcinoma of unknown primary” (CUP) or “tumor of unknown origin” (TUO) or “unknown primary tumor”. The need for confirmation is particularly relevant in light of the estimates of 5 to 10% misclassification using standard techniques. Thus the invention may be viewed as providing means for cancer identification, or CID.
In a first aspect of the invention, the classification is performed by use of gene expression profiles, or patterns, of 50 or more expressed sequences. The gene expression profiles, whether embodied in nucleic acid expression, protein expression, or other markers of gene expression, may be used to determine a cell containing sample as containing tumor cells of a tissue type or from a tissue origin to permit a more accurate identification of the cancer and thus treatment thereof as well as the prognosis of the subject from whom the sample was obtained.
In some embodiments, the invention is used to classify among at least 34 or at least 39 tumor types with significant accuracy in a clinical setting. The invention is based in part on the surprising and unexpected discovery that 50 or more expressed sequences in the human genome are capable of classifying among at least 34, or at least 39, tumor types, as well as subsets of those tumor types, in a meaningful manner. Stated differently, the invention is based in part on the discovery that it is not necessary to use supervised learning to identify gene sequences which are expressed in correlation with different tumor types. Thus the invention is based in part on the recognition that any 50 or more expressed sequences, even a random collection of expressed sequences, has the capability to classify, and so may be used to classify, a cell as being a tumor cell of a tissue or tissue origin.
In another aspect, the invention provides for the classifying of a cell containing sample as containing a tumor cell of a tissue type or origin by determining the expression levels of 50 or more transcribed sequences and then classifying the cell containing sample as containing a tumor cell of a plurality (two or more) of tumor types. To classify among at least 34 to at least 39 tumor types, and subsets thereof, as few as any 50 expressed sequences may be used to provide classification in a meaningful manner. The invention is also based in part on the observation that the expressed sequences need not be those the expression levels of which are evidently or highly correlated (directly, or indirectly through correlation with another expressed sequence) with any of the tumor types. Thus the invention provides, in a further embodiment, for the use of the expression levels of genes, the expression levels of which are not strongly correlated with the actual classification of the particular tumor sample, as one of the 50 or more transcribed sequences. All of the genes selected may be such non-correlates, or only a portion of the genes may be non-correlates, typically at least 90%, 85%, 75%, 50% or 25%, as well as portions falling within the ranges created by using any two of the foregoing point examples as endpoints of a range.
The invention is practiced by determining the expression levels of gene sequences where the sequences need not have been selected based on a correlation of their expression levels with the tumor types to be classified. Thus as a non-limiting example, the gene sequences need not be selected based on their correlation values with tumor types or a ranking based on the correlation values. Additionally, the invention may be practice with use of gene expression levels which are not necessarily correlated to one or more other gene expression level(s) used for classification. Thus in additional embodiments, the ability for the expression level of one expressed sequence to function in classification is not redundant with (is independent of) the ability of at least one other gene expression level used for classification.
The invention may be applied to identify the origin of a cancer in a patient in a wide variety of cases including, but not limited to, identification of the origin of a cancer in a clinical setting. In some embodiments, the identification is made by classification of a cell containing sample known to contain cancer cells, but the origin of those cells is unknown. In other embodiments, the identification is made by classification of a cell containing sample as containing one or more cancer cells followed by identification of the origin(s) of those cancer cell(s). In further embodiments, the invention is practiced with a sample from a subject with a previous history of cancer, and identification is made by classification of a cell as either being cancer from a previous origin of cancer or a new origin. Additional embodiments include those where multiple cancers found in the same organ or tissue and the invention is used to determine the origin of each cancer, as well as whether the cancers are of the same origin.
The invention is also based in part on the discovery that the expression levels of particular gene sequences can be used to classify among tumor types with greater accuracy than the expression levels of a random group of gene sequences. In one embodiment, the invention provides for the use of expression levels of 50 to 74 expressed sequences of a first set in the human genome to classify among at least 34 or at least 39 tumor types with significant accuracy. The invention thus provides for the identification and use of gene expression patterns (or profiles or “signatures”) based on the 50 to 74 expressed sequences as correlated with at least the 34 or 39 tumor types. The invention also provides for the use of 50 to 74 of these expressed sequences to classify among subsets of the 34 or 39 tumor types. Depending on the number of tumor types, accuracies ranging from over 80% to 100% may be achieved.
In another embodiment, the invention provides for the use of expression levels of 50 to 90 expressed sequences of a second set in the human genome to classify among at least 34 or at least 39 tumor types with significant accuracy. 38 of the sequences in the second set are present in the first set of 74 sequences. The expression levels of the 50 to 90 sequences in the second set may be used in the same manner as described for the first set of 74 sequences. Depending on the number of tumor types, accuracies ranging from about 75% to about 95% may be achieved.
The invention is also based in part upon the discovery that use of 50 or more expressed sequences to classify among 53 tumor types, which include (but are not limited to) the 34 and 39 types described herein, was limited by the number of available samples of some tumor types. As noted hereinbelow, accuracy is linked to the number of available samples of each tumor type such that the ability to classify additional tumor types is readily achieved by the application of increased numbers of each tumor type. Thus while the invention is exemplified by use in classifying among 34 or 39 tumor types as well as subsets of the 34 or 39, 50 or more expressed sequences can also be used to classify among all tumor types with the inclusion of samples of the additional tumor types. Thus the invention also provides for the classification of a tumor as being a type beyond the 34 or 39 types described herein.
The invention is based upon the expression levels of the gene sequences in a set of known tumor cells from different tissues and of different tumor types. These gene expression profiles (of gene sequences in the different known tumor cells/types), whether embodied in nucleic acid expression, protein expression, or other expression formats, may be compared to the expression levels of the same sequences in an unknown tumor sample to identify the sample as containing a tumor of a particular type and/or a particular origin or cell type. The invention provides, such as in a clinical setting, the advantages of a more accurate identification of a cancer and thus the treatment thereof as well as the prognosis, including survival and/or likelihood of cancer recurrence following treatment, of the subject from whom the sample was obtained.
The invention is further based in part on the discovery that use of 50 or more expressed sequences as described herein as capable of classifying among two or more tumor types necessarily and effectively eliminates one or more tumor types from consideration during classification. This reflects the lack of a need to select genes with expression levels that are highly correlated with all tumor types within the range of the classification system. Stated differently, the invention may be practiced with a plurality of genes the expression levels of which are not highly correlated with any of the individual tumor types or multiple types in the group of tumor types being classified. This is in contrast to other approaches based upon the selection and use of highly correlated genes, which likely do not “rule out” other tumor types as opposed to “rule in” a tumor type based on the positive correlation.
The classification of a tumor sample as being one of the possible tumor types described herein to the exclusion of other tumor types is of course made based upon a level of confidence as described below. Where the level of confidence is low, or an increase in the level of confidence is preferred, the classification can simply be made at the level of a particular tissue origin or cell type for the tumor in the sample. Alternatively, and where a tumor sample is not readily classified as a single tumor type, the invention permits the classification of the sample as one of a few possible tumor types described herein. This advantageously provides for the ability to reduce the number of possible tissue types, cell types, and tumor types from which to consider for selection and administration of therapy to the patient from whom the sample was obtained.
The invention thus provides a non-subjective means for the identification of the tissue source and/or tumor type of one or more cancers of an afflicted subject. Where subjective interpretation may have been previously used to determine the tissue source and/or tumor type, as well as the prognosis and/or treatment of the cancer based on that determination, the present invention provides objective gene expression patterns, which may used alone or in combination with subjective criteria to provide a more accurate identification of cancer classification. The invention is particularly advantageously applied to samples of secondary or metastasized tumors, but any cell containing sample (including a primary tumor sample) for which the tissue source and/or tumor type is preferably determined by objective criteria may also be used with the invention. Of course the ultimate determination of class may be made based upon a combination of objective and non-objective (or subjective/partially subjective) criteria.
The invention includes its use as part of the clinical or medical care of a patient. Thus in addition to using an expression profile of genes as described herein to assay a cell containing sample from a subject afflicted with cancer to determine the tissue source and/or tumor type of the cancer, the profile may also be used as part of a method to determine the prognosis of the cancer in the subject. The classification of the tumor/cancer and/or the prognosis may be used to select or determine or alter the therapeutic treatment for said subject. Thus the classification methods of the invention may be directed toward the treatment of disease, which is diagnosed in whole or in part based upon the classification. Given the diagnosis, administration of an appropriate anti-tumor agent or therapy, or the withholding or alternation of an anti-tumor agent or therapy may be used to treat the cancer.
Other clinical methods include those involved in the providing of medical care to a patient based on a classification as described herein. In some embodiments, the methods relate to providing diagnostic services based on expression levels of gene sequences, with or without inclusion of an interpretation of levels for classifying cells of a sample. In some embodiments, the method of providing a diagnostic service of the invention is preceded by a determination of a need for the service. In other embodiments, the method includes acts in the monitoring of the performance of the service as well as acts in the request or receipt of reimbursement for the performance of the service.
The details of one or more embodiments of the invention are set forth in the accompanying drawing and the description below. Other features and advantages of the invention will be apparent from the drawing and detailed description, and from the claims.
As used herein, a “gene” is a polynucleotide that encodes a discrete product, whether RNA or proteinaceous in nature. It is appreciated that more than one polynucleotide may be capable of encoding a discrete product. The term includes alleles and polymorphisms of a gene that encodes the same product, or a functionally associated (including gain, loss, or modulation of function) analog thereof, based upon chromosomal location and ability to recombine during normal mitosis.
