Title:
Targeted chromosomal genomic alterations in plants using modified single stranded oligonucleotides
Kind Code:
A1


Abstract:
Presented are methods and compositions for targeted chromosomal genomic alterations with modified single-stranded oligonucleotides. The oligonucleotides of the invention have modified nuclease-resistant termini comprising LNA, phosphorothioate linkages or 2′-O-Me base analogues or combinations of such modifications.



Inventors:
Kmiec, Eric B. (Landenberg, PA, US)
Gamper, Howard B. (Philadelphia, PA, US)
Rice, Michael C. (Newtown, PA, US)
Kim, Jungsup (Jeju-do, KR)
Application Number:
10/307005
Publication Date:
12/25/2003
Filing Date:
11/26/2002
Assignee:
KMIEC ERIC B.
GAMPER HOWARD B.
RICE MICHAEL C.
KIM JUNGSUP
Primary Class:
Other Classes:
435/455, 536/23.1
International Classes:
C12N15/10; C12N15/113; C12N15/82; A61K38/00; A61K48/00; (IPC1-7): A61K48/00; C07H21/04; C12N15/85
View Patent Images:



Primary Examiner:
VIVLEMORE, TRACY ANN
Attorney, Agent or Firm:
FISH & NEAVE (1251 AVENUE OF THE AMERICAS, NEW YORK, NY, 10020-1105, US)
Claims:

What is claimed is:



1. An oligonucleotide for targeted alteration of genetic sequence, comprising a single-stranded oligonucleotide having a DNA domain, said DNA domain having at least one mismatch with respect to the genetic sequence to be altered, and further comprising chemical modifications of the oligonucleotide, said chemical modifications selected from the group consisting of an o-methyl modification, an LNA modification including LNA derivatives and analogs, two or more phosphorothioate linkages on a terminus, and a combination of any two or more of these modifications.

2. The oligonucleotide according to claim one that comprises two or more phosphorothioate linkages on at least the 3′ terminus.

3. The oligonucleotide according to claim one that comprises a 2′-O-methyl analog.

4. The oligonucleotide according to claim one that comprises an LNA nucleotide, including an LNA derivative or analog.

5. The oligonucleotide according to claim one that comprises a combination of at least two modifications selected from the group of a phosphorothioate linkage, a 2′-O-methyl analog, a locked nucleotide analog and a ribonucleotide.

6. The oligonucleotide according to any one of claims 1 to 5 that comprises at least one unmodified ribonucleotide.

7. The oligonucleotide according to any one of claims 1 to 6, wherein the sequence of said oligonucleotide is selected from the group consisting of SEQ ID NOS: 1-2672.

8. A method of targeted alteration of genetic material, comprising combining the target genetic material with an oligonucleotide according to any one of claims 1 to 7 in the presence of purified proteins.

9. A method of targeted alteration of genetic material, comprising administering to a cell extract an oligonucleotide of any one of claims 1 to 7.

10. A method of targeted alteration of genetic material, comprising administering to a cell an oligonucleotide of any one of claims 1 to 7.

11. A method of targeted alteration of genetic sequence in callus, comprising administering to the callus an oligonucleotide of any one of claims 1 to 7.

12. A method of targeted alteration of genetic sequence, comprising combining target genetic material with an oligonucleotide according to any one of claims 1 to 7, said target genetic material being a non-transcribed DNA strand of a duplex DNA.

13. The genetic material obtained by any one of the methods of claim 8, 9 or claim 10.

14. A cell comprising the genetic material of claim 13.

15. A plant organism comprising the cell according to claim 14.

16. A plant or plant part produced by the method of claim 11.

17. A method of determining whether an oligonucleotide is optimized for targeted alteration of a genetic sequence, which comprises: (a) comparing the efficiency of alteration of a targeted genetic sequence by an oligonucleotide of any one of claims 1 to 7 with the efficiency of alteration of the same targeted genetic sequence by a second oligonucleotide, said second oligonucleotide selected from the group of an oligonucleotide that lacks the mismatch, a fully modified phosphorothiolated oligonucleotide, a fully modified 2′-O-methylated oligonucleotide and a chimeric double-stranded double hairpin containing RNA and DNA nucleotides.

18. The method of claim 17 in which the alteration is produced in a plant cell extract.

19. The method of claim 17 in which the alteration is produced in a cell.

20. A kit comprising the oligonucleotide according to any one of claims 1 to 7 and a second oligonucleotide selected from the group of an oligonucleotide that lacks the mismatch, a fully modified phosphorothiolated oligonucleotide, a fully modified 2-O-methylated oligonucleotide and a chimeric double stranded double hairpin containing RNA and DNA nucleotides.

Description:

FIELD OF THE INVENTION

[0001] The technical field of the invention is oligonucleotide-directed repair or alteration of plant genetic information using novel chemically modified oligonucleotides.

BACKGROUND OF THE INVENTION

[0002] A number of methods have been developed specifically to alter the genomic information of plants. These methods generally include the use of vectors such as, for example, T-DNA, carrying nucleic acid sequences encoding partial or complete portions of a particular protein which is expressed in a cell or tissue to effect the alteration. The expression of the particular protein then results in the desired phenotype. See, for example, U.S. Pat. No. 4,459,355 which describes a method for transforming plants with a DNA vector and U.S. Pat. No. 5,188,642 which describes cloning or expression vectors containing a transgenic DNA sequence which when expressed in plants confers resistance to the herbicide glyphosate. The use of such transgene-containing vectors adds one or more exogenous copies of a gene in a usually random fashion at one or more integration sites of the plant's genome at some variable frequency. The introduced gene may be foreign or may be derived from the host plant. Any gene which was originally present in the genome, which may be, for example, a normal allelic variant, mutated, defective, and/or functional copy of the introduced gene, is retained in the genome of the host plant.

[0003] These methods of gene alteration are problematic in that complications which can compromise the vigor, productivity, yield, etc. of the plant may result. One such problem is that insertion of exogenous nucleic acid at random location(s) in the genome can have deleterious effects. The random nature of this insertion and/or the use of exogenous promoters can also cause the timing, location or strength of expression of the introduced transgene to be inappropriate or unpredictable. Another problem with such systems includes the addition of unnecessary and unwanted genetic material to the genome of the recipient, including, for example, T-DNA ends or other vector remnants, exogenous control sequences required to allow production of the transgene protein, which control sequences may be exogenous or native to the host plant and/or the transgene, and reporter genes or resistance markers. Such remnants and added sequences may have presently unrecognized consequences, for example, involving genetic rearrangements of the recipient genomes. In addition, concerns have been raised with consumption, especially by humans, of plants containing such exogenous genetic material.

[0004] More recently, simpler systems involving poly- or oligo-nucleotides have been described for use in the alteration of genomic DNA. These chimeric RNA-DNA oligonucleotides, requiring contiguous RNA and DNA bases in a double-stranded molecule folded by complementarity into a double hairpin conformation, have been shown to effect single basepair or frameshift alterations, for example, for mutation or repair of plant, animal or fungal genomes. See, for example, WO 99/07865 and U.S. Pat. No. 5,565,350. In the chimeric RNA-DNA oligonucleotide, an uninterrupted stretch of DNA bases within the molecule is required for sequence alteration of the targeted genome while the obligate RNA residues are involved in complex stability. Due to the length, backbone composition, and structural configuration of these chimeric RNA-DNA molecules, they are expensive to synthesize and difficult to purify. Moreover, if the RNA-containing strand of the chimeric RNA-DNA oligonucleotide is designed so as to direct gene alteration, a series of mutagenic reactions resulting in nonspecific base alteration can result. Such a result reduces the utility of such a molecule in methods designed for targeted gene alteration.

[0005] Alternatively, other oligo- or poly-nucleotides have been used which require a triplex forming, usually polypurine or polypyrimidine, structural domain which binds to a DNA helical duplex through Hoogsteen interactions between the major groove of the DNA duplex and the oligonucleotide. Such oligonucleotides may have an additional DNA reactive moiety, such as psoralen, covalently linked to the oligonucleotide. These reactive moieties function as effective intercalation agents, stabilize the formation of a triplex and can be mutagenic. Such agents may be required in order to stabilize the triplex forming domain of the oligonucleotide with the DNA double helix if the Hoogsteen interactions from the oligonucleotide/target base composition are insufficient. See, e.g., U.S. Pat. No. 5,422,251. The utility of these oligonucleotides for directing targeted gene alteration is compromised by a high frequency of nonspecific base changes.

[0006] In more recent work, the domain for altering a genome is linked or tethered to the triplex forming domain of the bi-functional oligonucleotide, adding an additional linking or tethering functional domain to the oligonucleotide. See, e.g., Culver et al., Nature Biotechnology 17: 989-93 (1999). Such chimeric or triplex forming molecules have distinct structural requirements for each of the different domains of the complete poly- or oligo-nucleotide in order to effect the desired genomic alteration in either episomal or chromosomal targets.

[0007] Other genes, e.g. CFTR, have been targeted by homologous recombination using duplex fragments having several hundred basepairs. See, e.g., Kunzelmann et al., Gene Ther. 3:859-867 (1996). Similar efforts to target genes by homologous recombination in plants using large fragments of DNA had some success. See Kempin et al., Nature 389:802-803 (1997). However, the efficiency and reproducibility of the published homologous recombination approach in plants has severely limited the widespread use of this method.

[0008] Earlier experiments to mutagenize an antibiotic resistance indicator gene by homologous recombination used an unmodified DNA oligonucleotide rather than larger fragments of DNA, wherein the oligonucleotide had no functional domains other than a region of complementary sequence to the target. See Campbell et al., New Biologist 1: 223-227 (1989). These experiments required large concentrations of the oligonucleotide, exhibited a very low frequency of episomal modification of a targeted exogenous plasmid gene not normally found in the cell and have not been reproduced. However, as shown in examples herein, we have observed that an unmodified DNA oligonucleotide can convert a base at low frequency which is detectable using the assay systems described herein.

[0009] Oligonucleotides designed for use in the targeted alteration of genetic information are significantly different from oligonucleotides designed for antisense approaches. For example, antisense oligonucleotides are perfectly complementary to and bind an mRNA strand in order to modify expression of a targeted mRNA and are used at high concentration. As a consequence, they are unable to produce a gene conversion event by either mutagenesis or repair of a defect in the chromosomal DNA of a host genome. Furthermore, the backbone chemical composition used in most oligonucleotides designed for use in antisense approaches renders them inactive as substrates for homologous pairing or mismatch repair enzymes and the high concentrations of oligonucleotide required for antisense applications can be toxic with some types of nucleotide modifications. In addition, antisense oligonucleotides must be complementary to the mRNA and therefore, may not be complementary to the other DNA strand or to genomic sequences that span the junction between intron sequence and exon sequence.

[0010] Artificial chromosomes can be useful for the screening purposes identified herein. These molecules are man-made linear or circular DNA molecules constructed from essential cis-acting DNA sequence elements that are responsible for the proper replication and partitioning of natural chromosomes (Murray et al., 1983). The essential elements are: (1) Autonomous Replication Sequences (ARS), (2) Centromeres, and (3) Telomeres.

[0011] Yeast artificial chromosomes (YACs) allow large segments of genomic DNA to be cloned and modified (Burke et al., Science 236:806; Peterson et al., Trends Genet. 13:61 (1997); Choi, et al., Nat. Genet., 4:117-223 (1993), Davies, et al., Biotechnology 11:911-914 (1993), Matsuura, et al., Hum. Mol. Genet., 5:451-459 (1996), Peterson et al., Proc. Natl. Acad. Sci., 93:6605-6609 (1996); and Schedl, et al., Cell, 86:71-82 (1996)). Other vectors also have been developed for the cloning of large segments of genomic DNA, including cosmids, and bacteriophage P1 (Sternberg et al., Proc. Natl. Acad. Sci. U.S.A., 87:103-107 (1990)). YACs have certain advantages over these alternative large capacity cloning vectors (Burke et al., Science, 236:806-812 (1987)). The maximum insert size is 35-30 kb for cosmids, and 100 kb for bacteriophage P1, both of which are much smaller than the maximal insert size for a YAC.

[0012] An alternative to YACs are cloning systems based on the E. coli fertility factor that have been developed to construct large genomic DNA insert libraries. They are bacterial artificial chromosomes (BACs) and P-1 derived artificial chromosomes (PACs) (Mejia et al., Genome Res. 7:179-186 (1997); Shizuya et al., Proc. Natl. Acad. Sci. 89:8794-8797 (1992); Ioannou et al., Nat. Genet., 6:84-89 (1994); Hosoda et al., Nucleic Acids Res. 18:3863 (1990)). BACs are based on the E. coli fertility plasmid (F factor); and PACs are based on the bacteriophage P1. These vectors propagate at a very low copy number (1-2 per cell) enabling genomic inserts up to 300 kb in size to be stably maintained in recombination deficient hosts. The PACs and BACs are circular DNA molecules that are readily isolated from the host genomic background by classical alkaline lysis (Birnboim et al., Nucleic Acids Res. 7:1513-1523 (1979)). In addition, BACs have been developed for transformation of plants with high-molecular weight DNA using the T-DNA system (Hamilton, Gene 24:107-116 (1997); Frary & Hamilton, Transgenic Res. 10: 121-132 (2001)).

[0013] A need exists for simple, inexpensive oligonucleotides capable of producing targeted alteration of genetic material such as those described herein as well as methods to identify optimal oligonucleotides that accurately and efficiently alter target DNA.

SUMMARY OF THE INVENTION

[0014] Novel, modified single-stranded nucleic acid molecules that direct gene alteration in plants are identified and the efficiency of alteration is analyzed both in vitro using a cell-free extract assay and in vivo using a yeast system and a plant system. The alteration in an oligonucleotide of the invention may comprise an insertion, deletion, substitution, as well as any combination of these. Site specific alteration of DNA is not only useful for studying function of proteins in vivo, but it is also useful for creating plants with desired phenotypes, including, for example, environmental stress tolerance, improved nutritional value, herbicide resistance, disease resistance, modified oil production, modified starch production, and altered floral morphology including selective sterility. As described herein, oligonucleotides of the invention target directed specific gene alterations in genomic double-stranded DNA in cells. The target genomic DNA can be nuclear chromosomal DNA as well as plastid or mitochondrial chromosomal DNA. The target DNA can also be a transgene present in the plant cell, including, for example, a previously introduced T-DNA. For screening purposes, the target plant DNA can also be extrachromosomal DNA present in plant or non-plant cells in various forms including, e.g., mammalian artificial chromosomes (MACs), PACs from P-1 vectors, yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), plant artificial chromosomes (PLACs), as well as episomal DNA, including episomal DNA from an exogenous source such as a plasmid or recombinant vector. Many of these artificial chromosome constructs containing plant DNA can be obtained from a variety of sources, including, e.g., the Arabidopsis Biological Resource Center (ABRC) at the Ohio State University, and the Rice Genome Research Program at the MAFF DNA bank in Ibaraki, Japan. The target DNA may be transcriptionally silent or active. In a preferred embodiment, the target DNA to be altered is the non-transcribed strand of a genomic DNA duplex. In a more preferred embodiment, the target DNA to be altered is the non-transcribed strand of a transcribed gene of a genomic DNA duplex.

[0015] The low efficiency of targeted gene alteration obtained using unmodified DNA oligonucleotides is believed to be largely the result of degradation by nucleases present in the reaction mixture or the target cell. Although different modifications are known to have different effects on the nuclease resistance of oligonucleotides or stability of duplexes formed by such oligonucleotides (see, e.g., Koshkin et al., J. Am. Chem. Soc., 120:13252-3), we have found that it is not possible to predict which of any particular known modification would be most useful for any given alteration event, including for the construction of gene alteration oligonucleotides, because of the interaction of different as yet unidentified proteins during the gene alteration event. Herein, a variety of nucleic acid analogs have been developed that increase the nuclease resistance of oligonucleotides that contain them, including, e.g., nucleotides containing phosphorothioate linkages or 2′-O-methyl analogs. We recently discovered that single-stranded DNA oligonucleotides modified to contain 2′-O-methyl RNA nucleotides or phosphorothioate linkages can enable specific alteration of genetic information at a higher level than either unmodified single-stranded DNA or a chimeric RNA/DNA molecule. See, for example, copending applications U.S. application Ser. No. 60/208,538, U.S. application Ser. No. 60/244,989, U.S. application Ser. No. 09/818,875, international application no. PCT/US01/09761 and Gamper et al., Nucleic Acids Research 28: 4332-4339 (2000), the disclosures of which are incorporated herein in their entirety by reference. We also found that additional nucleic acid analogs which increase the nuclease resistance of oligonucleotides that contain them, including, e.g., “locked nucleic acids” or “LNAs”, xylo-LNAs and L-ribo-LNAs; see, for example, Wengel & Nielsen, WO 99/14226; Wengel, WO 00/56748; Wengel, WO 00/66604; and Jakobsen & Koshkin, WO 01/25478 also allow specific targeted alteration of genetic information.

[0016] The assay allows for determining the optimum length of the oligonucleotide, optimum sequence of the oligonucleotide, optimum position of the mismatched base or bases, optimum chemical modification or modifications, optimum strand targeted for identifying and selecting the most efficient oligonucleotide for a particular gene alteration event by comparing to a control oligonucleotide. Control oligonucleotides may include a chimeric RNA-DNA double hairpin oligonucleotide directing the same gene alteration event, an oligonucleotide that matches its target completely, an oligonucleotide in which all linkages are phosphorothiolated, an oligonucleotide fully substituted with 2′-O-methyl analogs or an RNA oligonucleotide. Such control oligonucleotides either fail to direct a targeted alteration or do so at a lower efficiency as compared to the oligonucleotides of the invention. The assay further allows for determining the optimum position of a gene alteration event within an oligonucleotide, optimum concentration of the selected oligonucleotide for maximum alteration efficiency by systematically testing a range of concentrations, as well as optimization of either the source of cell extract by testing different plants or strains, or testing cells derived from different plants or strains, or plant cell lines. Using a series of single-stranded oligonucleotides, comprising all RNA or DNA residues and various mixtures of the two, several new structures are identified as viable molecules in nucleotide conversion to direct or repair a genomic mutagenic event. When extracts from mammalian, plant and fungal cells are used and are analyzed using a genetic readout assay in bacteria, single-stranded oligonucleotides having one of several modifications are found to be more active than a control RNA-DNA double hairpin chimera structure when evaluated using an in vitro gene repair assay. Similar results are also observed in vivo using yeast, mammalian and plant cells. Molecules containing various lengths of modified bases were found to possess greater activity than unmodified single-stranded DNA molecules.

DETAILED DESCRIPTION OF THE INVENTION

[0017] The present invention provides oligonucleotides having chemically modified, nuclease resistant residues, preferably at or near the termini of the oligonucleotides, and methods for their identification and use in targeted alteration of plant genetic material, including gene mutation, targeted gene repair and gene knockout. The oligonucleotides are preferably used for mismatch repair or alteration by changing at least one nucleic acid base, or for frameshift repair or alteration by addition or deletion of at least one nucleic acid base. The oligonucleotides of the invention direct any such alteration, including gene correction, gene repair or gene mutation and can be used, for example, to introduce a polymorphism or haplotype or to eliminate (“knockout”) a particular protein activity. For example, gene alterations that knockout a particular protein activity can be obtained using oligonucleotides designed to convert a codon in the coding region of the protein to a stop codon, thus prematurely terminating translation of the protein. Oligonucleotides that introduce stop codons in the open-reading-frame of the protein are one embodiment of the invention. Generally, oligonucleotides that introduce stop codons early in the open-reading-frame of the protein are preferred. If the open-reading-frame contains more than one methionine, oligonucleotides that introduce stop codons after the second methionine are preferred. Additionally, if the gene exhibits alternative splice sites, oligonucleotides that introduce stop codons in exons after the alternative splice site are preferred. The following table provides examples of codons that can be converted to stop codons by altering a single oligonucleotide. A skilled artisan could readily identify other codons that can be converted to stop codons by altering one, two or three of the base pairs in a given codon. Similarly, a skilled artisan could readily identify codons that can be converted to stop codons by a frameshift mutations that inserts or deletes one or two base pairs in the open-reading-frame. It is also understood that more than one stop codon can be generated in a single open-reading-frame and that these stop codons can be adjacent in the sequence or separated by intervening codons. Where more than one stop codon is introduced into a single open-reading-frame, such alterations can be generated by a single or multiple oligonucleotides and can be generated simultaneously or by sequential mutagenesis of the target nucleic acid. 1

Corresponding
Original codons*stop codon
GGA (glycine), AGA (arginine), CGA (arginine), TTATGA
(leucine), TCA (serine), TGT (cysteine), TGG
(tryptophan), TGC (cysteine)
AAG (lysine), GAG (glutamate), CAG (glutamine), TTGTAG
(leucine), TCG (serine), TGG (tryptophan), TAT
(cysteine), TAC (tyrosine)
AAA (lysine), GAA (glutamate), CAA (glutamine), TTATAA
(leucine), TCA (serine), TAT (cysteine), TAC
(tyrosine)
*The amino acid encoded by the original codon is shown in parentheses and the base targeted for alteration to convert the codon to the corresponding stop codon is underlined and in bold

[0018] The oligonucleotides of the invention are designed as substrates for homologous pairing and repair enzymes and as such have a unique backbone composition that differs from chimeric RNA-DNA double hairpin oligonucleotides, antisense oligonucleotides, and/or other poly- or oligo-nucleotides used for altering genomic DNA, such as triplex forming oligonucleotides. The single-stranded oligo-nucleotides described herein are inexpensive to synthesize and easy to purify. In side-by-side comparisons, an optimized single-stranded oligonucleotide comprising modified residues as described herein is significantly more efficient than a chimeric RNA-DNA double hairpin oligonucleotide in directing a base substitution or frameshift mutation in a cell-free extract assay.

[0019] We have discovered that single-stranded oligonucleotides having a DNA domain surrounding the targeted base, with the domain preferably central to the poly- or oligo-nucleotide, and having at least one modified end, preferably at the 3′ terminal region, are able to alter a target genetic sequence and with an efficiency that is higher than chimeric RNA-DNA double hairpin oligonucleotides disclosed in U.S. Pat. No. 5,565,350. Preferred oligonucleotides of the invention have at least two modified bases on at least one of the termini, preferably the 3′ terminus of the oligonucleotide. Oligonucleotides of the invention can efficiently be used to introduce targeted alterations in a genetic sequence of DNA in the presence of human, animal, plant, fungal (including yeast) proteins and in cells of different types including, for example, plant cells, fungal cells including S. cerevisiae, Ustillago maydis, Candida albicans, and mammalian cells. Particularly preferred are cells and cell extracts derived from plants including, for example, experimental model plants such as Chiamydomonas reinhardtii, Physcomitrella patens, and Arabidopsis thaliana in addition to crop plants such as cauliflower (Brassica oleracea), artichoke (Cynara scolymus), fruits such as apples (Malus, e.g. domesticus), mangoes (Mangifera, e.g. indica), banana (Musa, e.g. acuminata), berries (such as currant, Ribes, e.g. rubrum), kiwifruit (Actinidia, e.g. chinensis), grapes (Vitis, e.g. vinifera), bell peppers (Capsicum, e.g. annuum), cherries (such as the sweet cherry, Prunus, e.g. avium), cucumber (Cucumis, e.g. sativus), melons (Cucumis, e.g. melo), nuts (such as walnut, Juglans, e.g. regia; peanut, Arachis hypogeae), orange (Citrus, e.g. maxima), peach (Prunus, e.g. persica), pear (Pyra, e.g. communis), plum (Prunus, e.g. domestica), strawberry (Fragaria, e.g. moschata or vesca), tomato (Lycopersicon, e.g. esculentum); leaves and forage, such as alfalfa (Medicago, e.g. sativa or truncatula), cabbage (e.g. Brassica oleracea), endive (Cichoreum, e.g. endivia), leek (Allium, e.g. porrum), lettuce (Lactuca, e.g. sativa), spinach (Spinacia, e.g. oleraceae), tobacco (Nicotiana, e.g. tabacum); roots, such as arrowroot (Maranta, e.g. arundinacea), beet (Beta, e.g. vulgaris), carrot (Daucus, e.g. carota), cassava (Manihot, e.g. esculenta), turnip (Brassica, e.g. rapa), radish (Raphanus, e.g. sativus), yam (Dioscorea, e.g. esculenta), sweet potato (Ipomoea batatas); seeds, including oilseeds, such as beans (Phaseolus, e.g. vulgaris), pea (Pisum, e.g. sativum), soybean (Glycine, e.g. max), cowpea (Vigna unguiculata), mothbean (Vigna aconitifolia), wheat (Triticum, e.g. aestivum), sorghum (Sorghum e.g. bicolor), barley (Hordeum, e.g. vulgare), corn (Zea, e.g. mays), rice (Oryza, e.g. sativa), rapeseed (Brassica napus), millet (Panicum sp.), sunflower (Helianthus annuus), oats (Avena sativa), chickpea (Cicer, e.g. arietinum); tubers, such as kohlrabi (Brassica, e.g. oleraceae), potato (Solanum, e.g. tuberosum) and the like; fiber and wood plants, such as flax (Linum e.g. usitatissimum), cotton (Gossypium e.g. hirsutum), pine (Pinus sp.), oak (Quercus sp.), eucalyptus (Eucalyptus sp.), and the like and ornamental plants such as turfgrass (Lolium, e.g. rigidum), petunia (Petunia, e.g. x hybrida), hyacinth (Hyacinthus orientalis), carnation (Dianthus e.g. caryophyllus), delphinium (Delphinium, e.g. ajacis), Job's tears (Coix lacryma-jobi), snapdragon (Antirrhinum majus), poppy (Papaver, e.g. nudicaule), lilac (Syringa, e.g. vulgaris), hydrangea (Hydrangea e.g. macrophylla), roses (including Gallicas, Albas, Damasks, Damask Perpetuals, Centifolias, Chinas, Teas and Hybrid Teas) and ornamental goldenrods (e.g. Solidago spp.). Such plant cells can then be used to regenerate whole plants according to methods described herein or any method known in the art. The DNA domain of the oligonucleotides is preferably fully complementary to one strand of the gene target, except for the mismatch base or bases responsible for the gene alteration event(s). On either side of the preferably central DNA domain, the contiguous bases may be either RNA bases or, preferably, are primarily DNA bases. The central DNA domain is generally at least 8 nucleotides in length. The base(s) targeted for alteration in the most preferred embodiments are at least about 8, 9 or 10 bases from one end of the oligonucleotide.

[0020] According to certain embodiments, one or both of the termini of the oligonucleotides of the present invention comprise phosphorothioate modifications, LNA backbone (including LNA derivatives and analogs) modifications, or 2′-O-methyl base analogs, or any combination of these modifications. Oligonucleotides comprising 2′-O-methyl or LNA analogs are a mixed DNA/RNA polymer. The oligonucleotides of the invention are, however, single-stranded and are not designed to form a stable internal duplex structure within the oligonucleotide. The efficiency of gene alteration is surprisingly increased with oligonucleotides having internal complementary sequence comprising phosphorothioate modified bases as compared to 2′-O-methyl modifications. This result indicates that specific chemical interactions are involved between the converting oligonucleotide and the proteins involved in the conversion. The effect of other such chemical interactions to produce nuclease resistant termini using modifications other than LNA (including LNA derivatives or analogs), phosphorothioate linkages, or 2′-O-methyl analog incorporation into an oligonucleotide can not yet be predicted because the proteins involved in the alteration process and their particular chemical interaction with the oligonucleotide substituents are not yet known and cannot be predicted.

[0021] In the examples, oligonucleotides of defined sequence are provided for alteration of genes in particular plants. Provided the teachings of the instant application, one of skill in the art could readily design oligonucleotides to introduce analogous alterations in homologous genes from any plant. Furthermore, in the tables of these examples, the oligonucleotides of the invention are not limited to the particular sequences disclosed. The oligonucleotides of the invention include extensions of the appropriate sequence of the longer 120 base oligonucleotides which can be added base by base to the smallest disclosed oligonucleotides of 17 bases. Thus the oligonucleotides of the invention include for each correcting change, oligonucleotides of length 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120 with further single-nucleotide additions up to the longest sequence disclosed. In some embodiments, longer nucleic acids of up to 240 bases which comprise the sequences disclosed herein may be used. Moreover, the oligonucleotides of the invention do not require a symmetrical extension on either side of the central DNA domain. Similarly, the oligonucleotides of the invention as disclosed in the various tables for alteration of particular plant genes contain phosphorothioate linkages, 2′-O-methyl analog or LNA (including LNA derivatives and analogs) or any combination of these modifications just as the assay oligonucleotides do.

[0022] The present invention, however, is not limited to oligonucleotides that contain any particular nuclease resistant modification. Oligonucleotides of the invention may be altered with any combination of additional LNAs (including LNA derivatives and analogs), phosphorothioate linkages or 2′-O-methyl analogs to maximize conversion efficiency. For oligonucleotides of the invention that are longer than about 17 to about 25 bases in length, internal as well as terminal region segments of the backbone may be altered. Alternatively, simple fold-back structures at each end of a oligonucleotide or appended end groups may be used in addition to a modified backbone for conferring additional nuclease resistance.

[0023] The different oligonucleotides of the present invention preferably contain more than one of the aforementioned backbone modifications at each end. In some embodiments, the backbone modifications are adjacent to one another. However, the optimal number and placement of backbone modifications for any individual oligonucleotide will vary with the length of the oligonucleotide and the particular type of backbone modification(s) that are used. If constructs of identical sequence having phosphorothioate linkages are compared, 2, 3, 4, 5, or 6 phosphorothioate linkages at each end are preferred. If constructs of identical sequence having 2′-O-methyl base analogs are compared, 1, 2, 3 or 4 analogs are preferred. The optimal number and type of backbone modifications for any particular oligo-nucleotide useful for altering target DNA may be determined empirically by comparing the alteration efficiency of the oligonucleotide comprising any combination of the modifications to a control molecule of comparable sequence using any of the assays described herein. The optimal position(s) for oligonucleotide modifications for a maximally efficient altering oligonucleotide can be determined by testing the various modifications as compared to control molecule of comparable sequence in one of the assays disclosed herein. In such assays, a control molecule includes, e.g., a completely 2′-O-methyl substituted molecule, a completely complementary oligonucleotide, or a chimeric RNA-DNA double hairpin.

[0024] Increasing the number of phosphorothioate linkages, LNAs or 2′-O-methyl bases beyond the preferred number generally decreases the gene repair activity of a 25 nucleotide long oligonucleotide. Based on analysis of the concentration of oligonucleotide present in the extract after different time periods of incubation, it is believed that the terminal modifications impart nuclease resistance to the oligo-nucleotide thereby allowing it to survive within the cellular environment. However, this may not be the only possible mechanism by which such modifications confer greater efficiency of conversion. For example, as disclosed herein, certain modifications to oligonucleotides confer a greater improvement to the efficiency of conversion than other modifications.

[0025] Efficiency of conversion is defined herein as the percentage of recovered substrate molecules that have undergone a conversion event. Depending on the nature of the target genetic material, e.g. the genome of a cell, efficiency could be represented as the proportion of cells or clones containing an extrachromosomal element that exhibit a particular phenotype. Alternatively, representative samples of the target genetic material can be sequenced to determine the percentage that have acquired the desire change. The oligonucleotides of the invention in different embodiments can alter DNA two, three, four, five, six, seven, eight, nine, ten, twelve, fifteen, twenty, thirty, and fifty or more fold more than control oligonucleotides. Such control oligonucleotides are oligonucleotides with fully phosphorothiolated linkages, oligonucleotides that are fully substituted with 2′-O-methyl analogs, a perfectly matched oligonucleotide that is fully complementary to a target sequence or a chimeric DNA-RNA double hairpin oligonucleotide such as disclosed in U.S. Pat. No. 5,565,350.

[0026] In addition, for a given oligonucleotide length, additional modifications interfere with the ability of the oligonucleotide to act in concert with the cellular recombination or repair enzyme machinery which is necessary and required to mediate a targeted substitution, addition or deletion event in DNA. For example, fully phosphorothiolated or fully 2-O-methylated molecules are inefficient in targeted gene alteration.

[0027] The oligonucleotides of the invention as optimized for the purpose of targeted alteration of genetic material, including gene knockout or repair, are different in structure from antisense oligo-nucleotides that may possess a similar mixed chemical composition backbone. The oligonucleotides of the invention differ from such antisense oligonucleotides in chemical composition, structure, sequence, and in their ability to alter genomic DNA. Significantly, antisense oligonucleotides fail to direct targeted gene alteration. The oligonucleotides of the invention may target either strand of DNA and can include any component of the genome including, for example, intron and exon sequences. The preferred embodiment of the invention is a modified oligonucleotide that binds to the non-transcribed strand of a genomic DNA duplex. In other words, the preferred oligonucleotides of the invention target the sense strand of the DNA, i.e. the oligonucleotides of the invention are complementary to the non-transcribed strand of the target duplex DNA. The sequence of the non-transcribed strand of a DNA duplex is found in the mRNA produced from that duplex, given that mRNA uses uracil-containing nucleotides in place of thymine-containing nucleotides.

[0028] Moreover, the initial observation that single-stranded oligonucleotides comprising these modifications and lacking any particular triplex forming domain have reproducibly enhanced gene alteration activity in a variety of assay systems as compared to a chimeric RNA-DNA double-stranded hairpin control or single-stranded oligonucleotides comprising other backbone modifications was surprising. The single-stranded molecules of the invention totally lack the complementary RNA binding structure that stabilizes a normal chimeric double-stranded hairpin of the type disclosed in U.S. Pat. No. 5,565,350 yet is more effective in producing targeted base conversion as compared to such a chimeric RNA-DNA double-stranded hairpin. In addition, the molecules of the invention lack any particular triplex forming domain involved in Hoogsteen interactions with the DNA double helix and required by other known oligonucleotides in other oligonucleotide-dependant gene conversion systems. Although the lack of these functional domains was expected to decrease the efficiency of an alteration in a sequence, just the opposite occurs: the efficiency of sequence alteration using the modified oligonucleotides of the invention is higher than the efficiency of sequence alteration using a chimeric RNA-DNA hairpin targeting the same sequence alteration. Moreover, the efficiency of sequence alteration or gene conversion directed by an unmodified oligonucleotide is many times lower as compared to a control chimeric RNA-DNA molecule or the modified oligonucleotides of the invention targeting the same sequence alteration. Similarly, molecules containing at least 3 2′-O-methyl base analogs are about four to five fold less efficient as compared to an oligonucleotide having the same number of phosphorothioate linkages.

[0029] The oligonucleotides of the present invention for alteration of a single base are about 17 to about 121 nucleotides in length, preferably about 17 to about 74 nucleotides in length. Most preferably, however, the oligonucleotides of the present invention are at least about 25 bases in length, unless there are self-dimerization structures within the oligonucleotide. If the oligonucleotide has such an unfavorable structure, lengths longer than 35 bases are preferred. Oligonucleotides with modified ends both shorter and longer than certain of the exemplified, modified oligonucleotides herein function as gene repair or gene knockout agents and are within the scope of the present invention.

[0030] Once an oligomer is chosen, it can be tested for its tendency to self-dimerize, since self-dimerization may result in reduced efficiency of alteration of genetic information. Checking for self-dimerization tendency can be accomplished manually or, preferably, using a software program. One such program is Oligo Analyzer 2.0, available through Integrated DNA Technologies (Coralville, Iowa 52241) (http://www.idtdna.com); this program is available for use on the world wide web at http://www.idtdna.com/program/oligoanalyzer/oligoanalyzer.asp.

[0031] For each oligonucleotide sequence input into the program, Oligo Analyzer 2.0 reports possible self-dimerized duplex forms, which are usually only partially duplexed, along with the free energy change associated with such self-dimerization. Delta G-values that are negative and large in magnitude, indicating strong self-dimerization potential, are automatically flagged by the software as “bad”. Another software program that analyzes oligomers for pair dimer formation is Primer Select from DNASTAR, Inc., 1228 S. Park St., Madison, Wis. 53715, Phone: (608) 258-7420 (http://www.dnastar.com/products/PrimerSelect.html).

[0032] If the sequence is subject to significant self-dimerization, the addition of further sequence flanking the “repair” nucleotide can improve gene correction frequency.

[0033] Generally, the oligonucleotides of the present invention are identical in sequence to one strand of the target DNA, which can be either strand of the target DNA, with the exception of one or more targeted bases positioned within the DNA domain of the oligonucleotide, and preferably toward the middle between the modified terminal regions. Preferably, the difference in sequence of the oligonucleotide as compared to the targeted genomic DNA is located at about the middle of the oligo-nucleotide sequence. In a preferred embodiment, the oligonucleotides of the invention are complementary to the non-transcribed strand of a duplex. In other words, the preferred oligonucleotides target the sense strand of the DNA, i.e. the oligonucleotides of the invention are preferably complementary to the strand of the target DNA the sequence of which is found in the mRNA.

[0034] The oligonucleotides of the invention can include more than a single base change. In an oligonucleotide that is about a 70-mer, with at least one modified residue incorporated on the ends, as disclosed herein, multiple bases can be simultaneously targeted for change. The target bases may be up to 27 nucleotides apart and may not be changed together in all resultant plasmids in all cases. There is a frequency distribution such that the closer the target bases are to each other in the central DNA domain within the oligonucleotides of the invention, the higher the frequency of change in a given cell. Target bases only two nucleotides apart are changed together in every case that has been analyzed. The farther apart the two target bases are, the less frequent the simultaneous change. Thus, oligonucleotides of the invention may be used to repair or alter multiple bases rather than just one single base. For example, in a 74-mer oligonucleotide having a central base targeted for change, a base change event up to about 27 nucleotides away can also be effected. The positions of the altering bases within the oligonucleotide can be optimized using any one of the assays described herein. Preferably, the altering bases are at least about 8 nucleotides from one end of the oligonucleotide.

[0035] The oligonucleotides of the present invention can be introduced into cells by any suitable means. According to certain preferred embodiments, the modified oligonucleotides may be used alone. Suitable means, however, include the use of polycations, cationic lipids, liposomes, polyethylenimine (PEI), electroporation, biolistics, microinjection and other methods known in the art to facilitate cellular uptake. For plant cells, biolistic or particle bombardment methods are typically used. According to certain preferred embodiments of the present invention, isolated plant cells are treated in culture according to the methods of the invention, to mutate or repair a target gene. Alternatively, plant target DNA may be modified in vitro or in another cell type, including for example, yeast or bacterial cells and then introduced into a plant cell as, for example, a T-DNA. Plant cells thus modified may be used to regenerate the whole organism as, for example, in a plant having a desired targeted genomic change. In other instances, targeted genomic alteration, including repair or mutagenesis, may take place in vivo following direct administration of the modified, single-stranded oligonucleotides of the invention to a subject.

[0036] The single-stranded, modified oligonucleotides of the present invention have numerous applications as gene repair, gene modification, or gene knockout agents. Such oligonucleotides may be advantageously used, for example, to introduce or correct multiple point mutations. Each mutation leads to the addition, deletion or substitution of at least one base pair. The methods of the present invention offer distinct advantages over other methods of altering the genetic makeup of an organism, in that only the individually targeted bases are altered. No additional foreign DNA sequences are added to the genetic complement of the organism. Such agents may, for example, be used to develop plants with improved traits by rationally changing the sequence of selected genes in isolated cells and using these modified cells to regenerate whole plants having the altered gene. See, e.g., U.S. Pat. No. 6,046,380 and U.S. Pat. No. 5,905,185 incorporated herein by reference. Such plants produced using the compositions of the invention lack additional undesirable selectable markers or other foreign DNA sequences. Targeted base pair substitution or frameshift mutations introduced by an oligonucleotide in the presence of a cell-free extract also provides a way to modify the sequence of extrachromosomal elements, including, for example, plasmids, cosmids and artificial chromosomes. The oligonucleotides of the invention also simplify the production of plants having particular modified or inactivated genes. Altered plant model systems such as those produced using the methods and oligonucleotides of the invention are invaluable in determining the function of a gene and in evaluating drugs. The oligonucleotides and methods of the present invention may also be used to introduce molecular markers, including, for example, SNPs, RFLPs, AFLPs and CAPs.

[0037] The purified oligonucleotide compositions may be formulated in accordance with routine procedures depending on the target. For example, purified oligonucleotide can be used directly in a standard reaction mixture to introduce alterations into targeted DNA in vitro or where cells are the target as a composition adapted for bathing cells in culture or for microinjection into cells in culture. The purified oligonucleotide compositions may also be provided on coated microbeads for biolistic delivery into plant cells. Where necessary, the composition may also include a solubilizing agent. Generally, the ingredients will be supplied either separately or mixed together in single-use form, for example, as a dry, lyophilized powder or water-free concentrate. In general, dosage required for efficient targeted gene alteration will range from about 0.001 to 50,000 μg/kg target tissue, preferably between 1 to 250 μg/kg, and most preferably at a concentration of between 30 and 60 micromolar.