A “sequence” or “gene sequence” as used herein is a nucleic acid molecule or polynucleotide composed of a discrete order of nucleotide bases. The term includes the ordering of bases that encodes a discrete product (i.e. “coding region”), whether RNA or proteinaceous in nature. It is appreciated that more than one polynucleotide may be capable of encoding a discrete product. It is also appreciated that alleles and polymorphisms of the human gene sequences may exist and may be used in the practice of the invention to identify the expression level(s) of the gene sequences or an allele or polymorphism thereof. Identification of an allele or polymorphism depends in part upon chromosomal location and ability to recombine during mitosis.
The terms “correlate” or “correlation” or equivalents thereof refer to an association between expression of one or more genes and another event, such as, but not limited to, physiological phenotype or characteristic, such as tumor type.
A “polynucleotide” is a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA and RNA. It also includes known types of modifications including labels known in the art, methylation, “caps”, substitution of one or more of the naturally occurring nucleotides with an analog, and internucleotide modifications such as uncharged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), as well as unmodified forms of the polynucleotide.
The term “amplify” is used in the broad sense to mean creating an amplification product can be made enzymatically with DNA or RNA polymerases. “Amplification,” as used herein, generally refers to the process of producing multiple copies of a desired sequence, particularly those of a sample. “Multiple copies” mean at least 2 copies. A “copy” does not necessarily mean perfect sequence complementarity or identity to the template sequence. Methods for amplifying mRNA are generally known in the art, and include reverse transcription PCR (RT-PCR) and quantitative PCR (or Q-PCR) or real time PCR. Alternatively, RNA may be directly labeled as the corresponding cDNA by methods known in the art.
By “corresponding”, it is meant that a nucleic acid molecule shares a substantial amount of sequence identity with another nucleic acid molecule. Substantial amount means at least 95%, usually at least 98% and more usually at least 99%, and sequence identity is determined using the BLAST algorithm, as described in Altschul et al. (1990), J. Mol. Biol. 215:403-410 (using the published default setting, i.e. parameters w=4, t=17).
A “microarray” is a linear or two-dimensional or three dimensional (and solid phase) array of discrete regions, each having a defined area, formed on the surface of a solid support such as, but not limited to, glass, plastic, or synthetic membrane. The density of the discrete regions on a microarray is determined by the total numbers of immobilized polynucleotides to be detected on the surface of a single solid phase support, such as of at least about 50 /cm2, at least about 100 /cm2, or at least about 500 /cm2, up to about 1,000 /cm2 or higher. The arrays may contain less than about 500, about 1000, about 1500, about 2000, about 2500, or about 3000 immobilized polynucleotides in total. As used herein, a DNA microarray is an array of oligonucleotide or polynucleotide probes placed on a chip or other surfaces used to hybridize to amplified or cloned polynucleotides from a sample. Since the position of each particular group of probes in the array is known, the identities of a sample polynucleotides can be determined based on their binding to a particular position in the microarray. As an alternative to the use of a microarray, an array of any size may be used in the practice of the invention, including an arrangement of one or more position of a two-dimensional or three dimensional arrangement in a solid phase to detect expression of a single gene sequence. In some embodiments, a microarray for use with the present invention may be prepared by photolithographic techniques (such as synthesis of nucleic acid probes on the surface from the 3′ end) or by nucleic synthesis followed by deposition on a solid surface.
Because the invention relies upon the identification of gene expression, some embodiments of the invention determine expression by hybridization of mRNA, or an amplified or cloned version thereof, of a sample cell to a polynucleotide that is unique to a particular gene sequence. Polynucleotides of this type contain at least about 16, at least about 18, at least about 20, at least about 22, at least about 24, at least about 26, at least about 28, at least about 30, or at least about 32 consecutive basepairs of a gene sequence that is not found in other gene sequences. The term “about” as used in the previous sentence refers to an increase or decrease of 1 from the stated numerical value. Other embodiments are polynucleotides of at least or about 50, at least or about 100, at least about or 150, at least or about 200, at least or about 250, at least or about 300, at least or about 350, at least or about 400, at least or about 450, or at least or about 500 consecutive bases of a sequence that is not found in other gene sequences. The term “about” as used in the preceding sentence refers to an increase or decrease of 10% from the stated numerical value. Longer polynucleotides may of course contain minor mismatches (e.g. via the presence of mutations) which do not affect hybridization to the nucleic acids of a sample. Such polynucleotides may also be referred to as polynucleotide probes that are capable of hybridizing to sequences of the genes, or unique portions thereof, described herein. Such polynucleotides may be labeled to assist in their detection. The sequences may be those of mRNA encoded by the genes, the corresponding cDNA to such mRNAs, and/or amplified versions of such sequences. In some embodiments of the invention, the polynucleotide probes are immobilized on an array, other solid support devices, or in individual spots that localize the probes.
In other embodiments of the invention, all or part of a gene sequence may be amplified and detected by methods such as the polymerase chain reaction (PCR) and variations thereof, such as, but not limited to, quantitative PCR (Q-PCR), reverse transcription PCR (RT-PCR), and real-time PCR (including as a means of measuring the initial amounts of mRNA copies for each sequence in a sample), optionally real-time RT-PCR or real-time Q-PCR. Such methods would utilize one or two primers that are complementary to portions of a gene sequence, where the primers are used to prime nucleic acid synthesis. The newly synthesized nucleic acids are optionally labeled and may be detected directly or by hybridization to a polynucleotide of the invention. The newly synthesized nucleic acids may be contacted with polynucleotides (containing sequences) of the invention under conditions which allow for their hybridization. Additional methods to detect the expression of expressed nucleic acids include RNAse protection assays, including liquid phase hybridizations, and in situ hybridization of cells.
Alternatively, and in further embodiments of the invention, gene expression may be determined by analysis of expressed protein in a cell sample of interest by use of one or more antibodies specific for one or more epitopes of individual gene products (proteins), or proteolytic fragments thereof, in said cell sample or in a bodily fluid of a subject. The cell sample may be one of breast cancer epithelial cells enriched from the blood of a subject, such as by use of labeled antibodies against cell surface markers followed by fluorescence activated cell sorting (FACS). Such antibodies may be labeled to permit their detection after binding to the gene product. Detection methodologies suitable for use in the practice of the invention include, but are not limited to, immunohistochemistry of cell containing samples or tissue, enzyme linked immunosorbent assays (ELISAs) including antibody sandwich assays of cell containing tissues or blood samples, mass spectroscopy, and immuno-PCR.
The terms “label” or “labeled” refer to a composition capable of producing a detectable signal indicative of the presence of the labeled molecule. Suitable labels include radioisotopes, nucleotide chromophores, enzymes, substrates, fluorescent molecules, chemiluminescent moieties, magnetic particles, bioluminescent moieties, and the like. As such, a label is any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means.
The term “support” refers to conventional supports such as beads, particles, dipsticks, fibers, filters, membranes and silane or silicate supports such as glass slides.
“Expression” and “gene expression” include transcription and/or translation of nucleic acid material.
As used herein, the term “comprising” and its cognates are used in their inclusive sense; that is, equivalent to the term “including” and its corresponding cognates.
Conditions that “allow” an event to occur or conditions that are “suitable” for an event to occur, such as hybridization, strand extension, and the like, or “suitable” conditions are conditions that do not prevent such events from occurring. Thus, these conditions permit, enhance, facilitate, and/or are conducive to the event. Such conditions, known in the art and described herein, depend upon, for example, the nature of the nucleotide sequence, temperature, and buffer conditions. These conditions also depend on what event is desired, such as hybridization, cleavage, strand extension or transcription.
Sequence “mutation,” as used herein, refers to any sequence alteration in the sequence of a gene disclosed herein interest in comparison to a reference sequence. A sequence mutation includes single nucleotide changes, or alterations of more than one nucleotide in a sequence, due to mechanisms such as substitution, deletion or insertion. Single nucleotide polymorphism (SNP) is also a sequence mutation as used herein. Because the present invention is based on the relative level of gene expression, mutations in non-coding regions of genes as disclosed herein may also be assayed in the practice of the invention.
“Detection” or “detecting” includes any means of detecting, including direct and indirect determination of the level of gene expression and changes therein.
Unless defined otherwise all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs.
FIG. 1 shows a capacity plot for the ability to use the expression levels of subsets of a set of 100 expressed gene sequences to classify among 39 tumor types and subsets thereof. Expression levels of random combinations of 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 and 100 (each sampled 10 times) of the 100 sequences were used with data from tumor types and then used to predict test random sets of tumor samples (each sampled 10 times) ranging from 2 to 39 types. A plot of numbers of tumor types versus prediction accuracies for results using from 50 to 100 genes are shown as non-limiting examples. Generally, accuracy improves with higher numbers of gene sequences, where 50 gene sequences results in a more noticeable reduction in accuracy when used with about 20 or more tumor types.
FIG. 2 shows an alternative presentation of the data used with respect to FIG. 1. A plot of numbers of gene sequences used, ranging from 50-100, versus prediction accuracies for various representative numbers of tumor types is shown. The plotted lines, from top to bottom, are of the results from 2, 10, 20, 30, and 39 tumor types, respectively.
FIG. 3 shows the performance of using all genes from a first set of 74 gene sequences and a second set of 90 gene sequences to classify various numbers of tumor types. Generally, the accuracy of the two sets are very similar, with the set of 74 displaying a more noticeable higher accuracy with about 28 or more (up to 39) tumor types.
FIG. 4 shows a capacity plot for the ability to use the expression levels of all or portions of a first set of 74 expressed gene sequences to classify among 39 tumor types and subsets thereof. Expression levels of random combinations of 50, 55, 60, 65, and 70 (each sampled 10 times) as well as all 74 of the sequences were used with data from tumor types and then used to predict test random sets of tumor samples (each sampled 10 times) ranging from 2 to 39 types. A plot of numbers of tumor types versus prediction accuracies for results using from 50 to 74 genes are shown as non-limiting examples. Generally, accuracy improves with higher numbers of gene sequences, with the use of 74 genes being more noticeable as providing the highest accuracies, and 50 gene sequences producing the lowest accuracies, when used with about 20 or more tumor types.
FIG. 5 shows an alternative presentation of the data used with respect to FIG. 4. A plot of numbers of gene sequences used, ranging from 50-74, versus prediction accuracies for various representative numbers of tumor types is shown. The plotted lines, from top to bottom, are of the results from 2, 10, 20, 30, and 39 tumor types, respectively.
FIG. 6 shows a capacity plot for the ability to use the expression levels of subsets of a set of 90 expressed gene sequences to classify among 39 tumor types and subsets thereof. Expression levels of random combinations of 50, 55, 60, 65, 70, 75, 80, and 85 (each sampled 10 times) as well as all 90 of the sequences were used with data from tumor types and then used to predict test random sets of tumor samples (each sampled 10 times) ranging from 2 to 39 types. A plot of numbers of tumor types versus prediction accuracies for results using from 50 to 90 genes are shown as non-limiting examples. Generally, accuracy improves with higher numbers of gene sequences, where 50 gene sequences results in noticeably reduced accuracy when used with about 20 or more tumor types.
FIG. 7 shows an alternative presentation of the data used with respect to FIG. 6. A plot of numbers of gene sequences used, ranging from 50-90, versus prediction accuracies for various representative numbers of tumor types is shown. The plotted lines, from top to bottom, are of the results from 2, 10, 20, 30, and 39 tumor types, respectively.
FIGS. 8A-8D show a “tree” that classifies tumor types covered herein as well as additional known tumor types. It was constructed mainly according to “Cancer, Principles and Practice of Oncology, (DeVito, Hellman and Rosenberg), 6th edition”. Thus beginning with a “tumor of unknown origin” (or “tuo”), the first possibilities are that it is either of a germ cell or non-germ cell origin. If it is the former, then it may be of ovary or testes origin. Within those of testes origin, the tumor may be of seminoma origin or an “other” origin.
If the tumor is of a non-germ cell origin, then it is either of a epithelial or non-epithelial origin. If it is the former, then it is either squamous or non-squamous origin. Squamous origin tumors are of cervix, esophagus, larynx, lung, or skin in origin. Non-squamous origin tumors are of urinary bladder, breast, carcinoid-intestine, cholangiocarcinoma, digestive, kidney, liver, lung, prostate, reproductive system, skin-basal cell, or thyroid-follicular-papillary origin. Among those of digestive origin, the tumors are of small and large bowel, stomach-adenocarcinoma, bile duct, esophagus, gall bladder, and pancreas in origin. The esophagus origin tumors may be of either Barrett's esophagus or adenocarcinoma types. Of the reproductive system origin tumors, they may be of cervix adenocarcinoma type, endometrial tumor, or ovarian origin. Ovarian origin tumors are of the clear, serous, mucinous, and endometroid types.
If the tumor is of non-epithelial origin, then it is of adrenal gland, brain, GIST (gastrointestinal stromal tumor), lymphoma, meningioma, mesothelioma, sarcoma, skin melanoma, or thyroid-medullary origin. Of the lymphomas, they are B cell, Hodgkin's, or T cell type. Of the sarcomas, they are leimyosarcoma, osteosarcoma, soft-tissue sarcoma, soft tissue MFH (malignant fibrous histiocytoma), soft tissue sarcoma synovial, soft tissue Ewing's sarcoma, soft tissue fibrosarcoma, and soft tissue rhabdomyosarcoma types.
This invention provides methods for the use of gene expression information to classify tumors in a more objective manner than possible with conventional pathology techniques. The invention is based in part on the results of randomly reducing the number of gene sequences used to classify a tumor sample as one of a plurality of tumor types, such as the 34 tumor types described below and in U.S. Provisional Application 60/577,084, filed Jun. 4, 2004. A total number of 16,948 genes, which were filtered down from a larger set based upon removal of genes that display low or constant signals in the samples used was used for both cross-validation and prediction accuracies as described in the examples below. 100 random selections of 50, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000 and more genes from the total were selected and used for classification as described herein.
Thus in a first aspect, the invention provides a method of classifying a cell containing sample as including a tumor cell of (or from) a type of tissue or a tissue origin. The method comprises determining or measuring the expression levels of 50 or more transcribed sequences from cells in a cell containing sample obtained from a subject, and classifying the sample as containing tumor cells of a type of tissue from a plurality of tumor types based on the expression levels of said sequences. As used herein, “a plurality” refers to the state of two or more.
In some embodiments of the invention, the expression of more than 50% of said transcribes sequences are not correlated with expression of another one of said transcribed sequences; and/or the 50 or more transcribes sequences are not selected based upon supervised learning using known tumor samples, on the level of correlation between their expression and said plurality of tumor types, or on their rank in a correlation between their expression and said plurality of tumor types.
The classifying is based upon a comparison of the expression levels of the 50 or more transcribed sequences in the cells of the sample to their expression levels in known tumor samples and/or known non-tumor samples. Alternatively, the classifying is based upon a comparison of the expression levels of the 50 or more transcribed sequences to the expression of reference sequences in the same samples, relative to, or based on, the same comparison in known tumor samples and/or known non-tumor samples. Thus as a non-limiting example, the expression levels of the gene sequences may be determined in a set of known tumor samples to provide a database against which the expression levels detected or determined in a cell containing sample from a subject is compared. The expression level(s) of gene sequence(s) in a sample also may be compared to the expression level(s) of said sequence(s) in normal or non-cancerous cells, preferably from the same sample or subject. As described below and in embodiments of the invention utilizing Q-PCR or real time Q-PCR, the expression levels may be compared to expression levels of reference genes in the same sample or a ratio of expression levels may be used.
The selection of 50 or more gene sequences to use may be random, or by selection based on various criteria. As one non-limiting example, the gene sequences may be selected based upon unsupervised learning, including clustering techniques. As another non-limiting example, selection may be to reduce or remove redundancy with respect to their ability to classify tumor type. For example, gene sequences are selected based upon the lack of correlation between their expression and the expression of one or more other gene sequences used for classifying. This is accomplished by assessing the expression level of each gene sequence in the expression data set for correlation, across the plurality of samples, with the expression level of each other gene in the data set to produce a correlation matrix of correlation coefficients. These correlation determinations may be performed directly, between expression of each pair of gene sequences, or indirectly, without direct comparison between the expression values of each pair of gene sequences.
A variety of correlation methodologies may be used in the correlation of expression data of individual gene sequences within the data set. Non-limiting examples include parametric and non-parametric methods as well as methodologies based on mutual information and non-linear approaches. Non-limiting examples of parametric approaches include Pearson correlation (or Pearson r, also referred to as linear or product-moment correlation) and cosine correlation. Non-limiting examples of non-parametric methods include Spearman's R (or rank-order) correlation, Kendall's Tau correlation, and the Gamma statistic. Each correlation methodology can be used to determine the level of correlation between the expressions of individual gene sequences in the data set. The correlation of all sequences with all other sequences is most readily considered as a matrix. Using Pearson's correlation as a non-limiting example, the correlation coefficient r in the method is used as the indicator of the level of correlation. When other correlation methods are used, the correlation coefficient analogous to r may be used, along with the recognition of equivalent levels of correlation corresponding to r being at or about 0.25 to being at or about 0.5. The correlation coefficient may be selected as desired to reduce the number of correlated gene sequences to various numbers. In some embodiments of the invention using r, the selected coefficient value may be of about 0.25 or higher, about 0.3 or higher, about 0.35 or higher, about 0.4 or higher, about 0.45 or higher, or about 0.5 or higher. The selection of a coefficient value means that where expression between gene sequences in the data set is correlated at that value or higher, they are possibly not included in a subset of the invention. Thus in some embodiments, the method comprises excluding or removing (not using for classification) one or more gene sequences that are expressed in correlation, above a desired correlation coefficient, with another gene sequence in the tumor type data set. It is pointed out, however, that there can be situations of gene sequences that are not correlated with any other gene sequences, in which case they are not necessarily removed from use in classification.
Thus the expression levels of gene sequences, where more than about 10%, more than about 20%, more than about 30%, more than about 40%, more than about 50%, more than about 60%, more than about 70%, more than about 80%, or more than about 90% of the levels are not correlated with that of another one of the gene sequences used, may be used in the practice of the invention. Correlation between expression levels may be based upon a value below about 0.9, about 0.8, about 0.7, about 0.6, about 0.5, about 0.4, about 0.3, or about 0.2. The ability to classify among classes with exclusion of the expression levels of some gene sequences is present because expression of the gene sequences in the subset is correlated with expression of the gene sequences excluded from the subset. So no information was lost because information based on the expression of the excluded gene sequences is still represented by sequences retained in the subset. Therefore, expression of the gene sequences of the subset has information content relevant to properties and/or characteristics (or phenotype) of a cell. This has application and relevance to the classification of additional tumor type classes not included as part of the original gene expression data set which can be classified by use of a subset of the invention because based on the redundancy of information between expression of sequences in the subset and sequences expressed in those additional classes. Thus the invention may be used to classify cells as being a tumor type beyond the plurality of known classes used to generate the original gene expression data set.
Selection of gene sequences based upon reducing correlation of expression to a particular tumor type may also be used. This also reflects a discovery of the present invention, based upon the observation that expression levels that were most highly correlated with one or more tumor types was not necessarily of greatest value in classification among different tumor types. This is reflected both by the ability to use randomly selected gene sequences for classification as well as the use of particular sequences, as described herein, which are not expressed with the most significant correlation with one or more tumor types. Thus the invention may be practiced without selection of gene sequences based upon the most significant P values or a ranking based upon correlation of gene expression and one or more tumor types. Thus the invention may be practiced without the use of ranking based methodologies, such as the Kruskal-Wallis H-test.