[0038] For cell administration, direct injection into the nucleus, biolistic bombardment, electroporation, liposome transfer and calcium phosphate precipitation may be used. In yeast, lithium acetate or spheroplast transformation may also be used. In a preferred method, the administration is performed with a liposomal transfer compound, e.g., DOTAP (Boehringer-Mannheim) or an equivalent such as lipofectin. The amount of the oligonucleotide used is about 500 nanograms in 3 micrograms of DOTAP per 100,000 cells. For electroporation, between 20 and 2000 nanograms of oligonucleotide per million cells to be electroporated is an appropriate range of dosages which can be increased to improve efficiency of genetic alteration upon review of the appropriate sequence according to the methods described herein. For biolistic delivery, microbeads are generally coated with resuspended oligonucleotides, which range of oligonucleotide to microbead concentration can be similarly adjusted to improve efficiency as determined using one of the assay methods described herein, starting with about 0.05 to 1 microgram of oligonucleotide to 25 microgram of 1.0 micrometer gold beads or similar microcarrier.

[0039] Another aspect of the invention is a kit comprising at least one oligonucleotide of the invention. The kit may comprise an additional reagent or article of manufacture. The additional reagent or article of manufacture may comprise a delivery mechanism, cell extract, a cell, or a plasmid, such as one of those disclosed in the Figures herein, for use in an assay of the invention. Alternatively, the invention includes a kit comprising an isogenic set of cells in which each cell in the kit comprises a different altered amino acid for a target protein encoded by a targeted altered gene within the cell produced according to the methods of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

[0040] FIG. 1. Flow diagram for the generation of modified single-stranded oligonucleotides. The upper strands of chimeric oligonucleotides I and II are separated into pathways resulting in the generation of single-stranded oligonucleotides that contain (A) 2′-O-methyl RNA nucleotides or (B) phosphorothioate linkages. Fold changes in repair activity for correction of kans in the HUH7 cell-free extract are presented in parenthesis. HUH7 cells are described in Nakabayashi et al., Cancer Research 42: 3858-3863 (1982). Each single-stranded oligonucleotide is 25 bases in length and contains a G residue mismatched to the complementary sequence of the kans gene. The numbers 3, 6, 8, 10, 12 and 12.5 respectively indicate how many phosphorothioate linkages (S) or 2′-O-methyl RNA nucleotides (R) are at each end of the molecule. Hence oligo 12S/25G contains an all phosphorothioate backbone, displayed as a dotted line. Smooth lines indicate DNA residues, wavy lines indicate 2′-O-methyl RNA residues and the carat indicates the mismatched base site (G). FIG. 1(C) provides a schematic plasmid indicating the sequence of the kan chimeric double-stranded hairpin oligonucleotide (left; SEQ ID NO: 2673) and the sequence the tet chimeric double-stranded hairpin oligonucleotide used in other experiments (right; SEQ ID NO: 2674). FIG. 1(D) provides a flow chart of a kan experiment in which a chimeric double-stranded hairpin oligonucleotide (SEQ ID NO: 2673) is used. In FIG. 1(D), the Kan mutant sequence corresponds to SEQ ID NO: 2675 and SEQ ID NO: 2676; the Kan converted sequence corresponds to SEQ ID NO: 2677 and SEQ ID NO: 2678; the mutant sequence in the sequence trace corresponds to SEQ ID NO: 2679 and the converted sequences in the sequence trace correspond to SEQ ID NO: 2680.

[0041] FIG. 2. Genetic readout system for correction of a point mutation in plasmid pKsm4021. A mutant kanamycin gene harbored in plasmid pKsm4021 is the target for correction by oligonucleotides. The mutant G is converted to a C by the action of the oligo. Corrected plasmids confer resistance to kanamycin in E.coli (DH10B) after electroporation leading to the genetic readout and colony counts. The wild type sequence corresponds to SEQ ID NO: 2681.

[0042] FIG. 3: Target plasmid and sequence correction of a frameshift mutation by chimeric and single-stranded oligonucleotides. (A) Plasmid pTsΔ208 contains a single base deletion mutation at position 208 rendering it unable to confer tet resistance. The target sequence presented below indicates the insertion of a T directed by the oligonucleotides to re-establish the resistant phenotype. (B) DNA sequence confirming base insertion directed by Tet 3S/25G; the yellow highlight indicates the position of frameshift repair. The wild type sequence corresponds to SEQ ID NO: 2682, the mutant sequence corresponds to SEQ ID NO: 2683 and the converted sequence corresponds to SEQ ID NO: 2684. The control sequence in the sequence trace corresponds to SEQ ID NO: 2685 and the 3S/25A sequence in the sequence trace corresponds to SEQ ID NO: 2686.

[0043] FIG. 4. DNA sequences of representative kanr colonies. Confirmation of sequence alteration directed by the indicated molecule is presented along with a table outlining codon distribution. Note that 10S/25G and 12S/25G elicit both mixed and unfaithful gene repair. The number of clones sequenced is listed in parentheses next to the designation for the single-stranded oligonucleotide. A plus (+) symbol indicates the codon identified while a figure after the (+) symbol indicates the number of colonies with a particular sequence. TAC/TAG indicates a mixed peak. Representative DNA sequences are presented below the table with yellow highlighting altered residues. The sequences in the sequence traces have been assigned numbers as follows: 3S/25G, 6S/25G and 8S/25G correspond to SEQ ID NO: 2687, 10S/25G corresponds to SEQ ID NO: 2688, 25S/25G on the lower left corresponds to SEQ ID NO: 2689 and 25S/25G on the lower right corresponds to SEQ ID NO: 2690.

[0044] FIG. 5. Gene correction in HeLa cells. Representative oligonucleotides of the invention are co-transfected with the pCMVneo()FIAsH plasmid (shown in FIG. 9) into HeLa cells. Ligand is diffused into cells after co-transfection of plasmid and oligonucleotides. Green fluorescence indicates gene correction of the mutation in the antibiotic resistance gene. Correction of the mutation results in the expression of a fusion protein that carries a marker ligand binding site and when the fusion protein binds the ligand, a green fluorescence is emitted. The ligand is produced by Aurora Biosciences and can readily diffuse into cells enabling a measurement of corrected protein function; the protein must bind the ligand directly to induce fluorescence. Hence cells bearing the corrected plasmid gene appear green while “uncorrected” cells remain colorless.

[0045] FIG. 6. Z-series imaging of corrected cells. Serial cross-sections of the HeLa cell represented in FIG. 5 are produced by Zeiss 510 LSM confocal microscope revealing that the fusion protein is contained within the cell.

[0046] FIG. 7. Hygromycin-eGFP target plasmids. (A) Plasmid pAURHYG(ins)GFP contains a single base insertion mutation between nucleotides 136 and 137, at codon 46, of the Hygromycin B coding sequence (cds) which is transcribed from the constitutive ADH1 promoter. The target sequence presented below indicates the deletion of an A and the substitution of a C for a T directed by the oligonucleotides to re-establish the resistant phenotype. In FIG. 7A, the sequence of the normal allele corresponds to SEQ ID NO: 2691, the sequence of the targe/existing mutation corresponds to SEQ ID NO: 2692 and the sequence of the desired alteration corresponds to SEQ ID NO: 2693. (B) Plasmid pAURHYG(rep)GFP contains a base substitution mutation introducing a G at nucleotide 137, at codon 46, of the Hygromycin B coding sequence (cds). The target sequence presented below the diagram indicates the amino acid conservative replacement of G with C, restoring gene function. In FIG. 7B, the sequence of the normal allele correspond to SEQ ID NO: 2691, the sequence of the targe/existing mutation corresponds to SEQ ID NO: 2694 and the sequence of the desired alteration corresponds to SEQ ID NO: 2693.

[0047] FIG. 8. Oligonucleotides for correction of hygromycin resistance gene. The sequence of the oligonucleotides used in experiments to assay correction of a hygromycin resistance gene are shown. DNA residues are shown in capital letters, RNA residues are shown in lowercase and nucleotides with a phosphorothioate backbone are capitalized and underlined. In FIG. 8, the sequence of HygE3T/25 corresponds to SEQ ID NO: 2695, the sequence of HygE3T/74 corresponds to SEQ ID NO: 2696, the sequence of HygE3T/74a corresponds to SEQ ID NO: 2697, the sequence of HygGG/Rev corresponds to SEQ ID NO: 2698 and the sequence of Kan70T corresponds to SEQ ID NO: 2699.

[0048] FIG. 9. pAURNeo(−)FIAsH plasmid. This figure describes the plasmid structure, target sequence, oligonucleotides, and the basis for detection of the gene alteration event by fluorescence. In FIG. 9, the sequence of the Neo/kan target mutant corresponds to SEQ ID NO: 2675 and SEQ ID NO: 2676, the converted sequence corresponds to SEQ ID NO: 2677 and SEQ ID NO: 2678 and the FIAsH peptide sequence corresponds to SEQ ID NO: 2700.

[0049] FIG. 10. pYESHyg(x)eGFP plasmid. This plasmid is a construct similar to the pAURHyg(x)eGFP construct shown in FIG. 7, except the promoter is the inducible GAL1 promoter. This promoter is inducible with galactose, leaky in the presence of raffinose, and repressed in the presence of dextrose.

[0050] FIG. 11. pBI-HygeGFP plasmid. This plasmid is a construct based on the plasmids pBI101, pBI 101.2, pBI101.3 or pBI 121 available from Clontech in which HygeGFP replaces the beta-glucuronidase gene of the Clontech plasmids. The different Clontech plasmids vary by a reading frame shift relative to the polylinker, or the presence of the Cauliflower mosaic virus promoter.

[0051] The following examples are provided by way of illustration only, and are not intended to limit the scope of the invention disclosed herein.

EXAMPLE 1

Assay Method for Base Alteration and Preferred Oligonucleotide Selection

[0052] In this example, single-stranded and double-hairpin oligonucleotides with chimeric backbones (see FIG. 1 for structures (A and B) and sequences (C and D) of assay oligonucleotides) are used to correct a point mutation in the kanamycin gene of pKsm4021 (FIG. 2) or the tetracycline gene of pTsΔ208 (FIG. 3). All kan oligonucleotides share the same 25 base sequence surrounding the target base identified for change, just as all tet oligonucleotides do. The sequence is given in FIG. 1C and FIG. 1D. Each plasmid contains a functional ampicillin gene. Kanamycin gene function is restored when a G at position 4021 is converted to a C (via a substitution mutation); tetracycline gene function is restored when a deletion at position 208 is replaced by a C (via frameshift mutation). A separate plasmid, pAURNeo(−)FIAsH (FIG. 9), bearing the kans gene is used in the cell culture experiments. This plasmid was constructed by inserting a synthetic expression cassette containing a neomycin phosphotransferasea (kanamycin resistance) gene and an extended reading frame that encodes a receptor for the FIAsH ligand into the pAUR123 shuttle vector (Panvera Corp., Madison, Wis.). The resulting construct replicates in S. cerevisiae at low copy number, confers resistance to aureobasidinA and constitutively expresses either the Neo+/FIAsH fusion product (after alteration) or the truncated Neo−/FIAsH product (before alteration) from the ADH1 promoter. By extending the reading frame of this gene to code for a unique peptide sequence capable of binding a small ligand to form a fluorescent complex, restoration of expression by correction of the stop codon can be detected in real time using confocal microscopy.

[0053] Additional constructs can be made to test additional gene alteration events or for specific use in different expression systems. For example, alternative comparable plant plasmids or integration vectors such as, e.g. those based on T-DNA, can be constructed for stable expression in plant cells according to the disclosures herein. Such constructs would use a plant specific promoter such as, e.g., cauliflower mosaic virus 35S promoter, to replace the promoters directing expression of the neo, hyg or aureobasidinA resistance gene disclosed herein, including for example, in FIGS. 7B, 9 and 10 herein. Moreover, the green fluorescent protein (GFP) sequence used herein may be modified to increase expression in plant cells such as Arabidopsis and the other plants disclosed herein as described in Haseloff et al., Proc. Natl.Acad. Sci. 94(6): 2122-7 (1997), Rouwendal et al. Plant Mol. Biol. 33(6): 989-99 (1997) and Hu et al. FEBS Lett. 369(2-3): 331-4 (1995). Codon usage for optimal expression of GFP in plants results from increasing the frequency of codons with a C or a G in the third position from 32 to about 60%. Specific constructs are disclosed and can be used as follows with such plant specific alterations.

[0054] We also construct three mammalian expression vectors, pHyg(rep)eGFP, pHyg(Δ)eGFP, pHyg(ins)eGFP, that contain a substitution mutation at nucleotide 137 of the hygromycin-B coding sequence. (rep) indicates a T1374→G replacement, (Δ) represents a deletion of the G137 and (ins) represents an A insertion between nucleotides 136 and 137. All point mutations create a nonsense termination codon at residue 46. We use pHYGeGFP plasmid (Invitrogen, CA) DNA as a template to introduce the mutations into the hygromycin-eGFP fusion gene by a two step site-directed mutagenesis PCR protocol. First, we generate overlapping 5′ and a 3′ amplicons surrounding the mutation site by PCR for each of the point mutation sites. A 215 bp 5′ amplicon for the (rep), (Δ) or (ins) was generated by polymerization from oligonucleotide primer HygEGFPf (5′-AATACGACTCACTATAGG-3′; SEQ ID NO: 2701) to primer Hygrepr (5′GACCTATCCACGCCCTCC-3′; SEQ ID NO: 2702), HygΔr (5′-GACTATCCACGCCCTCC-3′; SEQ ID NO: 2703), or Hyginsr (5′-GACATTATCCACGCCCTCC-3′; SEQ ID NO: 2704), respectively. We generate a 300 bp 3′ amplicon for the (rep), (Δ) or (ins) by polymerization from oligonucleotide primers Hygrepf (5′-CTGGGATAGGTCCTGCGG-3′; SEQ ID NO: 2705), HygΔf (5′-CGTGGATAGTCCTGCGG-3′; SEQ ID NO: 2706), Hyginsf (5′-CGTGGATAATGTCCTGCGG-3′; SEQ ID NO: 2707), respectively to primer HygEGFPr (5′-AAATCACGCCATGTAGTG-3′; SEQ ID NO: 2708). We mix 20 ng of each of the resultant 5′ and 3′ overlapping amplicon mutation sets and use the mixture as a template to amplify a 523 bp fragment of the Hygromycin gene spanning the KpnI and RsrII restriction endonuclease sites. We use the Expand PCR system (Roche) to generate all amplicons with 25 cycles of denaturing at 94° C. for 10 seconds, annealing at 55° C. for 20 seconds and elongation at 68° C. for 1 minute. We digest 10 μg of vector pHYGeGFP and 5 μg of the resulting fragments for each mutation with KpnI and RsrII (NEB) and gel purify the fragment for enzymatic ligation. We ligate each mutated insert into pHYGeGFP vector at 3:1 molar ratio using T4 DNA ligase (Roche). We screen clones by restriction digest, confirm the mutation by Sanger dideoxy chain termination sequencing and purify the plasmid using a Qiagen maxiprep kit.

[0055] Oligonucleotide synthesis and cells. Chimeric oligonucleotides and single-stranded oligonucleotides (including those with the indicated modifications) are synthesized using available phosphoramidites on controlled pore glass supports. After deprotection and detachment from the solid support, each oligonucleotide is gel-purified using, for example, procedures such as those described in Gamper et al., Biochem. 39, 5808-5816 (2000) and the concentrations determined spectrophotometrically (33 or 40 μg/ml per A260 unit of single-stranded or hairpin oligomer). HUH7 cells are grown in DMEM, 10% FBS, 2 mM glutamine, 0.5% pen/strep. The E.coli strain, DH10B, is obtained from Life Technologies (Gaithersburg, Md.); DH10B cells contain a mutation in the RECA gene (recA).

[0056] Cell-free extracts. Although this portion of this example is directed to mammalian systems, similar extracts from plants can be prepared as disclosed elsewhere in this application and used as disclosed in this example. We prepare cell-free extracts from HUH7 cells or other mammalian cells, as follows. We employ this protocol with essentially any mammalian cell including, for example, H1299 cells (human epithelial carcinoma, non-small cell lung cancer), C127I (immortal murine mammary epithelial cells), MEF (mouse embryonic fibroblasts), HEC-1-A (human uterine carcinoma), HCT15 (human colon cancer), HCT116 (human colon carcinoma), LoVo (human colon adenocarcinoma), and HeLa (human cervical carcinoma). We harvest approximately 2×108 cells. We then wash the cells immediately in cold hypotonic buffer (20 mM HEPES, pH7.5; 5 mM KCl; 1.5 mM MgCl2; 1 mM DTT) with 250 mM sucrose. We then resuspend the cells in cold hypotonic buffer without sucrose and after 15 minutes we lyse the cells with 25 strokes of a Dounce homogenizer using a tight fitting pestle. We incubate the lysed cells for 60 minutes on ice and centrifuge the sample for 15 minutes at 12000×g. The cytoplasmic fraction is enriched with nuclear proteins due to the extended co-incubation of the fractions following cell breakage. We then immediately aliquote and freeze the supernatant at −80° C. We determine the protein concentration in the extract by the Bradford assay.

[0057] We also perform these experiments with cell-free extracts obtained from fungal cells, including, for example, S. cerevisiae (yeast), Ustilago maydis, and Candida albicans. For example, we grow yeast cells into log phase in 2L YPD medium for 3 days at 30° C. We then centrifuge the cultures at 5000×g, resuspend the pellets in a 10% sucrose, 50 mM Tris, 1 mM EDTA lysis solution and freeze them on dry ice. After thawing, we add KCl, spermidine and lyticase to final concentrations of 0.25 mM, 5 mM and 0.1 mg/ml, respectively. We incubate the suspension on ice for 60 minutes, add PMSF and Triton X100 to final concentrations of 0.1 mM and 0.1% and continue to incubate on ice for 20 minutes. We centrifuge the lysate at 3000×g for 10 minutes to remove larger debris. We then remove the supernatant and clarify it by centrifuging at 30000×g for 15 minutes. We then add glycerol to the clarified extract to a concentration of 10% (v/v) and freeze aliquots at −80° C. We determine the protein concentration of the extract by the Bradford assay.

[0058] Reaction mixtures of 50 μl are used, consisting of 10-30 μg protein of cell-free extract, which can be optionally substituted with purified proteins or enriched fractions, about 1.5 μg chimeric double-hairpin oligonucleotide or 0.55 μg single-stranded molecule (3S/25G or 6S/25G, see FIG. 1), and 1 μg of plasmid DNA (see FIGS. 2 and 3) in a reaction buffer of 20 mM Tris, pH 7.4, 15 mM MgCl2, 0.4 mM DTT, and 1.0 mM ATP. Reactions are initiated with extract and incubated at 30° C. for 45 min. The reaction is stopped by placing the tubes on ice and then immediately deproteinized by two phenol/chloroform (1:1) extractions. Samples are then ethanol precipitated. The nucleic acid is pelleted at 15,000 r.p.m. at 4° C. for 30 min., is washed with 70% ethanol, resuspended in 50 μl H2O, and is stored at −20° C. 5 μl of plasmid from the resuspension (˜100 ng) was transfected in 20 μl of DH10B cells by electroporation (400 V, 300 μF, 4 kΩ) in a Cell-Porator apparatus (Life Technologies). After electroporation, cells are transferred to a 14 ml Falcon snap-cap tube with 2 ml SOC and shaken at 37° C. for 1 h. Enhancement of final kan colony counts is achieved by then adding 3 ml SOC with 10 μg/ml kanamycin and the cell suspension is shaken for a further 2 h at 37° C. Cells are then spun down at 3750×g and the pellet is resuspended in 500 μl SOC. 200 μl is added undiluted to each of two kanamycin (50 μg/ml) agar plates and 200 μl of a 105 dilution is added to an ampicillin (100 μg/ml) plate. After overnight 37° C. incubation, bacterial colonies are counted using an Accucount 1000 (Biologics). Gene conversion effectiveness is measured as the ratio of the average of the kan colonies on both plates per amp colonies multiplied by 10−5 to correct for the amp dilution.

[0059] The following procedure can also be used. 5 μl of resuspended reaction mixtures (total volume 50 μl) are used to transform 20 μl aliquots of electro-competent DH10B bacteria using a Cell-Porator apparatus (Life Technologies). The mixtures are allowed to recover in 1 ml SOC at 37° C. for 1 hour at which time 50 μg/ml kanamycin or 12 μg/ml tetracycline is added for an additional 3 hours. Prior to plating, the bacteria are pelleted and resuspended in 200 μl of SOC. 100 μl aliquots are plated onto kan or tet agar plates and 100 μl of a 1031 4 dilution of the cultures are concurrently plated on agar plates containing 100 μg/ml of ampicillin. Plating is performed in triplicate using sterile Pyrex beads. Colony counts are determined by an Accu-count 1000 plate reader (Biologics). Each plate contains 200-500 ampicillin resistant colonies or 0-500 tetracycline or kanamycin resistant colonies. Resistant colonies are selected for plasmid extraction and DNA sequencing using an ABI Prism kit on an ABI 310 capillary sequencer (PE Biosystems).

[0060] Chimeric single-stranded oligonucleotides. In FIG. 1 the upper strands of chimeric oligonucleotides I and II are separated into pathways resulting in the generation of single-stranded oligo-nucleotides that contain (FIG. 1A) 2′-O-methyl RNA nucleotides or (FIG. 1B) phosphorothioate linkages. Fold changes in repair activity for correction of kans in the HUH7 cell-free extract are presented in parenthesis. Each single-stranded oligonucleotide is 25 bases in length and contains a G residue mismatched to the complementary sequence of the kans gene.

[0061] Molecules bearing 3, 6, 8, 10 and 12 phosphorothioate linkages in the terminal regions at each end of a backbone with a total of 24 linkages (25 bases) are tested in the kans system. Alternatively, molecules bearing 2, 4, 5, 7, 9 and 11 in the terminal regions at each end are tested. The results of one such experiment, presented in Table 1 and FIG. 1B, illustrate an enhancement of correction activity directed by some of these modified structures. In this illustrative example, the most efficient molecules contained 3 or 6 phosphorothioate linkages at each end of the 25-mer; the activities are approximately equal (molecules IX and X with results of 3.09 and 3.7 respectively). A reduction in alteration activity may be observed as the number of modified linkages in the molecule is further increased. Interestingly, a single-strand molecule containing 24 phosphorothioate linkages is minimally active suggesting that this backbone modification when used throughout the molecule supports only a low level of targeted gene repair or alteration. Such a non-altering, completely modified molecule can provide a baseline control for determining efficiency of correction for a specific oligonucleotide molecule of known sequence in defining the optimum oligonucleotide for a particular alteration event.

[0062] The efficiency of gene repair directed by phosphorothioate-modified, single-stranded molecules, in a length dependent fashion, led us to examine the length of the RNA modification used in the original chimera as it relates to correction. Construct III represents the “RNA-containing” strand of chimera I and, as shown in Table 1 and FIG. 2A, it promotes inefficient gene repair. But, as shown in the same figure, reducing the RNA residues on each end from 10 to 3 increases the frequency of repair. At equal levels of modification, however, 25-mers with 2′-O-methyl ribonucleotides were less effective gene repair agents than the same oligomers with phosphorothioate linkages. These results reinforce the fact that an RNA containing oligonucleotide is not as effective in promoting gene repair or alteration as a modified DNA oligonucleotide.

[0063] Repair of the kanamycin mutation requires a G→C exchange. To confirm that the specific desired correction alteration was obtained, colonies selected at random from multiple experiments are processed and the isolated plasmid DNA is sequenced. As seen in FIG. 4, colonies generated through the action of the single-stranded molecules 3S/25G (IX), 6S/25G (X) and 8S/25G (XI) respectively contained plasmid molecules harboring the targeted base correction. While a few colonies appeared on plates derived from reaction mixtures containing 25-mers with 10 or 12 thioate linkages on both ends, the sequences of the plasmid molecules from these colonies contain nonspecific base changes. In these illustrative examples, the second base of the codon is changed (see FIG. 3). These results show that modified single-strands can direct gene repair, but that efficiency and specificity are reduced when the 25-mers contain 10 or more phosphorothioate linkages at each end.

[0064] In FIG. 1, the numbers 3, 6, 8, 10, 12 and 12.5 respectively indicate how many phosphorothioate linkages (S) or 2′-O-methyl RNA nucleotides (R) are at each end of the examplified molecule although other molecules with 2, 4, 5, 7, 9 and 11 modifications at each end can also be tested. Hence oligo 12S/25G represents a 25-mer oligonucleotide which contains 12 phosphorothioate linkages on each side of the central G target mismatch base producing a fully phosphorothioate linked backbone, displayed as a dotted line. The dots are merely representative of a linkage in the figure and do not depict the actual number of linkages of the oligonucleotide. Smooth lines indicate DNA residues, wavy lines indicate 2′-O-methyl RNA residues and the carat indicates the mismatched base site (G).

[0065] Correction of a mutant kanamycin gene in cultured mammalian cells. Although this portion of this example is directed to cultured mammalian cells, comparable methods may be used using cultured plant cells or protoplasts of those cells from the plant species disclosed herein. The experiments are performed using different eukaryotic cells including plant and mammalian cells, including, for example, 293 cells (transformed human primary kidney cells), HeLa cells (human cervical carcinoma), and H1299 (human epithelial carcinoma, non-small cell lung cancer). HeLa cells are grown at 37° C. and 5% CO2 in a humidified incubator to a density of 2×105 cells/ml in an 8 chamber slide (Lab-Tek). After replacing the regular DMEM with Optimem, the cells are co-transfected with 10 μg of plasmid pAURNeo(−) FIAsH and 5 μg of modified single-stranded oligonucleotide (3S/25G) that is previously complexed with 10 μg lipofectamine, according to the manufacturer's directions (Life Technologies). The cells are treated with the liposome-DNA-oligo mix for 6 hrs at 37° C. Treated cells are washed with PBS and fresh DMEM is added. After a 16-18 hr recovery period, the culture is assayed for gene repair. The same oligonucleotide used in the cell-free extract experiments is used to target transfected plasmid bearing the kans gene. Correction of the point mutation in this gene eliminates a stop codon and restores full expression. This expression can be detected by adding a small non-fluorescent ligand that bound to a C-C-R-E-C-C sequence (SEQ ID NO: 2717) in the genetically modified carboxy terminus of the kan protein, to produce a highly fluorescent complex (FIAsH system, Aurora Biosciences Corporation). Following a 60 min incubation at room temperature with the ligand (FIAsH-EDT2), cells expressing full length kan product acquire an intense green fluorescence detectable by fluorescence microscopy using a fluorescein filter set. Similar experiments are performed using the HygeGFP target as described in Example 2 with a variety of mammalian cells, including, for example, COS-1 and COS-7 cells (African green monkey), and CHO-K1 cells (Chinese hamster ovary). The experiments are also performed with PG12 cells (rat pheochromocytoma) and ES cells (human embryonic stem cells).

[0066] Summary of experimental results. Tables 1, 2 and 3 respectively provide data on the efficiency of gene repair directed by single-stranded oligonucleotides. Table 1 presents data using a cell-free extract from human liver cells (HUH7) to catalyze repair of the point mutation in plasmid pkansm4021 (see FIG. 1). Table 2 illustrates that the oligomers are not dependent on MSH2 or MSH3 for optimal gene repair activity. Table 3 illustrates data from the repair of a frameshift mutation (FIG. 3) in the tet gene contained in plasmid pTetΔ208. Table 4 illustrates data from repair of the pkansm4021 point mutation catalyzed by plant cell extracts prepared from canola and musa (banana). Colony numbers are presented as kanr or tetr and fold increases (single strand versus double hairpin) are presented for kanr in Table 1.

[0067] FIG. 5A is a confocal picture of HeLa cells expressing the corrected fusion protein from an episomal target. Gene repair is accomplished by the action of a modified single-stranded oligonucleotide containing 3 phosphorothioate linkages at each end (3S/25G). FIG. 5B represents a “Z-series” of HeLa cells bearing the corrected fusion gene. This series sections the cells from bottom to top and illustrates that the fluorescent signal is “inside the cells”.

[0068] Results. In summary, we have designed a novel class of single-stranded oligonucleotides with backbone modifications at the termini and demonstrate gene repair/conversion activity in mammalian and plant cell-free extracts. We confirm that the all DNA strand of the RNA-DNA double-stranded double hairpin chimera is the active component in the process of gene repair. In some cases, the relative frequency of repair by the novel oligonucleotides of the invention is elevated approximately 3-4-fold in certain embodiments when compared to frequencies directed by chimeric RNA-DNA double hairpin oligonucleotides.

[0069] This strategy centers around the use of extracts from various sources to correct a mutation in a plasmid using a modified single-stranded or a chimeric RNA-DNA double hairpin oligonucleotide. A mutation is placed inside the coding region of a gene conferring antibiotic resistance in bacteria, here kanamycin or tetracycline. The appearance of resistance is measured by genetic readout in E.coli grown in the presence of the specified antibiotic. The importance of this system is that both phenotypic alteration and genetic inheritance can be measured. Plasmid pKsm4021 contains a mutation (T→G) at residue 4021 rendering it unable to confer antibiotic resistance in E.coli. This point mutation is targeted for repair by oligonucleotides designed to restore kanamycin resistance. To avoid concerns of plasmid contamination skewing the colony counts, the directed correction is from G→C rather than G→T (wild-type). After isolation, the plasmid is electroporated into the DH10B strain of E.coli, which contains inactive RecA protein. The number of kanamycin colonies is counted and normalized by ascertaining the number of ampicillin colonies, a process that controls for the influence of electroporation. The number of colonies generated from three to five independent reactions was averaged and is presented for each experiment. A fold increase number is recorded to aid in comparison.

[0070] The original RNA-DNA double hairpin chimera design, e.g., as disclosed in U.S. Pat. No. 5,565,350, consists of two hybridized regions of a single-stranded oligonucleotide folded into a double hairpin configuration. The double-stranded targeting region is made up of a 5 base pair DNA/DNA segment bracketed by 10 base pair RNA/DNA segments. The central base pair is mismatched to the corresponding base pair in the target gene. When a molecule of this design is used to correct the kans mutation, gene repair is observed (I in FIG. 1A). Chimera II (FIG. 1B) differs partly from chimera I in that only the DNA strand of the double hairpin is mismatched to the target sequence. When this chimera was used to correct the kans mutation, it was twice as active. In the same study, repair function could be further increased by making the targeting region of the chimera a continuous RNA/DNA hybrid.

[0071] Frame shift mutations are repaired. By using plasmid pTsΔ208, described in FIG. 1(C) and FIG. 3, the capacity of the modified single-stranded molecules that showed activity in correcting a point mutation, can be tested for repair of a frameshift. To determine efficiency of correction of the mutation, a chimeric oligonucleotide (Tet I), which is designed to insert a T residue at position 208, is used. A modified single-stranded oligonucleotide (Tet IX) directs the insertion of a T residue at this same site. FIG. 3 illustrates the plasmid and target bases designated for change in the experiments. When all reaction components are present (extract, plasmid, oligomer), tetracycline resistant colonies appear. The colony count increases with the amount of oligonucleotide used up to a point beyond which the count falls off (Table 3). No colonies above background are observed in the absence of either extract or oligonucleotide, nor when a modified single-stranded molecule bearing perfect complementarity is used. FIG. 3 represents the sequence surrounding the target site and shows that a T residue is inserted at the correct site. We have isolated plasmids from fifteen colonies obtained in three independent experiments and each analyzed sequence revealed the same precise nucleotide insertion. These data suggest that the single-stranded molecules used initially for point mutation correction can also repair nucleotide deletions.

[0072] Comparison of phosphorothioate oligonucleotides to 2′-O-methyl substituted oligonucleotides. From a comparison of molecules VII and XI, it is apparent that gene repair is more subject to inhibition by RNA residues than by phosphorothioate linkages. Thus, even though both of these oligonucleotides contain an equal number of modifications to impart nuclease resistance, XI (with 16 phosphorothioate linkages) has good gene repair activity while VII (with 16 2′-O-methyl RNA residues) is inactive. Hence, the original chimeric double hairpin oligonucleotide enabled correction directed, in large part, by the strand containing a large region of contiguous DNA residues.

[0073] Oligonucleotides can target multiple nucleotide alterations within the same template. The ability of individual single-stranded oligonucleotides to correct multiple mutations in a single target template is tested using the plasmid pKsm4021 and the following single-stranded oligonucleotides modified with 3 phosphorothioate linkages at each end (indicated as underlined nucleotides): Oligo1 is a 25-mer with the sequence TTCGATAAGCCTATGCTGACCCGTG (SEQ ID NO: 2709) corrects the original mutation present in the kanamycin resistance gene of pKsm4021 as well as directing another alteration 2 basepairs away in the target sequence (both indicated in boldface); Oligo2 is a 70-mer with the 5′-end sequence TTCGGCTACGACTGGGCACAACAGACAATTGGC (SEQ ID NO: 2710) with the remaining nucleotides being completely complementary to the kanamycin resistance gene and also ending in 3 phosphorothioate linkages at the 3′ end. Oigo2 directs correction of the mutation in pKsm4021 as well as directing another alteration 21 basepairs away in the target sequence (both indicated in boldface).

[0074] We also use additional oligonucleotides to assay the ability of individual oligonucleotides to correct multiple mutations in the pKsM4021 plasmid. These include, for example, a second 25-mer that alters two nucleotides that are three nucleotides apart with the sequence 5′-TTGTGCCCAGTCGTATCCGAATAGC-3′ (SEQ ID NO: 2711); a 70-mer that alters two nucleotides that are 21 nucleotides apart with the sequence 5′-CATCAGAGCAGCCAATTGTCTGTTGTGCCCAGTCGTAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGA-3′ (SEQ ID NO: 2712); and another 70-mer that alters two nucleotides that are 21 nucleotides apart with the sequence 5′-GCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCAATTGTCTGTTGTGCCCAGTCGTAGCCGMTAGCCT-3′ (SEQ ID NO: 2713). The nucleotides in the oligonucleotides that direct alteration of the target sequence are underlined and in boldface. These oligonucleotides are modified in the same way as the other oligonucleotides of the invention.

[0075] We assay correction of the original mutation in pKsm4021 by monitoring kanamycin resistance (the second alterations which are directed by Oligo2 and Oligo3 are silent with respect to the kanamycin resistance phenotype). In addition, in experiments with Oligo2, we also monitor cleavage of the resulting plasmids using the restriction enzyme Tsp5091 which cuts at a specific site present only when the second alteration has occurred (at ATT in Oligo2). We then sequence these clones to determine whether the additional, silent alteration has also been introduced. The results of an analysis are presented below: 2

Oligo 1 (25-mer)Oligo 2 (70-mer)
Clones with both sites changed97
Clones with a single site changed02
Clones that were not changed41

[0076] Nuclease sensitivity of unmodified DNA oligonucleotide. Electrophoretic analysis of nucleic acid recovered from the cell-free extract reactions conducted here confirm that the unmodified single-stranded 25-mer did not survive incubation whereas greater than 90% of the terminally modified oligos did survive (as judged by photo-image analyses of agarose gels).

[0077] Plant extracts direct repair. The modified single-stranded constructs can be tested in plant cell extracts. We have observed gene alteration using extracts from multiple plant sources, including, for example, Arabidopsis, tobacco, banana, maize, soybean, canola, wheat, spinach as well as spinach chloroplast extract or extracts made from other plant cells disclosed herein. We prepare the extracts by grinding plant tissue or cultured cells under liquid nitrogen with a mortar and pestle. We extract 3 ml of the ground plant tissue with 1.5 ml of extraction buffer (20 mM HEPES, pH7.5; 5 mM KCl; 1.5 mM MgCl2; 10 mM DTT; and 10% [v/v] glycerol). Some plant cell-free extracts also include about 1% (w/v) PVP. We then homogenize the samples with 15 strokes of a Dounce homogenizer. Following homogenization, we incubate the samples on ice for 1 hour and centrifuge at 3000×g for 5 minutes to remove plant cell debris. We then determine the protein concentration in the supernatants (extracts) by Bradford assay. We dispense 100 μg (protein) aliquots of the extracts which we freeze in a dry ice-ethanol bath and store at −80° C.

[0078] We describe experiments using two sources here: a dicot (canola) and a monocot (banana, Musa acuminata cv. Rasthali). Each vector directs gene repair of the kanamycin mutation (Table 4); however, the level of correction is elevated 2-3 fold relative to the frequency observed with the chimeric oligonucleotide. These results are similar to those observed in the mammalian system wherein a significant improvement in gene repair occurred when modified single-stranded molecules were used.

[0079] Tables are attached hereto. 3

TABLE I
Gene repair activity is directed by single-stranded oligonucleotides.
OligonucleotidePlasmidExtract (ug)kanr coloniesFold increase
IpKSm402110300
I20418 1.0 ×
II10537
II20748 1.78 ×
III103
III205 0.01 ×
IV10112
IV2096 0.22 ×
V10217
V20342 0.81 ×
VI106
VI20390.093 ×
VII100
VII200   0 ×
VIII103
VIII205 0.01 ×
IX10936
IX201295 3.09 ×
X101140
X201588 3.7 ×
XI10480
XI20681 1.6 ×
XII1018
XII20250.059 ×
XIII100
XIII2040.009 ×
200
I0

[0080] Plasmid pKSm4021 (1 μg), the indicated oligonucleotide (1.5 μg chimeric oligonucleotide or 0.55 μg single-stranded oligonucleotide; molar ratio of oligo to plasmid of 360 to 1) and either 10 or 20 μg of HUH7 cell-free extract were incubated 45 min at 37° C. Isolated plasmid DNA was electroporated into E. coli (strain DH10B) and the number of kanr colonies counted. The data represent the number of kanamycin resistant colonies per 106 ampicillin resistant colonies generated from the same reaction and is the average of three experiments (standard deviation usually less than +/−15%). Fold increase is defined relative to 418 kanr colonies (second reaction) and in all reactions was calculated using the 20 μg sample. 4

TABLE II
Modified single-stranded oligomers are not dependent on MSH2
or MSH3 for optimal gene repair activity.
A.OligonucleotidePlasmidExtractkanr colonies
IX (3S/25G)HUH7637
X (6S/25G)HUH7836
IXMEF2−/−781
XMEF2−/−676
IXMEF3−/−582
XMEF3−/−530
IXMEF+/+332
XMEF+/+497
MEF2−/−10
MEF3−/−5
MEF+/+14

[0081] Chimeric oligonucleotide (1.5 μg) or modified single-stranded oligonucleotide (0.55 μg) was incubated with 1 μg of plasmid pKSm4021 and 20 μg of the indicated extracts. MEF represents mouse embryonic fibroblasts with either MSH2 (2−/−) or MSH3 (3−/−) deleted. MEF+/+ indicates wild-type mouse embryonic fibroblasts. The other reaction components were then added and processed through the bacterial readout system. The data represent the number of kanamycin resistant colonies per 106 ampicillin resistant colonies. 5

TABLE III
Frameshift mutation repair is directed by
single-stranded oligonucleotides
OligonucleotidePlasmidExtracttetr colonies
Tet IX (3S/25A; 0.5 μg)pTSΔ208 (1 μg)0
20 μg0
Tet IX (0.5 μg)48
Tet IX (1.5 μg)130
Tet IX (2.0 μg)68
Tet I (chimera; 1.5 μg)48

[0082] Each reaction mixture contained the indicated amounts of plasmid and oligonucleotide. The extract used for these experiments came from HUH7 cells. The data represent the number of tetracycline resistant colonies per 106 ampicillin resistant colonies generated from the same reaction and is the average of 3 independent experiments. Tet I is a chimeric oligonucleotide and Tet IX is a modified single-stranded oligonucleotide that are designed to insert a T residue at position 208 of pTsΔ208. The oligonucleotides are equivalent to structures I and IX in FIG. 2. 6

TABLE IV
Plant cell-free extracts support gene repair by
single-stranded oligonucleotides
OligonucleotidePlasmidExtractkanr colonies
II (chimera)pKSm402l30 μgCanola337
IX (3S/25G)Canola763
X (6S/25G)Canola882
IIMusa203
IXMusa343
XMusa746
Canola0
Musa0
IXCanola0
XMusa0

[0083] Canola or Musa cell-free extracts were tested for gene repair activity on the kanamycin-sensitive gene as previously described in (18). Chimeric oligonucleotide II (1.5 μg) and modified single-stranded oligonucleotides IX and X (0.55 μg) were used to correct pKSm4021. Total number of kanr colonies are present per 107 ampicillin resistant colonies and represent an average of four independent experiments. 7

TABLE V
Gene repair activity in cell-free extracts prepared from yeast
(Saccharomyces cerevisiae)
Cell-typePlasmidChimeric OligoSS Oligokanr/ampr × 106
Wild typepKansm40211 μg0.36
Wild type1 μg0.81
ΔRAD521 μg10.72
ΔRAD521 μg17.41
ΔPMS11 μg2.02
ΔPMS11 μg3.23
In this experiment, the kans gene in pKans4021 is corrected by either a chimeric double-hairpin oligonucleotide or a single-stranded oligonucleotide containing three thioate linkages at each end (3S/25G).