The gene sequences used in the practice of the invention may include those which have been observed to be expressed in correlation with particular tumor types, such as expression of the estrogen receptor, which has been observed to be expressed in correlation with some breast and ovarian cancers. In some embodiments of the invention, however, the invention is practiced with use of the expression level of at least one gene sequence that has not been previously identified as being associated with any of the tumor types being classified. Thus the invention may be practiced without all of the gene sequences having previously been associated or correlated with expression in the 2 or more (up to 39 or more) tumor types to which a cell containing sample may be classified.
While the invention is described mainly with respect to human subjects, samples from other subjects may also be used. All that is necessary is the ability to assess the expression levels of gene sequences in a plurality of known tumor samples such that the expression levels in an unknown or test sample may be compared. Thus the invention may be applied to samples from any organism for which a plurality of expressed sequences, and a plurality of known tumor samples, are available. One non-limiting example is application of the invention to mouse samples, based upon the availability of the mouse genome to permit detection of expressed murine sequences and the availability of known mouse tumor samples or the ability to obtain known samples. Thus, the invention is contemplated for use with other samples, including those of mammals, primates, and animals used in clinical testing (such as rats, mice, rabbits, dogs, cats, and chimpanzees) as non-limiting examples.
While the invention is readily practiced with the use of cell containing samples, any nucleic acid containing sample which may be assayed for gene expression levels may be used in the practice of the invention. Without limiting the invention, a sample of the invention may be one that is suspected or known to contain tumor cells. Alternatively, a sample of the invention may be a “tumor sample” or “tumor containing sample” or “tumor cell containing sample” of tissue or fluid isolated from an individual suspected of being afflicted with, or at risk of developing, cancer. Non-limiting examples of samples for use with the invention include a clinical sample, such as, but not limited to, a fixed sample, a fresh sample, or a frozen sample. The sample may be an aspirate, a cytological sample (including blood or other bodily fluid), or a tissue specimen, which includes at least some information regarding the in situ context of cells in the specimen, so long as appropriate cells or nucleic acids are available for determination of gene expression levels. The invention is based in part on the discovery that results obtained with frozen tissue sections can be validly applied to the situation with fixed tissue or cell samples and extended to fresh samples.
Non-limiting examples of fixed samples include those that are fixed with formalin or formaldehyde (including FFPE samples), with Boudin's, glutaldehyde, acetone, alcohols, or any other fixative, such as those used to fix cell or tissue samples for immunohistochemistry (IHC). Other examples include fixatives that precipitate cell associated nucleic acids and proteins. Given possible complications in handling frozen tissue specimens, such as the need to maintain its frozen state, the invention may be practiced with non-frozen samples, such as fixed samples, fresh samples, including cells from blood or other bodily fluid or tissue, and minimally treated samples. In some applications of the invention, the sample has not been classified using standard pathology techniques, such as, but not limited to, immunohistochemistry based assays.
In some embodiments of the invention, the sample is classified as containing a tumor cell of a type selected from the following 53, and subsets thereof: Adenocarcinoma of Breast, Adenocarcinoma of Cervix, Adenocarcinoma of Esophagus, Adenocarcinoma of Gall Bladder, Adenocarcinoma of Lung, Adenocarcinoma of Pancreas, Adenocarcinoma of Small-Large Bowel, Adenocarcinoma of Stomach, Astrocytoma, Basal Cell Carcinoma of Skin, Cholangiocarcinoma of Liver, Clear Cell Adenocarcinoma of Ovary, Diffuse Large B-Cell Lymphoma, Embryonal Carcinoma of Testes, Endometrioid Carcinoma of Uterus, Ewings Sarcoma, Follicular Carcinoma of Thyroid, Gastrointestinal Stromal Tumor, Germ Cell Tumor of Ovary, Germ Cell Tumor of Testes, Glioblastoma Multiforme, Hepatocellular Carcinoma of Liver, Hodgkin's Lymphoma, Large Cell Carcinoma of Lung, Leiomyosarcoma, Liposarcoma, Lobular Carcinoma of Breast, Malignant Fibrous Histiocytoma, Medulary Carcinoma of Thyroid, Melanoma, Meningioma, Mesothelioma of Lung, Mucinous Adenocarcinoma of Ovary, Myofibrosarcoma, Neuroendocrine Tumor of Bowel, Oligodendroglioma, Osteosarcoma, Papillary Carcinoma of Thyroid, Pheochromocytoma, Renal Cell Carcinoma of Kidney, Rhabdomyosarcoma, Seminoma of Testes, Serous Adenocarcinoma of Ovary, Small Cell Carcinoma of Lung, Squamous Cell Carcinoma of Cervix, Squamous Cell Carcinoma of Esophagus, Squamous Cell Carcinoma of Larynx, Squamous Cell Carcinoma of Lung, Squamous Cell Carcinoma of Skin, Synovial Sarcoma, T-Cell Lymphoma, and Transitional Cell Carcinoma of Bladder.
In other embodiments of the invention, the sample is classified as containing a tumor cell of a type selected from the following 34, and subsets thereof: adrenal, brain, breast, carcinoid-intestine, cervix (squamous cell), cholangiocarcinoma, endometrium, germ-cell, GIST (gastrointestinal stromal tumor), kidney, leiomyosarcoma, liver, lung (adenocarcinoma, large cell), lung (small cell), lung (squamous), lymphoma (B cell), Lymphoma (Hodgkins), meningioma, mesothelioma, osteosarcoma, ovary (clear cell), ovary (serous cell), pancreas, prostate, skin (basal cell), skin (melanoma), small and large bowel; soft tissue (liposarcoma); soft tissue (MFH or Malignant Fibrous Histiocytoma), soft tissue (Sarcoma-synovial), testis (seminoma), thyroid (follicular-papillary), thyroid (medullary carcinoma), and urinary bladder.
In further embodiments of the invention, the sample is classified as containing a tumor cell of a type selected from the following 39, and subsets thereof: adrenal gland, brain, breast, carcinoid-intestine, cervix-adenocarcinoma, cervix-squamous, endometrium, gall bladder, germ cell-ovary, GIST, kidney, leiomyosarcoma, liver, lung-adenocarcinoma-large cell, lung-small cell, lung-squamous, lymphoma-B cell, lymphoma-Hodgkin's, lymphoma-T cell, meningioma, mesothelioma, osteosarcoma, ovary-clear cell, ovary-serous, pancreas, prostate, skin-basal cell, skin-melanoma, skin-squamous, small and large bowel, soft tissue-liposarcoma, soft tissue-MFH, soft tissue-sarcoma-synovial, stomach-adenocarcinoma, testis-other (or non-seminoma), testis-seminoma, thyroid-follicular-papillary, thyroid-medullary, and urinary bladder.
The methods of the invention may also be applied to classify a cell containing sample as containing a tumor cell of a tumor of a subset of any of the above sets. The size of the subset will usually be small, composed of two, three, four, five, six, seven, eight, nine, or ten of the tumor types described above. Alternatively, the size of the subset may be any integral number up to the full size of the set. Thus embodiments of the invention include classification among 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52 of the above types. In some embodiments, the subset will be composed of tumor types that are of the same tissue or organ type. Alternatively, the subset will be composed of tumor types of different tissues or organs. In some embodiments, the subset will include one or more types selected from adrenal gland, brain, carcinoid-intestine, cervix-adenocarcinoma, cervix-squamous, gall bladder, germ cell-ovary, GIST, leiomyosarcoma, liver, meningioma, osteosarcoma, skin-basal cell, skin-squamous, soft tissue-liposarcoma, soft tissue-MFH, soft tissue-sarcoma-synovial, testis-other (or non-seminoma), testis-seminoma, thyroid-follicular-papillary, and thyroid-medullary.
Classification among subsets of the above tumor types is demonstrated by the results shown in FIGS. 1 and 2, where the expression levels of as few as 50 or more genes sequences can be used to classify among random samples of 2 tumor types among those in the set of 39 listed above. Expression levels of 50-100 gene sequences (that were randomly selected) can be used to classify among 2 to 39 tumor types with varying degrees of accuracy. The invention may be practiced with the expression levels of 50 or more, about 55 or more, about 60 or more, about 65 or more, about 70 or more, about 75 or more, about 80 or more, about 85 or more, about 90 or more, about 100 or more, about 110 or more, about 120 or more, about 130 or more, about 140 or more, about 150 or more, about 200 or more, about 250 or more, about 300 or more, about 350 or more, or about 400 or more transcribed sequences as found in the human “transcriptome” (transcribed portion of the genome). The invention may also be practiced with expression levels of 50-60 or more, about 60-70 or more, about 70-80 or more, about 80-90 or more, about 90-100 or more, about 100-110 or more, about 110-120 or more, about 120-130 or more, or about 130-140 or more transcribed sequences. In some embodiments of the invention, the transcribed genes may be randomly picked or include all or some of the specific genes sequences disclosed herein. As demonstrated herein, classification with accuracies of about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% or higher can be performed by use of the instant invention.
In other embodiments, the gene expression levels of other gene sequences may be determined along with the above described determinations of expression levels for use in classification. One non-limiting example of this is seen in the case of a microarray based platform to determine gene expression, where the expression of other gene sequences is also measured. Where those other expression levels are not used in classification, they may be considered the results of “excess” transcribed sequences and not critical to the practice of the invention. Alternatively, and where those other expression levels are used in classification, they are within the scope of the invention, where the description of using particular numbers of sequences does not necessarily exclude the use of expression levels of additional sequences. In some embodiments, the invention includes the use of expression level(s) from one or more “excess” gene sequences, such as those which may provide information redundant to one or more other gene sequences used in a method of the invention.
Because classification of a sample as containing cells of one of the above tumor types inherently also classifies the tissue or organ site origin of the sample, the methods of the invention may be applied to classification of a tumor sample as being of a particular tissue or organ site of the patient. This application of the invention is particularly useful in cases where the sample is of a tumor that is the result of metastasis by another tumor. In some embodiments of the invention, the tumor sample is classified as being one of the following 24: Adrenal, Bladder, Bone, Brain, Breast, Cervix, Endometrium, Esophagus, Gall Bladder, Kidney, Larynx, Liver, Lung, Lymph Node, Ovary, Pancreas, Prostate, Skin, Soft Tissue, Small/Large Bowel, Stomach, Testes, Thyroid, and Uterus.
While the invention also provides for classification as one of the above tumor types based upon comparisons to the expression levels of sequences in the 39 tumor types, it is possible that a higher level of confidence in the classification is desired. If an increase in the confidence of the classification is preferred, the classification can be adjusted to identify the tumor sample as being of a particular origin or cell type as shown in FIG. 8. Thus an increase in confidence can be made in exchange for a decrease in specificity as to tumor type by identification of origin or cell type.
The classification of a cell containing sample as having a tumor cell of one of the 39 tumor types above inherently also classifies the tissue or organ site origin of the sample. For example, the identification of a sample as being cervix-squamous necessarily classifies the tumor as being of cervical origin, squamous cell type (and thus epithelial rather than non-epithelial in origin) as shown in FIG. 8. It also means that the tumor was necessarily not germ cell in origin. Thus, the methods of the invention may be applied to classification of a tumor sample as being of a particular tissue or organ site of a subject or patient. This application of the invention is particularly useful in cases where the sample is of a tumor that is the result of metastasis by another tumor.
The practice of the invention to classify a cell containing sample as having a tumor cell of one of the above types is by use of an appropriate classification algorithm that utilizes supervised learning to accept 1) the levels of expression of the gene sequences in a plurality of known tumor types as a training set and 2) the levels of expression of the same genes in one or more cells of a sample to classify the sample as having cells of one of the tumor types. Further discussion of this is provided in the Example section herein. The levels of expression may be provided based upon the signals in any format, including nucleic acid expression or protein expression as described herein.
As would be evident to the skilled practitioner, the range of classification is affected by the number of tumor types as well as the number of samples for each tumor type. But given adequate samples of the full range of human tumors as provided herein, the invention is readily applied to the classification of those tumor types as well as additional types.
Non-limiting examples of classification algorithms that may be used in the practice of the invention include supervised learning algorithms, machine learning algorithms, linear discriminant analysis, attribute selection algorithms, and artificial neural networks (ANN). In preferred embodiments of the invention, a distance-based classification algorithm, such as the k-nearest neighbor (KNN) algorithm, or support vector machine (SVM) are used.
The use of KNN is in some embodiments of the invention and is discussed further as a non-limiting representative example. KNN can be used to analyze the expression data of the genes in a “training set” of known tumor samples including all 39 of the tumor types described herein. The training data set can then be compared to the expression data for the same genes in a cell containing sample. The expression levels of the genes in the sample are then compared to the training data set via KNN to identify those tumor samples with the most similar expression patterns. As a non-limiting example, the five “nearest neighbors” may be identified and the tumor types thereof used to classify the unknown tumor sample. Of course other numbers of “nearest neighbors” may be used. Non-limiting examples include less than 5, about 7, about 9, or about 11 or more “nearest neighbors”.
As a hypothetical example, if the five “nearest neighbors” of an unknown sample are four B cell lymphomas and one T cell lymphoma, then the classification of the sample as being of a B cell lymphoma can be made with great accuracy. This has been used with 84% or greater accuracy, such as 90%, as described in the Examples.
The classification ability may be combined with the inherent nature of the classification scheme to provide a means to increase the confidence of tumor classification in certain situations. For example, if the five “nearest neighbors” of a sample are three ovary clear cell and two ovary serous tumors, confidence can be improved by simply treating the tumors as being of ovarian origin and treating the subject or patient (from whom the sample was obtained) accordingly. See FIG. 8. This is an example of trading off specificity in favor of increased confidence. This provides the added benefit of addressing the possibility that the unknown sample was a mucinous or endometroid tumor. Of course the skilled practitioner is free to treat the tumor as one or both of these two most likely possibilities and proceeding in accordance with that determination.
Because the developmental lineage of tumor cells in certain tumor types (e.g., germ cells) can be complex and involve multiple cell types, FIG. 8 may appear to be oversimplified. However, it serves as a good basis to relate known histopathology and to serve as a “guide tree” for analyzing and relating tumor-associated gene expression signatures.
The inherent nature of the classification scheme also provides a means to increase the confidence of tumor classification in cases wherein the “nearest neighbors” are ambiguous. For example, if the five “nearest neighbors” were one urinary bladder, one breast, one kidney, one liver, and one prostate, the classification can simply be that of a non-squamous cell tumor. Such a determination can be made with significant confidence and the subject or patient from whom the sample was obtained can be treated accordingly. Without being bound by theory, and offered solely to improve the understanding of the invention, the last two examples reflect the similarities in gene expression of cells of a similar cell type and/or tissue origin.
Embodiments of the invention include use of the methods and materials described herein to identify the origin of a cancer from a patient. Thus given a sample containing tumor cells, the tissue origin of the tumor cells is identified by use of the present invention. One non-limiting example is in the case of a subject with an inflamed lymph node containing cancer cells. The cells may be from a tissue or organ that drains into the lymph node or it may be from another tissue source. The present invention may be used to classify the cells as being of a particular tumor or tissue type (or origin) which allows the identification of the source of the cancer cells. In an alternative non-limiting example, the sample (such as that from a lymph node) contains cells, which are first assayed by use of the invention to classify at least one cell as being a tumor cell of a tissue type or origin. This is then used to identify the source of the cancer cells in the sample. Both of these are examples of the advantageous use of the invention to save time, effort, and cost in the use of other cancer diagnostic tests.
In further embodiments, the invention is practiced with a sample from a subject with a previous history of cancer. As a non-limiting example, a cell containing sample (from the lymph node or elsewhere) of the subject may be found to contain cancer cells such that the present invention may be used to determine whether the cells are from the same or a different tissue from that of the previous cancer. This application of the invention may also be used to identify a new primary tumor, such as the case where new cancer cells are found in the liver of a subject who previously had breast cancer. The invention may be used to identify the new cancer cells as being the result of metastasis from the previous breast cancer (or from another tumor type, whether previously identified or not) or as a new primary occurrence of liver cancer. The invention may also be applied to samples of a tissue or organ where multiple cancers are found to determine the origin of each cancer, as well as whether the cancers are of the same origin.
While the invention may be practiced with the use of expression levels of a random group of expressed gene sequences, the invention also provides exemplary gene sequences for use in the practice of the invention. The invention includes a first group of 74 gene sequences from which 50 or more may be used in the practice of the invention. The 50 to 74 gene sequences may be used along with the determination of expression levels of additional sequences so long as the expression levels of gene sequences from the set of 74 are used in classifying. A non-limiting example of such embodiments of the invention is where the expression of the 74 gene sequences, or at least 50 (or 50 to about 90) members thereof, is measured along with the expression levels of a plurality of other sequences, such as by use of a microarray based platform used to perform the invention. Where those other expression levels are not used in classification, they may be considered the results of “excess” transcribed sequences and not critical to the practice of the invention. Alternatively, and where those other expression levels are used in classification, they are within the scope of the invention, where the use of the above described sequences does not necessarily exclude the use of expression levels of additional sequences.
mRNA sequences corresponding to a set of 74 gene sequences for use in the practice of the invention are provided in the attached Sequence Listing. A listing of the SEQ ID NOs, with corresponding identifying information, including accession numbers and other information, is provided by the following.