EXAMPLE 2

Yeast Cell Targeting Assay Method for Base Alteration and Preferred Oligonucleotide Selection

[0084] In this example, single-stranded oligonucleotides with modified backbones and double-hairpin oligonucleotides with chimeric, RNA-DNA backbones are used to measure gene repair using two episomal targets with a fusion between a hygromycin resistance gene and eGFP as a target for gene repair. These plasmids are pAURHYG(rep)GFP, which contains a point mutation in the hygromycin resistance gene (FIG. 7), pAURHYG(ins)GFP, which contains a single-base insertion in the hygromycin resistance gene (FIG. 7) and pAURHYG(Δ)GFP which has a single base deletion. We also use the plasmid containing a wild-type copy of the hygromycin-eGFP fusion gene, designated pAURHYG(wt)GFP, as a control. These plasmids also contain an aureobasidinA resistance gene. In pAURHYG(rep)GFP, hygromycin resistance gene function and green fluorescence from the eGFP protein are restored when a G at position 137, at codon 46 of the hygromycin B coding sequence, is converted to a C thus removing a premature stop codon in the hygromycin resistance gene coding region. In pAURHYG(ins)GFP, hygromycin resistance gene function and green fluorescence from the eGFP protein are restored when an A inserted between nucleotide positions 136 and 137, at codon 46 of the hygromycin B coding sequence, is deleted and a C is substituted for the T at position 137, thus correcting a frameshift mutation and restoring the reading frame of the hygromycin-eGFP fusion gene.

[0085] We synthesize the set of three yeast expression constructs pAURHYG(rep)eGFP, pAURHYG(Δ)eGFP, pAURHYG(ins)eGFP, that contain a point mutation at nucleotide 137 of the hygromycin-B coding sequence as follows. (rep) indicates a T137→G replacement, (Δ) represents a deletion of the G137 and (ins) represents an A insertion between nucleotides 136 and 137. We construct this set of plasmids by excising the respective expression cassettes by restriction digest from pHyg(x)EGFP and ligation into pAUR123 (Panvera, Calif.). We digest 10 μg pAUR123 vector DNA, as well as, 10 μg of each pHyg(x)EGFP construct with KpnI and SaII (NEB). We gel purify each of the DNA fragments and prepare them for enzymatic ligation. We ligate each mutated insert into pHygEGFP vector at 3:1 molar ratio using T4 DNA ligase (Roche). We screen clones by restriction digest, confirm by Sanger dideoxy chain termination sequencing and purify using a Qiagen maxiprep kit.

[0086] We use this system to assay the ability of five oligonucleotides (shown in FIG. 8) to support correction under a variety of conditions. The oligonucleotides which direct correction of the mutation in pAURHYG(rep)GFP can also direct correction of the mutation in pAURHYG(ins)GFP. Three of the four oligonucleotides (HygE3T/25, HygE3T/74 and HygGG/Rev) share the same 25-base sequence surrounding the base targeted for alteration. HygGG/Rev is an RNA-DNA chimeric double hairpin oligonucleotide of the type described in the prior art. One of these oligonucleotides, HygE3T/74, is a 74-base oligonucleotide with the 25-base sequence centrally positioned. The fourth oligonucleotide, designated HygE3T/74α, is the reverse complement of HygE3T/74. The fifth oligonucleotide, designated Kan70T, is a non-specific, control oligonucleotide which is not complementary to the target sequence. Alternatively, an oligonucleotide of identical sequence but lacking a mismatch to the target or a completely thioate modified oligonucleotide or a completely 2-O-methylated modified oligonucleotide may be used as a control. Alternatively, oligonucleotides containing one, two, three, four, five, six, eight, ten or more LNA modifications on at least one of the two termini (and preferrably the 3′ terminus) may be used in different embodiments.

[0087] Oligonucleotide synthesis and cells. We synthesized and purified the chimeric, double-hairpin oligonucleotides and single-stranded oligonucleotides (including those with the indicated modifications) as described in Example 1. Plasmids used for assay were maintained stably in yeast (Saccharomyces cerevisiae) strain LSY678 MAT α at low copy number under aureobasidin selection. Plasmids and oligonucleotides are introduced into yeast cells by electroporation as follows: to prepare electrocompetent yeast cells, we inoculate 10 ml of YPD media from a single colony and grow the cultures overnight with shaking at 300 rpm at 30° C. We then add 30 ml of fresh YPD media to the overnight cultures and continue shaking at 30° C. until the OD600 was between 0.5 and 1.0 (3-5 hours). We then wash the cells by centrifuging at 4° C. at 3000 rpm for 5 minutes and twice resuspending the cells in 25 ml ice-cold distilled water. We then centrifuge at 4° C. at 3000 rpm for 5 minutes and resuspend in 1 ml ice-cold 1M sorbitol and then finally centrifuge the cells at 4° C. at 5000 rpm for 5 minutes and resuspend the cells in 120 μl 1M sorbitol. To transform electrocompetent cells with plasmids or oligonucleotides, we mix 40 μl of cells with 5 μg of nucleic acid, unless otherwise stated, and incubate on ice for 5 minutes. We then transfer the mixture to a 0.2 cm electroporation cuvette and electroporate with a BIO-RAD Gene Pulser apparatus at 1.5 kV, 25 μF, 200 Ω for one five-second pulse. We then immediately resuspend the cells in 1 ml YPD supplemented with 1M sorbitol and incubate the cultures at 30° C. with shaking at 300 rpm for 6 hours. We then spread 200 μl of this culture on selective plates containing 300 μg/ml hygromycin and spread 200 μl of a 105 dilution of this culture on selective plates containing 500 ng/ml aureobasidinA and/or and incubate at 30° C. for 3 days to allow individual yeast colonies to grow. We then count the colonies on the plates and calculate the gene conversion efficiency by determining the number of hygromycin resistance colonies per 105 aureobasidinA resistant colonies.

[0088] Frameshift mutations are repaired in yeast cells. We test the ability of the oligonucleotides shown in FIG. 8 to correct a frameshift mutation in vivo using LSY678 yeast cells containing the plasmid pAURHYG(ins)GFP. These experiments, presented in Table 6, indicate that these oligonucleotides can support gene correction in yeast cells. These data reinforce the results described in Example 1 indicating that oligonucleotides comprising phosphorothioate linkages facilitate gene correction much more efficiently than control duplex, chimeric RNA-DNA oligonucleotides. This gene correction activity is also specific as transformation of cells with the control oligonucleotide Kan70T produced no hygromycin resistant colonies above background and thus Kan70T did not support gene correction in this system. In addition, we observe that the 74-base oligonucleotide (HygE3T/74) corrects the mutation in pAURHYG(ins)GFP approximately five-fold more efficiently than the 25-base oligonucleotide (HygE3T/25). We also perform control experiments with LSY678 yeast cells containing the plasmid pAURHYG(wt)GFP. With this strain we observed that even without added oligonucleotides, there are too many hygromycin resistant colonies to count.

[0089] We also use additional oligonucleotides to assay the ability of individual oligonucleotides to correct multiple mutations in the pAURHYG(x)eGFP plasmid. These include, for example, one that alters two basepairs that are 3 nucleotides apart is a 74-mer with the sequence 5′-CTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGGTACGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTAC-3′ (SEQ ID NO: 2714); a 74-mer that alters two basepairs that are 15 nucleotides apart with the sequence 5′-CTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATACGTCCTGCGGGTAAACAGCTGCGCCGATGGTTTCTAC-3′ (SEQ ID NO: 2715); and a 74-mer that alters two basepairs that are 27 nucleotides apart with the sequence 5′-CTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATACGTCCTGCGGGTAAATAGCTGCGCCGACGGTTTCTAC (SEQ ID NO: 2716). The nucleotides in these oligonucleotides that direct alteration of the target sequence are underlined and in boldface. These oligonucleotides are modified in the same ways as the other oligonucleotides of the invention.

[0090] Oligonucleotides targeting the sense strand direct gene correction more efficiently. We compare the ability of single-stranded oligonucleotides to target each of the two strands of the target sequence of both pAURHYG(ins)GFP and pAURHYG(rep)GFP. These experiments, presented in Tables 7 and 8, indicate that an oligonucleotide, HygE3T/74α, with sequence complementary to the sense strand (i.e. the strand of the target sequence that is identical to the mRNA) of the target sequence facilitates gene correction approximately ten-fold more efficiently than an oligonucleotide, HygE3T/74, with sequence complementary to the non-transcribed strand which serves as the template for the synthesis of RNA. As indicated in Table 7, this effect was observed over a range of oligonucleotide concentrations from 0-3.6 μg, although we did observe some variability in the difference between the two oligonucleotides (indicated in Table 7 as a fold difference between HygE3T/74α and HygE3T/74). Furthermore, as shown in Table 8, we observe increased efficiency of correction by HygE3T/74α relative to HygE3T/74 regardless of whether the oligonucleotides were used to correct the base substitution mutation in pAURHYG(rep)GFP or the insertion mutation in pAURHYG(ins)GFP. The data presented in Table 8 further indicate that the single-stranded oligonucleotides correct a base substitution mutation more efficiently than an insertion mutation. However, this last effect was much less pronounced and the oligonucleotides of the invention are clearly able efficiently to correct both types of mutations in yeast cells. In addition, the role of transcription is investigated using plasmids with inducible promoters such as that described in FIG. 10.

[0091] Optimization of oligonucleotide concentration. To determine the optimal concentration of oligonucleotide for the purpose of gene alteration, we test the ability of increasing concentrations of Hyg3T/74α to correct the mutation in pAURHYG(rep)GFP contained in yeast LSY678. We chose this assay system because our previous experiments indicated that it supports the highest level of correction. However, this same approach could be used to determine the optimal concentration of any given oligonucleotide. We test the ability of Hyg3T/74α to correct the mutation in pAURHYG(rep)GFP contained in yeast LSY678 over a range of oligonucleotide concentrations from 0-10.0 μg. As shown in Table 9, we observe that the correction efficiency initially increases with increasing oligonucleotide concentration, but then declines at the highest concentration tested.

[0092] Tables are attached hereto. 8

TABLE 6
Correction of an insertion mutation in pAURHYG(ins)GFP by
HygGG/Rev, HygE3T/25 and HygE3T/74
Colonies onColonies onCorrection
Oligonucleotide TestedHygromycinAureobasidin (/105)Efficiency
HygGG/Rev31570.02
HygE3T/25641470.44
HygE3T/742801741.61
Kan70T0

[0093] 9

TABLE 7
An oligonucleotide targeting the sense strand of the target sequence
corrects more efficiently.
Colonies per
hygromycin plate
Amount of Oligonucleotide (μg)HygE3T/74HygE3T/74α
000
0.624128 (8.4x)*
1.269140 (7.5x)*
2.462167 (3.8x)*
3.629367 (15x)* 
*The numbers in parentheses represent the fold increase in efficiency for targeting the non-transcribed strand as compared to the other strand of a DNA duplex that encodes a protein.

[0094] 10

TABLE 8
Correction of a base substitution mutation is more efficient than correction
of a frame shift mutation.
OligonucleotidePlasmid tested (contained in LSY678)
Tested (5 μg)pAURHYG(ins)GFPpAURHYG(rep)GFP
HygE3T/7472277
HygE3T/74α14642248
Kan70T00

[0095] 11

TABLE 9
Optimization of oligonucleotide concentration in electroporated yeast cells.
Colonies onColonies onCorrection
Amount (μg)hygromycinaureobasidin (/105)efficiency
00670
1.05640.08
2.547301.57
5.0199336.08
7.5383399.79
10.0191335.79

EXAMPLE 3

Cultured Cell Manipulation

[0096] Although disclosure in this example is directed to use of stem cells or human blood cells and microinjection, the microinjection procedures may also be used with cultured plant cells or protoplasts using any plant species, including those disclosed herein. Mononuclear cells are isolated from human umbilical cord blood of normal donors using Ficoll Hypaque (Pharmacia Biotech, Uppsala, Sweden) density centrifugation. CD34+ cells are immunomagnetically purified from mononuclear cells using either the progenitor or Multisort Kits (Miltenyi Biotec, Auburn, Calif.). LinCD38 cells are purified from the mononuclear cells using negative selection with StemSep system according to the manufacturer's protocol (Stem Cell Technologies, Vancouver, Calif.). Cells used for microinjection are either freshly isolated or cryopreserved and cultured in Stem Medium (S Medium) for 2 to 5 days prior to microinjection. S Medium contains Iscoves' Modified Dulbecc's Medium without phenol red (IMDM) with 100 μg/ml glutamine/penicillin/streptomycin, 50 mg/ml bovine serum albumin, 50 μg/ml bovine pancreatic insulin, 1 mg/ml human transferrin, and IMDM; Stem Cell Technologies), 40 μg/ml low-density lipoprotein (LDL; Sigma, St. Louis, Mo.), 50 mM HEPEs buffer and 50 μM 2-mercaptoethanol, 20 ng/ml each of thrombopoietin, flt-3 ligand, stem cell factor and human IL-6 (Pepro Tech Inc., Rocky Hill, N.J.). After microinjection, cells are detached and transferred in bulk into wells of 48 well plates for culturing.

[0097] 35 mm dishes are coated overnight at 4° C. with 50 μg/ml Fibronectin (FN) fragment CH-296 (Retronectin; TaKaRa Biomedicals, Panvera, Madison, Wis.) in phosphate buffered saline and washed with IMDM containing glutamine/penicillin/streptomycin. 300 to 2000 cells are added to cloning rings and attached to the plates for 45 minutes at 37° C. prior to microinjection. After incubation, cloning rings are removed and 2 ml of S Medium are added to each dish for microinjection. Pulled injection needles with a range of 0.22 μm to 0.3 μm outer tip diameter are used. Cells are visualized with a microscope equipped with a temperature controlled stage set at 37° C. and injected using an electronically interfaced Eppendorf Micromanipulator and Transjector. Successfully injected cells are intact, alive and remain attached to the plate post injection. Molecules that are flourescently labeled allow determination of the amount of oligonucleotide delivered to the cells.

[0098] For in vitro erythropoiesis from LinCD38 cells, the procedure of Malik, 1998 can be used. Cells are cultured in ME Medium for 4 days and then cultured in E Medium for 3 weeks. Erythropoiesis is evident by glycophorin A expression as well as the presence of red color representing the presence of hemoglobin in the cultured cells. The injected cells are able to retain their proliferative capacity and the ability to generate myeloid and erythoid progeny. CD34+ cells can convert a normal A (βA) to sickle T (βS) mutation in the β-globin gene or can be altered using any of the oligonucleotides of the invention herein for correction or alteration of a normal gene to a mutant gene. Alternatively, stem cells can be isolated from blood of humans having genetic disease mutations and the oligonucleotides of the invention can be used to correct a defect or to modify genomes within those cells.

[0099] Alternatively, non-stem cell populations of cultured cells can be manipulated using any method known to those of skill in the art including, for example, the use of polycations, cationic lipids, liposomes, polyethylenimine (PEI), electroporation, biolistics, calcium phosphate precipitation, or any other method known in the art.

[0100] Biolistic delivery of oligonucleotide into plant cells may be accomplished according to the following method. One milliliter of packed cell volume of plant cell suspensions are subcultured onto plates containing solid medium [with Murashige and Skoog salts from Gibco/BRL, 500 mg/liter Mes, 1 mg/liter thiamin, 100 mg/liter myo-inositol, 180 mg/liter KH2PO4, 2.21 mg/liter 2,4-dichlorophenoxyacetic acid (2,4-D), and 30 g/liter sucrose (pH 5.7) and having 8 g/liter agar-agar from Sigma added before autoclaving]. By using a helium-driven particle gun such as that from BioRad and following manufacturers directions, oligonucleotides may be introduced to cells after precipitation onto 1 micrometer or comparable gold microcarriers (Bio-Rad). To precipitate onto microcarriers, 35 microliters of a particle suspension (60 mg of microcarriers per ml of 100% ethanol) is transferred to a 1.5 ml microcentrifuge tube, which is agitated on a vortex mixer. Then 40 microliter of resuspended oligonucleotide (60 ng/microliter water) is added; then 75 microliter of ice-cold 2.5 M CaCl2 is added; then 75 microliter of ice-cold 0.1 M spermidine is added. The tube is mixed vigorously or a vortex mixer for 10 min at room temperature. The particles are allowed to settle for 10 min and are centrifuged at 11,750 g for 30 sec. The supernatant is removed and the particles are resuspended in 50 microliter of 100% ethanol. An aliquot of 10 microliter of the resuspended particles are applied to each macro-projectile which is used to bombard each plate once at 900 psi (1 psi=6.89 kPa) with a gap distance (distance from power source to macroprojectile) of 1 cm and a target distance (distance from microprojectile launch site to target material) of 10 cm.

[0101] An alternative method of delivery can be used as follows. Cultured cells are suspended in liquid N6 medium and then plated on a VWR Scientific glass fiber filter. About 0.4 microgram of oligonucleotide are precipitated with 15 microliter of 2.5 mM CaCl2 and 5 microliter of 0.1 M spermidine onto 25 microgram of 1.0 micrometer gold particles. Microprojectile bombardment is performed by using a Bio-Rad PDS-1000 He particle delivery system or comparable machine following manufacturers instructions. Alterations in oligonucleotide concentrations can be employed to determine the optimum concentration of oligonucleotide according to the procedures described herein for any particular oligonucleotide of the invention.

[0102] Alternatively, the oligonucleotide of the invention may be delivered to a plant cell by electroporation of a protoplast derived from a plant part. The protoplasts may be formed by enzymatic treatment of a plant part, particularly a leaf, according to techniques such as those in Gallois et al., Methods in Molecular Biology 55: 89-107 by Humana Press. Such conditions for electroporation use about 3×105 protoplasts in a total volume of about 0.3 ml with a concentration of oligonucleotide of between 0.6 to 4 microgram per ml.

EXAMPLE 4

Plant Cells

[0103] The oligonucleotides of the invention can also be used to repair or direct a mutagenic event in plants and animal cells. Although little information is available on plant mutations amongst natural cultivars, the oligonucleotides of the invention can be used to produce “knock out” mutations by modification of specific amino acid codons to produce stop codons (e.g., a CAA codon specifying Gln can be modified at a specific site to TAA; a AAG codon specifying Lys can be modified to UAG at a specific site; and a CGA codon for Arg can be modified to a UGA codon at a specific site). Such base pair changes will terminate the reading frame and produce a defective truncated protein, shortened at the site of the stop codon.

[0104] Alternatively, frameshift additions or deletions can be directed into the genome at a specific sequence to interrupt the reading frame and produce a garbled downstream protein. Such stop or frameshift mutations can be introduced to determine the effect of knocking out the protein in either plant or animal cells.

[0105] For introduction of a T-DNA, including the T-DNA in the plasmid of FIG. 11, into a plant cell, Agrobacterium tumefaciens is used. These techniques are routine standard techniques known in the art. For example, one method follows. We transform A. tumefaciens is transformed by electroporation (using a BioRad Gene Pulser™). Competent A. tumefaciens is prepared using a method similar to that of preparing competent E. coli by suspending a freshly grown culture three times in ice-cold water and a final resuspension in 10% glycerol. Electroporation conditions are a 0.2 cm gap cuvette at a setting of 25 μF,200 Ω and2.5 kV.

[0106] A. tumefaciens containing a plasmid with a T-DNA is then used to introduce the T-DNA into a plant cell using routine standard techniques known in the art. For example, we transform Arabidopsis by vacuum infiltration or by dipping flowers in an Agrobacterium solution containing a surfactant, e.g. L-77. Seeds are then collected, grown and screened for presence of the T-DNA. Alternatively, Agrobacterium can be used to transform callus tissue and the callus tissue can then be used to regenerate transformed plants.

[0107] All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

[0108] Notes on the Tables Presented Below:

[0109] Each of the following tables presents, for the specified gene, a plurality of mutations that are known to confer a relevant phenotype and, for each mutation, the oligonucleotides that can be used to correct the respective mutation site-specifically in the genome according to the present invention.

[0110] The left-most column identifies each alteration or mutation and the phenotype that the alteration/mutation confers.

[0111] For most entries, the mutation/alteration is identified at both the nucleic acid and protein level. At the amino acid level, mutations are presented according to the following standard nomenclature. The centered number identifies the position of the mutated codon in the protein sequence; to the left of the number is the wild type residue and to the right of the number is the mutant codon. Terminator codons are shown as “TERM”. At the nucleic acid level, the entire triplet of the wild type and mutated codons is shown.

[0112] The middle column presents, for each mutation, four oligonucleotides capable of repairing the mutation site-specifically in the genome or in cloned DNA including DNA in artificial chromosomes, episomes, plasmids, or other types of vectors. The oligonucleotides of the invention, however, may include any of the oligonucleotides sharing portions of the sequence of the 121 base sequence. Thus, oligonucleotides of the invention for each of the depicted targets may be 18, 19, 20 up to about 121 nucleotides in length. Sequence may be added non-symmetrically.

[0113] All oligonucleotides are presented, per convention, in the 5′ to 3′ orientation. The nucleotide that effects the change in the genome is underlined and presented in bold.

[0114] The first of the four oligonucleotides for each mutation is a 121 nt oligonucleotide centered about the repair/altering nucleotide. The second oligonucleotide, its reverse complement, targets the opposite strand of the DNA duplex for repair/alteration. The third oligonucleotide is the minimal 17 nt domain of the first oligonucleotide, also centered about the repair/alteration nucleotide. The fourth oligonucleotide is the reverse complement of the third, and thus represents the minimal 17 nt domain of the second.

[0115] The third column of each table presents the SEQ ID NO: of the respective repair oligonucleotide.

EXAMPLE 5

Engineering Herbicide Resistant Plants

[0116] Chemical weed control is an important tool of modern agriculture and many herbicides have been developed for this purpose. Their use has resulted in substantial increases in the yields of many crops, including, for example, maize, soybeans, and cotton. Thus while the use of fertilizers and new high-yielding crop varieties have contributed greatly to the “green revolution,” chemical weed control has also been at the forefront of technological achievement.

[0117] Herbicides having broad-spectrum activity are particularly useful because they obviate the need for multiple herbicides targeting different classes of weeds. The problem with such herbicides is that they typically also affect crops which are exposed to the herbicide. One way to overcome this is to generate plants which are resistant to one or more broad-spectrum herbicides. Such herbicide-tolerant plants may reduce the need for tillage to control weeds, thereby effectively reducing soil erosion and can reduce the quantity and number of different herbicides applied in the field.

[0118] Common herbicides used, for example, include those that inhibit the enzyme 5-enolpyruvyl-3-phosphoshikimic acid synthase (EPSPS), for example N-phosphonomethyl-glycine (e.g. glyphosate), those that inhibit acetolactate synthase (ALS) activity, for example the sulfonylureas and related herbicides, and those that inhibit dihydropteroate synthase, for example methyl[(4-amino-phenyl)sulfonyl]carbamate (e.g. Asulam). Herbicide-tolerant plants can be produced by several methods, including, for example, introducing into the genome of the plant the ability to degrade the herbicide, the capacity to produce a higher level of the targeted enzyme, and/or expressing an herbicide-tolerant allele of the enzyme.

[0119] The attached tables disclose exemplary oligonucleotides base sequences which can be used to generate site-specific mutations in plant genes that confer herbicide resistance. 12

TABLE 10
Genome-Altering Oligos Conferring Glyphosate Resistance
Phenotype, Gene,
Plant & TargetedSEQ ID
AlterationAltering OligosNO:
Glyphosate ResistanceAAGCGTCGGAGATTGTACTTCAACCCATTTAGAGAAATCTCCGGTC1
EPSPSTTATTAAGCTTCCTGCCTCCAAGTCTCTATCAAATCGGATCCTGC
Arabidopsis thalianaTTCTCGCTGCTCTGTCTGAGGTATATATCAC
Gly97AlaGTGATATATACCTCAGACAGAGCAGCGAGAAGCAGGATCCGATT2
GGC-GCCTGATAGAGACTTGGAGGCAGGAAGCTTAATAAGACCGGAGATTT
CTCTAATGGGTTGAAGTACAATCTCCGACGCTT
GCTTCCTGCCTCCAAGT3
ACTTGGAGGCAGGAAGC4
Glyphosate ResistanceAAGCTTCAGAGATTGTGCTTCAACCAATCAGAGAAATCTCGGGTC5
EPSPSTCATTAAGCTACCCGCATCCAAATCTCTCTCCAATCGGATCCTCC
Brassica napusTTCTTGCCGCTCTATCTGAGGTACATATACT
Gly93AIaAGTATATGTACCTCAGATAGAGCGGCAAGAAGGAGGATCCGATT6
GGA-GCAGGAGAGAGATTTGGATGCGGGTAGCTTAATGAGACCCGAGATTT
CTCTGATTGGTTGAAGCACAATCTCTGAAGCTT
GCTACCCGCATCCAAAT7
ATTIGGATGCGGGTAGC8
Glyphosate ResistanceAGCCCAACGAGATTGTGCTGCAACCCATCAAAGATATATCAGGC9
EPSPS 1ACTGTTAAATTGCCTGCTTCTAAATCCCTTTCCAATCGTATTCTCC
Nicotiana tabacumTTCTTGCTGCCCTTTCTAAGGGAAGGACTGT
Gly95AlaACAGTCCTTCCCTTAGAAAGGGCAGCAAGAAGGAGAATACGATT10
GGT-GCTGGAAAGGGATTTAGAAGCAGGCAATTTAACAGTGCCTGATATATC
TTTGATGGGTTGCAGCACAATCTCGTIGGGCT
ATTGCCTGCTTCTAAAT11
ATTTAGAAGCAGGCAAT12
Glyphosate ResistanceATTGTTTCCTTGGTACGAAATGTCCTCCTGTTCGAATTGTCAGCA13
EPSPS 2AGGGAGGCCTTCCCGCAGGGAAGGTAAAGCTCTCTGGATCAATT
Nicotiana tabacumAGCAGCCAGTACTTGACTGCTCTGCTTATGGC
Gly62AlaGCCATAAGCAGAGCAGTCAAGTACTGGCTGCTAATTGATCCAGA14
GGA-GCAGAGCTTTACCTTCCCTGCGGGAAGGCCTCCCTTGCTGACAATTC
GAACAGGAGGACATTTCGTACCAAGGAAACAAT
CCTTCCCGCAGGGAAGG15
CCTTCCCGCGGGAAGG16
Glyphosate ResistanceATTGTTTCCTTGGCACTGACTGGCCACCTGTTCGTGTCAATGGAA17
EPSPSTCGGAGGGCTACCTGCTGGCAAGGTCAAGCTGTCTGGCTCCATC
Zea maysAGCAGTCAGTACTTGAGTGCCTTGCTGATGGC
Gly168AlaGCCATCAGCAAGGCACTCAAGTACTGACTGCTGATGGAGCCAGA18
GGT-GCTCAGCTTGACCTTGCCAGCAGGTAGCCCTCCGATTCCATTGACAC
GAACAGGTGGGCAGTCAGTGCCAAGGAAACAAT
GCTACCTGCTGGCAAGG19
CCTTGCCAGCAGGTAGC20
Glyphosate ResistanceACTGTTTCCTTGGCACTGAATGCCCACCTGTTCGTGTCAAGGGA21
EPSPSATTGGAGGACTTCCTGCTGGCAAGGTTAAGCTCTCTGGTTCCAT
Cryza sativaCAGCAGTCAGTACTTGAGTGCCTTGCTGATGGC
Gly115AlaGCCATCAGCAAGGCACTCAAGTACTGACTGCTGATGGAACCAGA22
GGT-GCTGAGCTTAACCTTGCCAGCAGGAAGTCCTCCAATTCCCTTGACAC
GAACAGGTGGGCATTCAGTGCCAAGGAAACAGT
ACTTCCTGCTGGCAAGG23
CCTTGCCAGCAGGAAGT24
Glyphosate ResistanceAGCCTTCTGAGATAGTGTTGCAACCCATTAAAGAGATTTCAGGCA25
EPSPSCTGTTAAATTGCCTGCCTCTAAATCATTATCTAATAGAATTCTCCT
Petunia x hybridaTCTTGCTGCCTTATCTGAAGGMCAACTGT
Gly93AlaACAGTTGTTCCTTCAGATAAGGCAGCAAGAAGGAGAATTCTATTA26
GGC-GCCGATAATGATTTAGAGGCAGGCAATTTAACAGTGCCTGAAATCTCT
TTAATGGGTTGCAACACTATCTCAGAAGGCT
ATTGCCTGCCTCTAAAT27
ATTTAGAGGCAGGCAAT28
Glyphosate ResistanceAACCCCATGAGATTGTGCTAGNACCCATCAAAGATATATCTGGTA29
EPSPSCTGTTAAATTACCCGCTTCGAAATCCCTTTCCAATCGTATTCTCCT
LycopersiconTCTTGCTGCCCTTTCTGAGGGAAGGACTGT
esculentumACAGTCCTTCCCTCAGAAAGGGCAGCAAGAAGGAGAATACGATT30
Gly97AlaGGAAAGGGATTTCGAAGCGGGTAATTTAACAGTACCAGATATATC
GGT-GCTTTTGATGGGTNCTAGCACAATCTGATGGGGTT
ATTACCCGCTTCGAAAT31
ATTTCGAAGCGGGTAAT32
Glyphosate ResistanceATTGTTTCCTTGGCACTGACTGCCCACCTGTTCGKATCAACGGGA33
EPSPSTTGGAGGGCTACCTGCTGGCAAGGTTAAGCTGTCTGGTTCCAIT
Lolium rigidumAGCAGCCAATACTTGAGTTCCTTGCTGATGGC
Gly107AlaGCCATCAGCAAGGAACTCAAGTATTGGCTGCTGATGGAACCAGA34
GGT-GCTCAGCTTAACCTTGCCAGCAGGTAGCCCTCCAATGCCGTTGATCG
AACAGGTGGGCAGTCAGTGCCAAGGAAACAAT
GCTACCTGCTGGCAAGG35
CCTTGCCAGCAGGTAGC36