>Hs.73995_mRNA_1 gi|190403|gb|M60502.1|HUMPROFILE Human profilaggrin mRNA, |
3′ end polyA = 1 (SEQ ID NO: 1) |
>Hs.75236_mRNA_4 gi|14280328|gb|AY033998.1| Homo sapiens polyA = 3 (SEQ ID |
NO: 2) |
>Hs.299867_mRNA_1 gi|4758533|ref|NM_004496.1| Homo sapiens hepatocyte |
nuclear factor 3, alpha (HNF3A), mRNA polyA = 3 (SEQ ID NO: 3) |
>Hs.285401_contig1 |
AI147926|AI880620|AA768316|AA761543|AA279147|AI216016|AI738663|N79248|AI684489| |
AA960845|AI718599|AI379138|N29366|BF002507|AW044269|R34339|R66326|H04648| |
R67467|AI523112|BF941500 polyA = 2 polyA = 3 (SEQ ID NO: 4) |
>Hs.182507_mRNA_1 gi|15431324|ref|NM_002283.2| Homo sapiens keratin, hair, |
basic, 5 (KRTHB5), mRNA polyA = 3 (SEQ ID NO: 5) |
>Hs.292653_contig1 |
AI200660|AW014007|AI341199|AI692279|AI393765|AI378686|AI695373|AW292108|T10352| |
R44346|AW470408|AI380925|BF938983|AW003704|H08077|F03856|H08075|F08895| |
AW468398|AI865976|H22568|AI858374|AI216499 polyA = 2 polyA = 3 (SEQ ID NO: 6) |
>Hs.97616_mRNA_3 gi|12654852|gb|BC001270.1|BC001270 Homo sapiens clone |
MGC: 5069 IMAGE: 3458016 polyA = 3 (SEQ ID NO: 7) |
>Hs.123078_mRNA_3 gi|14328043|gb|BC009237.1|BC009237 Homo sapiens clone |
MGC: 2216 IMAGE: 2989823 polyA = 3 (SEQ ID NO: 8) |
>Hs.285508_contig1 AW194680|BF939744|BF516467 polyA = 1 polyA = 1 (SEQ ID NO: 9) |
>Hs.183274_contig1 |
BF437393|BF064008|BF509951|AW134603|AI277015|AI803254|AA887915|BF054958|AI004413| |
AI393911|AI278517|AW612644|AI492162|AI309226|AI863671|AA448864|AI640165| |
AA479926|AA461188|AA780161|BF591180|AI918020|AI758226|AI291375|BF001845| |
BF003064|AI337393|AI522206|BE856784|BF001760|AI280300 FLAG = 1 polyA = 2 WARN |
polyA = 3 (SEQ ID NO: 10) |
>Hs.334841_mRNA_3 gi|14290606|gb|BC009084.1|BC009084 Homo sapiens clone |
MGC: 9270 IMAGE: 3853674 polyA = 3 (SEQ ID NO: 11) |
>Hs.3321_contig1 |
AI804745|AI492375|AA594799|BE672611|AA814147|AA722404|AW170088|D11718|BG153444| |
AI680648|AA063561|BE219054|AI590287|R55185|AI479167|AI796872|AI018324|AI701122| |
BE218203|AA905336|AI681917|BI084742|AI480008|AI217994|AI401468 |
polyA = 2 polyA = 3 (SEQ ID NO: 12) |
>Hs.306216_singlet1 AW083022 polyA = 1 polyA = 2 (SEQ ID NO: 13) |
>Hs.99235_contig1 AA456140|AI167259|AA450056 polyA = 2 polyA = 3 (SEQ ID NO: 14) |
>Hs.169172_mRNA_2 gi|2274961|emb|AJ000388.1|HSCANPX Homo sapiens mRNA for |
calpain-like protease CANPX polyA = 3 (SEQ ID NO: 15) |
>Hs.351486_mRNA_1 gi|16549178|dbj|AK054605.1|AK054605 Homo sapiens cDNA |
FLJ30043 fis, clone 3NB692001548 polyA = 0 (SEQ ID NO: 16) |
>Hs.153504_contig2 |
BE962007|AW016349|AW016358|AW139144|AA932969|AI025620|AI688744|AI865632|AA854291| |
AA932970|AU156702|AI634439|AA152496|AI539557|AI123490|AI613215|AI318363| |
AW105672|AA843483|AI366889|AW181938|AI813801|AI433695|AA934772|N72230|AI760632| |
BE858965|AW058302|AI760087|AI682077|AA886672|AI350384|AW243848|AW300574| |
BE466359|AI859529|AI921588|BF062899|BE855597|BE617708 polyA = 2 polyA = 3 |
(SEQ ID NO: 17) |
>Hs.199354_singlet1 AI669760 polyA = 1 polyA = 2 (SEQ ID NO: 18) |
>Hs.162020_contig1 AW291189|AA505872 polyA = 2 polyA = 3 (SEQ ID NO: 19) |
>Hs.30743_mRNA_3 gi|18201906|ref|NM_006115.2| Homo sapiens preferentially |
expressed antigen in melanoma (PRAME), mRNA polyA = 3 (SEQ ID NO: 20) |
>Hs.271580_contig1 |
AI632869|AW338882|AW338875|AW613773|AI982899|AW193151|BE206353|BE208200|AI811548| |
AW264021 polyA = 2 polyA = 3 (SEQ ID NO: 21) |
>Hs.69360_mRNA_2 gi|14250609|gb|BC008764.1|BC008764 Homo sapiens clone |
MGC: 1266 IMAGE: 3347571 polyA = 3 (SEQ ID NO: 22) |
>Hs.30827_contig1 H07885|N39347|W85913|AA583408|W86449 polyA = 2 polyA = 3 (SEQ |
ID NO: 23) |
>Hs.211593_contig2 |
BF592799|AI570478|AA234440|R40214|BE501078|AW593784|AI184050|AI284161|W72149| |
AW780437|AI247981|AW241273|H60824 polyA = 2 polyA = 3 (SEQ ID NO: 24) |
>Hs.155097_mRNA|1 gi|15080385|gb|BC011949.1|BC011949 Homo sapiens clone |
MGC: 9006 IMAGE: 3863603 polyA = 3 (SEQ ID NO: 25) |
>Hs.5163_mRNA_1 gi|15990433|gb|BC015582.1|BC015582 Homo sapiens clone |
MGC: 23280 IMAGE: 4637504 polyA = 3 (SEQ ID NO: 26) |
>Hs.55150_mRNA_1 gi|17068414|gb|BC017586.1|BC017586 Homo sapiens clone |
MGC: 26610 IMAGE: 4837506 polyA = 3 (SEQ ID NO: 27) |
>Hs.170177_contig3 |
AI620495|AW291989|AA780896|AA976262|AI298326|BF111862|AW591523|AI922518|AI480280| |
BF589437|AA600354|AI886238|AA035599|H90049|BF112011|N52601|AI570965|AI565367| |
AW768847|H90073|BE504361|N45292|AI632075|AA679729|AW168052|AI978827| |
AI968410|AI669255|N45300|AI651256|AI698970|AI521256|AW078614|AI802070|AI885947| |
AI342534|AI653624|AW243936|T16586|R15989|AI289789|AI871636|AI718785|AW148847 |
polyA = 2 polyA = 3 (SEQ ID NO: 28) |
>Hs.184601_mRNA_5 gi|4426639|gb|AF104032.1|AF104032 Homo sapiens polyA = 2 |
(SEQ ID NO: 29) |
>Hs.351972_singlet1 AA865917 polyA = 2 polyA = 3 (SEQ ID NO: 30) |
>Hs.5366_mRNA_2 gi|15277845|gb|BC012926.1|BC012926 Homo sapiens clone |
MGC: 16817 IMAGE: 3853503 polyA = 3 (SEQ ID NO: 31) |
>Hs.18140_contig1 |
AI685931|AA410954|T97707|AA706873|AI911572|AW614616|AA548520|AW027764|BF511251| |
AI914294|AW151688 polyA = 1 polyA = 1 (SEQ ID NO: 32) |
>Hs.133196_contig2 |
BF224381|BE467992|AW137689|AI695045|AW207361|BF445141|AA405473 polyA = 2 WARN |
polyA = 3 (SEQ ID NO: 33) |
>Hs.63325_mRNA_5 gi|15451939|ref|NM_019894.1|Homo sapiens transmembrane |
protease, serine 4 (TMPRSS4), mRNA polyA = 3 (SEQ ID NO: 34) |
>Hs.250692_mRNA_2 gi|184223|gb|M95585.1|HUMHLF Human hepatic leukemia |
factor (HLF) mRNA, complete cds polyA = 3 (SEQ ID NO: 35) |
>Hs.250726_singlet4 AW298545 polyA = 2 polyA = 3 (SEQ ID NO: 36) |
>Hs.79217_mRNA_2 gi|16306657|gb|BC001504.1|BC001504 Homo sapiens clone |
MGC: 2273 IMAGE: 3505512 polyA = 3 (SEQ ID NO: 37) |
>Hs.47986_mRNA_1 gi|13279253|gb|BC004331.1|BC004331 Homo sapiens clone |
MGC: 10940 IMAGE: 3630835 polyA = 3 (SEQ ID NO: 38) |
>Hs.94367_mRNA_1 gi|10440200|dbj|AK027147.1|AK027147 Homo sapiens cDNA: |
FLJ23494 fis, clone LNG01885 polyA = 3 (SEQ ID NO: 39) |
>Hs.49215_contig1 |
BI493248|N66529|AA452255|BI492877|AW196683|AI963900|BF478125|AI421654|BE466675 |
polyA = 1 polyA = 1 (SEQ ID NO: 40) |
>Hs.281587_contig2 |
R61469|R15891|AA007214|R61471|AI014624|N69765|AW592075|H09780|AA709038|AI335898| |