[0120] 13

TABLE 11
Genome-Altering Oligos Conferring Imidazolinone
and Sulfonylurea Herbicide Resistance
Phenotype, Gene,
Plant & TargetedSEQ ID
AlterationAltering OligosNO:
SulfonylureaAGCGGATTAGCCGATGCGTTGTTAGATAGTGTTCCTCTTGTAGCA37
ResistanceATCACAGGACAAGTCTCTCGTCGTATGATTGGTACAGATGCGTTT
ALSCAAGAGACTCCGATTGTTGAGGTAACGCGTT
Arabidopsis thalianaAACGCGTTACCTCAACAATCGGAGTCTCTTGAAACGCATCTGTAC38
Pro197SerCAATCATACGACGAGAGACTTGTCCTGTGATTGCTACAAGAGGAA
CCT-TCTCACTATCTAACAACGCATCGGCTAATCCGCT
GACAAGTCTCTCGTCGT39
ACGACGAGAGACTTGTC40
SulfonylureaAGCGGATTAGCCGATGCGTTGTTAGATAGTGTTCCTCTTGTAGCA41
ResistanceATCACAGGACAAGTCCAGCGTCGTATGATTGGTACAGATGCGTTT
ALSCAAGAGACTCCGATTGTTGAGGTAACGCGTT
Arabidopsis thalianaAACGCGTTACCTCAACAATCGGAGTCTCTTGAAACGCATCTGTAC42
Pro197GLNCAATCATACGACGCTGGACTTGTCCTGTGATTGCTACAAGAGGAA
CCT-CAGCACTATCTAACAACGCATCGGCTAATCCGCT
ACAAGTCCAGCGTCGTC43
TACGACGCTGGACTTGT44
SulfonylureaAGCGGATTAGCCGATGCGTTGTTAGATAGTGTTCCTCTTGTAGCA45
ResistanceATCACAGGACAAGTCCAACGTCGTATGATTGGTACAGATGCGTTT
ALSCAAGAGACTCCGATTGTTGAGGTAACGCGTT
Arabidopsis thalianaAACGCGTTACCTCAACAATCGGAGTCTCTTGAAACGCATCTGTAC46
Pro197GLNCAATCATACGACGTTGGACTTGTCCTGTGATTGCTACAAGAGGAA
CCT-CAACACTATCTAACAACGCATCGGCTAATCCGCT
ACAAGTCCAACGTCGTA47
TACGACGTTGGACTTGT48
ImidazolinoneGACCTTACCTGTTGGATGTGATTTGTCCGCACCAAGAACATGTGT49
ResistanceTGCCGATGATCCCGAACGGTGGCACTTTCAACGATGTCATAACGG
ALSAAGGAGATGGCCGGATTAAATACTGAGAGAT
Arabidopsis thalianaATCTCTCAGTATTTAATCCGGCCATCTCCTTCCGTTATGACATCGT50
Ser653AsnTGAAAGTGCCACCGTTCGGGATCATCGGCAACACATGTTCTTGGT
AGT-AACGCGGACAAATCACATCCAACAGGTAAGGTC
GATCCCGAACGGTGGCA51
TGCCACCGTTCGGGATC52
ImidazolinoneGACCTTACCTGTTGGATGTGATTTGTCCGCACCAAGAACATGTGT53
ResistanceTGCCGATGATCCCGAATGGTGGCACTTTCAACGATGTCATAACGG
ALSAAGGAGATGGCCGGATTAAATACTGAGAGAT
Arabidopsis thalianaATCTCTCAGTATTTAATCCGGCCATCTCCTTCCGTTATGACATCGT54
Ser653AsnTGAAAGTGCCACCATTCGGGATCATCGGCAACACATGTTCTTGGT
AGT-AATGCGGACAAATCACATCCAACAGGTAAGGTC
GATCCCGAATGGTGGCA55
TGCCACCATTCGGGATC56
SulfonylureaTCCGCGCTCGCCGACGCGCTGCTCGACTCCGTCCCGATGGTCGC57
ResistanceCATCACGGGCCAGGTCTCCCGCCGCATGATCGGCACCGACGCCT
ALSTCCAGGAGACGCCCATAGTCGAGGTCACCCGCT
Oryza salivaAGCGGGTGACCTCGACTATGGGCGTCTCCTGGAAGGCGTCGGTG58
Pro171SerCCGATCATGCGGCGGGAGACCTGGCCCGTGATGGCGACCATCG
CCC-TCCGGACGGAGTCGAGCAGCGCGTCGGCGAGCGCGGA
GCCAGGTCTCCCGCCGC59
GCGGCGGGAGACCTGGC60
SulfonylureaCCGCGCTCGCCGACGCGCTGCTCGACTCCGTCCCGATGGTCGCC61
ResistanceATCACGGGCCAGGTCCAACGCCGCATGATCGGCACCGACGCCTT
ALSCCAGGAGACGCCCATAGTCGAGGTCACCCGCTC
Oryza salivaGAGCGGGTGACCTCGACTATGGGCGTCTCCTGGAAGGCGTCGGT 62
Pro171GlnGCCGATCATGCGGCGTTGGACCTGGCCCGTGATGGCGACCATCG
CCC-CAAGGACGGAGTCGAGCAGCGCGTCGGCGAGCGCGG
CCAGGTCCAACGCCGCA63
TGCGGCGTTGGACCTGG64
SulfonylureaCCGCGCTCGCCGACGCGCTGCTCGACTCCGTCCCGATGGTCGCC65
ResistanceATCACGGGCCAGGTCCAGCGCCGCATGATCGGCACCGACGCCTT
ALSCCAGGAGACGCCCATAGTCGAGGTCACCCGCTC
Oryza salivaGAGCGGGTGACCTCGACTATGGGCGTCTCCTGGAAGGCGTCGGT66
Pro171GlnGCCGATCATGCGGCGCTGGACCTGGCCCGTGATGGCGACCATCG
CCC-CAGGGACGGAGTCGAGCAGCGCGTCGGCGAGCGCGG
CCAGGTCCAGCGCCGCA67
TGCGGCGCTGGACCTGG68
ImidazolinoneGGCCATACTTGTTGGATATCATCGTCCCGCACCAGGAGCATGTGC69
ResistanceTGCCTATGATCCCAAATGGGGGCGCATTCAAGGACATGATCCTGG
ALSATGGTGATGGCAGGACTGTGTATTAATCTAT
Oryza salivaATAGATTAATACACAGTCCTGCGATCACCATCCAGGATCATGTCCT70
Ilee627AsnTGAATGCGCCCCCATTTGGGATCATAGGCAGCACATGCTCCTGGT
ATT-AATGCGGGACGATGATATCCAACAAGTATGGCC
GATCCCAAATGGGGGCG71
CGCCCCCATTTGGGATC72
SulfonylureaTCCGCGCTCGCCGACGCGCTGCTCGATTCCGTCCCCATGGTCGC73
ResistanceCATCACGGGACAGGTGTCGCGACGCATGATTGGCACCGACGCCT
ALSTCCAGGAGACGCCCATCGTCGAGGTCACCCGCT
Zea maysAGCGGGTGACCTCGACGATGGGCGTCTCCTGGAAGGCGTCGGT74
Pro165SerGCCAATCATGCGTCGCGACACCTGTCCCGTGATGGCGACCATGG
CCG-TCGGGACGGAATCGAGCAGCGCGTCGGCGAGCGCGGA
GACAGGTGTCGCGACGC75
GCGTCGCGACACCTGTC76
SulfonylureaCCGCGCTCGCCGACGCGCTGCTCGATTCCGTCCCCATGGTCGCC77
ResistanceATCACGGGACAGGTGCAGCGACGCATGATTGGCACCGACGCCTT
ALSCCAGGAGACGCCCATCGTCGAGGTCACCCGCTC
Zea maysGAGCGGGTGACCTCGACGATGGGCGTCTCCTGGAAGGCGTCGG78
Pro165GlnTGCCAATCATGCGTCGCTGCACCTGTCCCGTGATGGCGACCATG
CCG-CAGGGGACGGAATCGAGCAGCGCGTCGGCGAGCGCGG
ACAGGTGCAGCGACGCA79
TGCGTCGCTGCACCTGT80
ImidazolinoneGGCCGTACCTCTTGGATATAATCGTCCCACACCAGGAGCATGTGT81
ResistanceTGCCTATGATCCCTAATGGTGGGGCTTTCAAGGATATGATCCTGG
ALSATGGTGATGGCAGGACTGTGTACTGATCTAA
Zea maysTTAGATCAGTACACAGTCCTGCCATCACCATCCAGGATCATATCCT82
Ser621AsnTGAAAGCCCCACCATTAGGGATCATAGGCAACACATGCTCCTGGT
AGT-AATGTGGGACGATTATATCCAAGAGGTACGGCC
GATCCCTAATGGTGGGG83
CCCCACCATTAGGGATC84
ImidazolinoneGGCCGTACCTCTTGGATATAATCGTCCCACACCAGGAGCATGTGT85
ResistanceTGCCTATGATCCCTAACGGTGGGGCTTTCAAGGATATGATCCTGG
ALSATGGTGATGGCAGGACTGTGTACTGATCTAA
Zea maysTTAGATCAGTACACAGTCCTGCCATCACCATCCAGGATCATATCCT86
Ser621AsnTGAAAGCCCCACCGTTAGGGATCATAGGCAACACATGCTCCTGGT
AGT-AACGTGGGACGATTATATCCAAGAGGTACGGCC
GATCCCTAACGGTGGGG87
CCCCACCGTTAGGGATC88
SulfonylureaTCCGCGCTCGCCGACGCCGTCCTCGACTCCATCCCCATGGTGGC89
ResistanceCATCACGGGGCAGGTCTCGCGCCGCATGATCGGCACGGACGCCT
ALSTCCAGGAGACGCCCATCGTCGAGGTCACCCGCT
Lolium multiflorumAGCGGGTGACCTCGACGATGGGCGTCTCCTGGAAGGCGTCCGTG90
Pro167SerCCGATCATGCGGCGCGAGACCTGCCCCGTGATGGCCACCATGG
CCG-TCCGGATGGAGTVGAGGAGGGCCTCGGCGACCCCCCA
GGCAGGTCTCGCGCCGC91
GCGGCGCGAGACCTGCC92
SulfonylureaCCGCGCTCGCCGACGCCCTCCTCGACTCCATCCCCATGGTGGCC93
ResistanceATCACGGGGCAGGTCCAGCGCCGCATGATCGGCACGGACGCCTT
ALSCCAGGAGACGCCCATCGTCGAGGTCACCCGCTC
Lolium multiflorumGAGCGGGTGACCTCGACGATGGGCGTCTCCTGGAAGGCGTCCGT94
Pro167GlnGCCGATCATGCGGCGCTGGACCTGCCCCGTGATGGCCACCATGG
CCG-CAGGGATGGAGTCGAGGAGGGCGTCGGCGAGCGCGG
GCAGGTCCAGCGCCGCA95
TGCGGCGCTGGACCTGC96
ImidazolinoneCTGGGCCATACTTGTTGGATATCATCGTCCCTCACCAGGAGCATG97
ResistanceTGCTGCCTATGATCCCTAACGGTGGTGCTTTCAAGGACATTATCA
ALSTGGAAGGTGATGGCAGGATTTCGTATTAAAC
Lolium multiflorumGTTTAATACGAAATCCTGCCATCACCTTCCATGATAATGTCGTTGA98
Ser623AsnAAGCACCACCGTTAGGGATCATAGGCAGCACATGCTCCTGGTGA
AGC-AACGGGACGATGATATCCAACAAGTATGGCCCAG
GATCCCTAACGGTGGTG99
CACCACCGTTAGGGATC100
SulfonylureaTCCGCGCTCGCCGACGGTCTCCTCGACTCCATCGCCATGGTCGC101
ResistanceCATCACGGGCCAGGTCTCACGCCGCATGATCGGCACGGACGCGT
ALSTCCAGGAGACGCCCATAGTGGAGGTCACGCGCT
Hordeum vulgareAGCGCGTGACCTCCACTATGGGCGTCTCCTGGAACGCGTCCGTG102
Pro68SerCGGATCATGCGGCGTGAGACCTGGCCCGTGATGGCGACCATGG
CCA-TCAGGATGGAGTCGAGGAGAGCGTCGGCGAGCGCGGA
GCCAGGTCTCACGCCGC103
GCGGCGTGAGACCTGGC104
SulfonyureaCCGCGCTCGCCGACGCTCTCCTCGACTCCATCCCCATGGTCGCC105
ResistanceATCACGGGCCAGGTCCAACGCCGCATGATCGGCACGGACGCGTT
ALSCCAGGAGACGCCCATAGTGGAGGTCACGCGCTC
Hordeum vulgareGAGCGCGTGACCTCCACTATGGGCGTCTCCTGGAACGCGTCCGT106
Pro68GlnGCCGATCATGCGGCGTTGGACCTGGCCCGTGATGGCGACCATGG
CCA-CAAGGATGGAGTCGAGGAGAGCGTCGGCGAGCGCGG
CCAGGTCCAACGCCGCA107
TGCGGCGTTGGACCTGG108
ImidazolinoneCCCAGGGCCGTACCTGCTGGATATCATTGTCCCGCATCAGGAGC109
ResistanceACGTGCTGCCTATGATCCCAAACGGTGGTGCTTTCAAGGACATGA
ALSTCATGGAGGGTGATGGCAGGACCTCGTACTGA
Hordeum vulgareTCAGTACGAGGTCCTGCCATTCACCCTCCATGATCATGTCCTTGAA110
Ser524AsnAGCACCACCGTTTGGGATCATAGGCAGCACGTGCTCCTGATGCG
AGC-AACGGACAATGATATCCAGCAGGTACGGCCCTGGG
GATCCCAAACGGTGGTG111
CACCACCGTTTGGGATC112
SulfonylureaAGTGGTCTCGCTGATGCAATGCTCGATAGTATCCCTCTCGTGGCG113
ResistanceATCACTGGTCAAGTCTCTCGTCGGATGATCGGTACCGATGCTTTC
ALSCAGGAAACTCCAATTGTTGAGGTAACAAGGT
Gossypium hirsutumACCTTGTTACCTCAACAATTGGAGTTTCCTGGAAAGCATCGGTAC114
Pro186SerCGATCATCCGACGAGAGACTTGACCAGTGATCGCCACGAGAGGG
CCT-TCTATACTATCGAGCATTGCATCAGCGAGACCACT
GTCAAGTCTCTCGTCGG115
CCGACGAGAGACTTGAC116
SulfonylureaGTGGTCTCGCTGATGCAATGGTCGATAGTATCCCTCTCGTGGCGA117
ResistanceTCACTGGTCAAGTCCAACGTCGGATGATCGGTACCGATGCTTTCC
ALSAGGAAACTCCAATTGTTGAGGTAACAAGGTC
Gossypium hirsutumGACCTTGTTACCTCAACAATTGGAGTTICCTGGAAAGCATCGGTA118
Pro186GlnCCGATCATCCGACGTTGGACTTGACCAGTGATCGCCACGAGAGG
CCT-CAAGATACTATCGAGCATTGCATCAGCGAGACCAC
TCAAGTCCAACGTCGGA119
TCCGACGTTGGACTTGA120
SulfonylureaGTGGTCTCGCTGATGCAATGCTCGATAGTATCCCTCTCGTGGCGA121
ResistanceTCACIGGTCAAGTCCAGCGTCGGATGATCGGTACCGATGCTTTCC
ALSAGGAAACTCCAATTGTTGAGGTAACAAGGTC
Gossypium hirsutumGACCTTGTTACCTCAACAATTGGAGTTTCCTGGAAAGCATCGGTA122
Pro186GlnCCGATCATCCGACGCTGGACTTGACCAGTGATCGCCACGAGAGG
CCT-CAGGATACTATCGAGCATTGCATCAGCGAGACCAC
TCAAGTCCAGCGTCGGA123
TCCGACGCTGGACTTGA124
ImidazolinoneGACCTTACTTGTTGGATGTGATTGTCCCACATCAAGAACATGTCCT125
ResistanceGCCTATGATCCCCAATGGAGGCGCTTTCAAAGATGTGATCACAGA
ALSGGGTGATGGAAGAACACAATATTGACCTCA
Gossypium hirsutumTGAGGTCAATATTGTGTTCTTCCATCACCCTCTGTGATCACATCTT126
Ser642AsnTGAAAGCGCCTCCATTGGGGATCATAGGCAGGACATGTTCTTGAT
AGT-AATGTGGGACAATCACATCCAACAAGTAAGGTC
GATCCCCAATGGAGGCG127
CGCCTCCATTGGGGATC128
SulfonylureaTCTGGTCTTGCTGATGCACTTCTTGACTCAGTCCCTCTTGTCGCCA129
ResistanceTTACTGGGCAAGTTTCCCGGCGTATGATTGGTACTGATGCTTTTCA
ALSAGAGACTCCAATTGTTGAGGTAACTCGAT
AmaranthusATCGAGTTACCTCAACAATTGGAGTCTCTTGAAAAGCATCAGTACC130
retroflexusAATCATACGCCGGGAAACTTGCCCAGTAATGGCGACAAGAGGGA
Pro192SerCTGAGTCAAGAAGTGCATCAGCAAGACCAGA
CCC-TCCGGCAAGTTTCCCGGCGT131
ACGCCGGGAAAGTTGCC132
SulfonylureaCTGGTCTTGCTGATGCACTTCTTGACTCAGTCCCTCTTGTCGCCAT133
ResistanceTACTGGGCAAGTTCAACGGCGTATGATTGGTACTGATGCTTTTCA
ALSAGAGACTCCAATTGTTGAGGTAACTCGATC
AmaranthusGATCGAGTTACCTCAACAATTGGAGTCTCTTGAAAAGCATCAGTAC134
retroflexusCAATCATACGCCGTTGAACTTGCCCAGTAATGGCGACAAGAGGGA
Pro192GlnCTGAGTCAAGAAGTGCATCAGCAAGACCAG
CCC-CAAGCAAGTTCAACGGCGTA135
TACGCCGTTGAACTTGC136
SulfonylureaCTGGTCTTGCTGATGCACTTCTTGACTCAGTCCCTCTTGTCGCCAT137
ResistanceTACTGGGCAAGtTCAGCGGCGTATGATTGGTACTGATGCTTTTCA
ALSAGAGACTCCAATTGTTGAGGTAACTCGATC
AmaranthusGATCGAGTTACCTCAACAATTGGAGTCTCTTGAAAAGCATCAGTAC138
retroflexusCAATCATACGCCGCTGAACTTGCCCAGTAATGGCGACAAGAGGG
Pro192GlnACTGAGTCAAGAAGTGCATCAGCAAGACCAG
CCC-CAGGCAAGTTCAGCGGCGTA139
TACGCCGCTGAACTTGC140
ImidazolinoneGACCGTATCTTGCTGGATGTTAATCGTACCACATCAGGAGCATGTGC141
ResistanceTGCCTAIGATCCCTAACGGTGCCGCCTTCAAGGACACCATAACAG
ALSAGGGTGATGGAAGAAGGGGTTATTAGTTGGT
AmaranthusACCAACTAATAAGCCCTTCTTCCATTCACCCTCTGTTATGGTGTCCT142
retroflexusTGAAGGCGGCACCGTTAGGGATCATAGGCAGCACATGCTCCTGA
Ser652AsnTGTGGTACGATTACATCCAGCAGATACGGTC
AGC-AACGATCCCTAACGGTGCCG143
CGGCACCGTTAGGGATC144
SulfonylureaAGCGGCCTCGCTGACGCGCTACTGGATAGCGTCCCCATTGTTGC145
ResistanceTATAACAGGTCAAGTGTCACGTAGGATGATAGGTACTGATGCTTTT
ALS 1CAGGAAACTCCTATTGTITGAGGTAACTAGAT
Nicotiana tabacumATCTAGTTACCTCAACAATAGGAGTTTCCTGAAAAGCATCAGTACC146
Pro194SerTATCATCCTACGTGACACTTGACCTGTTATAGCAACAATGGGGAC
CCA-TCAGCTATCCAGTAGCGCGTCAGCGAGGCCGCT
GTCAAGTGTCACGTAGG147
CCTACGTGACACTTGAC148
SulfonylureaGCGGCCTCGCTGACGCGCTACTGGATAGCGTCCCCATTGTTGCT149
ResistanceATAACAGGTCAAGTGCAACGTAGGATGATAGGTACTGATGCTTTT
ALS 1CAGGAAACTCCTATTGTTGAGGTAACTAGATC
Nicotiana tabacumGATCTAGTTACCTCAACAATAGGAGTTTCCTGAAAAGCATCAGTAC150
Pro194GlnCTATCATCCTACGTTGCACTTGACCTGTTATAGCAACAATGGGGA
CCA-CAACGCTATCCAGTAGCGCGTCAGCGAGGCCGC
TCAAGTGCAACGTAGGA151
TCCTACGTTGCACTTGA152
ImidazolinoneGGCCATACTTGTTGGATGTGATTGTACCTCATCAGGAACATGTTTT153
ResistanceACCTATGATTCCCAATGGCGGAGCTTTCAAAGATGTGATCACAGA
ALS 1GGGTGACGGGAGAAGTTCCTATTGAGTTTG
Nicotiana tabacumCAAACTGAATAGGAACTTCTCCCGTCACCCTCTGTGATCACATCTT154
Ser650AsnTGAAAGCTCCGCCATTGGGAATCATAGGTAAAACATGTTCCTGAT
AGT-AATGAGGTACAATCACATCCAACAAGTATGGCC
GATTCCCAATGGCGGAG155
CTCCGCCATTGGGAATC156
SulfonylureaAGTGGCCTCGCGGACGCCCTACTGGATAGCGTCCCCATTGTTGC157
ResistanceTATAACCGGTCAAGTGTCACGTAGGATGATCGGTACTGATGCTTT
ALS 2TCAGGAAACTCCGATTGTTGAGGTAACTAGAT
Nicotiana tabacumATCTAGTTACCTCAACAATCGGAGTTTCCTGAAAAGCATCAGTACC158
Pro191SerGATCATCCTACGTGACACTTGACCGGTTATAGCAACAATGGGGAC
CCA-TCAGCTATCCAGTAGGGCGTCCGCGAGGCCACT
GICAAGTGTCACGTAGG159
CCTACGTGACACTTGAC160
SulfonylureaGTGGCCTCGCGGACGCCCTACTGGATAGCGTCCCCATTGTTGCT161
ResistanceATAACCGGTCAAGTGCAACGTAGGATGATCGGTACTGATGCTTTT
ALS 2CAGGAAACTCCGATTGTTGAGGTAACTAGATC
Nicotiana tabacumGATCTAGTTACCTCAACAATCGGAGTTTCCTGAAAAGCATCAGTAC162
Pro191GlnCGATCATCCTACGTTGCACTTGACCGGTTATAGCAACAATGGGGA
CCA-CAACGCTATCCAGTAGGGCGTCCGCGAGGCCAC
TCAAGTGCAACGTAGGA163
TCCTACGTTGCACTTGA164
ImidazolinoneGGCCATACTTGTTGGATGTGATTGTACCTCATCAGGAACATGTTCT165
ResistanceACCTATGATTCCCAATGGCGGGGCTTTCAAAGATGTGATCACAGA
ALS 2GGGTGACGGGAGAAGTTCCTATTGACTTTG
Nicotiana tabacumCAAAGTCAATAGGAACTTCTCCCGTCACCCTCTGTGATCACATCTT166
Ser647AsnTGAAAGCCCCGCCATTGGGAATCATAGGTAGAACATGTTCCTGAT
AGT-AATGAGGTACAATCACATCCAACAAGTATGGCC
GATTCCCAATGGCGGGG167
CCCCGCCATTGGGAATC168
SulfonylureaAGTGGTCTTGCTGATGCTTTATTAGACAGTGTTCCAATGGTTGCTA169
ResistanceTTACTGGTCAAGTTTCCAGGAGAATGATTGGAACAGATGCGTTTC
ALSAAGAAACCCCTATTGTTGAGGTAACACGTT
Xanthium spp.AACGTGTTACCTCAACAATAGGGGTTTCTTGAAACGCATCTGTTCC170
Pro175SerAATCATTCTCCTGGAAACTTGACCAGTAATAGCAACCATTGGAACA
CCC-TCCCTGTCTAATAAAGCATCAGCAAGACCACT
GTCAAGTTTCCAGGAGA171
TCTCCTGGAAACTTGAC172
SulfonylureaGTGGTCTTGCTGATGCTTTATTAGACAGTGTTCCAATGGTTGCTAT173
ResistanceTACTGGTCAAGTTCAAAGGAGAATGATTGGAACAGATGCGTTTCA
ALSAGAAACCCCTATTGTTGAGGTAACACGTTC
Xanthium spp.GAACGTGTTACCTCAACAATAGGGGTTTCTTGAAACGCATCTGTTC174
Pro175GlnCAATCATTCTCCTTTGAACTTGACCAGTAATAGCAACCATTGGAAC
CCC-CAAACTGTCTAATAAAGCATCAGCAAGACCAC
TCAAGTTCAAAGGAGAA175
TTCTCCTTTGAACTTGA176
SulfonylureaGTGGTCTTGCTGATGCTTTATTAGACAGTGTTCCAATGGTTGCTAT177
ResistanceTACTGGTCAAGTTCAGAGGAGAATGATTGGAACAGATGCGTTTCA
ALSAGAAACCCCTATTGTTGAGGTAACACGTTC
Xanthium spp.GAACGTGTTACCTCAACAATAGGGGTTTCTTGAAACGCATCTGTTC 178
Pro175GlnCAATCATTCTCCTCTGAACTTGACCAGTAATAGCAACCATTGGAAC
CCC-CAGACTGTCTAATAAAGCATCAGCAAGACCAC
TCAAGTTCAGAGGAGAA179
TTCTCCTCTGAACTTGA180
ImidazolinoneGGGCCTTACTTGTTGGATGTGATCGTGCCCCATCAAGAACATGTG181
ResistanceTTGCCCATGATCCCGAATGGTGGAGGTTTCATGGATGTGATCACC
ALSGAAGGCGACGGCAGAATGAAATATTGAGCTT
Xanthium spp.AAGCTCAATATTTCATTCTGCCGTCGCCTTCGGTGATCACATCCAT182
Ala631AsnGAAACCTCCACCATTCGGGATCATGGGCAACACATGTTCTTGATG
GCT-AATGGGCACGATCACATCCAACAAGTAAGGCCC
TGATCCCGAATGGTGGA183
TCCACCATTCGGGATCA184
SulfonylureaTCCGGGTTTGCTGATGCTTTGCTCGATTCCGTTCCACTGGTGGCG185
ResistanceATCACGGGGCAGGTGTCGCGGCGAATGATTGGGACGGATGCTTT
ALSTCAGGAGACTCCTATTGTTGAGGTAACACGGT
Bassia scopariaACCGTGTTACCTCAACAATAGGAGTCTCCTGAAAAGCATCCGTCC186
Pro189SerCAATCATTCGCCGCGACACCTGCCCCGTGATCGCCACCAGTGGA
CCG-TCGACGGAATCGAGCAAAGCATCAGCAAACCCGGA
GGCAGGTGTCGCGGCGA187
TCGCCGCGACACCTGCC188
SulfonylureaCCGGGTTTGGTGATGCTTTGCTCGATTCCGTTCCACTGGTGGCGA189
ResistanceTCACGGGGCAGGTGCAGCGGCGAATGATTGGGACGGATGCTTTT
ALSCAGGAGACTCCTATTGTTGAGGTAACACGGTC
Bassia scopariaGACCGTGTTACCTCAACAATAGGAGTCTCCTGAAAAGCATCCGTC190
Pro189GlnCCAATCATTCGCCGCTGCACCTGCCCCGTGATCGCCACCAGTGG
CCG-CAGAACGGAATCGAGCAAAGCATCAGCAAACCCGG
GCAGGTGCAGCGGCGAA191
TTCGCCGCTGCAGCTGC192
ImidazolinoneGACCTTACCTGCTTGATGTGATTGTACCTCATCAGGAGCATGTGC193
ResistanceTGCCTATGATTCCTAATGGTGCAGCCTTCAAGGATATCATTAACGA
ALSAGGTGATGGAAGAACAAGTTATTGATGTTC
Bassia scopariaGAACATCAATAACTTGTTCTTCCATCACCTTCGTTAATGATATCCTT194
Ser649AsnGAAGGCTGCACCATTAGGAATCATAGGCAGCACATGCTCCTGATG
AGT-AATAGGTACAATCACATCAAGCAGGTAAGGTC
GATTCGTAATGGTGCAG195
CTGCACCATTAGGAATC196
SulfonylureaAGCGGGTTAGCAGACGCGATGCTTGACAGTGTTCCTCTTGTCGCC197
ResistanceATTACAGGACAGGTCTCTCGCCGGATGATCGGTACTGACGCCTTC
ALS 1CAAGAGACACCAATCGTTGAGGTAACGAGGT
Brassica napusACCTCGTTACCTCAACGATTGGTGTCTCTTGGAAGGCGTCAGTAC198
Pro182SerCGATCATCCGGCGAGAGACCTGTCCTGTAATGGCGACAAGAGGA
CCT-TCTACACTGTCAAGCATCGCGTCTGCTAACCCGCT
GACAGGTCTCTCGCCGG199
CCGGCGAGAGACCTGTC200
SulfonylureaGCGGGTTAGCAGACGCGATGCTTGACAGTGTTCCTCTTGTCGCCA201
ResistanceTTACAGGACAGGTCCAACGCCGGATGATCGGTACTGACGCCTTC
ALS 1CAAGAGACACCAATCGTTGAGGTAACGAGGTC
Brassica napusGACCTCGTTACCTCAACGATTGGTGTCTCTTGGAAGGCGTCAGTA202
Pro182GlnCCGATCATCCGGCGTTGGACCTGTCCTGTAATGGCGACAAGAGG
CCT-CAAAACACTGTCAAGCATCGCGTCTGCTAACCCGC
ACAGGTCCAACGCCGGA203
TCCGGCGTTGGACCTGT204
SulfonylureaGCGGGTTAGCAGACGCGATGCTTGACAGTGTTCCTCTTGTCGCCA205
ResistanceTTACAGGACAGGTCCAGCGCCGGATGATCGGTACTGACGCCTTC
ALS 1CAAGAGACACCAATCGTTGAGGTAACGAGGTC
Brassica napusGACCTCGTTACCTCAACGATTGGTGTCTCTTGGAAGGCGTCAGTA206
Pro182GlnCCGATCATCCGGCGCTGGACCTGTCCTGTAATGGCGACAAGAGG
CCT-CAGAACACTGTCAAGCATCGCGTCTGCTAACCCGC
ACAGGTCCAGCGCCGGA207
TCCGGCGCTGGACCTGT208
ImidazolinoneGACCATACCTGTTGGATGTGATATGTCCGCACCAAGAACATGTGT209
ResistanceTACCGATGATCCCAAATGGTGGCACTTTCAAAGATGTAATAACAG
ALS 1AAGGGGATGGTCGCACTAAGTACTGAGAGAT
Brassica napusATCTCTCAGTACTTAGTGCGACCATCCCCTTCTGTTATTACATCTTT210
Ser638AsnGAAAGTGCCACCATTTGGGATCATCGGTAACACATGTTCTTGGTG
AGT-AATCGGACATATCACATCCAACAGGTATGGTC
GATCCCAAATGGTGGCA211
TGCCACCATTTGGGATC212
SulfonylureaCAGCGGGTTAGCAGACGCGATGCTTGACAGTGTTCCTCTTGTCGC213
ResistanceCATTACAGGACAGGTTCCTCGCCGGATGATCGGTACTGACGCCTT
ALS 2CCAAGAGACACCAATCGTTGAGGTAACGAGG
Brassica napusCCTCGTTACCTCAACGATTGGTGTCTCTTGGAAGGCGTCAGTACC214
Pro126SerGATCATCCGGCGAGGAACCTGTCCTGTAATGGCGACAAGAGGAA
CCC-TCCCACTGTCAAGCATCGCGTCTGCTAACCCGCTG
GGACAGGTTCCTCGCCG215
CGGCGAGGAACCTGTCC216
SulfonylureaAGCGGGTTAGCAGACGCGATGCTTGACAGTGTTCCTCTTGTCGCC217
ResistanceATTACAGGACAGGTCACTCGCCGGATGATCGGTACTGACGCCTTC
ALS 2CAAGAGACACCAATCGTTGAGGTAACGAGGT
Brassica napusACCTCGTTACCTCAACGATTGGTGTCTCTTGGAAGGCGTCAGTAC218
Pro126GlnCGATCATCCGGCGAGTGACCTGTCCTGTAATGGCGACAAGAGGA
CCC-CAGACACTGTCAAGCATCGCGTCTGCTAACCCGCT
GACAGGTCACTCGCCGG219
CCGGCGAGTGACCTGTC220
ImidazolinoneGACCATACCTGTTGGATGTGATATGTCCGCACCAAGAACATGTGT221
ResistanceTACCGATGATCCCAAATGGTGGCACTTTCAAAGATGTAATAACAG
ALS 2AAGGGGATGGTCGCACTAAGTACTGAGAGAT
Brassica napusATCTCTCAGTACTTAGTGCGACCATCCCCTTCTGTTATTACATCTTT222
Ser582AsnGAAAGTGCCACCATTTGGGATCATCGGTAACACATGTTCTTGGTG
AGT-AATCGGACATATCACATCCAACAGGTATGGTC
GATCCCAAATGGTGGCA223
TGCCACCATTTGGGATC224
SulfonylureaAGCGGGTTAGCCGACGCGATGCTTGACAGTGTTCCTCTCGTCGC225
ResistanceCATCACAGGACAGGTCTCTCGCCGGATGATCGGTACTGACGCGT
ALS 3TCCAAGAGACGCCAATCGTTGAGGTAACGAGGT
Brassica napusACCTCGTTACCTCAACGATTGGCGTCTCTTGGAACGCGTCAGTAC226
Pro179SerCGATCATCCGGCGAGAGACCTGTCCTGTGATGGCGACGAGAGGA
CCT-TCTACACTGTCAAGCATCGCGTCGGCTAACCCGCT
GACAGGTCTCTCGCCGG227
CCGGCGAGAGACCTGTC228
SulfonylureaGCGGGTTAGCCGACGCGATGCTTGACAGTGTTCCTCTCGTCGCC229
ResistanceATCACAGGACAGGTCCAACGCCGGATGATCGGTACTGACGCGTT
ALS 3CCAAGAGACGCCAATCGTTGAGGTAACGAGGTC
Brassica napusGACCTCGTTACCTCAACGATTGGCGTCTCTTGGAACGCGTCAGTA230
Pro179GlnCCGATCATCCGGCGTTGGACCTGTCCTGTGATGGCGACGAGAGG
CCT-CAAAACACTGTCAAGCATCGCGTCGGCTAACCCGC
ACAGGTCCAAee CGCCGGA231
TCCGGCGTTGGACCTGT232
SulfonylureaGCGGGTTAGCCGACGCGATGCTTGACAGTGTTCCTCTCGTCGCC233
ResistanceATCACAGGACAGGTCCAGCGCCGGATGATCGGTACTGACGCGTT
ALS 3CCAAGAGACGCCAATCGTTGAGGTAACGAGGTC
Brassica napusGACCTCGTTACCTCAACGATTGGCGTCTCTTGGAACGCGTCAGTA234
Pro179GlnCCGATCATCCGGCGCTGGACCTGTCCTGTGATGGCGACGAGAGG
CCT-CAGAACACTGTCAAGCATCGCGTCGGCTAACCCGC
ACAGGTCCAGCGCCGGA235
TCCGGCGCTGGACCTGT236
ImidazolinoneGACCGTACCTGTTGGATGTCATCTGTCCGCACCAAGAACATGTGT237
ResistanceTACOGATGATCCCAAATGGTGGCACTTTCAAAGATGTAATAACCG
ALS 3AAGGGGATGGTCGCACTAAGTACTGAGAGAT
Brassica napusATCTCTCAGTACTTAGTGCGACCATCCCCTTCGGTTATTACATCTT238
Ser635AsnTGAAAGTGCCACCATTTGGGATCATCGGTAACACATGTTCTTGGT
AGT-AATGCGGACAGATGACATCCAACAGGTACGGTC
GATCCCAAATGGTGGCA239
TGCCACCATTTGGGATC240
SultonylureaTCCGCGCTCGCCGACGCGCTGCTCGACTCCGTCCCGATGGTCGC241
ResistanceCATCACGGGCCAGGTCTCCCGCCGCATGATCGGCACCGACGCCT
ALSTCCAGGAGACGCCCATAGTCGAGGTCACCCGCT
Oryza sativaAGCGGGTGACCTCGACTATGGGCGTCTCCTGGAAGGCGTCGGTG242
Prol7l SerCCGATCATGCGGCGGGAGACCTGGCCCGTGATGGCGACCATCG
CCC-TCCGGACGGAGTCGAGCAGCGCGTCGGCGAGCGCGGA
GCCAGGTCTCCCGCCGC243
GCGGCGGGAGACCTGGC244
SulfonylureaCCGCGCTCGCCGACGCGCTGCTCGACTCCGTCCCGATGGTCGCC245
ResistanceATCACGGGCCAGGTCCAACGCCGCATGATCGGCACCGACGCCTT
ALSCCAGGAGACGCCCATAGTCGAGGTCACCCGCTC
Oryza sativaGAGCGGGTGACCTCGACTATGGGCGTCTCCTGGAAGGCGTCGGT246
Pro171GlnGCCGATCATGCGGCGTee TGGACCTGGCCCGTGATGGCGACCATCG
CCC-CAAGGACGGAGTCGAGCAGCGCGTCGGCGAGCGCGG
CCAGGTCCAACGCCGCA247
TGCGGCGTTGGACCTGG248
SulfonylureaCCGCGCTCGCCGACGCGCTGCTCGACTCCGTCCCGATGGTCGCC249
ResistanceATCACGGGCCAGGTCCAGCGCCGCATGATCGGCACCGACGCCTT
ALSCCAGGAGACGCCCATAGTCGAGGTCACCCGCTC
Oryza sativaGAGCGGGTGACCTCGACTATGGGCGTCTCCTGGAAGGCGTCGGT 250
Pro171GlnGCCGATCATGCGGCGCTGGACCTGGCCCGTGATGGGGACCATCG
CCC-CAGGGACGGAGTCGAGCAGCGCGTCGGCGAGCGCGG
CCAGGTCCAGCGCCGCA251
TGCGGCGCTGGACCTGG252
ImidazolinoneGGCCATACTTGTTGGATATCATCGTCCCGCACCAGGAGCATGTGC253
ResistanceTGCCTATGATCCCAAATGGGGGCGCATTCAAGGACATGATCCTGG
ALSATGGTGATGGCAGGACTGTGTATTAATCTAT
Oryza sativaATAGATTAATACACAGTCCTGCCATCACCATCCAGGATCATGTCCT254
Ser627AsnTGAATGCGCCCCCATTTGGGATCATAGGCAGCACATGCICCTGGI
AGT-AATGCGGGACGATGATATCCAACAAGTATGGCC
GATCCCAAATGGGGGCG255
CGCCCCGATTTGGGATC256
SulfonylureaTCTGCGCTCGCAGACGCGTTGCTCGACTCCGTCCCCATGGTCGC257
ResistanceCATCACGGGACAGGTGTCGCGACGCATGATTGGCACCGACGCCT
ALSTTCAGGAGACGCCCATCGTCGAGGTCACCCGCT
Zea maysAGCGGGTGACCTCGACGATGGGCGTCTCCTGAAAGGCGTCGGTG258
Pro165SerCCAATCATGCGTCGCGACACCTGTCCCGTGATGGCGACCATGGG
CCG-TCGGACGGAGTCGAGCAACGCGTCTGCGAGCGCAGA
GACAGGTGTCGCGACGC259
GCGTCGCGACACCTGTC260
SulfonylureaCTGCGCTCGCAGACGCGTTGCTCGACTCCGTCCCCATGGTCGCC261
ResistanceATCACGGGACAGGTGCAGCGACGCATGATTGGCACCGACGCCTT
ALSTCAGGAGACGCCCATCGTCGAGGTCACCCGCTC
Zea maysGAGCGGGTGACCTCGACGATGGGCGTCTCCTGAAAGGCGTCGGT 262
Pro165GlnGCCAATCATGCGTCGCTGCACCTGTCCCGTGATGGCGACCATGG
CCG-CAGGGACGGAGTCGAGCAACGCGTCTGCGAGCGCAG
ACAGGTGCAGCGACGCA263
TGCGTCGCTGCACCTGT264
ImidazolinoneGGCCGTACCTCTTGGATATAATCGTCCCGCACCAGGAGCATGTGT265
ResistanceTGCCTATGATCCCTAATGGTGGGGCTTTCAAGGATATGATCCTGG
ALSATGGTGATGGCAGGACTGTGTATTGATCCGT
Zea maysACGGATCAATACACAGTCCTGCCATCACCATCCAGGATCATATCC266
Ser621AsnTTGAAAGCCCCACCATTAGGGATCATAGGCAACACATGCTCCTGG
AGT-AATTGCGGGACGATTATATCCAAGAGGTACGGCC
GATCCCTAATGGTGGGG267
CCCCACCATTAGGGATC268
SulfonylureaAGTGGTCTCGCTGATGCAATGCTCGATAGTATCCCTCTCGTGGCG269
ResistanceATCACTGGICAAGTCTCTCGTCGGATGATCGGTACCGATGCTTTC
ALSCAGGAAACTCCAATTGTTGAGGTAACAAGGT
Gossypium hirsutumACCTTGTTACCTCAACAATTGGAGTTTCCTGGAAAGCATCGGTAC270
Pro186SerCGATCATCCGACGAGAGACTTGACCAGTGATCGCCACGAGAGGG
CCT-TCTATACTATGGAGCATTGCATCAGCGAGACCACT
GTCAAGTCTCTCGTCGG271
CCGACGAGAGACTTGAC272
SulfonylureaGTGGTCTCGCTGATGCAATGCTCGATAGTATCCCTCTCGTGGCGA273
ResistanceTCACTGGTCAAGTCCAACGTCGGATGATCGGTACCGATGCTTTCC
ALSAGGAAACTCCAATTGTTGAGGTAACAAGGTC
Gossypium hirsutumGACCTTGTTACCTTAACAATTGGAGTTTCCTGGAAAGCATCGGTA274
Pro186GlnCCGATCATCCGACGTTGGACTTGACCAGTGATCGCCACGAGAGG
CCT-CAAGATACTATCGAGCATTGCATCAGCGAGACCAC
TCAAGTCCAACGTCGGA275
TTCCGACGTTGGACTTGA276
SulfonylureaGTGGTCTCGCTGATGCAATGCTCGATAGTATCCCTCTCGTGCCGA277
ResistanceTCACTGGTCAAGTCCAGCGTCGGATGATCGGTACCGATGCTTTCC
ALSAGGAAACTCCAATTGTTGAGGTAACAAGGTC
Gossypium hirsutumGACCTTGTTACCTCAACAATTGGAGTTTCCTGGAAAGCATCGGTA278
Pro186GlnCCGATCATCCGACGCTGGACTTGACCAGTGATCGCCACGAGAGG
CCT-CAGGATACTATCGAGCATTGCATCAGCGAGACCAC
TCAAGTCCAGCGTCGGA279
TCCGACGCTGGACTTGA280
ImidazolinoneGACCTTACTTGTTGGATGTGATTGTCCCACATCAAGAACATGTCCT281
ResistanceGCCTATGATCCCCAATGGAGGGGCTTTCAAAGATGTGATCACAGA
ALSGGGTGATGGAAGAACACAATATTGACCTCA
Gossypium hirsutumTGAGGTCAATATTGTGTTCTTCCATCACCCTCTGTGATCACATCTT282
Ser642AsnTGAAAGCCCCTCCATTGGGGATCATAGGCAGGACATGTTCTTGAT
AGT-AATGTGGGACAATCACATCCAACAAGTAAGGTC
GATCCCCAATGGAGGGG283
CCCCTCCATee TGGGGATC284
SulfonylureaTCTGGTCTTGCTGATGCACTTCTTGACTCAGTCCCTCTTGTCGCCA285
ResistanceTTACTGGGCAAGTTTCCCGGCGTATGATTGGTACTGATGCTTTTCA
ALSAGAGACTCCAATTGTTGAGGTAACTCGAT
Amaranthus powelliiATCGAGTTACCTCAACAATTGGAGTCTCTTGAAAAGCATCAGTACC286
Pro192SerAATCATACGCCGGGAAACTTGCCCAGTAATGGCGACAAGAGGGA
CCC-TCCCTGAGTCAAGAAGTGCATCAGCAAGACCAGA
GGCAAGTTTCCCGGCGT287
ACGCCGGGAAACTTGCC288
SulfonymureaCTGGTCTTGCTGATGCACTTCTTGACTCAGTCCCTCTTGTCGCCAT289
ResistanceTACTGGGCAAGTTCAACGGCGTATGATTGGTACTGATGCTTTTCA
ALSAGAGACTCCAATTGTTGAGGTAACTCGATC
Amaranthus powelliiGATCGAGTTACCTCAACAATTGGAGTCTCTTGAAAAGCATCAGTAC290
Pro192GlnCAATCATACGCCGTTGAACTTGCCCAGTAATGGCGACAAGAGGGA
CCC-CAACTGAGTCAAGAAGTGCATCAGCAAGACCAG
GCAAGTTCAACGGCGTA291
TACGCCGTTGAACTTGC292
SulfonylureaCTGGTCTTGCTGATGCACTTCTTGACTCAGTCCCTCTTGTCGCCAT293
ResistanceTACTGGGCAAGTTCAGCGGCGTATGATTGGTACTGATGCTTTTCA
ALSAGAGACTCCAATTGTTGAGGTAACTCGATC
Amaranthus powelliiGATCGAGTTACCTCAACAATTGGAGTCTCTTGAAAAGCATCAGTAC294
Pro192GlnCAATCATACGCCGCTGAACTTGCCCAGTAATGGCGACAAGAGGG
CCC-CAGACTGAGTCAAGAAGTGCATCAGCAAGACCAG
GCAAGTTCAGCGGCGTA295
TACGCCGCTGAACTTGC296
ImidazolinoneGACCGTATCTGCTGGATGTAATCGTACCACATCAGGAGCATGTGC297
ResistanceTGCCTATGATCCCTAACGGTGCCGCCTTCAAGGACACCATAACAG
ALSAGGGTGATGGAAGAAGGGCTTATTAGTTGGT
Amaranthus powelliiACCAACTAATAAGCCCTTCTTCCATCACCCTCTGTTATGGIGTCCT298
Ser652AsnTGAAGGCGGCACCGTTAGGGATCATAGGCAGCACATGCTCCTGA
AGC-AACTGTGGTACGATTACATCCAGCAGATACGGTG
GATCCCTAACGGTGCCG299
CGGCACCGTTAGGGATC300

[0121] 14

TABLE 12
Genome-Altering Oligos Conferring Porphyric Herbicide Resistance
Phenotype, Gene,
Plant & Targeted SEQ ID
AlterationAltering OligosNO:
Porphyric HerbicideTCTTGCGCCCTCTTTCTGAATCTGCTGCAAATGCACTCTCAAAACT301
ResistantATATTACCCACCAATGGCAGCAGTATCTATCTCGTACCCGAAAGA
PPOAGCAATCCGAACAGAATGTTTGATAGATGG
Arabidopsis thalianaCCATCTATCAAACATTCTGTTCGGATTGCTTCTTTCGGGTACGAGA302
Val365MetTAGATACTGCTGCCATTGGTGGGTAATATAGTTTTGAGAGTGCATT
GTT-ATGTGCAGCAGATTCAGAAAGAGGGCGCAAGA
CCCACCAATGGCAGCAG303
CTGCTGCCATTGGTGGG304
Porphyric HerbicideTATTACGTCCTCTTTCGGTTGCCGCAGCAGATGCACTTTCAAATTT305
ResistantCTACTAICCCCCAATGGGAGCAGTCACAATTTCATATCCTCAAGAA
PPOGCTATTCGTGATGAGCGTCTGGTTGATGG
Nicotiana tabacumCCATCAACCAGACGCTCATCACGAATAGCTTCTTGAGGATATGAA306
Val376MetATTGTGACTGCTCCCATTGGGGGATAGTAGAAATTTGAAAGTGCA
GTT-ATGTCTGCTGCGGCAACCGAAAGAGGACGTAATA
TCCCCCAATGGGAGCAG307
CTGCTCCCATTGGGGGA308
Porphyric HerbicideTGTTGCGTCCGCTTTCGTTGGGTGCAGCAGATGCATTGTCAAAAT309
ResistantTTTATTATCCTCCGATGGCAGCTGTATCAATTTCATATCCAAAAGA
PPOCGGAATTCGTGCTGACCGGCTGATTGATGG
Cichorium intybusCCATCAATCAGCCGGTCAGCACGAATTGCGTCTTTTGGATATGAA310
Val383MetATTGATACAGCTGCCATCGGAGGATAATAAAATTTTGACAATGCAT
GTT-ATGCTGCTGCACCCAACGAAAGCGGACGCAACA
TCCTCCGATGGCAGCTG311
CAGCTGCCATCGGAGGA312
Porphyric HerbicideTCCTTCGTCCACTTTCAGATGTCGCCGCAGAATCTCTTTCAAAATT313
ResistantTCATTATCCACCAATGGCAGCTGTGTCACTTTCCTATCCTAAAGAA
PPOGCAATTAGATCAGAGTGCTTGATTGACGG
Spinacia oleraceaCCGTCAATCAAGCACTCTGATCTAATTGCTTCTTTAGGATAGGAAA314
Val390MetGTGACACAGCTGCCATTGGTGGATAATGAAATTTTGAAAGAGATT
GTT-ATGCTGCGGCGACATCTGAAAGTGGACGAAGGA
TCCACCAATGGCAGCTG315
CAGCTGCCATTGGTGGA316
Porphyric HerbicideTTTTGCGTCCACTTTCAAGCGATGCTGCAGATGCTCTATCAAGATT317
ResistantCTATTATCCACCGATGGCTGCIGTAACTGTTTCGTATCCAAAGGAA
PPOGCAATTAGAAAAGAATGCTTAATTGATGG
Zea maysCGATCAATTAAGCATTCTTTTCTAATTGCTTCCTTTGGATACGAAAC318
Val363MetAGTTACAGCAGCCATCGGTGGATAATAGAATCTTGATAGAGCATC
GTT-ATGTGCAGCATCGCTTGAAAGTGGACGCAAAA
TCCACCGATGGCTGCTG319
CAGCAGCCATCGGTGGA320
Porphyric HerbicideTCTTGCGGCCACTTTCAAGTGATGGAGCAGATGCTCTGTCAATATT321
ResistantCTATTATCCACCAATGGCTGCTGTAACTGTTTCATATCCAAAAGAA
PPOGCAATTAGAAAAGAATGCTTAATTGACGG
Oryza sativaCCGTCAATTAAGCATTCTTTTCTAATTGCTTCTTTTGGATATGAAAC322
Val364MetAGTTACAGCAGCCATTGGTGGATAATAGAATATTGACAGAGCATC
GTT-ATGTGCTGCATCACTTGAAAGTGGCCGCAAGA
TCCACCAATGGCTGCTG323
CAGCAGCCATTGGTGGA324
Porphyric HerbicideCTGGTCAAGGAGCAGGCGCCCGCCGCCGCCGAGGCCCTGGGCT325
ResistantCCTTCGACTACCCGCCGATGGGCGCCGTGACGCTGTCGTACCCG
PPOCTGAGCGCCGTGCGGGAGGAGCGCAAGGCCTCGG
ChlamydomonasCCGAGGCCTTGCGCTCCTCCCGCACGGCGCTCAGCGGGTACGAC326
reinhardtiiAGCGTCACGGCGCCCATCGGCGGGTAGTCGAAGGAGCCCAGGG
Val389MetCCTCGGCGGCGGCGGGCGCCTGCTCCTTGACCAG
GTG-ATGACCCGCCGATGGGCGCC327
GGCGCCCATCGGGGGGT328