AI559229|F09750|R49594|H11055|T72573|AA935558|AA988654|AA826438|AI002431| |
AI299721 polyA = 1 polyA = 2 (SEQ ID NO: 41) |
>Hs.79378_mRNA_1 gi|16306528|ref|NM_003914.2| Homo sapiens cyclin A1 |
(CCNA1), mRNA polyA = 3 (SEQ ID NO: 42) |
>Hs.156469_contig2 AI341378|AI670817|AI701687|AI3In set |
22|AW235883|AI948598|AA446356 polyA = 2 polyA = 3 (SEQ ID NO: 43) |
>Hs.6631_mRNA_1 gi|7020430|dbj|AK000380.1|AK000380 Homo sapiens cDNA |
FLJ20373 fis, clone HEP19740 polyA = 3 (SEQ ID NO: 44) |
>Hs.155977_contig1 AI309080|AI313045 polyA = 1 WARN polyA = 1 (SEQ ID NO: 45) |
>Hs.95197_mRNA_4 gi|5817138|emb|AL110274.1|HSM800829 Homo sapiens mRNA; |
cDNA DKFZp564I0272 (from clone DKFZp564I0272) polyA = 3 (SEQ ID NO: 46) |
>Hs.48956_contig1 N64339|AI569513|AI694073 polyA = 1 polyA = 1 (SEQ ID NO: 47) |
>Hs.118825_mRNA_10 gi|1495484|emb|X96757.1|HSSAPKK3 H. sapiens mRNA for MAP |
kinase kinase polyA = 3 (SEQ ID NO: 48) |
>Hs.135118_contig3 |
AI683181|AI082848|AW770198|AI333188|AI873435|AW169942|AI806302|AW340718|BF196955| |
AA909720 polyA = 1 polyA = 2 (SEQ ID NO: 49) |
>Hs.171857_mRNA_1 gi|13161080|gb|AF332224.1|AF332224 Homo sapiens testis |
protein mRNA, partial cds polyA = 3 (SEQ ID NO: 50) |
>Hs.18910_mRNA_3 gi|12804464|gb|BC001639.1|BC001639 Homo sapiens clone |
MGC: 1944 IMAGE: 2959372 polyA = 3 (SEQ ID NO: 51) |
>Hs.194774_mRNA_1 gi|16306633|gb|BC001492.1|BC001492 Homo sapiens clone |
MGC: 1774 IMAGE: 3510004 polyA = 3 (SEQ ID NO: 52) |
>Hs.127428_mRNA_2 gi|16306818|gb|BC006537.1|BC006537 Homo sapiens clone |
MGC: 1934 IMAGE: 2987903 polyA = 3 (SEQ ID NO: 53) |
>Hs.126852_contig1 |
AI802118|BF197404|BF224434|AA931964|AW236083|AI253119|AW614335|AI671372|AI793240| |
AW006851|AI953604|AI640505|AI633982|AW195809|AI493069|AW058576|AW293622 |
polyA = 2 polyA = 3 (SEQ ID NO: 54) |
>Hs.28149_mRNA_1 gi|14714936|gb|BC010626.1|BC010626 Homo sapiens clone |
MGC: 17687 IMAGE: 3865868 polyA = 3 (SEQ ID NO: 55) |
>Hs.35453_mRNA_3 gi|7018494|emb|AL157475.1|HSM802461 Homo sapiens mRNA; |
cDNA DKFZp761G151 (from clone DKFZp761G151); partial cds polyA = 3 (SEQ ID |
NO: 56) |
>Hs.180570_contig1 R08175|AA707224|AA699986|R11209|W89099|T98002|AA494546 |
polyA = 2 polyA = 3 (SEQ ID NO: 57) |
>Hs.196270_mRNA_1 gi|11545416|gb|AF283645.1|AF283645 Homo sapiens |
chromosome 8 map 8q21 polyA = 3 (SEQ ID NO: 58) |
>Hs.9030_mRNA_3 gi|12652600|gb|BC000045.1|BC000045 Homo sapiens clone |
MGC: 2032 IMAGE: 3504527 polyA = 3 (SEQ ID NO: 59) |
>Hs.1282_mRNA_3 gi|4559405|ref|NM_000065.1| Homo sapiens complement |
component 6 (C6), mRNA polyA = 1 (SEQ ID NO: 60) |
>Hs.268562_mRNA_2 gi|15341874|gb|BC013117.1|BC013117 Homo sapiens clone |
MGC: 8711 IMAGE: 3882749 polyA = 3 (SEQ ID NO: 61) |
>Hs.151301_mRNA_3 gi|16041747|gb|BC015754.1|BC015754 Homo sapiens clone |
MGC: 23085 IMAGE: 4862492 polyA = 3 (SEQ ID NO: 62) |
>Hs.111_contig1 AA946776|AW242338|H24274|AI078616 polyA = 1 polyA = 2 (SEQ ID |
NO: 63) |
>Hs.150753_contig1 AI123582|AI288234 polyA = 0 polyA = 0 (SEQ ID NO: 64) |
>Hs.82109_mRNA_1 gi|14250611|gb|BC008765.1|BC008765 Homo sapiens clone |
MGC: 1622 IMAGE: 3347793 polyA = 3 (SEQ ID NO: 65) |
>Hs.44276_mRNA_2 gi|12654896|gb|BC001293.1|BC001293 Homo sapiens clone |
MGC: 5259 IMAGE: 3458115 polyA = 3 (SEQ ID NO: 66) |
>Hs.2142_mRNA_4 gi|13325274|gb|BC004453.1|BC004453 Homo sapiens clone |
MGC: 4303 IMAGE: 2819400 polyA = 3 (SEQ ID NO: 67) |
>Hs.180908_contig1 AA846824|AW611680|AA846182|AA846342|AA846360 polyA = 2 |
polyA = 3 (SEQ ID NO: 68) |
>Hs.89436_mRNA_1 gi|16507959|ref|NM_004063.2| Homo sapiens cadherin 17, LI |
cadherin (liver-intestine) (CDH17), mRNA polyA = 1 (SEQ ID NO: 69) |
>Hs.151544_mRNA_8 gi|3153107|emb|AL023657.1|HSDSHP Homo sapiens SH2D1A |
cDNA, formerly known as DSHP polyA = 3 (SEQ ID NO: 70) |
>Hs.1657_contig4 |
AW473119|AA164586|AI540656|AI758480|AI810941|AI978964|AI675862|AI784397|AW591562| |
AW514102|AI888116|AI983175|AI634735|AI669577|AI202659|AI910598|AI961352| |
AI565481|AI886254|AI538838|AA291749|AW571455|AI370308|AI274727|AW473925| |
AW514787|AI273871|AW470552|AI524356|AI888281|AW089672|AI952766|AW440601|AI654044| |
AW438839|AI972926 polyA = 2 polyA = 3 (SEQ ID NO: 71) |
>Hs.35984_mRNA_1 gi|6049161|gb|AF133587.1|AF133587 Homo sapiens chromosome |
22 map 22q11.2 polyA = 3 (SEQ ID NO: 72) |
>Hs.334534_mRNA_2 gi|17389403|gb|BC017742.1|BC017742 Homo sapiens, clone |
IMAGE: 4391536, mRNA polyA = 3 (SEQ ID NO: 73) |
>Hs.60162_mRNA_1 gi|10437644|dbj|AK025181.1|AK025181 Homo sapiens cDNA: |
FLJ21528 fis, clone C0L05977 polyA = 3 (SEQ ID NO: 74) |
As would be understood by the skilled person, detection of expression of any of the above identified sequences, as well as sequences of the set of 90 below, or the sequences provided in the attached Sequence Listing may be performed by the detection of expression of any appropriate portion or fragment of these sequences. Preferably, the portions are sufficiently large to contain unique sequences relative to other sequences expressed in a cell containing sample. Moreover, the skilled person would recognize that the disclosed sequences represent one strand of a double stranded molecule and that either strand may be detected as an indicator of expression of the disclosed sequences. This follows because the disclosed sequences are expressed as RNA molecules in cells which are preferably converted to cDNA molecules for ease of manipulation and detection. The resultant cDNA molecules may have the sequences of the expressed RNA as well as those of the complementary strand thereto. Thus either the RNA sequence strand or the complementary strand may be detected. Of course is it also possible to detect the expressed RNA without conversion to cDNA.
In some embodiments of the invention, the expression levels of gene sequences is measured by detection of expressed sequences in a cell containing sample as hybridizing to the following oligonucleotides, which correspond to the above sequences as indicated by the accession numbers provided.
(SEQ ID NO:75) | |
>AF133587 | |
CCCGGATCGCCATCAGTGTCATCGAGTTCAAACCCTGAGCCCTTCATTCA | |
CCTCTGTGAG | |
(SEQ ID NO:76) | |
>BC017742 | |
TGCCCTTGCTCTGTGTCATCTCAGTCATTTGACTTAGAAAGTGCCCTTCA | |
AAAGGACCCT | |
(SEQ ID NO:77) | |
>BF437393 | |
GGAGGGAGGGCTAATTATATATTTTGTTGTTCCTCTATACTTTGTTCTGT | |
TGTCTGCGCC | |
(SEQ ID NO:78) | |
>AI620495 | |
CAGTTTGGATTGTATAATAACGCCAAGCCCAGTTGTAGTCGTTTGAGTGC | |
AGTAATGAAA | |
(SEQ ID NO:79) | |
>AK000380 | |
AAATCAGAGTAACCCTTTCTGTATTGAGTGCAGTGTTTTTTACTCTTTTC | |
TCATGCACAT | |
(SEQ ID NO:80) | |
>BC009237 | |
TGCCTGGCACAAAGAAGGAAGAATATAAATGATAGTTCGACTCGTCTGTG | |
GAAGAACTTA | |
(SEQ ID NO:81) | |
>BC008765 | |
AGTCTTTTGCTTTTGGCAAAACTCTACTTAATCCAATGGGTTTTTCCCTG | |
TACAGTAGAT | |
(SEQ ID NO:82) | |
>BC001504 | |
GGTTACTGTGGGTGGAATAGTGGAGGCCTTCAACTGATTAGACAAGGCCC | |
GCCCACATCT | |
(SEQ ID NO:83) | |
>NM_019894 | |
TAAAATGCACTGCCCTACTGTTGGTATGACTACCGTTACCTACTGTTGTC | |
ATTGTTATTA | |
(SEQ ID NO:84) | |
>BF224381 | |
TTCTCTTTTGGGGGCAAACACTATGTCCTTTTCTTTTTCTAGATACAGTT | |
AATTCCTGGA | |
(SEQ ID NO:85) | |
>AL157475 | |
AAGACCCACACCCTGTAGCAATACCAAGTGCTATTACATAATCAATGGAC | |
GATTTATACT | |
(SEQ ID NO:86) | |
>AY033998 | |
AGTGTTGCAAGTTTCCTTTAAAACCAACAAAGCCCACAAGTCCTGAATTT | |
CCCATTCTTA | |
(SEQ ID NO:87) | |
>H07885 | |
GTCACTGTCATAGCAGCTGTGATTTCACAAGGAAGGGTGCTGCAGGGGGA | |
CCTGGTTGAT | |
(SEQ ID NO:88) | |
>NM_004496 | |
TTTCATCCAGTGTTATGCACTTTCCACAGTTGGTGTTAGTATAGCCAGAG | |
GGTTTCATTA | |
(SEQ ID NO:89) | |
>AA846824 | |
GGGAAGTAGGGATTATTCGTTTAAATTCAATCGCGAGCACCAAGTCGGAC | |
TGGCCGGGGA | |
(SEQ ID NO:90) | |
>BC017586 | |
GGGACCAGGCCCTGGGACAGCCATGTGGCTCCAAATGACTAAATGTCAGC | |
TCAAAAACCA | |
(SEQ ID NO:91) | |
>AA456140 | |
TCCGTTTATGGAGGCAATTCCATATCCTTTCTTGAACGCACATTCAGCTT | |
ACCCCAGAGA | |
(SEQ ID NO:92) | |
>NM_002283 | |
AGAGTTAAGCCACTTCCTGGGTCTCCTTCTTATGACTGTCTATGGGTGCA | |
TTGCCTTCTG | |
(SEQ ID NO:93) | |
>AL023657 | |
GTGGCCTGAGTAATGCATTATGGGTGGTTTACCATTTCTTGAGGTAAAAG | |
CATCACATGA | |
(SEQ ID NO:94) | |
>BC001639 | |
ACACATGCATGTGTCTGTGTATGTGTGAATGTGAGAGAGACACAGCCCTC | |
CTTTCAGAAG | |
(SEQ ID NO:95) | |
>BC015754 | |
TCTGTAACTGCACAACCCTGGGGTTTGCTGCAGAGCTATTTCTTTCCATG | |
TAAAGTAGTG | |
(SEQ ID NO:96) | |
>AF332224 | |
AAACACTCTTTCCGACTCCAGAGGAGAAGCTGGCAGCTCTCTGTAAGAAA | |
TATGCTGATC | |
(SEQ ID NO:97) | |
>BC001270 | |
GCTTCCTCTATCGCCCAATGCAAAATCGATGAAATGGGGAGTTCTCTGGG | |
CCAGGCCACA | |
(SEQ ID NO:98) | |
>AI147926 | |
GTAGAATCCTCTGTTCATAATGAACAAGATGAACCAATGTGGATTAGAAA | |
GAAGTCCGAG | |
(SEQ ID NO:99) | |
>AW298545 | |
CTGTTTTAAAACTGAATGGCACGAAATTGTTTTCCTCAACTCGGAGATTC | |
CTGTATGGAG | |
(SEQ ID NO:100) | |
>AI802118 | |
AATAAATAGTAGCTCTGCTGATGATGACGTTGATAACCAAACTGTTCTGT | |
GGTCTTAAGT | |
(SEQ ID NO:101) | |
>AI683181 | |
CAAACAGCCCGGTCTTGATGCAGGAGAGTCTGGAAAAGGAAGAAAATGGT | |
TTCAGTTTCA | |
(SEQ ID NO:102) | |
>M95585 | |
AACATGGACCATCCAAATTTATGGCCGTATCAAATGGTAGCTGAAAAAAC | |
TATATTTGAG | |
(SEQ ID NO:103) | |
>AK027147 | |
TTGTAATCATGCCAATTCCAGATCAATAACTGCATGTCTGTTCTTTGGTA | |
GAAATAGCTT | |
(SEQ ID NO:104) | |
>AW291189 | |
AAAGATTATTAACCCAAATCACCTTTCTTGCTTACTCCAGATGCCTCAGC | |
CTCTGATATA | |
(SEQ ID NO:105) | |
>AI632869 | |
GACTTCCTTTAGGATCTCAGGCTTCTGCAGTTCTCATGACTCCTACTTTT | |
CATCCTAGTC | |
(SEQ ID NO:106) | |
>BC006537 | |
CTGTATATTTTGCAATAGTTACCTCAAGGCCTACTGACCAAATTGTTGTG | |
TTGAGATGAT | |
(SEQ ID NO:107) | |
>R61469 | |
TGTTCAAACAGACTTTAACCTCTGCATCATACTTAACCCTGCGACATGCG | |
TACAGTATGC | |
(SEQ ID NO:108) | |
>BC009084 | |
TGAGTCATATACATTTACTGACCACTGTTGCTTGTTGCTCACTGTGCTGC | |
TTTTCCATGA | |
(SEQ ID NO:109) | |
>N64339 | |
CTGAAATGTGGATGTGATTGCCTCAATAAAGCTCGTCCCCATTGCTTAAG | |
CCTTCAAAAA | |
(SEQ ID NO:110) | |
>AI200660 | |
ATCAAGAAAACCTAATCTTCTGACTCCCAGGCCAGGATGTTTTATTTCTC | |
ACATCATGTC | |
(SEQ ID NO:111) | |
>AK054605 | |
TTCATTTCCAAACATCATCTTTAAGACTCCAAGGATTTTTCCAGGCACAG | |
TGGCTCATAC | |
(SEQ ID NO:112) | |
>NM_006115 | |
AGTTAGAAATAGAATCTGAATTTCTAAAGGGAGATTCTGGCTTGGGAAGT | |
ACATGTAGGA | |
(SEQ ID NO:113) | |
>X96757 | |
CAATTTTCTTTTTACTCCCCCTCTTAAGGGGGCCTTGGAATCTATAGTAT | |
AGAATGAACT | |
(SEQ ID NO:114) | |
>AI804745 | |
GGGTGGAGTTTCAGTGAGAATAAACGTGTCTGCCTTTGTGTGTGTGTATA | |
TATACAGAGA | |
(SEQ ID NO:115) | |
>AJ000388 | |
CTCGCTCATTTTTTACCATGTTTTCCAGTCTGTTTAACTTCTGCAGTGCC | |
TTCACTACAC | |
(SEQ ID NO:116) | |
>BC008764 | |
CTTTGGGCCGAGCACTGAATGTCTTGTACTTTAAAAAAATGTTTCTGAGA | |
CCTCTTTCTA | |
(SEQ ID NO:117) | |
>AI309080 | |
CTGGACCCTTGGAGCAGTGTTGTGTGAACTTGCCTAGAACTCTGCCTTCT | |
CCGTTGTCAA | |
(SEQ ID NO:118) | |
>AA865917 | |
CCACCTCCTTCGACCTCCACTGCGCCCCACCTCCCTGCCTGTGTGTGTTA | |
TTTCAAAGGA | |
(SEQ ID NO:119) | |
>AA946776 | |
TCTGGCTGGTGGCCTGCGCGAGGGTGCAGTCTTACTTAAAAGACTTTCAG | |
TTAATTCTCA | |
(SEQ ID NO:120) | |
>AF104032 | |
AGATGCTGTCGGCACCATGTTTATTTATTTCCAGTGGTCATGCTCAGCCT | |
TGCTGCTCTG | |
(SEQ ID NO:121) | |
>AW194680 | |
TCCTTCCTCTTCGGTGAATGCAGGTTATTTAAACTTTGGGAAATGTACTT | |
TTAGTCTGTC | |
(SEQ ID NO:122) | |
>BC001293 | |
GTCCTGTCCCTGTCTGGGAGTTGTGTTATTTAAAGATATTCTGTATGTTG | |
TATCTTTTGC | |
(SEQ ID NO:123) | |
>BE962007 | |
ATTATATTTCAGGTGTCCTGAACAGGTCACTAGACTCTACATTGGGCAGC | |
CTTTAAATAT | |
(SEQ ID NO:124) | |
>B1493248 | |
AGGAATGGTACTACCGTTCCAGATTTTCTGTAATTGCTTCTGCAAAGTAA | |
TAGGCTTCTT | |
(SEQ ID NO:125) | |
>AF283645 | |
CTGTACCCAAAGGATGCCAGAATACTAGTATTTTTATTTATCGTAAACAT | |
CCACGAGTGC | |
(SEQ ID NO:126) | |
>AI669760 | |
ATTGCCCCCCTAACCAATCATGCAAACTTTTCCCCCCCTGGGGTAATTCA | |
CCAGTTAAAA | |
(SEQ ID NO:127)) | |
>BC001492 | |
CCCACAGTATTTAATGCCCTGTCAGTCCCTTCTAGTCTGACTCAATGGTA | |
ACTTGCTGTA | |
(SEQ ID NO:128) | |
>BC004453 | |
AAAACCAACTCTCTACTACACAGGCCTGATAACTCTGTACGAGGCTTCTC | |
TAACCCCTAG | |
(SEQ ID NO:129) | |
>BC010626 | |
CTCAGACTGGGCTCCACACTCTTGGGCTTCAGTCTGCCCATCTGCTGAAT | |
GGAGACAGCA | |
(SEQ ID NO:130) | |
>BC013117 | |
CCTAATGGGGATTCCTCTGGTTGTTCACTGCCAAAACTGTGGCATTTTCA | |
TTACAGGAGA | |
(SEQ ID NO:131) | |
>BC011949 | |
CACTCACAATTGTTGACTAAAATGCTGCCTTTAAAACATAGGAAAGTAGA | |
ATGGTTGAGT | |
(SEQ ID NO:132) | |
>AW083022 | |
CTTTGAAGGGCTGCTGCACATTGTTGAATCCATCGACCTTTAGCTGCAAT | |
GGGATCTCTA | |
(SEQ ID NO:133) | |
>R08175 | |
TGCCTCATCGATATTATAGGGGTCCATCACAACCCAACTGTGTGGCCGGA | |
TCCTGAGTCT | |
(SEQ ID NO:134) | |
>NM_000065 | |
AAAACAGACAAAAGCCTTTGCCTTCATGAAGCATACATTCATTCAGGGGT | |
AGACACACAA | |
(SEQ ID NO:135) | |
>AK025181 | |
TAACAAACAAAGGCAGTAGCTCATCACTTGGGTAGCAGGTACCCATTTTA | |
GGACCCTACA | |
(SEQ ID NO:136) |