[0122] 15

TABLE 13
Genome-Altering Oligos Conferring Triazine Resistance
Phenotype, Gene,
Plant & TargetedSEQ ID
AlterationAltering OligosNO:
Triazine ResistantAAACTTACAACATTGTAGCTGCTCACGGTTATTTTGGCCGATTGAT329
D1 ProteinTTTCCAATATGCTACTTTCAACAATTCTCGTTCTTTACATTTCTTCTT
Arabidopsis thalianaAGCGGCTTGGCCGGTAGTAGGTATTTG
Ser264ThrCAAATACCTACTACCGGCCAAGCCGCTAAGAAGAAATGTAAAGAA330
AGT-ACTCGAGAATIGTTGAAAGTAGCATATTGGAAAATCAATCGGCCAAAAT
AACCGTGAGCAGCTACAATGTTGTAAGTTT
ATATGCTACTTTCAACA331
TGTTGAAAGTAGCATAT332
Triazine ResistantAAACTTATAACATCGTAGCCGCTCATGGTTATTTTGGCCGATTGAT333
D1ProteinCTTCCAATATGCTACTTTCAACAACTCTCGTTCGTTACACTTCTTCC
Nicotiana tabacumTAGCTGCTTGGCCTGTAGTAGGTATCTG
Ser264ThrCAGATACCTACTACAGGCCAAGCAGCTAGGAAGAAGTGTAACGAA334
AGT-ACTCGAGAGtTGTIGAAAGTAGCATATTGGAAGATCAAtCGGCCAAAA
TAACCATGAGCGGCTACGATGTTATAAGTTT
ATATGCTACTTTCAACA335
TGTTGAAAGTAGCATAT336
Triazine ResistantAAACTTATAATATCGTAGCCGCTCATGGTTATTTTGGCCGATTGAT337
D1ProteinCTTCCAATATGCTACTTTTAACAACTCTCGCTCTTTACATTTCTTCT
Populus deltoidesTAGCTGCTTGGCCTGTAGTAGGTATCTG
Ser264ThrCAGATACCTACTACAGGCCAAGCAGCTAAGAAGAAATGTAAAGAG338
AGT-ACTCGAGAGTTGTTAAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAACCATGAGCGGCTACGATATTATAAGTTT
ATATGCTACTTTTAACA339
TGTTAAAAGTAGCATAT340
Triazine ResistantAAACTTATAATATCGTAGCCGCTCATGGTTATTTTGGCCGATTGAT341
D1ProteinCTTCCAATATGCTACTTTCAACAACTCTCGTTCGTTACACTTCTTCC
Petunia x hybridaTAGCTGCTTGGCCTGTAGTAGGTATCTG
Ser264ThrCAGATACCTACTACAGGCCAAGCAGCTAGGAAGAAGTGTAACGAA342
AGT-ACTCGAGAGTTGTTGAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAACCATGAGCGGCTACGATATTATAAGTTT
ATATGCTACTTTCAACA343
TGTTGAAAGTAGCATAT344
Triazine ResistantAAACTTATAAIATCGTAGCTGCTCATGGTTATTTTGGCCGATTGAT345
D1ProteinCTTCCAATATGCTACTTTCAACAATTCTCGTTCTTTACATTTCTTCC
Magnolia pyramidataTAGCTGCTTGGCCTGTAGTAGGTATCTG
Ser264ThrCAGATACCTACTACAGGCCAAGCAGCTAGGAAGAAATGTAAAGAA346
AGT-ACTCGAGAATTGTTGAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAACCATGAGCAGCTACGATATTATAAGTTT
ATATGCTACTTTCAACA347
TGTTGAAAGTAGCATAT348
Triazine ResistantAAACCTATAATATTGTAGCAGCTCATGGTTATTTTGGCCGATTGAT349
D1ProteinCTTCCAATATGCTACTTTCAACAACTCTCGTTCTTTACATTTCTTCC
Medicago sativaTAGCTGCTTGGCCTGTAGTAGGTATCTG
Ser264ThrCAGATACCTACTACAGGCCAAGCAGCTAGGAAGAAATGTAAAGAA350
AGT-ACTCGAGAGTTGTTGAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAAGCATGAGCTGCTACAATATTATAGGTTT
ATATGCTACTTTCAACA351
TGTTGAAA+E,us GTAGCATAT1352
Triazine ResistantAAACCTATAATATTGTAGCTGCTCATGGTTATTTGGCCGATTGAT353
D1ProteinCTTCCAATATGCAACTTTCAACAATTCTCGTTCTTTACATTTCTTCT
Glycine maxTAGCTGCTTGGCCTGTAGTAGGTATTTG
Ser264ThrCAAATACCTACTACAGGCCAAGCAGCTAAGAAGAAATGTAAAGAA354
AGT-ACTCGAGAATTGTTGAAAGTTGCATATTGGAAGATCAATCGGCCAAAA
TAACCATGAGCAGCTACAATATTATAGGTTT
ATATGCAACTTTCAACA355
TGTTGAAAGTTGCATAT356
Triazine ResistantAAACTTACAACATTGTAGCTGCTCACGGTTATTTTGGCCGATTGAT357
D1ProteinCTTCCAATATGCTACTTTCAACAATTCTCGTTCTTTACATTTCTTCT
Brassica napusTAGCGGCTTGGCCGGTAGTAGGTATTTG
Gly264ThrCAAATACCTACTACCGGCCAAGCCGCTAAGAAGAAATGTAAAGAA358
GGT-ACTCGAGAAITGTTGAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAACCGTGAGCAGCTACAATGTTGTAAGTTT
ATATGCTACTTTCAACA359
TGTTGAAAGTAGCATAT360
Triazine ResistantAAACTTATAATATTGTGGCCGCTCATGGTTATTTTGGCCGATTAAT361
D1ProteinCTTCCAATATGCTACTTTTAACAACTCTCGTTCTTTACACTTCTTCT
Oryza sativaTGGCTGCTTGGCCTGTAGTAGGGATTTG
Ser264ThrCAAATCCCTACTACAGGCCAAGCAGCCAAGAAGAAGTGTAAAGAA362
AGT-ACTCGAGAGTTGTTAAAAGTAGCATATTGGAAGATTAATCGGCCAAAAT
AACCATGAGCGGCCACAATATTATAAGTTT
ATATGCTACTTTTAACA363
TGTTAAAAGTAGCATAT364
Triazine ResistantAGACTTATAATATTGTGGCTGCTCACGGTTATTTTGGTCGATTAAT365
D1ProteinCTTCCAATATGCTACTTTCAACAATTCTCGTTCTTTACACTTCTTCT
Zea maysTGGCTGCTtGGCCTGTAGTAGGGATCtG
Ser264ThrCAGATCCCTACTACAGGCCAAGCAGCCAAGAAGAAGTGTAAAGAA366
AGT-ACTCGAGAATTGTTGAAAGTAGCATATTGGAAGATTAATCGACCAAAAT
AACCGTGAGCAGCCACAATATTATAAGTCT
ATATGCTACTTTCAACA367
TGTTGAAAGTAGCATAT368
Triazine ResistantAAACTTACAACATTGTAGCTGCTCACGGTTATTTTGGCCGATTGAT369
D1ProteinTTTCCAATATGCTACTTTCAACAATTCTCGTTCTTTACATTTCTTCTT
Arabidopsis thalianaAGCGGCTTGGCCGGTAGTAGGTATTTG
Ser264ThrCAAATACCTACTACCGGCCAAGCCGCTAAGAAGAAATGTAAAGAA370
AGT-ACTCGAGAATTGITGAAAGTAGCATATTGGAAAATCAATCGGCCAAAAT
AACCGTGAGCAGCTACAATGTTGTAAGTTT
ATATGCTACTTTCAACA371
TGTTGAAAGTAGCATAT372
Triazine ResistantAAACTTATAACATCGTAGCCGCTCATGGTTATTTTGGCCGATTGAT373
D1ProteinCTTCCAATATGCTACTTTCAACAACTCTCGTTCGTTACACTTCTTCC
Nicotiana tabacumTAGCTGCTTGGCCTGTAGTAGGTATCTG
Ser264ThrCAGATACCTACTACAGGCCAAGCAGCTAGGAAGAAGTGTAACGAA374
AGT-ACTCGAGAGTTGTTGAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAACCATGAGCGGCTACGATGTTATAAGTTT
ATATGCTACTTTCAACA375
TGTTGAAAGTAGCATAT376
Triazine ResistantAAACTTATAATATCGTAGCCGCTCATGGTTATTTTGGCCGATTGAT377
D1ProteinCTTCCAATATGCTACTTTTAACAACTCTCGCTCTTTACATTTCTTCT
Papulus deltoidesTAGCTGCTTGGCCTGTAGTAGGTATCTG
Ser264ThrCAGATACCTACTACAGGCCAAGCAGGTAAGAAGAAATGTAAAGAG378
AGT-AGTCGAGAGTTGTTAAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAACCATGAGCGGCTACGATATTATAAGTTT
ATATGCTACTTTTAACA379
TGTTAAAAGTAGCATAT380
Triazine ResistantAAACTTATAATATCGTAGCCGCTCATGGTTATTTTGGCCGATTGAT381
D1ProteinCTTCCAATATGCTACTTTCAACAACTCTCGTTCGTTACACTTCTTCC
Petunia x hybridaTAGCTGGTTGGCCTGTAGTAGGTATCTG
Ser264ThrCAGATACCTACTACAGGCCAAGCAGCTAGGAAGAAGTGTAACGAA382
AGT-ACTCGAGAGTTGTTGAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAACCATGAGCGGCTACGATATTATAAGTTT
ATATGCTACTTTCAACA383
TGTTGAAAGTAGCATAT384
Triazine ResistantAAACTTATAATATCGTAGCTGCTCATGGTTATTTTGGCCGATTGAT385
D1ProteinCTTCCAATATGCTACTTTCAACAATTCTCGTTCTTTACATTTCTTCC
Magnolia pyramidataTAGCTGCTTGGCCTGTAGTAGGTATCTG
Ser264ThrCAGATACCTACTACAGGCCAAGCAGCTAGGAAGAAATGTAAAGAA386
AGT-ACTCGAGAATTGTTGAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAACCATGAGCAGCTACGATATTATAAGTTT
ATATGCTACTTTCAACA387
TGTTGAAAGTAGCATAT388
Triazine ResistantAAACCTATAATATTGTAGCAGCTCATGGTTATTTTGGCCGATTGAT389
D1ProteinCTTCCAATATGCTACTTTCAACAACTCTCGTTCTTTACATTTGTTCC
Medicago sativaTAGCTGCTTGGCCTGTAGTAGGTATCTG
Ser264ThrCAGATACCTACTACAGGCCAAGCAGCTAGGAAGAAATGTAAAGAA390
AGT-ACTCGAGAGTTGTTGAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAACCATGAGCTGCTACAATATTATAGGTTT
ATATGCTACTTTCAACA391
TGTTGAAAGTAGCATAT392
Triazine ResistantAAACCTATAATATTGTAGCTGCTCATGGTTATTTTGGCCGATTGAT393
D1ProteinCTTCCAATATGCAACTTTCAACAATTCTCGTTCTTTACATTTCTTCT
Glycine maxTAGCTGCTTGGCCTGTAGTAGGTATTTG
Ser264ThrCAAATACCTACTACAGGCCAAGCAGCTAAGAAGAAATGTAAAGAA394
AGT-ACTCGAGAATTGTTGAAAGTTGCATATTGGAAGATCAATCGGGCAAAA
TAACCATGAGCAGCTACAATATTATAGGTTT
ATATGCAACTTTCAACA395
TGTTGAAAGTTGCATAT396
Triazine ResistantAAACTTACAACATTGTAGCTGCTCACGGTTATTTTGGCCGATTGAT397
D1ProteinCTTCCAATATGCTACTTTCAACAATTCTCGTTCTTTACATTTCTTCT
Brassica napusTAGCGGCTTGGCCGGTAGTAGGTATTTG
Gly264ThrCAAATACCTACTACCGGCCAAGCCGCTAAGAAGAAATGTAAAGAA398
GGT-ACTCGAGAATTGTTGAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAACCGTGAGCAGCTACAATGTTGTAAGTTT
ATATGCTACTTTCAACA399
TGTTGAAAGTAGCATAT400
Triazine ResistantAAACTTATAATATTGTGGCCGCTCATGGTTATTTTGGCCGATTAAT401
D1ProteinCTTCCAATATGCTACTTTTAACAACTCTCGTTCTTTACACTTCTTCT
Oryza sativaTGGCTGCTTGGCCTGTAGTAGGGATTTG
Ser264IhrCAAATCCCTACTACAGGCCAAGCAGCCAAGAAGAAGTGTAAAGAA402
AGT-ACTCGAGAGTTGTTAAAAGTAGCATATTGGAAGATTAATCGGCCAAAAT
AACCATGAGCGGCCACAATATTATAAGTTT
ATATGCTACTTTTAACA403
TGTTAAAAGTAGCATAT404
Triazine ResistantAGACTTATAATATTGTGGCTGCTCACGGTTATTTTGGTCGATTAAT405
D1ProteinCTTCCAATATGCTACTTTCAACAATTCTCGTTCTTTACACTTCTTCT
Zea maysTGGCTGCTTGGCCTGTAGTAGGGATCTG
Ser264ThrCAGATCCCTACTACAGGCCAAGCAGCCAAGAAGAAGTGTAAAGAA406
AGT-ACTCGAGAATTGTTGAAAGTAGCATATTGGAAGATTAATCGACCAAAAT
AACCGTGAGCAGCCACAATATTATAAGTCT
ATATGCTACTTTCAACA407
TGTTGAAAGTAGCATAT408
Triazine ResistantAAACTTACAACATTGTAGCTGCTCACGGTTATTTTGGCCGATTGAT409
D1ProteinTTTCCAATATGCTACTTTCAACAATTCTCGTTCTTTACATTTCTTCTT
Arabidopsis thalianaAGCGGCTTGGCCGGTAGTAGGTATTTG
Ser264ThrCAAATACCTACTACCGGCCAAGCCGCTAAGAAGAAATGTAAAGAA410
AGT-ACTCGAGAATTGTTGAAAGTAGCATATTGGAAAATCAATCGGCCAAAAT
AACCGTGAGCAGCTACAATGTTGTAAGTTT
ATATGCTACTTTCAACA411
TGTTGAAAGTAGCATAT412
Triazine ResistantAAACCTACAATATTGTGGCTGCTCACGGTTATTTCGGCCGATTGAT413
D1ProteinCTTCCAGTATGCTACTTTCAACAACTCCCGTTCTTTACATTTCTTCT
Picea abiesTAGCTGCTTGGCCCGTAGCAGGTATCTG
Ser264ThrCAGATACCTGCTACGGGCCAAGCAGCTAAGAAGAAATGTAAAGAA414
AGT-ACTCGGGAGTTGTTGAAAGTAGCATACTGGAAGATCAATCGGCCGAAA
TAACCGTGAGCAGCCACAATATTGTAGGTTT
GTATGCTACTTTCAACA415
TGTTGAAAGTAGCATAC416
Triazine ResistantAAACCTATAATATTGTAGCTGCTCACGGTTATTTTGGCCGATTGAT417
D1ProteinCTTCCAATATGCTACTTTCAACAATTCTCGCTCTTTACATTTCTTCC
Vicia fabaTAGCTGCTTGGCCTGTAGTAGGTATCTG
Ser264ThrCAGATACCTACTACAGGCCAAGCAGCTAGGAAGAAATGTAAAGAG418
AGT-ACTCGAGAATTGTTGAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAACCGTGAGCAGCTACAATATTATAGGTTT
ATATGCTACTTTCAACA419
TGTTGAAAGTAGCATAT420
Triazine ResistantAGACTTATAATATTGTGGCTGCTCATGGTTATTTTGGCCGATTAAT421
D1ProteinCTTCCAATATGCTACTTTCAACAACTCTCGTTCTTTACACTTCTTCT
Hordeum vulgareTGGCTGCTTGGCCTGTAGTAGGAATCTG
Ser264ThrCAGATTCCTACTACAGGCCAAGCAGCCAAGAAGAAGTGTAAAGAA422
AGT-ACTCGAGAGTTGTTGAAAGTAGCATATTGGAAGATTAATCGGCCAAAA
TAACCATGAGCAGCCACAATATTATAAGTCT
ATATGCTACTTTCAACA423
TGTTGAAAGTAGCATAT424
Triazine ResistantAAACTTATAATATTGTGGCTGCTCATGGTTATTTTGGCCGATTAAT425
D1ProteinCTTCCAATATGCTACTTTCAACAACTCTCGTTCTTTACACTTCTTCT
Triticum aestivumTGGCTGCTTGGCCTGTAGTAGGAATCTG
Ser264ThrCAGATTCCTACTACAGGCCMGCAGCCAAGAAGAAGTGTAAAGAA426
AGT-ACTCGAGAGTTGTTGAAAGTAGCATATTGGAAGATTAATCGGCCAAAA
TAACCATGAGCAGCCACAATATTATAAGTTT
ATATGCTACTTTCAACA427
TGTTGAAAG+E TAGCATAT428
Triazine ResistantAAACTTATAATATTGTAGCTGCTCATGGTTATTTTGGCCGATTAATC429
D1ProteinTTCCAATATGCAACTTTCMCAATTCTCGTTCTTTACATTTCTTCCT
Vigna unguiculataAGCTGCTTGGCCTGTAGTAGGTATTTG
Ser264ThrCAAATACCTACTACAGGCCAAGCAGCTAGGAAGAAATGTAAAGAA430
AGT-ACTCGAGAATTGTTGAAAGTTGCATATTGGAAGATTAATCGGCCAAAAT
AACCATGAGCAGCTACAATATTATAAGTTT
ATATGCAACTTTCAACA431
TGTTGAAAGTTGCATAT432
Triazine ResistantAAACCTATAATATTGTAGCTGCTCACGGTTATTTTGGCCGATTGAT433
D1ProteinCTTCCAATATGCAACTTTCAACAACTCTCGTTCTTTACACTTCTTCT
Lotus japonicusTAGCTGCTTGGCCTGTTGTAGGTATCTG
Ser264ThrCAGATACCTACAACAGGCCAAGCAGCTAAGAAGAAGTGTAAAGAA434
AGT-ACTCGAGAGTTGTTGAAAGTTGCATATTGGAAGATCAATCGGCCAAAA
TAACCGTGAGCAGCTACAATATTATAGGTTT
ATATGCAACTTTCAACA435
TGTTGAAAGTTGCATAT436
Triazine ResistantAAACTTACAACATTGTAGCTGCTCACGGTTATTTTGGCCGATTGAT437
D1ProteinCTTCCAATATGCTACTTTCAACAATTCTCGTTCTTTACATTTCTTCT
Sinapis albaTAGCGGCTTGGCCGGTAGTAGGTATTTG
Ser264ThrCAAATACCTACTACCGGCCAAGCCGCTAAGAAGAAATGTAAAGAA438
AGT-ACTCGAGAATTGTTGAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAACCGTGAGCAGCTACAATGTTGTAAGTTT
ATATGCTACTTTCAACA439
TGTTGAAAGTAGCATAT440
Triazine ResistantAAACCTATAATATTGTAGCTGCTCACGGTTATTTTGGCCGATTGAT441
D1ProteinCTTCCAATATGCTACTTTCAACAATTCTCGCTCTTTACATTTCTTCC
Pisum sativumTAGCTGCTTGGCCTGTAGTAGGTATCTG
Ser264ThrCAGATACCTACTACAGGCCAAGCAGCTIAGGAAGAAATGTAAAGAG442
AGt-ACTCGAGAATTGTTGAAAGTAGCAtATTGGAAGATCAATCGGCCAAAA
TAACCGTGAGCAGCTACAATATTATAGGTTT
ATATGCTACTTTCAACA443
TGTTGAAAGTAGCATAT444
Triazine ResistantAAACTTATAATATCGTAGGTGCTCATGGTTATTTTGGTCGATTGAT445
D1ProteinCTTCCAATATGCTACTTTCAACAACTCTCGTTCTTTACACTTCTTCT
Spinacia oleraceaTAGCTGCTTGGCCTGIAGTAGGTATTTG
Ser264ThrCAAATACCTACTACAGGCCAAGCAGCTAAGAAGAAGTGTAAAGAA446
AGT-ACTCGAGAGTTGTTGAAAGTAGCATATTGGAAGATCAATCGACCAAAA
TAACCATGAGCAGGTACGATATTATAAGTTT
ATATGCTACTTTCAACA447
TGTTGAAAGTAGCATAT448
Triazine ResistantAAACTTATAACATCGTAGCCGCTCATGGTTATTTTGGCCGATTGAT449
D1ProteinCTTCCAATATGCTACTTTCAACAACTCTCGTTCGTTACACTTCTTCC
Nicotiana debneyiTAGCTGCTTGGCCTGTAGTAGGTATCTG
Ser264ThrCAGAtACCtACTACAGGCGAAGCAGCtAGGAAGAAGTGTAACGAA450
AGT-ACTCGAGAGtTGTTGAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAACCATGAGCGGCTACGATGTTATAAGTTT
ATATGCTACTTTCAACA451
TGTTGAAAGTAGCATAT452
Triazine ResistantAAACTTATAATATCGTAGCCGCTCATGGTTATTTTGGCCGATTGAT453
D1ProteinCTTCCAATATGCTACTTTCAACAACTCTCGTTCGTTACACTTCTTCC
Solanum nigrumTAGCTGCTTGGCCTGTAGTAGGTATCTG
Ser264ThrCAGATACCTACTACAGGCCAAGCAGCTAGGAAGAAGTGTAACGAA454
AGT-ACTCGAGAGTTGTTGAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
TAACCATGAGCGGCTACGATATTATAAGTTT
ATATGCTACTTTCAACA455
TGTTGAAAGTAGCATAT456
Triazine ResistantAAACTTATAACATCGTAGCCGCTCATGGTTATTTTGGCCGATTGAT457
D1ProteinCTTCCAATATGCTACTTTCAACAACTCTCGTICGTTACACTTCTTCC
NicotianaTAGCTGCTTGGCCTGTAGTAGGTATCTG
plumbaginifoliaCAGATACCTACTACAGGCCAAGCAGCTAGGAAGAAGTGTAACGAA458
Ser264ThrCGAGAGTTGTTGAAAGTAGCATATTGGAAGATCAATCGGCCAAAA
AGT-ACTTAACCATGAGCGGCTACGATGTTATAAGTTT
ATATGCTACTTTCAACA459
TGTTGAAAGTAGCATAT460

EXAMPLE 6

Engineering Male- or Female-Sterile Plants

[0123] Flower development in distantly related dicot plant species is increasingly better understood and appears to be regulated by a family of genes which encode regulatory proteins. These genes include, for example, AGAMOUS (AG), APETALA1 (AP1), and APETALA3 (AP3) and PISTILLATA (PI) in Arabidopsis thaliana, and DEFICIENS A (DEFA), GLOBOSA (GLO), SQUAMOSA (SQUA), and PLENA (PLE) in Antirrhinum majus. Genetic studies have shown that the DEFA, GLO and AP3 genes are essential for petal and stamen development. Sequence analysis of these genes revealed that the gene products contain a conserved MADS box region, a DNA-binding domain. Using these clones as probes, MADS box genes have also been isolated from other species including tomato, tobacco, petunia, Brassica napus, and maize.

[0124] Altering the expression of these genes results in altered floral morphology. For example, mutations in AP3 and PI result in male-sterile flowers because petals develop in place of stamens.

[0125] The attached tables disclose exemplary oligonucleotide base sequences which can be used to generate site-specific mutations that confer altered floral structures in plants. 16

TABLE 14
Oligonucleotides to produce male-sterile plants
Phenotype, Gene,
Plant & TargetedSEQ ID
AlterationAltering OligosNO:
Male-sterileTTGTCCTCTCCACCAAATCTCTTCAACAAAAAGATTAAACAAAGAG461
AP3AGAAGAATATGGCGTGAGGGAAGATCCAGATCAAGAGGATAGAGA
Arabidopsis thalianaACCAGACAAACAGACAAGTGACGTATTCAA
Arg3TermTTGAATACGTCACTTGTCTGTTTGTCTGGTTCTCTATCCTCTTGATC462
AGA-TGATGGATCTTCCCTCACGCCATATTCTTCTCTCTTIGTTTAATCTTTTT
GTTGAAGAGATTTGGTGGAGAGGACAA
ATATGGCGTGAGGGAAG463
CTTCCCTCACGCCATAT464
Male-sterileTCTCCACCAAATCTCTTCAACAAAAAGATTAAACAAAGAGAGAAGA465
AP3ATATGGCGAGAGGGTAGATCCAGATCAAGAGGATAGAGAACCAGA
Arabidopsis thalianaCAAACAGACAAGTGACGTATTCAAAGAGAA
Lys5TermTTCTCTTTGAATACGTCACTTGTCTGTTTGTCTGGTTCTCTATCCTC466
AAG-TAGTTGATCTGGATCTACCCTCTCGCCATATTCTTCTCTCTTTGTTTAAT
CTTTTTGTTGAAGAGATTTGGTGGAGA
CGAGAGGGTAGATCCAG467
CTGGATCTACCGTCTCG468
Male-sterileCCAAATCTCTTCAACAAAAAGATTAAACAAAGAGAGAAGAATATGG469
AP3CGAGAGGGAAGATCTAGATCAAGAGGATAGAGAAGCAGACAAACA
Arabidopsis thalianaGACAAGTGACGTATTCAAAGAGAAGGAATG
Gln7TermCATTCCTTCTCTTTGAATACGTCACTTGTCTGTTTGTCTGGTTCTCT470
CAG-TAGATCCTCTTGATCTAGATCTTCCCTCTCGCCATATTCTTCTCTCTTTG
TTTAATCTTTTTGTTGAAGAGATTTGG
GGAAGATCTAGATCAAG471
CTTGATCTAGATCTTCC472
Male-sterileCTCTTCAACAAAAAGATTAAACAAAGAGAGAAGAATATGGCGAGAG473
AP3GGAAGATCCAGATCTAGAGGATAGAGAACCAGACAAACAGAGAAG
Arabidopsis thalianaTGACGTATTCAAAGAGAAGGAATGGTTTAT
Lys9TermATAAACCATTCGTTCTCTTTGAATACGTCACTTGTCTGTTTGTCTGG474
AAG-TAGTTCTCTATCCTCTAGATCTGGATCTTCCCTCTCGCCATATTCTTCTC
TCTTTGTTTAATCTTTTTGTTGAAGAG
TCCAGATCTAGAGGATA475
TATCCTCTAGATCTGGA476
Male-sterileAGAGGGAAGATCGAGATGAAGAGGATAGAGAACGAGAGGAACCG477
AP3ACAAGTGACGTATTCTTAGAGAAGAAATGGTTTGTTCAAGAAAGCT
Brassica oleraceaCACGAGCTTACAGTTTTATGTGATGCTAGGG
Lys23TermCCCTAGCATCACATAAAACTGTAAGCTCGTGAGCTTTCTTGAACAA478
AAG-TAGACCATTTCTTCTCTAAGAATACGTCACTTGTCGGTTGGTCTGGTTC
TCTATCCTCTTGATCTGGATCTTCCCTCT
CGTATTCTTAGAGAAGA479
TCTTCTCTAAGAATACG480
Male-sterileGGGAAGATCCAGATCAAGAGGATAGAGAACCAGACCAACCGACAA481
AP3GTGACGTATTCTAAGTGAAGAAATGGTTTGTTCAAGAAAGCTCACG
Brassica oleraceaAGCTTACAGTTTTATGTGATGCTAGGGTTT
Arg24TermAAACCCTAGCATCACATAAAACTGTAAGCTCGTGAGCTTTCTTGAA482
AGA-TGACAAACCATTTCTTCACTTAGAATACGTCACTTGTGGGTTGGTCTGG
TTCTCTATCCTCTTGATCTGGATCTTCCC
ATTCTAAGTGAAGAAAT483
ATTTCTTCACTTAGAAT484
Male-sterileAAGATCCAGATCAAGAGGATAGAGAACCAGACCAACCGACAAGTG485
AP3ACGTATTCTAAGAGATGAAATGGTTTGTTCAAGAAAGCTCACGAGC
Brassica oleraceaTTACAGTTTTATGTGATGCTAGGGTTTCGA
Arg25TermTCGAAACCCTAGCATCACATAAAACTGTAAGCTCGTGAGCTTTCTT486
AGA-TGAGAACAAACCATTTCATCTCTTAGAATACGTCACTTGTCGGTTGGTC
TGGTTCTCTATGCTCTTGATCTGGATCTT
CTAAGAGATGAAATGGT487
ACCATTTCATCTCTTAG488
Male-sterileTCAAGAGGATAGAGAACCAGACCAACCGACAAGTGACGTATTCTA489
AP3AGAGAAGAAATGGTTAGTTCAAGAAAGCTCACGAGCTTACAGTTTT
Brassica oleraceaATGTGATGCTAGGGTTTCGATTATCATGTT
Leu28TermAACATGATAATCGAAACCCTAGCATCACATAAAACTGTAAGCTCGT490
TTG-TAGGAGCTTTCTTGAACTAACCATTTCTTCTCTTAGAATACGTCACTTGT
CGGTTGGTCTGGTTCTCTATCCTCTTGA
AAATGGTTAGTTCAAGA491
TCTTGAACTAACCATTT492
Male-sterileGGCTCGAGGGAAGATCCAGATTAAGAGGATAGAGAACCAAACAAA493
AP3CAGGCAGGTCACCTAGTCCAAGAGAAGAAATGGTTTGTTCAAGAA
Brassica napusAGCACACGAGCTCTCTGTTCTCTGTGATGCT
Tyr21TermAGCATCACAGAGAACAGAGAGCTCGTGTGCTTTCTTGAACAAACC494
TAC-TAGATTTCTTCTCTTGGACTAGGTGACCTGCCTGTTTGTTTGGTTCTCTA
TCCTCTTAATCTGGATCTTCCCTCGAGCC
GTCACCTAGTCCAAGAG495
CTCTTGGACTAGGTGAC496
Male-sterileCGAGGGAAGATCCAGATTAAGAGGATAGAGAACCAAACAAACAGG497
AP3CAGGTCACCTACTCCTAGAGAAGAAATGGTTTGTTCAAGAAAGCAC
Brassica napusACGAGCTCTCTGTTCTCTGTGATGCTAAAG
Lys23TermCTTTAGCATCACAGAGAACAGAGAGCTCGTGTGCTTTCTTGAACAA498
AAG-TAGACCATTTCTTCTCTAGGAGTAGGTGACCTGCCTGTTTGTTTGGTTC
TCTATCCTCTTAATCTGGATCTTCCCTCG
CCTACTCCTAGAGAAGA499
TCTTCTCTAGGAGTAGG500
Male-sterileGGGAAGATCCAGATTAAGAGGATAGAGAACCAAACAAACAGGCAG501
AP3GTCACCTACTCCAAGTGAAGAAATGGTTTGTTCAAGAAAGCACACG
Brassica napusAGCTCTCTGTTCTCTGTGATGCTAAAGTTT
Arg24TermAAACTTTAGCATCACAGAGAACAGAGAGCTCGTGTGCTTTCTTGAA502
AGA-TGACAAACCATTTGTTCACTTGGAGTAGGTGACCTGCCTGTTTGTTTGG
TTCTCTATCCTCTTAATCTGGATCTTCCC
ACTCCAAGTGAAGAAAT503
ATTTCTTCACTTGGAGT504
Male-sterileAAGATCCAGATTAAGAGGATAGAGAACCAAACAAACAGGCAGGTC505
AP3ACCTACTCCAAGAGATGAAATGGTTTGTTCAAGAAAGCACACGAG
Brassica napusCTCTCTGTTCTCTGTGATGCTAAAGTTTCCA
Arg25TermTGGAAACTTTAGCATCACAGAGAACAGAGAGCTCGTGTGCTTTCTT506
AGA-TGAGAACAAACCATTTCATCTCTTGGAGTAGGTGACCTGCCTGTTTGTT
TGGTTCTCTATCCTCTTAATCTGGATCTT
CCAAGAGATGAAATGGT507
ACCATTTCATCTCTTGG508
Male-sterileGGAGAGAAAGGAAAGCTGGAAGAAGAAAACAAGAGCAGTAGTGG509
DEFATAGTGGTTCGATGGCTTGAGGGAAGATCCAGATTAAGAGGATAGA
Antirrhinum majusGAACCAAACAAACAGGCAGGTCACCTACTCCA
Arg3TermTGGAGTAGGTGACCTGCCTGTTTGTTTGGTTCTCTATCCTCTTAAT510
CGA-TGACTGGATCTTCCCTCAAGCCATCGAACCACTACCACTACTGCTCTTG
TTTTCTTCTTCCAGCTTTCCTTTCTCTCC
CGATGGCTTGAGGGAAG511
CTTCCCTCAAGCCATCG512
Male-sterileAAAGGAAAGCTGGAAGAAGAAAACAAGAGCAGTAGTGGTAGTGGT513
DEFATCCATGGCTCGAGGGTAGATCCAGATTAAGAGGATAGAGAACCAA
Antirrhinum majusACAAACAGGCAGGTCACCTACTCCAAGAGAA
Lys5TermTTCTCTTGGAGTAGGTGACCTGCCTGTTTGTTTGGTTCTCTATCCT514
AAG-TAGCTTAATCTGGATCTACCCTCGAGCCATCGAACCACTAGCACTACTG
CTCTTGTTTTCTTCTTCCAGCTTTCCTTT
CTCGAGGGTAGATCCAG515
CTGGATCTACCCTCGAG516
Male-sterileAAGCTGGAAGAAGAAAACAAGAGCAGTAGTGGTAGTGGTTCGATG517
DEFAGCTCGAGGGAAGATCTAGATTAAGAGGATAGAGAACCAAACAAAC
Antirrhinum majusAGGCAGGTCACCTACTCCAAGAGAAGAAATG
Gln7TermCATTTCTTCTCTTGGAGTAGGTGACCTGCCTGTTTGTTTGGTTCTC518
CAG-TAGTATCCTCTTAATCTAGATCTTCCCTCGAGCCATCGAACCACTACCA
CTACTGCTCTTGTTTTCTTCTTCCAGCTT
GGAAGATCTAGATTAAG519
CTTAATCTAGATCTTCC520
Male-sterileGAAGAAGAAAACAAGAGCAGTAGTGGTAGTGGTTCGATGGCTCGA521
DEFAGGGAAGATCCAGATTTAGAGGATAGAGAACCAAACAAACAGGCAG
Antirrhinum majusGTCACCTACTCCAAGAGAAGAAATGGTTTGT
Lys9TermACAAACCATTTCTTCTCTTGGAGTAGGTGACCTGCCTGTTTGTTTG522
AAG-TAGGTTCTCTATCCTCTAAATCTGGATCTTCCCTCGAGCCATCGAACCA
CTACCACTACTGCTCTTGTTTTCTTCTTC
TCCAGATTTAGAGGATA523
TATCCTCTAAATCTGGA524
Male-sterileTCAGTAATTCTTAAGATCTCAAACTTTGAGCAAAAAGAAAAAAAAAC525
AP3TATGGCTCGTGGGTAGATCCAGATCAAGAGAATAGAGAACCAAAC
Nicotiana tabacumAAACAGACAAGTCACTTATTCTAAGAGAA
Lys5TermTTCTCTTAGAATAAGTGACTTGTCTGTTTGTTTGGTTCTCTATTCTC526
AAG-TAGTTGATCTGGATCTACCCACGAGCCATAGTTTTTTTTTCTTTTTGCTC
AAAGTTTGAGATCTTAAGAATTACTGA
CTCGTGGGTAGATCCAG527
CTGGATCTACCCACGAG528
Male-sterileATTCTTAAGATCTCAAACTTTGAGCAAAAAGAAAAAAAAACTATGGC529
AP3TCGTGGGAAGATCTAGATCAAGAGAATAGAGAACCAAACAAACAG
Nicotiana tabacumACAAGTCACTTATTCTAAGAGAAGAAATG
Gln7TermCATTTCTTCTCTTAGAATAAGTGACTTGTCTGTTTGTTTGGTTCTCT530
CAG-TAGATTCTCTTGATCTAGATCTTCCCACGAGCCATAGTTTTTTTTTCTTT
TTGCTCAAAGTTTGAGATCTTAAGAAT
GGAAGATCTAGATCAAG531
CTTGATCTAGATCTTCC532
Male-sterileAAGATCTCAAACTTTGAGCAAAAAGAAAAAAAAACTATGGCTCGTG533
AP3GGAAGATCCAGATCTAGAGAATAGAGAACCAAACAAACAGACAAG
Nicotiana tabacumTCACTTATTCTAAGAGAAGAAATGGACTTT
Lys9TermAAAGTCCATTTCTTCTCTTAGAATAAGTGACTTGTCTGTTTGTTTGG534
AAG-TAGTTCTCTATTCTCTAGATCTGGATCTTCCCACGAGCCATAGTTTTTTT
TTCTTTTTGCTCAAAGTTTGAGATCTT
TCCAGATCTAGAGAATA535
TATTCTCT+E,un AGATCTGGA536
Male-sterileATCTCAAACTTTGAGCAAAAAGAAAAAAAAACTATGGCTCGTGGGA537
AP3AGATCCAGATCAAGTGAATAGAGAACCAAACAAACAGACAAGTCA
Nicotiana tabacumCTTATTCTAAGAGAAGAAATGGACTTTTCA
Arg10TermTGAAAAGTCCATTTCTTCTCTTAGAATAAGTGACTTGTCTGTTTGTT538
AGA-TGATGGTTCTCTATTCACTTGATCTGGATCTTCCCACGAGCCATAGTTT
TTTTTTCTTTTTGCTCAAAGTTTGAGAT
AGATCAAGTGAATAGAG539
CTCTATTCACTTGATCT540
Male-sterileGGCTCGAGGAAAGATCCAGATCAAGAGAATAGAGAACACAACGAA541
AP3CAGACAAGTAACTTAGTCAAAACGAAGGGATGGTCTTTTCAAGAAG
Medicago sativaGCCAATGAGCTCACTGTTCTTTGTGATGCT
Tyr21TermAGCATCACAAAGAACAGTGAGCTCATTGGCCTTCTTGAAAAGACCA542
TAC-TAGTCCCTTCGTTTTGACTAAGTTACTTGTCTGTTCGTTGTGTTCTCTAT
TCTCTTGATCTGGATCTTTCCTCGAGCC
GTAACTTAGTCAAAACG543
CGTTTTGACTAAGTTAC544
Male-sterileCTCGAGGAAAGATCCAGATCAAGAGAATAGAGAACACAACGAACA545
AP3GACAAGTAACTTACTGAAAACGAAGGGATGGTCTTTTCAAGAAGG
Medicago sativaCCAATGAGCTCACTGTTCTTTGTGATGCTAA
Ser22TermTTAGCATCACAAAGAACAGTGAGCTCATTGGCCTTCTTGAAAAGAC546
TCA-TGACATCCCTTCGTTTTCAGTAAGTTACTTGTCTGTTCGTTGTGTTCTCT
ATTCTCTTGATCTGGATCTTTCCTCGAG
AACTTACTGAAAACGAA547
TTCGTTTT+E,un CAGTAAGTT548
Male-sterileCGAGGAAAGATCCAGATCAAGAGAATAGAGAACACAACGAACAGA549
AP3CAAGTAACTTACTCATAACGAAGGGATGGTCTTTTCAAGAAGGCCA
Medicago sativaATGAGCTCACTGTTCTTTGTGATGCTAAGG
Lys23TermCCTTAGCATCACAAAGAACAGTGAGCTCATTGGCCTTCTTGAAAAG550
AAA-TAAACCATCCCTTCGTTATGAGTAAGTTACTTGTCTGTTCGTTGTGTTCT
CTATTCTCTTGATCTGGATCTTTCCTCG
CTTACTCATAACGAAGG551
CCTTCGTTATGAGTAAG552
Male-sterileGGAAAGATCCAGATCAAGAGAATAGAGAACACAACGAACAGACAA553
AP3GTAACTTACTCAAAATGAAGGGATGGTCTTTTCAAGAAGGCCAATG
Medicago sativaAGCTCACTGTTCTTTGTGATGCTAAGGTTT
Arg24TermAAACCTTAGCATCACAAAGAACAGTGAGCTCATTGGCCTTCTTGAA554
CGA-TGAAAGACCATCCCTTCATTTTGAGTAAGTTACTTGTCTGTTCGTTGTGT
TCTCTATTCTCTTGATCTGGATCTTTCC
ACTCAAAATGAAGGGAT555
ATCCCTTCATTTTGAGT556
Male-sterileGGCTCGTGGTAAGATCCAGATCAAGAAAATAGAAAACCAAACAAAT557
DEF4AGGCAAGTGACTTAGTCAAAGAGAAGAAATGGGCTATTCAAGAAG
Solanum tuberosumGCTAATGAACTTACAGTTCTTTGTGATGCT
Tyr21TermAGCATCACAAAGAACTGTAAGTTCATTAGCCTTCTTGAATAGCCCA558
TAT-TAGTTTCTTCTCTTTGACTAAGTCACTTGCCTATTTGTTTGGTTTTCTATT
TTCTTGATCTGGATCTTACCACGAGCC
GTGACTTAGTCAAAGAG559
CTCTTTGACTAAGTCAC560
Male-sterileCTCGTGGTAAGATCCAGATCAAGAAAATAGAAAACCAAACAAATAG561
DEF4GCAAGTGACTTATTGAAAGAGAAGAAATGGGCTATTCAAGAAGGC
Solanum tuberosumTAATGAACTTACAGTTCTTTGTGATGCTAA
Ser22TermTTAGCATCACAAAGAACTGTAAGTTCATTAGCCTTCTTGAATAGCC562
TCA-TGACATTTCTTCTCTTTCAATAAGTCACTTGCCTATTTGTTTGGTTTTCTA
TTTTCTTGATCTGGATCTTACCACGAG
GACTTATTGAAAGAGAA563
TTCTCTTTCAATAAGTC564
Male-sterileCGTGGTAAGATCCAGATCAAGAAAATAGAAAACCAAACAAATAGG565
DEF4CAAGTGACTTATTCATAGAGAAGAAATGGGCTATTCAAGAAGGCTA
Solanum tuberosumATGAACTTACAGTTCTTTGTGATGCTAAAG
Lys23TermCTTTAGCATCACAAAGAACTGTAAGTTCATTAGCCTTCTTGAATAG566
AAG-TAGCCCATTTCTTCTCTATGAATAAGTCACTTGCCTATTTGTTTGGTTTT
CTATTTTCTTGATCTGGATCTTACCACG
CTTATTCATAGAGAAGA567
TCTTCTCTATGAATAAG568
Male-sterileGGTAAGATCCAGATCAAGAAAATAGAAAACCAAACAAATAGGCAA569
DEF4GTGACTTATTCAAAGTGAAGAAATGGGCTATTCAAGAAGGCTAATG
Solanum tuberosumAACTTACAGTTCTTTGTGATGCTAAAGTTT
Arg24TermAAACTTTAGCATCACAAAGAACTGTAAGTTCATTAGCCTTCTTGAAT570
AGA-TGAAGCCCATTTCTTCACTTTGAATAAGTCACTTGCCTATTTGTTTGGTT
TTCTATTTTCTTGATCTGGATCTTACC
ATTCAAAGTGAAGAAAT571
ATTTCTTCAGTTTGAAT572
Male-sterileGCTAATGAACTTACTGTTCTTTGTGATGCTAAAGTTTCAATTGTTAT573
AP3GATTTCTAGTACTTGAAAACTTCATGAGTTTATAAGTCCCTCTATCA
LycopersiconCGACCAAACAATTGTTCGATCTGTACC
esculentumGGTACAGATCGAACAATTGTTTGGTCGTGATAGAGGGACTTATAAA574
Gly27TermCTCATGAAGTTTTCAAGTACTAGAAATCATAACAATTGAAACTTTAG
GGA-TGACATCACAAAGAACAGTAAGTTCATTAGC
CTAGTACTTGAAAACTT575
AAGTTTTCAAGTACTAG576
Male-sterileAATGAACTTACTGTTCTTTGTGATGCTAAAGTTTCAATTGTTATGAT577
AP3TTCTAGTACTGGATAACTTCATGAGTTTATAAGTCCCTCTATCACGA
LycopersiconCCAAACAATTGTTCGATCTGTACCAGA
esculentumTCTGGTACAGATCGAACAATTGTTTGGTCGTGATAGAGGGACTTAT578
Lys28TermAAACTCATGAAGTTATCCAGTACTAGAAATCATAACAATTGAAACTT
AAA-TAATAGCATCACAAAGAACAGTAAGTTCATT
GTACTGGATAACTTCAT579
ATGAAGTTATCCAGTAC580
Male-sterileACTGTTCTTTGTGATGCTAAAGTTTCAATTGTTATGATTTCTAGTAC581
AP3TGGAAAACTTCATTAGTTTATAAGTCCCTCTATCACGACCAAACAAT
LycopersiconTGTTCGATCTGTACCAGAAGACTATTG
esculentumCAATAGTCTTCTGGTACAGATCGAACAATTGTTTGGTCGTGATAGA582
Glu31TermGGGACTTATAAACTAATGAAGTTTTCCAGTACTAGAAATCATAACA
GAG-TAGATTGAAACTTTAGCATCACAAAGAACAGT
AACTTCATTAGTTTATA583
TATAAACTAATGAAGTT584
Male-sterileATTGTTATGATTTCTAGTACTGGAAAACTTCATGAGTTTATAAGTCC585
AP3CTCTATCACGACCTAACAATTGTTCGATCTGTACCAGAAGACTATT
LycopersiconGGAGTTGATATTTGGACTACTCACTATG
esculentumCATAGTGAGTAGTCCAAATATCAACTCCAATAGTCTTCTGGTACAG586
Lys40TermATCGAACAATTGTTAGGTCGTGATAGAGGGACTTATAAACTCATGA
AAA-TAAAGTTTTCCAGTACTAGAAATCATAACAAT
TCACGACCTAACAATTG587
CAATTGTTAGGTCGTGA588
Male-sterileGGGGCGGGGGAAGATTGAGATAAAGCGGATCGAGAACGCCACCA589
AP3ACAGGCAGGTGACCTAGTCCAAGCGCCGGTCGGGGATCATGAAG
Triticum aestivumAAGGCGCGGGAGCTCACCGTGCTCTGCGACGCC
Tyr21TermGGCGTCGCAGAGCACGGTGAGCTCCCGCGCCTTCTTCATGATCC590
TAC-TAGCCGACCGGCGCTTGGACTAGGTCACCTGCCTGTTGGTGGCGTTCT
CGATCCGCTTTATCTCAATCTTCCCCCGCCCC
GTGACCTAGTCCAAGCG591
CGCTTGGACTAGGTCAC592
Male-sterileCGGGGGAAGATTGAGATAAAGCGGATCGAGAACGCCACCAACAG593
AP3GCAGGTGACCTACTCCTAGCGCCGGTCGGGGATCATGAAGAAGG
Triticum aestivumCGCGGGAGCTCACCGTGCTCTGCGACGCCCAGG
Lys23TermCCTGGGCGTCGCAGAGCACGGTGAGCTCCCGCGCCTTCTTCATG594
AAG-TAGATCCCCGACCGGCGCTAGGAGTAGGTCACCTGCCTGTTGGTGGC
GTTCTCGATCCGCTTTATCTCAATCTTCCCCCG
CCTACTCCTAGCGCCGG595
CCGGCGCTAGGAGTAGG596
Male-sterileTTGAGATAAAGCGGATCGAGAACGCCACCAACAGGCAGGTGACCT597
AP3ACTCGAAGCGCCGGTAGGGGATCATGAAGAAGGCGCGGGAGCTC
Triticum aestivumACCGTGCTCTGCGACGCCCAGGTCGCCATCAT
Ser26TermATGATGGCGACCTGGGCGTCGCAGAGCACGGTGAGCTCCCGCGC598
TCG-TAGCTTCTTCATGATCCCCTACCGGCGCTTGGAGTAGGTCACCTGCCT
GTTGGTGGCGTTGTCGATCCGCTTTATCTCAA
GCGCCGGTAGGGGATCA599
TGATCCCCTACCGGCGC600
Male-sterileCGGATCGAGAACGCCACCAACAGGCAGGTGACCTACTCCAAGCG601
AP3CCGGTCGGGGATCATGTAGAAGGCGCGGGAGCTCACCGTGCTCT
Triticum aestivumGCGACGCCCAGGTCGCCATCATCATGTTCTCCT
Lys30TermAGGAGAACATGATGATGGCGACCTGGGCGTCGCAGAGCACGGTG602
AAG-TAGAGCTCCCGCGCCTTCTACATGATCCCCGACCGGCGCTTGGAGTAG
GTCACCTGCCTGTTGGTGGCGTTGTCGATCCG
GGATCATGTAGAAGGCG603
CGCCTTCTACATGATCC604
Male-sterileGGGGCGCGGCAAGATCGAGATCAAGCGGATCGAGAACGCCACCA605
Silky1ACCGCCAGGTGACCTAGTCCAAGCGCCGGACGGGGATCATGAAG
Zea maysAAGGCACGCGAGCTCACCGTGCTCTGCGACGCC
Tyr21TermGGCGTCGCAGAGCACGGTGAGCTCGCGTGCCTTCTTCATGATCCC606
TAG-TAGCGTCCGGCGCTTGGACTAGGTCACCTGGCGGTTGGTGGCGTTCT
CGATCGGCTTGATCTCGATCTTGCCGCGCCCC
GTGACCTAGTCCAAGCG607
CGCTTGGACTAGGTCAC608
Male-sterileCGCGGCAAGATCGAGATCAAGCGGATCGAGAACGCCACCAACCG609
Silky1CCAGGTGACCTACTCCTAGCGCCGGACGGGGATCATGAAGAAGG
Zea maysCACGCGAGCTCACCGTGCTCTGCGACGCCCAGG
Lys23TermCCTGGGCGTCGCAGAGCACGGTGAGCTCGCGTGCCTTCTTCATG610
AAG-TAGATCCCCGTCCGGCGCTAGGAGTAGGTCACCTGGCGGTTGGTGGC
GTTCTCGATCCGCTTGATCTCGATCTTGCCGCG
CCTACTCCTAGCGCCGG611
CCGGCGCTAGGAGTAGG612
Male-sterileCGGATCGAGAACGCCACCAACCGCCAGGTGACCTACTCCAAGCG613
Silky1CCGGACGGGGATCATGTAGAAGGCACGCGAGCTCACCGTGCTCT
Zea maysGCGACGCCCAGGTCGCCATCATCATGTTCTCCT
Lys30TermAGGAGAACATGATGATGGCGACCTGGGCGTCGCAGAGCACGGTG614
AAG-TAGAGCTCGCGTGCCTTCTACATGATCCCGGTCCGGCGCTTGGAGTAG
GTCACCTGGCGGTTGGTGGCGTTCTCGATCCG
GGATCATGTAGAAGGCA615
TGCCTTCTACATGATCC616
Male-sterileATCGAGAACGCCACCAACCGCCAGGTGACGTACTCCAAGCGCCG617
Silky1GACGGGGATCATGAAGTAGGCACGCGAGCTCACCGTGCTCTGCG
Zea maysACGCCCAGGTCGCCATCATCATGTTCTCCTCCA
Lys31TermTGGAGGAGAACATGATGATGGCGACCTGGGCGTCGCAGAGCACG618
AAG-TAGGTGAGCTCGCGTGCCTACTTCATGATCCCCGTCCGGCGCTTGGAG
TAGGTCACCTGGCGGTTGGTGGCGTTCTCGAT
TCATGAAGTAGGCACGC619
GCGTGCCTACTTCATGA620
Male-sterileGCTAGCTGCATTGTCCGGCGAGAGAGATAGCTGCTGCAGGGGGC621
AP3GGCCATGGGGAGGGGCTAGATCGAGATCAAGCGGATCGAGAACG
Oryza sativaCGACCAACAGGCAGGTGACCTACTCGAAGCGCC
Lys5TermGGCGCTTGGAGTAGGTCACCTGCCTGTTGGTCGCGTTCTCGATCC622
AAG-TAGGCTTGATCTCGATCTAGCCCGTCCCCATGGCGGCCCCCTGCAGCA
GCTATCTCTCTCGCCGGACAATGCAGCTAGC
GGAGGGGCTAGATCGAG623
CTCGATCTAGCCCCTCC624
Male-sterileTGCATTGTCCGGCGAGAGAGATAGCTGCTGCAGGGGGCGGCCAT625
AP3GGGGAGGGGCAAGATCTAGATCAAGCGGATCGAGAACGCGACCA
Oryza sativaACAGGCAGGTGACCTACTCGAAGCGCCGCACGG
Glu7TermCCGTGCGGCGCTTCGAGTAGGTCACCTGCCTGTTGGTCGCGTTCT626
GAG-TAGCGATCCGCTTGATCTAGATCTTGCCCCTCCCCATGGCCGCCCCCT
GCAGCAGCTATCTCTCTCGCCGGACAATGCA
GCAAGATCTAGATCAAG627
CTTGATCTAGATCTTGC628
Male-sterileGTCCGGCGAGAGAGATAGCTGCTGCAGGGGGCGGCCATGGGGA629
AP3GGGGCAAGATCGAGATCTAGCGGATCGAGAACGCGACCAACAGG
Oryza sativaCAGGTGACCTACTCGAAGCGCCGCACGGGGATCA
Lys9TermTGATCCCCGTGCGGCGCTTCGAGTAGGTCACCTGCCTGTTGGTCG630
AAG-TAGCGTTCTCGATCCGCTAGATCTCGATCTTGCCCCTCCCCATGGCCG
CCCCCTGCAGCAGCTATCTCTCTCGCCGGAC
TCGAGATCTAGCGGATC631
GATCCGCTAGATCTCGA632
Male-sterileGAGAGATAGCTGCTGCAGGGGGCGGCCATGGGGAGGGGCAAGA633
AP3TCGAGATCAAGCGGATCTAGAACGCGACCAACAGGCAGGTGACCT
Oryza sativaACTCGAAGCGCCGCACGGGGATCATGAAGAAGG
Glu12TermCCTTCTTCATGATCCCCGTGCGGCGCTTCGAGTAGGTCACCTGCC634
GAG-TAGTGTTGGTCGCGTTCTAGATCCGCTTGATCTCGATCTTGCCCCTCCC
CATGGCGGCCCCCTGCAGCAGCTATCTCTC
AGCGGATCTAGAACGCG635
CGCGTTCTAGATCCGCT636

[0126] 17

TABLE 15
Oligonucleotides to produce male-sterile plants
Phenotype, Gene,
Plant & TargetedSEQ ID
AlterationAltering OligosNO:
Male-sterileTCTGTACTAATCAAATTTTGCCCTAAACGTTTTTGGCTTTGGAGCA637
AGGCAATCACGGCGTAGCAATCGGAGCTAGGAGGAGATTCCTCTCC
Arabidopsis thalianaCTTGAGGAAATCTGGGAGAGGAAAGATCGAA
Tyr35TermTTCGATCTTTCCTCTCCCAGATTTCCTCAAGGGAGAGGAATCTCCT638
TAG-TAGCCTAGGTCCGATTGCTACGCCGTGATTGCTGCTCCAAAGCCAAAA
ACGTTTAGGGCAAAATTTGATTAGTACAGA
ACGGCGTAGCAATCGGA639
TCCGATTGCTACGCCGT640
Male-sterileCTGTACTAATCAAATTTTGCCCTAAACGTTTTTGGCTTTGGAGCAG641
AGCAATCACGGCGTACTAATCGGAGCTAGGAGGAGATTCCTCTCCCT
Arabidopsis thalianaTGAGGAAATCTGGGAGAGGAAAGATCGAAA
Gln36TermTTTCGATCTTTCCTCTCCCAGATTTCCTCAAGGGAGAGGAATCTCC642
CAA-TAATCCTAGCTCCGATTAGTACGCCGTGATTGCTGCTCCAAAGCCAAA
AACGTTTAGGGCAAAATTTGATTAGTACAG
CGGCGTACTAATCGGAG643
CTCCGATTAGTACGCCG644
Male-sterileACTAATCAAATTTTGCCCTAAACGTTTTTGGCTTTGGAGCAGCAAT645
AGCACGGCGTACCAATAGGAGCTAGGAGGAGATTCCTCTCCCTTGA
Arabidopsis thalianaGGAAATCTGGGAGAGGAAAGATCGAAATCAA
Ser37TermTTGATTTCGATCTTTCCTCTCCCAGATTTCCTCAAGGGAGAGGAAT646
TCG-TAGCTCCTCCTAGCTCCTATTGGTACGCCGTGATTGCTGCTCCAAAGC
CAAAAACGTTTAGGGCAAAATTTGATTAGT
GTACCAATAGGAGCTAG647
CTAGCTCCTATTGGTAC648
Male-sterileTAATCAAATTTTGCCCTAAACGTTTTTGGCTTTGGAGCAGCAATCA649
AGCGGCGTACCAATCGTAGCTAGGAGGAGATTCCTCTCCCTTGAGGA
Arabidopsis thalanaAATCTGGGAGAGGAAAGATCGAAATCAAAC
Glu38TermGTTTGATTTCGATCTTTCCTCTCCCAGATTTCCTCAAGGGAGAGGA650
GAG-TAGATCTCCTCCTAGCTACGATTGGTACGCCGTGATTGCTGCTCCAAA
GCCAAAAACGTTTAGGGCAAAATTTGATTA
ACCAATCGTAGCTAGGA651
TCCTAGCTACGATTGGT652
Male-sterileCTCTCCCACTTCTTTTCGGTGGTTTATTCATTTGGTGACGATATCA653
AGCAGAAGCAATGGATTAAGGTGGGAGTAGTCACGATGCAGAGAGT
Brassica napusAGCAAGAAGATAGGTAGAGGGAAGATAGAGA
Glu3TermTCTCTATCTTCCCTCTACCTATCTTCTTGCTACTCTCTGCATCGTGA654
GAA-TAACTACTCCCACCTTAATCCATTGCTTCTGTGATATCGTCACCAAATG
AATAAACCACCGAAAAGAAGTGGGAGAG
CAATGGATTAAGGTGGG655
CCCACCTTAATCCATTG656
Male-sterileTATTCATTTGGTGACGATATCACAGAAGCAATGGATGAAGGTGGG657
AGAGTAGTCACGATGCATAGAGTAGCAAGAAGATAGGTAGAGGGAA
Brassica napusGATAGAGATAAAGAGGATAGAGAACACAACAA
Glu11TermTTGTTGTGTTCTCTATCCTCTTTATCTCTATCTTCCCTCTACCTATC658
GAG-TAGTTCTTGCTACTCTATGCATCGTGACTACTCCCACCTTCATCCATTG
CTTCTGTGATATCGTCACCAAATGAATA
ACGATGCATAGAGTAGC659
GCTACTCTATGCATCGT660
Male-sterileGGTGACGATATCACAGAAGCAATGGATGAAGGTGGGAGTAGTCA661
AGCGATGCAGAGAGTAGCTAGAAGATAGGTAGAGGGAAGATAGAGA
Brassica napusTAAAGAGGATAGAGAACACAACAAATCGTCAAG
Lys14TermCTTGACGATTTGTTGTGTTCTCTATCCTCTTTATCTCTATCTTCCCT662
AAG-TAGGTACCTATCTTCTAGCTACTCTCTGCATCGTGACTACTCCCACCTT
CATCCATTGCTTCTGTGATATCGTCACC
AGAGTAGCTAGAAGATA663
TATCTTCTAGCTAGTCT664
Male-sterileGACGATATCACAGAAGCAATGGATGAAGGTGGGAGTAGTCACGA665
AGTGCAGAGAGTAGCAAGTAGATAGGTAGAGGGAAGATAGAGATAAA
Brassica napusGAGGATAGAGAACACAACAAATCGTCAAGTAA
Lys15TermTTACTTGACGATTTGTTGTGTTCTCTATCCTCTTTATCTCTATCTTC666
AAG-TAGCCTCTACCTATCTACTTGCTACTCTCTGCATCGTGACTACTCCCAC
CTTCATCCATTGCTTCTGTGATATCGTC
GTAGCAAGTAGATAGGT667
ACCTATCTACTTGCTAC668
Male-sterileCAACCAAAAAACTTAAAAATCTTCTCTTTCCTTTCCTTACAAGGTGA669
AGAGTAATGGACTTCTAAAGTGATCTAACCAGAGAGATCTCACCACAA
LycopersiconAGGAAACTAGGAAGGGGGAAAATTGAGA
esculentumTCTCAATTTTCCCCCTTCCTAGTTTCCTTTGTGGTGAGATCTCTCT670
Glu4TermGGTTAGATCACTTTAGAAGTCCATTACTTCACCTTGTAAGGAAAGG
CAA-TAAAAAGAGAAGATTTTTAAGTTTTTTGGTTG
TGGACTTC+E,unc TAAAGTGAT671
ATCACTTTAGAAGTCCA672
Male-sterileAAAATCTTCTCTTTCCTTTCCTTACAAGGTGAAGTAATGGACTTCC673
AGAAAGTGATCTAACCTGAGAGATCTCACCACAAAGGAAACTAGGAA
LycopersiconGGGGGAAAATTGAGATCAAAAGGATCGAAA
esculentumTTTCGATCCTTTTGATCTCAATTTTCCCCCTTCCTAGTTTCCTTTGT674
Arg9TermGGTGAGATCTCTCAGGTTAGATCACTTTGGAAGTCCATTACTTCAC
AGA-TGACTTGTAAGGAAAGGAAAGAGAAGATTTT
ATCTAACCTGAGAGATC675
GATCTCTCAGGTTAGAT676
Male-sterileATCTTCTCTTTCCTTTCCTTACAAGGTGAAGTAATGGACTTCCAAA677
AGGTGATCTAACCAGATAGATCTCACCACAAAGGAAACTAGGAAGGG
LycopersiconGGAAAATTGAGATCAAAAGGATCGAAAACA
esculentumTGTTTTCGATCCTTTTGATCTCAATTTTCCCCCTTCCTAGTTTCCTT678
Glu10TermTGTGGTGAGATCTATCTGGTTAGATCACTTTGGAAGTCCATTACTT
GAG-TAGCACCTTGTAAGGAAAGGAAAGAGAAGAT
TAACCAGATAGATCTCA679
TGAGATCTATCTGGTTA680
Male-sterileCTTTCCTTTCCTTACAAGGTGAAGTAATGGACTTCCAAAGTGATCT681
AGAACCAGAGAGATCTGACCACAAAGGAAACTAGGAAGGGGGAAAA
LycopersiconTTGAGATCAAAAGGATCGAAAACACGACGAA
esculentumTTCGTCGTGTTTTCGATCCTTTTGATCTCAATTTTCCCCCTTCCTAG682
Ser12TermTTTCCTTTGTGGTCAGATCTCTGTGGTTAGATCACTTTGGAAGTCC
TCA-TGAATTACTTCACCTTGTAAGGAAAGGAAAG
AGAGATCTGACCACAAA683
TTTGTGGTCAGATCTCT684
Male-sterileGTACTCTCTATTTTCATCTTCCAACCCTTTCTTTCCTTACCAGGTGA685
NAG1AAGTATGGACTTCTAAAGTGATCTAACAAGAGAGATCTCTCCACAA
Nicotiana tabacumAGGAAACTGGGAAGAGGAAAGATTGAGA
Gln4TermTCTCAATCTTTCCTCTTCCCAGTTTCCTTTGTGGAGAGATCTCTCTT686
CAA-TAAGTTAGATCACTTTAGAAGTCCATACTTTCACCTGGTAAGGAAAGAA
AGGGTTGGAAGATGAAAATAGAGAGTAC
TGGACTTCTAAAGTGAT687
ATCACTTTAGAAGTCCA688
Male-sterileATCTTCCAACCCTTTCTTTCCTTACCAGGTGAAAGTATGGACTTCC689
NAG1AAAGTGATCTAACATGAGAGATCTCTCCACAAAGGAAACTGGGAA
Nicotiana tabacumGAGGAAAGATTGAGATCAAACGGATCGAAA
Arg9TermTTTCGATCCGTTTGATCTCAATCTTTCCTCTTCCCAGTTTCCTTTGT690
AGA-TGAGGAGAGATCTCTCATGTTAGATCACTTTGGAAGTCCATACTTTCAC
CTGGTAAGGAAAGAAAGGGTTGGAAGAT
ATCTAACATGAGAGATC691
GATCTCTCATGTTAGAT692
Male-sterileTTCCAACCCTTTCTTTCCTTAGCAGGTGAAAGTATGGACTTCCAAA693
NAG1GTGATCTAACAAGATAGATCTCTCCACAAAGGAAACTGGGAAGAG
Nicotiana tabacumGAAAGATTGAGATCAAACGGATCGAAAACA
Glu10TermTGTTTTCGATCCGTTTGATCTCAATCTTTCCTCTTCCCAGTTTCCTT694
GAG-TAGTGTGGAGAGATCTATCTTGTTAGATGACTTTGGAAGTCCATACTTT
CACCTGGTAAGGAAAGAAAGGGTTGGAA
TAACAAGATAGATCTCT695
AGAGATCTATCTTGTTA696
Male-sterileCTTTCCTTACCAGGTGAAAGTATGGACTTCCAAAGTGATCTAACAA697
NAG1GAGAGATCTCTCCATAAAGGAAACTGGGAAGAGGAAAGATTGAGA
Nicotiana tabacumTCAAACGGATCGAAAACACAACGAATCGTC
Gln14TermGACGATTCGTTGTGTTTTCGATCCGTTTGATCTCAATCTTTCCTCTT698
CAA-TAACCCAGTTTCCTTTATGGAGAGATCTCTCTTGTTAGATCACTTTGGA
AGTCCATACTTTCACCTGGTAAGGAAAG
TCTCTCCATAAAGGAAA699
TTTCCTTTATGGAGAGA700
Male-sterileGCCTATGAAAACAAACCCAACACGGTCCTGGACGCTGATGCCCAA701
AGAGAAGATTGGGAAGGTGAAAGATCGAGATCAAGCGGATCGAAAA
Rosa hybridaCACCACCAATCGTCAAGTCACCTTCTGCAAAA
Gly22TermTTTTGCAGAAGGTGACTTGACGATTGGTGGTGTTTTCGATCCGCT702
GGA-TGATGATCTGGATCTTTCACCTTCCCAATCTTCTTTGGGCATCAGCGTC
CAGGACCGTGTTGGGTTTGTTTTCATAGGC
TGGGAAGGTGAAAGATC703
GATCTTTCACCTTCCCA704
Male-sterileTATGAAAACAAACCCAACACGGTCCTGGACGCTGATGCCCAAAGA705
AGAGATTGGGAAGGGGATAGATCGAGATCAAGCGGATCGAAAACAC
Rosa hybridaCACCAATCGTCAAGTCACCTTCTGCAAAAGGC
Lys23TermGCCTTTTGCAGAAGGTGACTTGACGATTGGTGGTGTTTTCGATCC706
AAG-TAGGCTTGATCTCGATCTATCCCCTTCCCAATCTTCTTTGGGCATCAGC
GTCCAGGACCGTGTTGGGTTTGTTTTCATA
GAAGGGGATAGATCGAG707
CTCGATCTATCCCCTTC708
Male-sterileAACAAACCCAACACGGTCCTGGACGCTGATGCCCAAAGAAGATTG709
AGGGAAGGGGAAAGATCTAGATCAAGCGGATCGAAAACACCACCAA
Rosa hybridaTCGTCAAGTCACCTTCTGCAAAAGGCGCAATG
Glu25TermCATTGCGCCTTTTGCAGAAGGTGACTTGACGATTGGTGGTGTTTT710
GAG-TAGCGATCCGCTTGATCTAGATCTTTCCCCTTCCCAATCTTCTTTGGGC
ATCAGCGTCCAGGACCGTGTTGGGTTTGTT
GAAAGATCTAGATCAAG711
CTTGATCTAGATCTTTC712
Male-sterileCCCAACACGGTCCTGGACGCTGATGCCCAAAGAAGATTGGGAAG713
AGGGGAAAGATCGAGATCTAGCGGATCGAAAACACCACCAATCGTCA
Rosa hybridaAGTCACCTTCTGCAAAAGGCGCAATGGTTTGC
Lys27GCAAACCATTGCGCCTTTTGCAGAAGGTGACTTGACGATTGGTGG714
AAG-TAGTGTTTTCGATCCGCTAGATCTCGATCTTTCCCCTTCCCAATCTTCT
TTGGGCATCAGCGTCCAGGACCGTGTTGGG
TCGAGATCTAGCGGATC715
GATCCGCTAGATCTCGA716
Male-sterileCAATTGCGTGTTTTTATTTTTTTTGTTTTTGACTAAGTAGAAATGGC717
farGTCTCTAAGCGATTAATCGACCGAGGTATCGCGCGAGAGGAAAAT
Antirrhinum majusCGGGAGAGGAAAGATCGAGATCAAACGGA
Gln7TermTCCGTTTGATCTCGATCTTTCCTCTCCCGATTTTCCTCTCGGGCGA718
CAA-TAATACCTCGGTCGATTAATCGCTTAGAGACGCCATTTCTACTTAGTCA
AAAAGAAAAAAAATAAAAACAGGCAATTG
TAAGCGATTAATCGACC719
GGTCGATTAATCGCTTA720
Male-sterileGTTTTTATTTTTTTTCTTTTTGACTAAGTAGAAATGGCGTCTCTAAG721
farCGATCAATCGACCTAGGTATCGCCCGAGAGGAAAATCGGGAGAG
Antirrhinum majusGAAAGATCGAGATCAAACGGATCGAAAACA
Glu10TermTGTTTTCGATCCGTTTGATCTCGATCTTTCCTCTCCCGATTTTCCTC722
GAG-TAGTCGGGCGATACCTAGGTCGATTGATCGCTTAGAGACGCCATTTCT
ACTTAGTCAAAAAGAAAAAAAATAAAAAC
AATCGACCTAGGTATCG723
CGATACCTAGGTCGATT724
Male-sterileTTTCTTTTTGACTAAGTAGAAATGGCGTCTCTAAGCGATCAATCGA725
farCCGAGGTATCGCCCTAGAGGAAAATCGGGAGAGGAAAGATCGAG
Antirrhinum majusATCAAACGGATCGAAAACAAAACAAATCAAC
Glu14TermGTTGATTTGTTTTGTTTTCGATCCGTTTGATCTCGATCTTTCCTCTC726
GAG-TAGCCGATTTTCCTCTAGGGCGATACCTCGGTCGATTGATCGCTTAGA
GACGCCATTTCTACTTAGTCAAAAAGAAA
TATCGCCCTAGAGGAAA727
TTTCCTCTAGGGCGATA728
Male-sterileTTTGACTAAGTAGAAATGGCGTCTCTAAGCGATCAATCGACCGAG729
farGTATCGCCCGAGAGGTAAATCGGGAGAGGAAAGATCGAGATCAA
Antirrhinum majusACGGATCGAAAACAAAACAAATCAACAGGTTA
Lys16TermTAACCTGTTGATTTGTTTTGTTTTCGATCCGTTTGATCTCGATCTTT730
AAA-TAACCTCTCCCGATTTACCTCTCGGGCGATACCTCGGTCGATTGATCG
CTTAGAGACGCCATTTCTACTTAGTCAAA
CCGAGAGGTAAATCGGG731
CCCGATTTACCTCTCGG732
Male-sterileTGTCCAAGCATTATCAGTCACCACTCACAAGAATGATTAAGGAAGA733
AGAGGAAAGGGTAAGTAGCAAATAAAGGGGATGTTCCAGAATCAAGA
Cucumis sativusAGAGAAGATGTCAGACTCGCCTCAGAGGAA
Leu21TermTTCCTCTGAGGCGAGTCTGACATCTTCTCTTCTTGATTCTGGAACA734
TTG-TAGTCCCCTTTATTTGCTACTTACCCTTTCCTTCTTCCTTAATCATTCTT
GTGAGTGGTGACTGATAATGCTTGGACA
GGGTAAGTAGCAAATAA735
TTATTTGCTACTTACCC736
Male-sterileTCCAAGCATTATCAGTCACCACTCACAAGAATGATTAAGGAAGAA737
AGGGAAAGGGTAAGTTGTAAATAAAGGGGATGTTCCAGAATCAAGAA
Cucumis sativusGAGAAGATGTCAGACTCGCCTCAGAGGAAGA
Gln22TermTCTTCCTCTGAGGCGAGTCTGACATCTTCTCTTCTTGATTCTGGAA738
CAA-TAACATCCCCTTTATTTACAACTTACCCTTTCCTTCTTCCTTAATCATTC
TTGTGAGTGGTGACTGATAATGCTTGGA
GTAAGTTGTAAATAAAG739
CTTTATTTACAACTTAC740
Male-sterileCATTATCAGTCACCACTCACAAGAATGATTAAGGAAGAAGGAAAG741
AGGGTAAGTTGCAAATATAGGGGATGTTCCAGAATCAAGAAGAGAAG
Cucumis sativusATGTCAGACTCGCCTCAGAGGAAGATGGGAA
Lys24TermTTCCCATCTTCCTCTGAGGCGAGTCTGACATCTTCTCTTCTTGATT742
AAG-TAGCTGGAACATCCCCTATATTTGCAACTTACCCTTTCCTTCTTCCTTAA
TCATTCTTGTGAGTGGTGACTGATAATG
TGCAAATATAGGGGATG743
CATCCCCTATATTTGCA744
Male-sterileCCACTCACAAGAATGATTAAGGAAGAAGGAAAGGGTAAGTTGCAA745
AGATAAAGGGGATGTTCTAGAATCAAGAAGAGAAGATGTCAGACTCG
Cucumis sativusCCTCAGAGGAAGATGGGAAGAGGAAAGATTG
Gln28TermCAATCTTTCCTCTTCCCATCTTCCTCTGAGGCGAGTCTGACATCTT746
CAG-TAGCTCTTCTTGATTCTAGAACATCCCCTTTATTTGCAACTTACCCTTTC
CTTCTTCCTTAATCATTCTTGTGAGTGG
GGATGTTCTAGAATCAA747
TTGATTCTAGAACATCC748
Male-sterileCCACCACCACCACCACCACCACCACCACACCATGCTCAACATGAT749
AGGACTGATCTGAGCTGAGGGCCGTCGTCCAAGGTCAAGGAGCAGG
Zea maysTGGCGGCGGCGCCGACGGGCTCCGGCGACAGG
Cys10TermCCTGTCGCCGGAGCCCGTCGGCGCCGCCGCCACCTGCTCCTTGA750
TGC-TGACCTTGGACGACGGCCCTCAGCTCAGATCAGTCATCATGTTGAGCA
TGGTGTGGTGGTGGTGGTGGTGGTGGTGGTGG
CTGAGCTGAGGGCCGTC751
GACGGCCCTCAGCTCAG752
Male-sterileACCACCACCACCACCACCACACCATGCTCAACATGATGACTGATC753
AGTGAGCTGCGGGCCGTAGTCCAAGGTCAAGGAGCAGGTGGCGGC
Zea maysGGCGCCGACGGGCTCCGGCGACAGGCAGGGGCA
Ser13TermTGCCCCTGCCTGTCGCCGGAGCCCGTCGGCGCCGCCGCCACCT754
TCG-TAGGCTCCTTGACCTTGGACTACGGCCCGCAGCTCAGATCAGTCATCA
TGTTGAGCATGGTGTGGTGGTGGTGGTGGTGGT
CGGGCCGTAGTCCAAGG755
CCTTGGACTACGGCCCG756
Male-sterileCACCACCACCACCACACCATGCTCAACATGATGACTGATCTGAGC757
AGTGCGGGCCGTCGTCCTAGGTCAAGGAGCAGGTGGCGGCGGCGC
Zea maysCGACGGGCTCCGGCGACAGGCAGGGGCAGGGGA
Lys15TermTCCCCTGCCCCTGCCTGTCGCCGGAGCCCGTCGGCGCCGCCGC758
AAG-TAGCACCTGCTCCTTGACCTAGGACGACGGCCCGCAGCTCAGATCAG
TCATCATGTTGAGCATGGTGTGGTGGTGGTGGTG
CGTCGTCCTAGGTCAAG759
CTTGACCTAGGACGACG760
Male-sterileCACCACCACACCATGCTCAACATGATGACTGATCTGAGCTGCGGG761
AGCCGTCGTCCAAGGTCTAGGAGCAGGTGGCGGCGGCGCCGACGG
Zea maysGCTCCGGCGACAGGCAGGGGCAGGGGAGAGGCA
Lys17TermTGCCTCTCCCCTGCCCCTGCCTGTCGCCGGAGCCCGTCGGCGCC762
AAG-TAGGCCGCCACCTGCTCCTAGACCTTGGACGACGGCCCGCAGCTCAG
ATCAGTCATCATGTTGAGCATGGTGTGGTGGTG
CCAAGGTCTAGGAGCAG763
CTGCTCCTAGACCTTGG764
Male-sterileTCCTACCTTTTCTCCTTCAGACCTCAAAATCTGTGTGATAGGAACA765
AGAGAGCATGCACATCTGAGAAGAGGAGGCTACACCATCCACAGTAA
Zea maysCAGGCATCATGTCGACCCTGACTTCGGCGG
Arg4TermCCGCCGAAGTCAGGGTCGACATGATGCCTGTTACTGTGGATGGT766
CGA-TGAGTAGCCTCCTCTTCTCAGATGTGCATGCTCTTGTTCCTATCACACA
GATTTTGAGGTCTGAAGGAGAAAAGGTAGGA
TGCACATCTGAGAAGAG767
CTCTTCTCAGATGTGCA768
Male-sterileTACCTTTTCTCCTTCAGACCTCAAAATCTGTGTGATAGGAACAAGA769
AGGCATGCACATCCGATAAGAGGAGGCTACACCATCCACAGTAACAG
Zea maysGCATCATGTCGACCCTGACTTCGGCGGGGC
Glu5TermGCCCCGCCGAAGTCAGGGTCGACATGATGCCTGTTACTGTGGAT770
GAA-TAAGGTGTAGCCTCCTCTTATCGGATGTGCATGCTCTTGTTCCTATCAC
ACAGATTTTGAGGTCTGAAGGAGAAAAGGTA
ACATCCGATAAGAGGAG771
CTCCTCTTATCGGATGT772
Male-sterileCTTTTCTCCTTCAGACCTCAAAATCTGTGTGATAGGAACAAGAGCA773
AGTGCACATCCGAGAATAGGAGGCTACACCATCCACAGTAACAGGCA
Zea maysTCATGTCGACCCTGACTTCGGCGGGGCAGC
Glu6TermGCTGCCCCGCCGAAGTGAGGGTCGACATGATGCCTGTTACTGTG774
GAG-TAGGATGGTGTAGCCTCCTATTCTCGGATGTGCATGCTCTTGTTCCTAT
CACACAGATTTTGAGGTCTGAAGGAGAAAAG
TCCGAGAATAGGAGGCT775
AGCCTCCTATTCTCGGA776
Male-sterileTTCTCCTTCAGACCTCAAAATCTGTGTGATAGGAACAAGAGCATG777
AGCACATCCGAGAAGAGTAGGCTACACCATCCACAGTAACAGGCATC
Zea maysATGTCGACCCTGACTTCGGCGGGGCAGCAGA
Glu7TermTCTGCTGCCCCGCCGAAGTCAGGGTCGACATGATGCCTGTTACT778
GAG-TAGGTGGATGGTGTAGCCTACTCTTCTCGGATGTGCATGCTCTTGTTC
CTATCACACAGATTTTGAGGTCTGAAGGAGAA
GAGAAGAGTAGGCTACA779
TGTAGCCTACTCTTCTC780
Male-sterileGCTGGGTCAGGATCGTCGGCGGCGGTGGCGGCGGGGAGCAGC781
AGGAGAAGATGGGGAGGGGGTAGATCGAGATAAAGCGGATCGAGAA
Oryza sativaCACGACGAACCGGCAGGTGACCTTCTGCAAGCGCC
Lys5TermGGCGCTTGCAGAAGGTCACCTGCCGGTTCGTCGTGTTCTCGATC782
AAG-TAGCGCTTTATCTCGATCTACCCCCTCCCCATCTTCTCGCTGCTCCCC
GCCGCCACCGCCGCCGACGATCCTGACCCAGC
GGAGGGGGTAGATCGAG783
CTCGATCTACCCCCTCC784
Male-sterileTCAGGATCGTCGGCGGGGGTGGCGGCGGGGAGCAGCGAGAAGA785
AGTGGGGAGGGGGAAGATCTAGATAAAGCGGATCGAGAACACGACG
Oryza sativaAACCGGCAGGTGACCTTCTGCAAGCGCCGCAATG
GTu7TermCATTGCGGCGCTTGCAGAAGGTCACCTGCCGGTTCGTCGTGTTCT786
GAG-TAGCGATCCGCTTTATCTAGATCTTCCCCCTCCCCATCTTCTCGCTGCT
CCCCGCCGCCACCGCCGCCGACGATCCTGA
GGAAGATCTAGATAAAG787
CTTTATCTAGATCTTCC788
Male-sterileTCGTCGGCGGCGGTGGCGGCGGGGAGCAGCGAGAAGATGGGG789
AGAGGGGGAAGATCGAGATATAGCGGATCGAGAACACGACGAACCG
Oryza sativaGCAGGTGACCTTCTGCAAGCGCCGCAATGGCCTCC
Lys9TermGGAGGCCATTGCGGCGCTTGCAGAAGGTCACCTGCCGGTTCGTC790
AAG-TAGGTGTTCTCGATCCGCTATATCTCGATCTTCCCCCTCCCCATCTTCT
CGCTGCTCCCCGCCGCCACCGCCGCCGACGA
TCGAGATATAGCGGATC791
GATCCGCTATATCTCGA792
Male-sterileGCGGTGGCGGCGGGGAGCAGCGAGAAGATGGGGAGGGGGAAG793
AGATCGAGATAAAGCGGATCTAGAACACGACGAACCGGCAGGTGAC
Oryza sativaCTTCTGCAAGCGCCGCAATGGCCTCCTGAAGAAGG
Glu12TermCCTTCTTCAGGAGGCCATTGCGGCGCTTGCAGAAGGTCACCTGC794
GAG-TAGCGGTTCGTCGTGTTCTAGATCCGCTTTATCTCGATCTTCCCCCTCC
CCATCTTCTCGCTGCTCCCCGCCGCCACCGC
AGCGGATCTAGAACACG795
CGTGTTCTAGATCCGCT796

[0127] 18

TABLE 16
Oligonucleotides to produce male-sterile plants
Phenotype, Gene,
Plant & TargetedSEQ ID
AlterationAltering OligosNO:
Male-sterileGGGAAGAGGGAAAATAGAAATAAAAAGAATAGAGAACTCAAGCAA797
P1TAGACAAGTTACATAGTCAAAGAGAAGAAATGGTATCATCAAAAAA
Cucumis sativusGCCAAAGAAATTACTGTTCTTTGCGATGCT
Tyr21TermAGCATCGCAAAGAACAGTAATTTCTTTGGCTTTTTTGATGATACCAT798
TAT-TAGTTCTTCTCTTTGACTATGTAACTTGTCTATTGCTTGAGTTCTCTATTC
TTTTTATTTCTATTTTCCCTCTTCCC
GTTACATAGTCAAAGAG799
CTCTTTGACTATGTAAC800
Male-sterileGAAGAGGGAAAATAGAAATAAAAAGAATAGAGAACTCAAGCAATA801
P1GACAAGTTACATATTGAAAGAGAAGAAATGGTATCATCAAAAAAGC
Cucumis sativusCAAAGAAATTACTGTTCTTTGCGATGCTCA
Ser22TermTGAGCATCGCAAAGAACAGTAATTTCTTTGGCTTTTTTGATGATAC802
TCA-TGACATTTCTTCTCTTTCAATATGTAACTTGTCTATTGCTTGAGTTCTCTA
TTGTTTTTATTTCTATTTTCCCTCTTC
TACATATTGAAAGAGAA803
TTCTCTTT+E,un CAATATGTA804
Male-sterileAGAGGGAAAATAGAAATAAAAAGAATAGAGAACTCAAGCAATAGAC805
P1AAGTTAGATATTCATAGAGAAGAAATGGTATCATCAAAAAAGCCAA
Cucumis sativusAGAAATTACTGTTCTTTGCGATGCTCAAG
Lys23TermCTTGAGCATCGCAAAGAACAGTAATTTCTTTGGCTTTTTTGATGATA806
AAG-TAGCCATTTCTTCTCTATGAATATGTAACTTGTCTATTGCTTGAGTTCTC
TATTCTTTTTATTTCTATTTTCCCTCT
CATATTCATAGAGAAGA807
TCTTCTCTATGAATATG808
Male-sterileGGGAAAATAGAAATAAAAAGAATAGAGAACTCAAGCAATAGACAAG809
P1TTACATATTCAAAGTGAAGAAATGGTATCATCAAAAAAGCCAAAGA
Cucumis sativusAATTACTGTTCTTTGCGATGCTCAAGTTT
Arg24TermAAACTTGAGCATCGCAAAGAACAGTAATTTCTTTGGCTTTTTTGATG810
AGA-TGAATACCATTTCTTCACTTTGAATATGTAACTTGTCTATTGCTTGAGTT
CTCTATTCTTTTTATTTCTATTTTCCC
ATTCAAAGTGAAGAAAT811
ATTTCTTCACTTTGAAT812
Male-sterileGGGACGTGGGAAGGTTGAGATCAAGAGGATTGAGAACTGAAGTAA813
P1CAGGCAGGTGACCTAGTCCAAGAGGAGGAATGGGATTATCAAGAA
Malus domesticaGGCAAAGGAGATCACTGTTCTATGTGATGCT
Tyr21TermAGCATCACATAGAACAGTGATCTCCTTTGCCTTCTTGATAATCCCA814
TAG-TAGTTCCTCCTCTTGGACTAGGTGACCTGCCTGTTACTTGAGTTCTCAA
TCCTCTTGATCTCAACCTTCCCACGTCGC
GTGACCTAGTGCAAGAG815
CTCTTGGACTAGGTCAC816
Male-sterileCGTGGGAAGGTTGAGATCAAGAGGATTGAGAACTCAAGTAACAGG817
P1CAGGTGACCTACTCCTAGAGGAGGAATGGGATTATCAAGAAGGCA
Malus domesticaAAGGAGATCACTGTTCTATGTGATGCTAAAG
Lys23TermCTTTAGCATCACATAGAACAGTGATCTCCTTTGCCTTCTTGATAATC818
AAG-TAGCCATTCCTCCTCTAGGAGTAGGTCACCTGCCTGTTACTTGAGTTCT
CAATCCTCTTGATCTCAACCTTCCCACG
CCTACTCCTAGAGGAGG819
CCTCCTCTAGGAGTAGG820
Male-sterileAGGATTGAGAAGTCAAGTAACAGGCAGGTGACCTACTCCAAGAGG821
P1AGGAATGGGATTATCTAGAAGGCAAAGGAGATGACTGTTCTATGT
Malus domesticaGATGCTAAAGTATCTCTTATCATTTATTCTA
Lys30TermTAGAATAAATGATAAGAGATACTTTAGCATCACATAGAACAGTGAT822
AAG-TAGCTCCTTTGCCTTCTAGATAATCGCATTCCTCCTCTTGGAGTAGGTC
ACCTGCCTGTTACTTGAGTTCTCAATCCT
GGATTATCTAGAAGGCA823
TGCCTTCTAGATAATCC824
Male-sterileATTGAGAACTCAAGTAACAGGCAGGTGACCTACTCCAAGAGGAGG825
P1AATGGGATTATCAAGTAGGCAAAGGAGATCACTGTTCTATGTGATG
Malus domesticaCTAAAGTATCTCTTATCATTTATTCTAGCT
Lys31TermAGCTAGAATAAATGATAAGAGATACTTTAGCATCACATAGAACAGT826
AAG-TAGGATCTCCTTTGCCTACTTGATAATGCCATTCCTCCTCTTGGAGTAG
GTCACCTGCCTGTTACTTGAGTTCTCAAT
TTATCAAGTAGGCAAAG827
CTTTGCCTACTTGATAA828
Male-sterileCATTTTTACAATAGTTATCTGCAAACAAAAACAAGAGAGAAAAACAA829
globosaAAACAAAAAAATGTGAAGAGGAAAAATTGAGATCAAAAGAATTGAG
Antirrhinum majusAACTCAAGCAACAGGCAGGTTACTTACT
Gly2TermAGTAAGTAACCTGCCTGTTGCTTGAGTTCTCAATTCTTTTGATCTCA830
GGA-TGAATTTTTCCTCTTCACATTTTTTTGTTTTTGTTTTTCTCTCTTGTTTTTG
TTTGCAGATAACTATTGTAAAAATG
AAAAAATGTGAAGAGGA831
TCCTCTTCACATTTTTT832
Male-sterileTTTTACAATAGTTATCTGCAAACAAAAACAAGAGAGAAAAACAAAAA833
globosaCAAAAAAATGGGATGAGGAAAAATTGAGATCAAAAGAATTGAGAAC
Antirrhinum majusTCAAGCAACAGGCAGGTTACTTACTCAA
Arg3TermTTGAGTAAGTAACCTGCCTGTTGCTTGAGTTCTCAATTCTTTTGATC834
AGA-TGATCAATTTTTCCTCATCCCATTTTTTTGTTTTTGTTTTTCTCTCTTGTTT
TTGTTTGCAGATAACTATTGTAAAA
AAATGGGATGAGGAAAA835
TTTTCCTCATCCCATTT836
Male-sterileTACAATAGTTATCTGCAAACAAAAACAAGAGAGAAAAACAAAAACA837
globosaAAAAAATGGGAAGATGAAAAATTGAGATCAAAAGAATTGAGAACTC
Antirthinum majusAAGCAACAGGCAGGTTACTTACTCAAAGA
Gly4TermTCTTTGAGTAAGTAACCTGCCTGTTGCTTGAGTTCTCAATTCTTTTG838
GGA-TGAATCTCAATTTTTCATCTTCCCATTTTTTTGTTTTTGTTTTTCTCTCTTG
TTTTTGTTTGCAGATAACTATTGTA
TGGGAAGATGAAAAATT839
AATTTTTCATCTTCCCA840
Male-sterileAATAGTTATCTGCAAACAAAAACAAGAGAGAAAAACAAAAACAAAA841
globosaAAATGGGAAGAGGATAAATTGAGATCAAAAGAATTGAGAACTCAAG
Antirrhinum majusCAACAGGCAGGTTACTTACTCAAAGAGAA
Lys5TermTTCTCTTTGAGTAAGTAACCTGCCTGTTGCTTGAGTTCTCAATTGTT842
AAA-TAATTGATCTCAATTTATCCTCTTCCCATTTTTTTGTTTTTGTTTTTCTCT
CTTGTTTTTGTTTGCAGATAACTATT
GAAGAGGATAAATTGAG843
CTCAATTTATCCTCTTC844
Male-sterileGCTGAGCTCTTGCTGCCCTTGGATCTGTTTGGGAGTGGAGAACGC845
P1AGTATGGGGCGCGGCTAGATCAAGATCAAGAGGATCGAGAACTCT
Zea maysACCAACCGGCAGGTGACCTTCTCCAAGCGCC
Lys5TermGGCGCTTGGAGAAGGTCACCTGCCGGTTGGTAGAGTTCTCGATCC846
AAG-TAGTCTTGATCTTGATCTAGCCGCGCCCCATACTGCGTTCTCCACTCCC
AAACAGATCCAAGGGCAGCAAGAGCTCAGC
GGCGCGGCTAGATGAAG847
CTTGATCTAGCCGCGCC848
Male-sterileCTCTTGCTGCCCTTGGATCTGTTTGGGAGTGGAGAACGCAGTATG849
P1GGGCGCGGCAAGATCTAGATCAAGAGGATCGAGAACTCTACCAAC
Zea maysCGGCAGGTGACCTTCTCCAAGCGCCGGGCCG
Lys7TermCGGCCCGGCGCTTGGAGAAGGTCACCTGCCGGTTGGTAGAGTTC850
AAG-TAGTCGATCCTCTTGATCTAGATCTTGCCGCGCCCCATACTGCGTTCTC
CACTCCCAAACAGATCCAAGGGCAGCAAGAG
GCAAGATCTAGATCAAG851
CTTGATCTAGATCTTGC852
Male-sterileCTCTTGCTGCCCTTGGATCTGTTTGGGAGTGGAGAACGCAGTATG853
P1GGGCGCGGCAAGATCTAGATCAAGAGGATCGAGAACTCTACCAAC
Zea maysCGGCAGGTGACCTTCTCCAAGCGCCGGGCCG
Lys9TermCGGCCCGGCGCTTGGAGAAGGTCACCTGCCGGTTGGTAGAGTTC854
AAG-TAGTCGATCCTCTTGATCTAGATCTTGCCGCGCCCCATACTGCGTTCTC
CACTCCCAAACAGATCCAAGGGCAGCAAGAG
GCAAGATCTAGATCAAG855
GTTGATCTAGATCTTGC856
Male-sterileGATCTGTTTGGGAGTGGAGAACGCAGTATGGGGCGCGGCAAGAT857
P1CAAGATCAAGAGGATCTAGAACTCTACCAACCGGCAGGTGACCTT
Zea maysCTCCAAGCGCCGGGCCGGACTGGTCAAGAAGG
Glu12TermCCTTCTTGACGAGTCCGGCCCGGCGCTTGGAGAAGGTCACCTGC858
GAG-TAGCGGTTGGTAGAGTTCTAGATCCTCTTGATCTTGATCTTGCCGCGCC
CCATACTGCGTTCTCCACTCCCAAACAGATC
AGAGGATCTAGAACTCT859
AGAGTTCTAGATGCTCT860
Male-sterileGCTGAGCTCTTGCTGCCCTTGAATCTGTTAGGGAGTGGAGAACGG861
P1AGTATGGGGCGCGGCTAGATCGAGATCAAGAGGATCGAGAACTCT
Zea maysACCAACCGGCAGGTGACCTTCTCCAAGCGCC
Lys5TermGGCGCTTGGAGAAGGTCACCTGCCGGTTGGTAGAGTTCTCGATCC862
AAG-TAGTCTTGATCTCGATCTAGCCGCGCCCCATACTCCGTTCTCCACTCCC
TAACAGATTCAAGGGCAGCAAGAGCTCAGC
GGCGCGGCTAGATCGAG863
CTCGATCTAGCCGCGCC864
Male-sterileCTCTTGCTGCCCTTGAATCTGTTAGGGAGTGGAGAACGGAGTATG865
P1GGGCGCGGCAAGATCTAGATCAAGAGGATCGAGAACTCTACCAAC
Zea maysCGGCAGGTGACCTTCTCCAAGCGCCGGGCCG
Glu7TermCGGCCCGGCGCTTGGAGAAGGTCACCTGCCGGTTGGTAGAGTTC866
GAG-TAGTCGATCCTCTTGATCTAGATCTTGCCGCGCCCCATACTCCGTTCTC
CACTCCCTAACAGATTCAAGGGCAGCAAGAG
GCAAGATCTAGATCAAG867
CTTGATCTAGATCTTGC868
Male-sterileCTGCCCTTGAATCTGTTAGGGAGTGGAGAACGGAGTATGGGGCG869
P1CGGCAAGATCGAGATCTAGAGGATCGAGAACTCTACCAACCGGCA
Zea maysGGTGACCTTCTCCAAGCGCCGGGCCGGACTGG
Lys9TermCCAGTCCGGCCCGGCGCTTGGAGAAGGTCACCTGCCGGTTGGTA870
AAG-TAGGAGTTCTCGATCCTCTAGATCTCGATCTTGCCGCGCCCCATACTC
CGTTCTCCACTCCCTAACAGATTCAAGGGCAG
TCGAGATCTAGAGGATC871
GATCCTCTAGATCTCGA872
Male-sterileAATCTGTTAGGGAGTGGAGAACGGAGTATGGGGCGCGGCAAGAT873
P1GGAGATGAAGAGGATCTAGAACTCTACCAACCGGCAGGTGACCTT
Zea maysCTCCAAGCGCCGGGCCGGACTGGTCAAGAAGG
Glu12TermCCTTCTTGACCAGTCCGGCCCGGCGCTTGGAGAAGGTCACCTGC874
GAG-TAGCGGTTGGTAGAGTTCTAGATCCTCTTGATCTCGATCTTGCCGCGC
CCCATACTCCGTTCTCCACTCCCTAACAGATT
AGAGGATCTAGAACTCT875
AGAGTTCTAGATCCTCT876
Male-sterileTTGCTGCTAAGCTAGCTGGAGGAAGGAGGAGGAGGAGGAGGAGG877
P1CGGGATGGGGCGCGGG+E,un TAGATCGAGATCAAGAGGATCGAGAACT
Oryza sativaCCACCAACCGCCAGGTGACCTTCTCCAAGCGCA
Lys5TermTGCGCTTGGAGAAGGTCACCTGGCGGTTGGTGGAGTTCTCGATCC878
AAG-TAGTCTTGATGTCGATGTACCCGCGCCCCATCCCGCCTCCTCCTCCTC
CTCCTCCTTCCTCCAGCTAGCTTAGCAGCAA
GGCGCGGGTAGATCGAG879
CTCGATCTACCCGCGCC880
Male-sterileCTAAGCTAGCTGGAGGAAGGAGGAGGAGGAGGAGGAGGCGGGA881
P1TGGGGCGCGGGAAGATCTAGATCAAGAGGATCGAGAACTCCACC
Oryza sativaAACCGCCAGGTGACCTTCTCCAAGCGCAGGAGCG
Glu7TermCGCTCCTGCGCTTGGAGAAGGTCACCTGGCGGTTGGTGGAGTTCT882
GAG-TAGCGATCCTCTTGATCTAGATCTTCCCGCGCCCCATCCCGCCTCCTC
CTCCTCCTCCTCCTTCCTCCAGCTAGCTTAG
GGAAGATCTAGATCAAG883
CTTGATCTAGATCTTCC884
Male-sterileTAGCTGGAGGAAGGAGGAGGAGGAGGAGGAGGCGGGATGGGGC885
P1GCGGGAAGATCGAGATCTAGAGGATCGAGAACTCCACCAACCGC
Oryza sativaCAGGTGACCTTCTCCAAGCGCAGGAGCGGGATCC
Lys9TermGGATCCCGCTCCTGCGCTTGGAGAAGGTCACCTGGCGGTTGGTG886
AAG-TAGGAGTTCTCGATCCTCTAGATCTCGATCTTCCCGCGCCCCATCCCG
CCTCCTCCTCCTCCTCCTCCTTCCTCCAGCTA
TCGAGATCTAGAGGATC887
GATCCTCTAGATCTCGA888
Male-sterileGAAGGAGGAGGAGGAGGAGGAGGCGGGATGGGGCGCGGGAAG889
P1ATCGAGATCAAGAGGATCTAGAACTCCACCAACCGCCAGGTGACC
Oryza sativaTTCTCCAAGCGCAGGAGCGGGATCCTCAAGAAGG
Glu12TermCCTTCTTGAGGATCCCGCTCCTGCGCTTGGAGAAGGTCACCTGGC890
GAG-TAGGGTTGGTGGAGTTCTAGATCCTCTTGATCTCGATCTTCCCGCGCC
CCATCCCGCCTCCTCCTCCTCCTCCTCCTTC
AGAGGATCTAGAACTCC891
GGAGTTCTAGATCCTCT892

EXAMPLE 7

Engineering Plants for Abiotic Stress Tolerance

[0128] Environmental stresses, such as drought, increased soil salinity, soil contamination with heavy meals, and extreme temperature, are major factors limiting plant growth and productivity. The worldwide loss in yield of three major cereal crops, rice, maize, and wheat due to water stress (drought) has been estimated to be over ten billion dollars annually and many currently marginal soils could be brought into cultivation if suitable plant varieties were available.

[0129] Physiological and biochemical responses to high levels of ionic or nonionic solutes and decreased water potential have been studied in a variety of plants. It is known, for example, that increasing levels of alcohol dehydrogenase can confer enhances flooding resistance in plants. There are also several possible mechanisms to enhance plant salt tolerance. For example, one mechanism underlying the adaptation or tolerance of plants to osmotic stresses is the accumulation of compatible, low molecular weight osmolytes such as sugar alcohols, special amino acids, and glycinebetaine. Such accumulation can be engineered, for example, by removing feedback inhibition on 1-pyrroline-t-carboxylate synthetase, which results in accumulation of proline. Additionally, recent experiments suggest that altering the expression or activity of specific sodium or potassium transporters can confer enhanced salt tolerance.

[0130] Plant tolerance of contamination by heavy metals such as lead and aluminum in soils has also been investigated and one mechanism underlying tolerance is the production of dicarboxylic acids such as oxalate and citrate. In addition, individual genes involved in heavy metal sensitivity have been identified.

[0131] The attached tables disclose exemplary oligonucleotide base sequences which can be used to generate site-specific mutations that confer stress tolerance in plants. 19

TABLE 17
Genome-Altering Oligos Conferring Stress Tolerance
Phenotype, Gene,
Plant & TargetedSEQ ID
AlterationAltering OligosNO:
Salt ToleranceCGTCTTTTTGTGTGGTAGTTGGATGTGACGGTTGCTCAAATGCTT893
P5CSGTGACCGATAGCAGTGCTAGAGATAAGGATTTCAGGAAGCAACTT
Arabidopsis thalianaAGTGAAACTGTCAAAGCGATGCTGAGGATGA
Phe128AlaTCATCCTCAGCATCGCTTTGACAGTTTCACTAAGTTGCTTCCTGAA894
TTT-GCTATCCTTATGTCTAGCACTGCTATCGGTCACAAGCATTTGAGCAACC
GTCACATCCAACTACCACACAAAAAGACG
ATAGCAGTGCTAGAGAT895
ATCTCTAGCACTGCTAT896
Salt ToleranceGAGAGTATGTTTGACCAGCTGGATGTGACGGCTGCTCAGCTGCTG897
P5CS 1GTGAATGACAGTAGTGCCAGAGACAAGGAGTTCAGGAAGCAACTT
Brassica napusAATGAGACAGTGAAGTCCATGCTTGATTTGA
Phe128AlaTCAAATCAAGCATGGACTTCACTGTCTCATTAAGTTGCTTCCTGAA898
TTC-GCCCTCCTTGTCTCTGGCACTACTGTCATTCACCAGCAGCTGAGCAGC
CGTCACATCCAGCTGGTCAAACATAGTGTC
ACAGTAGTGCCAGAGAC899
GTCTCTGGCACTACTGT900
Salt ToleranceGAGACTATGTTTGACCAGATGGATGTGACGGTGGCTCAAATGCTG901
P505 2GTGACTGATAGCAGTGTCAGAGATAAGGATTTCAGGAAGCAACTT
Brassica napusAGTGAGACAGTCAAAGCTATGCTGAAAATGA
Phe129AlaTCATTTTCAGCATAGCTTTGACTGTCTCACTAAGTTGCTTCCTGAA902
TTC-GCCATCCTTATCTCTGACACTGCTATCAGTCACCAGCATTTGAGCCACC
GTCACATCCATCTGGTCAAACATAGTCTC
ATAGCAGTGTCAGAGAT903
ATCTCTGACACTGCTAT904
Salt ToleranceGATATGTTGTTTAACCAACTGGATGTCTCGTCATCTCAACTTCTTG905
P5GSTCACCGACAGTGATGCTGAGAACCCAAAGTTCCGGGAGCAACTCA
Oryza sativaCTGAAACTGTTGAGTCATTATTAGATCTTA
Phe128AlaTAAGATCTAATAATGACTCAACAGTTTCAGTGAGTTGCTCCCGGAA906
TTT-GCTCTTTGGGTTCTCAGCATCACTGTCGGTGACAAGAAGTTGAGATGA
CGAGACATCCAGTTGGTTAAACAACATATC
ACAGTGATGCTGAGAAC907
GTTCTCAGCATCACTGT908
Salt ToleranceGATATTTTGTTTAGTCAGCTGGATGTGACATCTGCTCAGCTTCTTG909
P5CSTTACTGACAATGATGCTAGAGACCAAGATTTTAGAAAGCAACTTTC
Medicago sativaTGAAACTGTGAGATCACTTCTAGCACTAA
Phe128AlaTTAGTGCTAGAAGTGATCTCACAGTTTCAGAAAGTTGCTTTCTAAA910
TTT-GCTATCTTGGTCTCTAGCATCATTGTCAGTAAGAAGAAGCTGAGCAGAT
GTCACATCCAGCTGACTAAACAAAATATC
ACAATGATGCTAGAGAC911
GTCTCTAGCATCATTGT912
Salt ToleranceGATACATTGTTTAGTCAGCTGGATGTGACATCAGCTCAGCTACTC913
P5CSGTTACTGATAATGATGCTAGGGATCCAGAATTCAGGAAGCAACTT
Actinidia deliciosaACTGAAACTGTAGAATCACTATTGAATTTGA
Phe128AlaTCAAATTCAATAGTGATTCTACAGTTTCAGTAAGTTGCTTCCTGAAT914
TTT-GCTTCTGGATCCCTAGCATCATTATCAGTAACGAGTAGCTGAGCTGAT
GTCACATCCAGCTGACTAAACAATGTATC
ATAATGATGCTAGGGAT915
ATCCCTAGCATCATTAT916
Salt ToleranceGACACACTCTTCAGTCAACTGGATGTGACATCAGCACAGCTTCTT917
P5CSGTAACAGATAATGACGCCAGAAGTCCAGAATTTAGAAAACAACTTA
Cichorium intybusCTGAAACAGTCGATTCTTTATTATCTTATA
Phe122AlaTATAAGATAATAAAGAATCGACTGTTTCAGTAAGTTGTTTTCTAAAT918
TTC-GCCTCTGGACTTCTGGCGTCATTATCTGTTACAAGAAGCTGTGCTGAT
GTCACATCCAGTTGACTGAAGAGTGTGTC
ATAATGACGCCAGAAGT919
ACTTCTGGCGTCATTAT920
Salt ToleranceGATTCTTTGTTCAGTCAGTTGGATGTGACATCAGCTCAGCTTCTGG921
P5CSTGACTGATAATGACGCTAGAGATCCAGATTTTAGGAGACAACTCA
LycopersiconATGACACAGTAAATTCGTTGCTTTCTCTAA
esculentumTTAGAGAAAGCAACGAATTTACTGTGTCATTGAGTTGTCTCCTAAA922
Phe12BAlaATCTGGATCTCTAGCGTCATTATCAGTCACCAGAAGCTGAGCTGA
TTT-GCTTGTCACATCCAACTGACTGAACAAAGAATC
ATAATGACGCTAGAGAT923
ATCTCTAGCGTCATTAT924
Salt ToleranceGATACCATGTTCAGCCAGCTTGATGTGACTTCTTCCCAACTTCTTG925
P5CSTGAATGATGGATTTGCTAGGGATGCTGGCTTCAGAAAACAACTTT
Vigna unguiculataCGGACACAGTGAACGCGTTATTAGATTTAA
Phe162AlaTTAAATCTAATAACGCGTTCACTGTGTCCGAAAGTTGTTTTCTGAA926
TTT-GCTGCCAGCATCCCTAGCAAATCCATCATTCACAAGAAGTTGGGAAGA
AGTCACATCAAGCTGGCTGAACATGGTATC
ATGGATTTGCTAGGGAT927
ATCCCTAGCAAATCCAT928
Salt ToleranceGACACCTTGTTTAGTCAGTTGGATCTGACTGCTGCTCAGCTGCTT929
P5CSGTGACGGACAACGACGCTAGAGATCCAAGTTTTAGAACACAACTA
MesembryanthemumACTGAAACAGTGTATCAGTTGTTGGATCTAA
crystallinumTTAGATCCAACAACTGATACACTGTTTCAGTTAGTTGTGTTCTAAA930
Phe125AlaACTTGGATCTCTAGCGTCGTTGTCCGTCACAAGCAGCTGAGCAGC
TTT-GCTAGTCAGATCCAACTGACTAAACAAGGTGTC
ACAACGACGCTAGAGAT931
ATCTCTAGCGTCGTTGT932
Salt ToleranceGACACATTATTTAGCCAGCTGGATGTGACATCAGCTCAGCTTCTT933
P5CSGTGACTGATAATGATGCTAGGGATGAAGCTTTCCGAAATCAACTTA
Vitis viniferaCTCAAACAGTGGATTCATTGTTAGCTTTGA
Phe130AlaTCAAAGCTAACAATGAATCCACTGTTTGAGTAAGTTGATTTCGGAA934
TTT-GCTAGCTTCATCCCTAGCATCATTATCAGTCACAAGAAGCTGAGCTGAT
GTCACATCCAGCTGGCTAAATAATGTGTC
ATAATGATGCTAGGGAT935
ATCCCTAGCATCATTAT936
Salt ToleranceGATACGCTGTTCACTCAGCTCGATGTGACATCGGCTCAGCTTCTT937
P5CSGTGACGGATAACGATGCTCGAGATAAGGATTTCAGGAAGCAGCTT
Vigna aconitifoliaACTGAGACTGTGAAGTCGCTGTTGGGGCTGA
Phe129AlaTCAGCGCCAACAGCGACTTCACAGTCTCAGTAAGCTGCTTCCTGA938
TTT-GCTAATCCTTATCTCGAGCATCGTTATCCGTCACAAGAAGCTGAGCCG
ATGTCACATCGAGCTGAGTGAACAGCGTATC
ATAACGATGCTCGAGAT939
ATCTCGAGCATCGTTAT940
Salt ToleranceAGAGATGTTCTTAGTTCCAAAGAAATCTCACCTCTCAGTTTCTCCG941
HKT1TCTTCACAACAGTTGTCACGTTTGCAAACTGCGGATTTGTCCCCAC
Arabidopsis thalianaGAATGAGAACATGATCATCTTTCGCAAAA
Ser207ValTTTTGCGAAAGATGATCATGTTCTCATTCGTGGGGACAAATCCGC942
TCC-GTCAGTTTGCAAACGTGACAACTGTTGTGAAGACGGAGAAAGTGAGAG
GTGAGATTTCTTTGGAACTAAGAACATCTCT
CAACAGTTGTCACGTTT943
AAACGTGACAACTGTTG944
Salt ToleranceCGAATGAGAACATGATCATCTTTCGCAAAAACTCTGGTCTCATCTG945
HKT1GCTCCTAATCCCTCTAGTACTGATGGGAAACACTTTGTTCCCTTGC
Arabidopsis thalianaTTCTTGGTTTTGCTCATATGGGGACTTTA
Gln237LeuTAAAGTCCCCATATGAGCAAAACCAAGAAGCAAGGGAACAAAGTG946
CAA-CTATTTCCCATCAGTACTAGAGGGATTAGGAGCCAGATGAGACCAGAG
TTTTTGCGAAAGATGATCATGTTCTCATTCG
AATCCCTCTAGTACTGA947
TCAGTACTAGAGGGATT948
Salt ToleranceAGTCTCTAGAAGGAATGAGTTCGTACGAGAAGTTGGTTGGATCGT949
HKT1TGTTTCAAGTGGTGAGTTCGCGACACACCGGAGAAACTATAGTAG
Arabidopsis thalianaACCTCTCTACACTTTCCCCAGCTATCTTGGT
Asn332SerACCAAGATAGCTGGGGAAAGTGTAGAGAGGTCTACTATAGTTTCT950
AAT-AGTCCGGTGTGTCGCGAACTCACCACTTGAAACAACGATCCAACCAAC
TTCTCGTACGAACTCATTCCTTCTAGAGACT
AGTGGTGAGTTCGCGAC951
GTCGCGAACTCACCACT952
Salt ToleranceAGAGATGTGCTAAAGAAGAAAGGTCTCAAAATGGTGACCTTTTCC953
HKT1GTCTTCACCACCGTGGTGACCTTTGCCAGTTGTGGGTTTGTCCCG
EucalyptusACCAATGAAAACATGATTATCTTCAGCAAAA
camaldulensisTTTTGCTGAAGATAATCATGTTTTCATTGGTCGGGACAAACCCACA954
Ser256ValACTGGCAAAGGTCACCACGGTGGTGAAGACGGAAAAGGTCACCA
TCG-GTGTTTTGAGACCTTTCTTCTTTAGCACATCTCT
CCACCGTGGTGACCTTT955
AAAGGTCACCACGGTGG956
Salt ToleranceCCAATGAAAACATGATTATCTTCAGCAAAAACTCTGGCCTCCTCCT957
HKT1GATTCTCATCCCTCTGGCCCTTCTTGGGAACATGCTGTTCCCATC
EucalyptusGAGCCTACGTTTGACGCTTTGGCTCATCGG
camaldulensisCCGATGAGCCAAAGCGTCAAACGTAGGCTCGATGGGAACAGCAT958
Gln286LeuGTTCCCAAGAAGGGCCAGAGGGATGAGAATCAGGAGGAGGCCA
CAG-CTGGAGTTTTTGCTGAAGATAATCATGTTTTCATTGG
CATCCCTCTGGCCCTTC959
GAAGGGCCAGAGGGATG960
Salt ToleranceAATCGTTGAATGGACTAAGCTCCTGTGAGAAAATCGTGGGCGCGC961
HKT1TGTTTCAGTGCGTGAGCAGCAGACATACCGGCGAGACGGTCGTC
EucalyptusGATCTGTCCACAGTTGCTCCCGCCATCTTGGT
camaldulensisACCAAGATGGCGGGAGCAACTGTGGACAGATCGACGACCGTCTC962
Asn381SerGCCGGTATGTCTGCTGCTCACGCACTGAAACAGCGCGCCCACGA
AAC-AGCTTTTCTCACAGGAGCTTAGTCCATTCAACGATT
GTGCGTGAGCAGCAGAC963
GTCTGCTG+E,un CTCACGCAC964
Salt ToleranceAAAGCTCCACTGAAGAAGAAAGGGATCAACATTGCACTCTTCTCA965
HKT1TTCTCGGTCACGGTCGTCTCGTTTGCGAATGTGGGGCTCGTGCC
Oryza sativaGACAAATGAGAACATGGCAATCTTCTCCAAGA
Ser238ValTCTTGGAGAAGATTGCCATGTTCTCATTTGTCGGCACGAGCCCCA966
TCC-GTCCATTCGCAAACGAGACGACCGTGACCGAGAATGAGAAGAGTGCA
ATGTTGATCCCTTTCTTCTTCAGTGGAGCTTT
TCACGGTCGTCTCGTTT967
AAACGAGACGACCGTGA968
Salt ToleranceCAAATGAGAACATGGCAATCTTCTCCAAGAACCCGGGCCTCCTCC969
HKT1TCCTGTTCATCGGCCTGATTGTTGCAGGCAATACACTTTACCCTCT
Oryza sativaCTTCCTAAGGCTATTGATATGGTTCCTGGG
Gln268LeuCCCAGGAACCATATCAATAGCCTTAGGAAGAGAGGGTAAAGTGTA970
CAG-CTGTTGCCTGCAAGAATCAGGCCGATGAACAGGAGGAGGAGGCCCGG
GTTCTTGGAGAAGATTGCCATGTTCTCATTTG
CATCGGCCTGATTCTTG971
CAAGAATCAGGCCGATG972
Salt ToleranceCAGTCTTTGATGGACTCAGCTCTTACCAGAAGATTATCAATGCATT973
HKT1GTTCATGGCAGTGAGCGCAAGGCACTCGGGGGAGAACTCCATCG
Oryza sativaACTGCTCACTCATCGCCCCTGCTGTTCTAGT
Asn363SerACTAGAACAGCAGGGGCGATGAGTGAGCAGTCGATGGAGTTCTC974
AAC-AGCCCCCGAGTGCCTTGCGCTCACTGCCATGAACAATGCATTGATAAT
CTTCTGGTAAGAGCTGAGTCCATCAAAGACTG
GGCAGTGAGCGCAAGGC975
GCCTTGCGCTCACTGCC976
Salt ToleranceGTGCCCCACTGAACAAGAAAGGGATCAACATCGTGCTCTTCTCAC977
HKT1TATCAGTCACCGTTGTCTCCTGTGCGAATGCAGGACTCGTGCCCA
Triticum aestivumCAAATGAGAACATGGTCATCTTCTCAAAGAA
Ala240ValTTCTTTGAGAAGATGACCATGTTCTCATTTGTGGGCACGAGTCCT978
GCC-GTCGCATTCGCACAGGAGACAACGGTGAGTGATAGTGAGAAGAGCAC
GATGTTGATCCCTTTCTTGTTCAGTGGGGCAC
CACCGTTGTCTCCTGTG979
CACAGGAGACAACGGTG980
Salt ToleranceCAAATGAGAACATGGTCATCTTCTCAAAGAATTCAGGCCTCTTGTT981
HKT1GCTGCTGAGTGGCCTGATGCTCGCAGGCAATACATTGTTCCCTCT
Triticum aestivumCTTCCTGAGGCTACTGGTGTGGTTCCTGGG
Gln270LeuCCCAGGAACCACACCAGTAGCCTCAGGAAGAGAGGGAACAATGT982
CAG-CTGATTGCCTGCGAGCATCAGGCCACTCAGCAGCAACAAGAGGCCTG
AATTCTTTGAGAAGATGACCATGTTCTCATTTG
GAGTGGCCTGATGCTCG983
CGAGCATCAGGCCACTC984
Salt ToleranceCAGTCTTTGATGGGCTCAGCTCTTATCAGAAGACTGTCAATGCATT985
HKT1CTTCATGGTGGTGAGTGCGAGGCACTCAGGGGAGAATTCCATCG
Triticum aestivumACTGCTCGCTCATGTCCCCTGCCATTATAGT
Asn365SerACTATAATGGCAGGGGACATGAGCGAGCAGTCGATGGAATTCTCC986
AAT-AGTCCTGAGTGCCTCGCACTCACCACCATGAAGAATGCATTGACAGTC
TTCTGATAAGAGCTGAGCCCATCAAAGACTG
GGTGGTGAGTGCGAGGC987
GCCTCGCACTCACCACC988
Freezing ToleranceTTTTTTTTGTTTTCGTTTTCAAAAAGAAAATCTTTGAATTTTATGGCA989
praline oxidaseACCGGTCTTCTCTGAACAAACTTTATCCGGCGATCTTACCGTTTAG
precursorCCGCTTTTAGCCCGGTGGGTCCTCCCA
Arabidopsis thalianaTGGGAGGACCCACCGGGCTAAAAGCGGGTAAACGGTAAGATCGC990
Arg7TermGGGATAAAGTTTGTTCAGAGAAGACGGGTTGCCATAAAATTCAAA
CGA-TGAGATTTTGTTTTTGAAAACGAAAACAAAAAAAA
GTCTTCTCTGAACAAAC991
GTTTGTTCAGAGAAGAC992
Freezing ToleranceTCAAAAACAAAATCTTTGAATTTTATGGCAACCCGTCTTCTCAGAA993
proline oxidaseCAAACTTTATCCGGTGATCTTACCGTTTACCGGCTTTTAGCCCGGT
precursorGGGTCCTCCCACCGTGACTGCTTCCACCG
Arabidopsis thalianaCGGTGGAAGCAGTCACGGTGGGAGGACCCAGCGGGCTAAAAGC994
Arg13TermGGGTAAACGGTAAGATCACCGGATAAAGTTTGTTCTGAGAAGACG
CGA-TGAGGTTGCCATAAAATTCAAAGATTTTGTTTTTGA
TTATCCGGTGATCTTAC995
GTAAGATCACCGGATAA996
Freezing ToleranceAAAATCTTTGAATTTTATGGCAACCCGTCTTCTCCGAACAAACTTT997
praline oxidaseATCCGGCGATCTTAGCGTTTACCCGCTTTTAGCCCGGTGGGTCCT
precursorCCCACCGTGACTGCTTCCACCGCCGTCGTC
Arabidopsis thalianaGACGACGGCGGTGGAAGCAGTCACGGTGGGAGGACCCACCGGG998
Tyr15TermCTAAAAGCGGGTAAACGCTAAGATCGCCGGATAAAGTTTGTTCGG
TAG-TAGAGAAGAGGGGTTGCCATAAAATTCAAAGATTTT
CGATCTTAGCGTTTACC999
GGTAAACGCTAAGATCG1000
Freezing ToleranceCTTTGAATTTTATGGCAACCCGTCTTCTCCGAACAAACTTTATCCG1001
praline oxidaseGCGATCTTACCGTTAACCCGCTTTTAGCCCGGTGGGTCCTCCCAC
precursorCGTGACTGCTTCCACCGCCGTCGTCCCGGA
Arabidopsis thalianaTCCGGGACGACGGCGGTGGAAGCAGTCACGGTGGGAGGACCCA1002
Leu17TermCCGGGCTAAAAGCGGGTTAACGGTAAGATCGGCGGATAAAGTTT
TTA-TAAGTTCGGAGAAGACGGGTTGCCATAAAATTCAAAG
TTACCGTTAACCCGCTT1003
AAGCGGGTTAACGGTAA1004
Freezing ToleranceCCGGTGGGTCCTCCCACCGTGACTGCTTCCAGCGCCGTGGTCCC1005
proline oxidaseGGAGATTCTCTCCTTTTGACAACAAGCACCGGAACCACCTCTTCA
precursorCCACCCAAAACCCACCGAGCAATCTCACGATG
Arabidopsis thalianaCATCGTGAGATTGCTCGGTGGGTTTTGGGTGGTGAAGAGGTGGT1006
Gly42TermTCCGGTGCTTGTTGTCAAAAGGAGAGAATCTCCGGGACGACGGC
GGA-TGAGGTGGAAGCAGTCACGGTGGGAGGACCCACCGG
TCTCCTTTTGACAACAA1007
TTGTTGTCAAAAGGAGA1008
Lead ToleranceACATGAAGCAGTGAAATCTCTGTTTGTATTGAATCTTATTAGTCTCT1009
cyclic nucleotide-AAACTATGAATTTCTGACAAGAGAAGTTTGTAAGGTCAGTGTTCCA
regulated ion channelGATTTGTCTCATTGAATTCTAAGTCGTGA
Arabidopsis thalianaTCACGACTTAGAATTCAATGAGACAAATCTGGAACACTGACCTTAC1010
Arg4TermAAACTTCTCTTGTCAGAAATTCATAGTTTGAGACTAATAAGATTCAA
CGA-TGATACAAACAGAGATTTCACTGCTTCATGT
TGAATTTCTGACAAGAG1011
CTCTTGTCAGAAATTCA1012
Lead ToleranceTGAAGCAGTGAAATCTCTGTTTGTATTGAATCTTATTAGTCTCAAA1013
cyclic nucleotide-CTATGAATTTCCGATAAGAGAAGTTTGTAAGGTCAGTGTTCCAGAT
regulated ion channelTTGTCTCATTGAATTCTAAGTCGTGAAGC
Arabidopsis thalianaGCTTCACGACTTAGAATTCAATGAGACAAATCTGGAACACTGACCT1014
Gln5TermTACAAACTTCTCTTATCGGAAATTCATAGTTTGAGACTAATAAGATT
CAA-TAACAATACAAACAGAGATTTCACTGCTTCA
ATTTCCGATAAGAGAAG1015
CTTCTCTTATCGGAAAT1016
Lead ToleranceAGCAGTGAAATCTCTGTTTGTATTGAATCTTATTAGTCTCAAACTAT1017
cyclic nucleotide-GAATTTCCGACAATAGAAGTTTGTAAGGTCAGTGTTCCAGATTTGT
regulated ion channelCTCATTGAATTCTAAGTCGTGAAGCTTA
Arabidopsis thalianaTAAGCTTCACGACTTAGAATTCAATGAGACAAATCTGGAACACTGA1018
Glu6TermCCTTACAAACTTCTATTGTCGGAAATTCATAGTTTGAGACTAATAA
GAG-TAGGATTCAATACAAACAGAGATTTCACTGCT
TCCGACAATAGAAGTTT1019
AAACTTCTATTGTCGGA1020
Lead ToleranceAGTGAAATCTCTGTTTGTATTGAATCTTATTAGTCTCAAACTATGAA1021
cyclic nucleotide-TTTCCGACAAGAGTAGTTTGTAAGGTCAGTGTTCCAGATTTGTCTC
regulated ion channelATTGAATTCTAAGTCGTGAAGCTTAATT
Arabidopsis thalianaAATTAAGCTTCACGACTTAGAATTCAATGAGACAAATCTGGAACAC1022
Lys7TermTGACCTTACAAACTACTCTTGTCGGAAATTCATAGTTTGAGACTAA
AAG-TAGTAAGATTCAATACAAACAGAGATTTCACT
GACAAGAGTAGTTTGTA1023
TACAAACTACTCTTGTC1024
Lead ToleranceCATTGAATTCTAAGTCGTGAAGCTTAATTCGATTCTTCTTCACTTTC1025
cyclic nucleotide-TCGGATCAGGTTTTAAGATTGGAAGTCGGATAAGACTTCCTCCGA
regulated ion channelCGTGGAATATTCCGGTAAAAACGAGATTC
Arabidopsis thalianaGAATCTCGTTTTTACCGGAATATTCCACGTCGGAGGAAGTCTTATC1026
Gln12TermCGACTTCCAATCTTAAAACCTGATCCGAGAAAGTGAAGAAGAATC
CAA-TAAGAATTAAGCTTCACGACTTAGAATTCAATG
TCAGGTTTTAAGATTGG1027
CCAATCTTAAAACCTGA1028
Lead ToleranceTGGAAGTCAATCCCCCACGTTGAGCAGGTTGATGCATTGGGTAAA1029
cyclic nucleotide-GTTATGAATCACCGCTAAGACGAGTTTGTGAGGTTTCAGGATTGG
gated calmodulin-AAATCAGAGAGAAGCTCTGAGGGAAATTTTC
binding ion channelGAAAATTTCCCTCAGAGCTTCTCTCTGATTTCCAATCCTGAAACCT1030
(CBP4)CACAAACTCGTCTTAGCGGTGATTCATAACTTTAGCCAATGCATCA
Nicotiana TabacumACCTGCTCAACGTGGGGGATTGACTTCCA
Gln5TermATCACCGCTAAGACGAG1031
CAA-TAACTCGTCTTAGCGGTGAT1032
Lead ToleranceTCAATCCCCCACGTTGAGCAGGTTGATGCATTGGCTAAAGTTATG1033
cyclic nucleotide-AATCACCGCCAAGACTAGTTTGTGAGGTTTCAGGATTGGAAATCA
gated calmodulin-GAGAGAAGCTCTGAGGGAAATTTTCATGCTA
binding ion channelTAGCATGAAAATTTCCCTCAGAGCTTCTCTCTGATTTCCAATCCTG1034
(CBP4)AAACCTCACAAACTAGTCTTGGCGGTGATTCATAACTTTAGCCAAT
Nicotiana TabacumGCATCAACCTGCTCAACGTGGGGGATTGA
Gly7TermGCCAAGACTAGTTTGTG1035
GAG-TAGCACAAACTAGTCTTGGC1036
Lead ToleranceGAGCAGGTTGATGCATTGGCTAAAGTTATGAATCACCGCCAAGAC1037
cyclic nucleotide-GAGTTTGTGAGGTTTTAGGATTGGAAATCAGAGAGAAGCTCTGAG
gated calmodulin-GGAAATTTTCATGCTAAAGGTGGAGTCCACC
binding ion channelGGTGGACTCCACCTTTAGCATGAAAATTTCCCTCAGAGCTTCTCTC1038
(CBP4)TGATTTCCAATCCTAAAACCTCACAAACTCGTCTTGGCGGTGATTC
Nicotiana TabacumATAACTTTAGCCAATGCATCAACCTGCTC
Gln12TermTGAGGTTTTAGGATTGG1039
CAG-TAGCCAATCCTAAAACCTCA1040
Lead ToleranceTGATGCATTGGCTAAAGTTATGAATCACCGCCAAGACGAGTTTGT1041
cyclic nucleotide-GAGGTTTCAGGATTGTAAATCAGAGAGAAGCTCTGAGGGAAATTT
gated calmodulin-TCATGCTAAAGGTGGAGTCCACCGAAGTAAA
binding ion channelTTTACTTCGGTGGACTCCACCTTTAGCATGAAAATTTCCCTCAGAG1042
(CBP4)CTTCTCTCTGATTTACAATCCTGAAACCTCACAAACTCGTCTTGGC
Nicotiana TabacumGGTGATTCATAACTTTAGCCAATGCATCA
Trp14TermCAGGATTGTAAATCAGA1043
TGG-TGATCTGATTTACAATCCTG1044
Lead ToleranceGATGCATTGGCTAAAGTTATGAATCACCGCCAAGACGAGTTTGTG1045
cyclic nucleotide-AGGTTTCAGGATTGGTAATCAGAGAGAAGCTGTGAGGGAAATTTT
gated calmoduin-CATGCTAAAGGTGGAGTCCACCGAAGTAAAG
binding ion channelCTTTACTTCGGTGGACTCCACCTTTAGCATGAAAATTTCCCTCAGA1046
(CBP4)GCTTCTCTCTGATTACCAATCCTGAAACCTCACAAACTCGTCTTGG
Nicotiana TabacumCGGTGATTCATAACTTTAGCCAATGCATC
Lys15TermAGGATTGGTAATCAGAG1047
AAA-TAACTCTGATTACCAATCCT1048
Lead ToleranceCTTGAAGAATTGATCTACCACTCTTAGCTGCTAACTGTTCGCCTGG1049
calmoduin bindingTGGAGATAATGATGTAAAGAGAGGACAGATATGTTAGATTTCAGG
transport proteinACTGCAAATCAGAGCAATCTGTTATCTCAG
Hordeum vulgareCTGAGATAACAGATTGCTCTGATTTGCAGTCCTGAAATGTAACATA1050
Glu2TermTCTGTCCTCTCTTTACATCATTATCTCCACCAGGCGAACAGTTAGC
GAA-TAAAGCTAAGAGTGGTAGATCAATTCTTCAAG
TAATGATGTAAAGAGAG1051
CTCTCTTTACATCATTA1052
Lead ToleranceGAAGAATTGATCTACCACTCTTAGCTGCTAACTGTTCGCCTGGTG1053
calmodulin bindingGAGATAATGATGGAATGAGAGGACAGATATGTTAGATTTCAGGAC
transport proteinTGCAAATCAGAGCAATCTGTTATCTCAGAGA
Hordeum vulgareTCTCTGAGATAACAGATTGCTCTGATTTGCAGTCCTGAAATCTAAC1054
Arg3TermATATCTGTCCTCTCATTCCATCATTATCTCCACCAGGCGAACAGTT
AGA-TGAAGCAGCTAAGAGTGGTAGATCAATTCTTC
TGATGGAATGAGAGGAC1055
GTCCTCTCATTCCATCA1056
Lead ToleranceGAATTGATCTACCACTCTTAGCTGCTAACTGTTCGCCTGGTGGAG1057
calmodulin bindingATAATGATGGAAAGATAGGACAGATATGTTAGATTTCAGGACTGC
transport proteinAAATCAGAGCAATCTGTTATCTCAGAGAACG
Hordeum vulgareCGTTCTCTGAGATAACAGATTGCTCTGATTTGCAGTCCTGAAATCT1058
Glu4TermAACATATCTGTCCTATCTTTCCATCATTATCTCCACCAGGCGAACA
GAG-TAGGTTAGCAGCTAAGAGTGGTAGATCAATTC
TGGAAAGATAGGACAGA1059
TCTGTCCTATCTTTCCA1060
Lead ToleranceATCTACCACTCTTAGCTGCTAACTGTTCGCCTGGTGGAGATAATG1061
calmodulin bindingATGGAAAGAGAGGACTGATATGTTAGATTTCAGGACTGCAAATCA
transport proteinGAGCAATCTGTTATCTCAGAGAACGCAGTTT
Hordeum vulgareAAACTGCGTTCTCTGAGATAACAGATTGCTCTGATTTGCAGTCCTG1062
Arg6TermAAATCTAACATATCAGTCCTCTCTTTCCATCATTATCTCCACCAGG
AGA-TGACGAACAGTTAGCAGCTAAGAGTGGTAGAT
GAGAGGACTGATATGTT1063
AACATATCAGTCCTCTC1064
Lead ToleranceCCACTCTTAGCTGCTAACTGTTCGCCTGGTGGAGATAATGATGGA1065
calmodulin bindingAAGAGAGGACAGATAGGTTAGATTTCAGGAGTGCAAATCAGAGCA
transport proteinATCTGTTATCTCAGAGAACGCAGTTTCACCA
Hordeum vulgareTGGTGAAACTGCGTTCTCTGAGATAACAGATTGCTCTGATTTGCA1066
Tyr7TermGTCCTGAAATCTAACCTATCTGTCCTCTCTTTCCATCATTATCTCCA
TAT-TAGCCAGGCGAACAGTTAGCAGCTAAGAGTGG
GACAGATAGGTTAGATT1067
AATCTAACCTATCTGTC1068
2,4-DB resistanceATCCTTCTCTGAGAAAAAACAACAGATCCGAATTTTATCTTTAATCA1069
3-ketoacyl-CoAGCCGGAAAAAATGTAGAAAGCGATCGAGAGACAACGCGTTCTTCT
thiolaseTGAGCATCTCCGACCTTCTTCTTCTTCTT
Arabidopsis thalianaAAGAAGAAGAAGAAGGTCGGAGATGCTCAAGAAGAACGCGTTGT1070
Glu2TermCTCTCGATCGCTTTCTACATTTTTTCCGGCTGATTAAAGATAAAATT
GAG-TAGCGGATCTGTTGTTTTTTCTCAGAGAAGGAT
AAAAAATGTAGAAAGCG1071
CGCTTTCTACATTTTTT1072
2,4-DB resistanceCTTCTCTGAGAAAAAACAACAGATCCGAATTTTATCTTTAATCAGC1073
3-ketoacyl-CoACGGAAAAAATGGAGTAAGCGATCGAGAGACAACGCGTTCTTCTTG
thiolaseAGCATCTCCGACCTTCTTCTTCTTCTTCGC
Arabidopsis thalianaGCGAAGAAGAAGAAGAAGGTCGGAGATGCTCAAGAAGAACGCGT1074
Lys3TermTGTCTCTCGATCGCTTACTCCATTTTTTCCGGCTGATTAAAGATAA
AAA-TAAAATTCGGATCTGTTGTTTTTTCTCAGAGAAG
AAATGGAGTAAGCGATC1075
GATCGCTTACTCCATTT1076
2,4-DB resistanceGAAAAAACAACAGATCCGAATTTTATCTTTAATCAGCCGGAAAAAA1077
3-ketoacyl-CoATGGAGAAAGCGATCTAGAGACAACGCGTTCTTCTTGAGCATCTCC
thiolaseGACCTTCTTCTTCTTCTTCGCACAATTACG
Arabidopsis thalianaCGTAATTGTGCGAAGAAGAAGAAGAAGGTCGGAGATGCTCAAGA1078
Glu6TermAGAACGCGTTGTCTCTAGATCGCTTTCTCCATTTTTTCCGGCTGAT
GAG-TAGTAAAGATAAAATTCGGATCTGTTGTTTTTTC
AAGCGATCTAGAGACAA1079
TTGTCTCTAGATCGCTT1080
2,4-DB resistanceAAAACAACAGATCCGAATTTTATCTTTAATCAGCCGGAAAAAATGG1081
3-ketoacyl-CoAAGAAAGCGATCGAGTGACAACGCGTTCTTCTTGAGCATCTCCGAC
thiolaseCTTCTTCTTCTTCTTCGCACAATTACGAGG
Arabidopsis thalianaCCTCGTAATTGTGGGAAGAAGAAGAAGAAGGTCGGAGATGCTCAA1082
Arg7TermGAAGAACGCGTTGTCACTCGATCGCTTTCTCCATTTTTTCCGGCT
AGA-TGAGATTAAAGATAAAATTCGGATCTGTTGTTTT
CGATCGAGTGACAACGC1083
GCGTTGTCACTCGATCG1084
2,4-DB resistanceACAACAGATCCGAATTTTATCTTTAATCAGCCGGAAAAAATGGAGA1085
3-ketoacyl-CoAAAGCGATCGAGAGATAACGCGTTCTTCTTGAGCATCTCCGACCTT
thiolaseCTTCTTCTTCTTCGCACAATTACGAGGCTT
Arabidopsis thalianaAAGCCTCGTAATTGTGCGAAGAAGAAGAAGAAGGTCGGAGATGC1086
Gln8TermTCAAGAAGAACGCGTTATCTCTCGATCGCTTTCTCCATTTTTTCCG
CAA-TAAGCTGATTAAAGATAAAATTCGGATCTGTTGT
TCGAGAGATAACGCGTT1087
AACGCGTTATCTCTCGA1088
2,4-DB resistanceGAGAGACAAAGAGTTCTTCTTGAACATCTCCGTCCTTCTTCTTCTT1089
glyoxysomal beta-CCTCTCACAGCTTTTAAGGCTCTCTCTCTGCTTCAGCTTGCTTGGC
ketoacyol-thiolaseTGGGGACAGTGCTGCGTATCAGAGGACCT
precursorAGGTCGTCTGATACGCAGCACTGTCCCCAGCCAAGCAAGCTGAA1090
Brassica napusGCAGAGAGAGAGCCTTAAAAGCTGTGAGAGGAAGAAGAAGAAGG
Glu26TermACGGAGATGTTCAAGAAGAACTCTTTGTCTCTC
GAA-TAAACAGCTTTTAAGGCTCT1091
AGAGCCTTAAAAGCTGT1092
2,4-DB resistanceTTGAACATCTCCGTCCTTCTTCTTCTTCCTCTCACAGCTTTGAAGG1093
glyoxysomal beta-CTCTCTCTCTGCTTGAGCTTGCTTGGCTGGGGACAGTGCTGCGTA
ketoacyol-thiolaseTCAGAGGACCTCTCTCTATGGAGATGATGT
precursorACATCATCTCCATAGAGAGAGGTCCTCTGATACGCAGCACTGTCC1094
Brassica napusCCAGCCAAGCAAGCTCAAGCAGAGAGAGAGCCTTCAAAGCTGTG
Ser32TermAGAGGAAGAAGAAGAAGGACGGAGATGTTCAA
TCA-TGACTCTGCTTGAGCTTGCT1095
AGCAAGCTCAAGCAGAG1096
2,4-DB resistanceTCTCCGTCCTTCTTCTTCTTCCTCTCACAGCTTTGAAGGCTCTCTC1097
glyoxysomal beta-TCTGCTTCAGCTTGATTGGCTGGGGACAGTGCTGCGTATCAGAG
ketoacyol-thiolaseGACCTCTCTCTATGGAGATGATGTAGTCATT
precursorAATGACTACATCATCTCCATAGAGAGAGGTCCTCTGATACGCAGC1098
Brassica napusACTGTCCCCAGCCAATCAAGCTGAAGCAGAGAGAGAGCCTTCAAA
Cys34TermGCTGTGAGAGGAAGAAGAAGAAGGACGGAGA
TGC-TGATCAGCTTGATTGGCTGG1099
CCAGCCAATCAAGCTGA1100
2,4-DB resistanceTCCGTCCTTCTTCTTGTTCCTCTCACAGCTTTGAAGGCTCTCTCTC1101
glyoxysomal beta-TGCTTCAGCTTGCTAGGCTGGGGACAGTGCTGCGTATCAGAGGA
ketoacyol-thiolaseCCTCTCTCTATGGAGATGATGTAGTCATTGT
precursorACAATGACTACATCATCTCCATAGAGAGAGGTCGTCTGATACGCA1102
Brassica napusGCACTGTCCCCAGCCTAGCAAGCTGAAGCAGAGAGAGAGCCTTC
Leu35TermAAAGCTGTGAGAGGAAGAAGAAGAAGGACGGA
TTG-TAGAGCTTGCTAGGCTGGGG1103
CCCCAGCCTAGCAAGCT1104
2,4-DB resistanceTCACAGCTTTGAAGGCTCTCTCTCTGCTTCAGCTTGCTTGGCTGG1105
glyoxysomal beta-GGACAGTGCTGCGTAGCAGAGGACCTCTCTCTATGGAGATGATGT
ketoacyol-thiolaseAGTCATTGTTGCGGCACATAGGACTGCACTA
precursorTAGTGCAGTCCTATGTGCCGCAACAATGACTACATCATCTCCATA1106
Brassica napusGAGAGAGGTCGTCTGCTACGCAGCACTGTCCCCAGCCAAGCAAG
Tyr42TermCTGAAGCAGAGAGAGAGCCTTCAAAGCTGTGA
TAT-TAGGCTGCGTAGCAGAGGAC1107
GTCCTCTGCTACGCAGC1108
2,4-DB resistanceCAACAGACAGGAAGTGTTGCTCCAGCATCTCCGCCCTTCTAATTC1109
3-ketoacyl-CoATTCTTCTCACAATTAGee GAGTCCGCTCTTGCCGCATCAGTATGTGCT
thiolase BGCAGGGGATAGCGCCGCATATCATAGGGCT
Mangifera indicaAGCCCTATGATATGCGGCGCTATCCCCTGCAGCACATACTGATGC1110
Tyr25TermGGCAAGAGCGGACTCCTAATTGTGAGAAGAAGAATTAGAAGGGC
TAC-TAGGGAGATGCTGGAGCAACACTTGCTGTCTGTTG
CACAATTAGGAGTCCGC1111
GCGGACTCCTAATTGTG1112
2,4-DB resistanceAACAGACAGCAAGTGTTGCTCCAGCATCTCCGCCCTTCTAATTCTT1113
3-ketoacyol-CoACTTCTCACAATTACTAGTCCGCTCTTGCCGCATCAGTATGTGCTGC
thiolase BAGGGGATAGCGCCGCATATCATAGGGCTT
Magnifera indicaAAGCCCTATGATATGCGGCGCTATCCCCTGCAGCACATACTGATG1114
Glu26TermCGGCAAGAGCGGACTAGTAATTGTGAGAAGAAGAATTAGAAGGG
GAG-TAGCGGAGATGCTGGAGCAACACTTGCTGTCTGTT
ACAATTACTAGTCCGCT1115
AGCGGACTAGTAATTGT1116
2,4-DB resistanceTCCAGCATCTCCGCCCTTCTAATTCTTCTTCTCACAATTACGAGTC1117
3-ketoacy\to-CoACGCTCTTGCCGCATGAGTATGTGCTGCAGGGGATAGCGCCGCAT
thioblase BATCATAGGGCTTCTGTTTATGGAGACGATGT
Mangifera indicaACATCGTCTCCATAAACAGAAGCCCTATGATATGCGGCGCTATCC1118
Ser32TermCCTGCAGCACATACTCATGCGGCAAGAGCGGACTCGTAATTGTGA
TCA-TGAGAAGAAGAATTAGAAGGGCGGAGATGCTGGA
TGCCGCATGAGTATGTG1119
CACATACTCATGCGGCA1120
2,4-DB resistanceTCTCCGCCCTTCTAATTCTTCTTCTCACAATTACGAGTCCGCTCTT1121
3-ketoacyl-CoAGCCGCATCAGTATGAGCTGCAGGGGATAGCGCCGGATATCATAG
thiolase BGGCTTCTGTTTATGGAGACGATGTGGTGATT
Mangifera indicaAATCACCACATCGTCTCCATAAACAGAAGCCCTATGATATGCGGC1122
Cys34TermGCTATCCCCTGCAGCTCATACTGATGCGGCAAGAGCGGACTCGT
TGT-TGAAATTGTGAGAAGAAGAATTAGAAGGGCGGAGA
TCAGTATGAGCTGCAGG1123
CCTGCAGCTCATACTGA1124
2,4-DB resistanceTCACAATTACGAGTCCGCTCTTGCCGCATCAGTATGTGCTGCAGG1125
3-ketoacyl-CoAGGATAGCGCCGCATAGCATAGGGCTTGTGTTTATGGAGACGATGT
thiolase BGGTGATTGTGGCAGGTCATCGTACTGCACTT
Mangifera indicaAAGTGCAGTAGGATGAGCTGCCACAATCACCACATCGTCTCCATA1126
Tyr42TermAACAGAAGCCCTATGCTATGCGGCGCTATCCCCTGCAGCACATAC
TAT-TAGTGATGCGGCAAGAGCGGACTCGTAATTGTGA
GCCGCATAGCATAGGGC1127
GCCCTATGCTATGCGGC1128
2,4-DB resistanceGAAGGCGATCAACAGGCAGAGCATTTTGCTACATCATCTCCGGCC1129
3-ketoacyl-CoATTCTTCTTCCGCTTAGACAAATGAATCTTCGCTCTCTGCATCGGTT
thiolaseTGTGCAGCTGGGGATAGTGCTTCGTATCAA
Cucumis sativusTTGATACGAAGCACTATCCCCAGCTGCACAAACCGATGCAGAGAG1130
Tyr22TermCGAAGATTCATTTGTCTAAGCGGAAGAAGAAGGCCGGAGATGATG
TAG-TAGTAGCAAAATGCTCTGGCTGTTGATCGCCTTC
TCCGCTTAGACAAATGA1131
TCATTTGTCTAAGCGGA1132
2,4-DB resistanceATCAACAGGCAGAGCATTTTGCTACATCATCTCCGGCCTTCTTCTT1133
3-ketoacyl-CoACCGCTTACACAAATTAATCTTCGCTCTCTGCATCGGTTTGTGCAGC
thiolaseTGGGGATAGTGCTTCGTATCAAAGGACAT
Cucumis sativusATGTCCTTTGATACGAAGCAGTATCCCCAGCTGCACAAACCGATG1134
Glu25TermCAGAGAGCGAAGATTAATTTGTGTAAGCGGAAGAAGAAGGCCGG
GAA-TAAAGATGATGTAGCAAAATGCTCTGCCTGTTGAT
ACACAAATTAATCTTCG1135
CGAAGATTAATTTGTGT1136
2,4-DB resistanceGGCAGAGCATTTTGCTACATCATCTCCGGCCTTCTTCTTCCGCTTA1137
3-ketoacyl-CoACACAAATGAATCTTAGCTCTCTGCATCGGTTTGTGCAGCTGGGGA
thiolaseTAGTGCTTCGTATCAAAGGACATCGGTGTT
Cucumis sativusAACACCGATGTCCTTTGATACGAAGCACTATCCCCAGCTGCACAA1138
Ser27TermACCGATGCAGAGAGCTAAGATTCATTTGTGTAAGCGGAAGAAGAA
TCG-TAGGGCCGGAGATGATGTAGCAAAATGCTCTGCC
TGAATCTTAGCTCTCTG1139
CAGAGAGCTAAGATTCA1140
2,4-DB resistanceTGCTACATCATCTCCGGCCTTCTTCTTCCGCTTACACAAATGAATC1141
3-ketoacyl-CoATTCGCTCTCTGCATAGGTTTGTGCAGCTGGGGATAGTGCTTCGTA
thiolaseTCAAAGGACATCGGTGTTTGGAGATGATGT
Cucumis sativusACATCATCTCCAAACACCGATGTCCTTTGATACGAAGCACTATCCC1142
Ser31TermCAGCTGCACAAACCTATGCAGAGAGCGAAGATTCATTTGTGTAAG
TCG-TAGCGGAAGAAGAAGGCCGGAGATGATGTAGCA
CTCTGCATAGGTTTGTG1143
CACAAACCTATGCAGAG1144
2,4-DB resistanceTCATCTCCGGCCTTCTTCTTCCGCTTACACAAATGAATCTTCGCTC1145
3-ketoacyl-CoATCTGCATCGGTTTGAGCAGCTGGGGATAGTGCTTCGTATCAAAGG
thiolaseACATCGGTGTTTGGAGATGATGTCGTGATT
Cucumis sativusAATCACGACATCATCTCCAAACACCGATGTCCTTTGATACGAAGCA1146
Cys33TermCTATCCCCAGCTGCTCAAACCGATGCAGAGAGCGAAGATTCATTT
TGT-TGAGTGTAAGCGGAAGAAGAAGGCCGGAGATGA
TCGGTTTGAGCAGCTGG1147
CCAGCTGCTCAAACCGA1148
2A-DB resistanceGAAGGCAATCAACAGGCAGAGCATTCTGCTACATCATCTCCGGCC1149
3-ketoacyl-CoATTCATCTTCGGCTTAGACCCATGAATCTTCGCTCTCTGCATCGGTT
thiolaseTGTGCAGCTGGGGATAGTGCGTCGTATCAA
Cucurbita sp.TTGATACGACGCACTATCCCCAGCTGCACAAACCGATGCAGAGAG1150
Tyr22TermCGAAGATTCATGGCTCTAAGCCGAAGATGAAGGCCGGAGATGAT
TAT-TAGGTAGCAGAATGCTCTGCCTGTTGATTGCCTTC
TCGGCTTAGAGCCATGA1151
TCATGGCTCTAAGCCGA1152
2,4-DB resistanceATCAACAGGCAGAGCATTCTGCTACATCATCTCCGGCCTTCATCTT1153
3-ketoacyl-CoACGGCTTATAGCCATTAATCTTCGCTCTCTGCATCGGTTTGTGCAGC
thiolaseTGGGGATAGTGCGTCGTATCAAAGAACGT
Cucurbita sp.ACGTTCTTTGATACGACGCACTATCCCCAGCTGCACAAACCGATG1154
Glu25TermCAGAGAGCGAAGATTAATGGCTATAAGCCGAAGATGAAGGCCGG
GAA-TAAAGATGATGTAGCAGAATGCTCTGCCTGTTGAT
ATAGCCATTAATCTTCG1155
CGAAGATTAATGGCTAT1156
2,4-DB resistanceGGCAGAGCATTCTGCTACATCATCTCCGGCCTTCATCTTCGGCTT1157
3-ketoacyl-CoAATAGCCATGAATCTTAGCTCTCTGCATCGGTTTGTGCAGCTGGGG
thiolaseATAGTGCGTCGTATCAAAGAACGTCGGTGTT
Cucurbita sp.AACACCGACGTTCTTTGATACGACGCACTATCCCCAGCTGCACAA1158
Ser27TermACCGATGCAGAGAGCTAAGATTCATGGCTATAAGCCGAAGATGAA
TCG-TAGGGCCGGAGATGATGTAGCAGAATGCTCTGCC
TGAATCTTAGCTCTCTG1159
CAGAGAGCTAAGATTCA1160
2,4-DB resistanceTGCTACATCATCTCCGGCCTTCATCTTCGGCTTATAGCCATGAATC1161
3-ketoacyl-CoATTCGCTCTCTGCATAGGTTTGTGCAGCTGGGGATAGTGCGTCGTA
thiolaseTCAAAGAACGTCGGTGTTTGGAGATGATGT
Cucurbita sp.ACATCATCTCCAAACACCGACGTTCTTTGATACGACGCACTATCCC1162
Ser31TermCAGCTGCACAAACCTATGCAGAGAGCGAAGATTCATGGCTATAAG
TCG-TAGCCGAAGATGAAGGCCGGAGATGATGTAGCA
CTCTGCATAGGTTTGTG1163
CACAAACCTATGCAGAG1164
2,4-DB resistanceTCATCTCCGGCCTTCATCTTCGGCTTATAGCCATGAATCTTCGCTC1165
3-ketoacyl-CoATCTGCATCGGTTTGAGCAGCTGGGGATAGTGCGTCGTATCAAAGA
thiolaseACGTCGGTGTTTGGAGATGATGTCGTGATA
Cucurbita sp.TATCACGACATCATCTCCAAACACCGACGTTCTTTGATACGACGCA1166
Cys33TermCTATCCCCAGCTGCTCAAACCGATGCAGAGAGCGAAGATTCATGG
TGT-TGACTATAAGCCGAAGATGAAGGCCGGAGATGA
TCGGTTTGAGCAGCTGG1167
CCAGCTGCTCAAACCGA1168
2,4 DB resistanceTCATAGTCTCTTTTGCCGCTTGGATTCTTCCAAGGTTAGTGAGCTG1169
Pex14CTATGGCAACTCATTAGCAAACGCAACCTCCTTCCGATTTTCCCGC
Arabidopsis thalianaTCTTGCCGATGAAAATTCCCAGATTCCAG
Gln5TermCTGGAATCTGGGAATTTTCATCGGCAAGAGCGGGAAAATCGGAA1170
CAG-TAGGGAGGTTGCGTTTGCTAATGAGTTGCCATAGCAGCTCACTAACCT
TGGAAGAATCCAAGCGGCAAAAGAGACTATGA
CAACTCATTAGCAAACG1171
CGTTTGCTAATGAGTTG1172
2,4 DB resistanceTAGTCTCTTTTGCCGCTTGGATTCTTCCAAGGTTAGTGAGCTGCTA1173
Pex14TGGCAACTCATCAGTAAACGCAACCTCCTTCCGATTTTCCCGCTCT
Arabidopsis thalianaTGCCGATGAAAATTCCCAGATTGCAGGTT
Gln6TermAACCTGGAATCTGGGAATTTTCATCGGCAAGAGCGGGAAAATCGG1174
CAA-TAAAAGGAGGTTGCGTTTACTGATGAGTTGCCATAGCAGCTCACTAAC
CTTGGAAGAATCCAAGCGGCAAAAGAGACTA
CTCATCAGTAAACGCAA1175
TTGCGTTTACTGATGAG1176
2,4 DB resistanceCTTTTGCCGCTTGGATTCTTCCAAGGTTAGTGAGCTGCTATGGCA1177
Pex14ACTCATCAGCAAACGTAACCTCCTTCCGATTTTCCCGCTCTTGCCG
Arabidopsis thalianaATGAAAATTCCGAGATTCCAGGTTCAATTT
Gln8TermAAATTGAACCTGGAATCTGGGAATTTTCATCGGCAAGAGCGGGAA1178
CAA-TAAAATCGGAAGGAGGTTACGTTTGCTGATGAGTTGCCATAGCAGCTC
ACTAACCTTGGAAGAATCCAAGCGGCAAAAG
AGCAAACGTAACCTCCT1179
AGGAGGTTACGTTTGCT1180
2,4 DB resistanceGCTGCTATGGCAACTGATGAGCAAACGCAACCTCCTTCCGATTTT1181
Pex14CCCGCTCTTGCCGATTAAAATTCCCAGATTCCAGGTTCAATTTACA
Arabidopsis thalianaCCTTCTAATCATTATTTCTTAATTTTTCTT
Glu19TermAAGAAAAATTAAGAAATAATGATTAGAAGGTGTAAATTGAACCTGG1182
GAA-TAAAATCTGGGAATTTTAATCGGCAAGAGCGGGAAAATCGGAAGGAG
GTTGCGTTTGCTGATGAGTTGCCATAGCAGC
TTGCCGATTAAAATTCC1183
GGAATTTTAATCGGCAA1184
2,4 DB resistanceGCAACTCATCAGCAAACGCAACCTCCTTCCGATTTTCCCGCTCTT1185
Pex14GCCGATGAAAATTCCTAGATTCCAGGTTCAATTTACACCTTCTAAT
Arabidopsis thalianaCATTATTTCTTAATTTTTCTTTGGTGGATT
Gln22TermAATCCACCAAAGAAAAATTAAGAAATAATGATTAGAAGGTGTAAAT1186
CAG-TAGTGAACCTGGAATCTAGGAATTTTCATCGGCAAGAGCGGGAAAATC
GGAAGGAGGTTGCGTTTGCTGATGAGTTGC
AAAATTCCTAGATTCCA1187
TGGAATCTAGGAATTTT1188

EXAMPLE 8

Production of Albino Mutants for the Analysis of Photosynthetic Processes

[0132] Plant productivity is limited by resources available and the ability of plants to harness these resources. The conversion of light to chemical energy, which is then used to synthesize carbohydrates, fatty acids, sugars, amino acids and other compounds, requires a complex system which combines the light harvesting apparatus of pigments and proteins. The value of light energy to the plant can only be realized when it is efficiently converted into chemical energy by photosynthesis and fed into various biochemical processes. Significant effort has therefore been directed at studying photosynthetic processes in plants in order to improve productivity and/or the efficiency of photosynthesis. The analysis of the photosynthetic process is substantially aided by the ability to produce albino plants.

[0133] The attached table discloses exemplary oligonucleotide base sequences which can be used to generate site-specific mutations in genes involved in starch metabolism. 20

TABLE 18
Oligonucleotides to produce albino plants
Phenotype, Gene,
Plant & TargetedSEQ ID
AlterationAltering OligosNO:
White leavesTTCTTTCCTGTGAAATTATCTGCTCAAATCTTTGGTTCCTGACGGAG1189
ImmutansATGGCGGCGATTTGAGGCATCTCCTCTGGTACGTTGACGATTTCA
Arabidopsis thalianaCGGCCTTTGGTTACTCTTCGACGCTCTAG
Ser5TermCTAGAGCGTCGAAGAGTAACCAAAGGCCGTGAAATCGTCAACGTA1190
TCA-TGACCAGAGGAGATGCCTCAAATCGCCGCCATCTCCGTCAGGAACCAA
AGATTTGAGCAGATAATTTCACAGGAAAGAA
GGCGATTTGAGGCATCT1191
AGATGCCTCAAATCGCC1192
White leavesGCTCAAATCTTTGGTTCCTGACGGAGATGGCGGCGATTTCAGGCA1193
ImmutansTCTCCTCTGGTACGTAGACGATTTCACGGCCTTTGGTTACTCTTCG
Arabidopsis thalianaACGCTCTAGAGCCGCCGTTTCGTACAGCTC
Leu12TermGAGCTGTACGAAACGGCGGCTCTAGAGCGTCGAAGAGTAACCAAA 1194
TTG-TAGGGCCGTGAAATCGTCTACGTACCAGAGGAGATGCCTGAAATCGCC
GCCATCTCCGTCAGGAACCAAAGATTTGAGC
TGGTACGTAGACGATTT1195
AAATCGTCTACGTACCA1196
White leavesTTTGGTTCCTGACGGAGATGGCGGCGATTTCAGGCATCTCCTCTG1197
ImmutansGTACGTTGACGATTTGACGGCCTTTGGTTACTCTTCGACGCTCTAG
Arabidopsis thalianaAGCCGCCGTTTCGTACAGCTCCTCTCACCG
Ser15TermCGGTGAGAGGAGCTGTACGAAACGGCGGCTCTAGAGCGTCGAAG1198
TCA-TGAAGTAACCAAAGGCCGTCAAATCGTCAACGTACCAGAGGAGATGCC
TGAAATCGCCGCCATCTCCGTCAGGAACCAAA
GACGATTTGACGGCCTT1199
AAGGCCGTCAAATCGTC1200
White leavesGCGGCGATTTCAGGCATCTCCTCTGGTACGTTGACGATTTCACGG1201
ImmutansCCTTTGGTTACTCTTTGACGCTCTAGAGCCGCCGTTTCGTACAGCT
Arabidopsis thalianaCCTCTCACCGATTGCTTCATCATCTTCCTC
Arg22TermGAGGAAGATGATGAAGCAATCGGTGAGAGGAGCTGTACGAAACG1202
CGA-TGAGCGGCTCTAGAGCGTCAAAGAGTAACCAAAGGCCGTGAAATCGTC
AACGTACCAGAGGAGATGCCTGAAATCGCCGC
TTACTCTTTGACGCTCT1203
AGAGCGTCAAAGAGTAA1204
White leavesTCAGGCATCTCCTCTGGTACGTTGACGATTTCACGGCCTTTGGTTA1205
ImmutansCTCTTCGACGCTCTTGAGCCGCCGTTTCGTACAGCTCCTCTCACC
Arabidopsis thalianaGATTGCTTCATCATCTTCCTCTCTCTTCTC
Arg25TermGAGAAGAGAGAGGAAGATGATGAAGCAATCGGTGAGAGGAGCTG1206
AGA-TGATACGAAACGGCGGCTCAAGAGCGTCGAAGAGTAACCAAAGGCCG
TGAAATCGTCAACGTACCAGAGGAGATGCCTGA
GACGCTCTTGAGCCGCC1207
GGCGGCTCAAGAGCGTC1208
White leavesGATTCTTGTGGGAAGGAAGAAGGATCAAGAATGGCGATTTCGATT1209
ImmutansTCTGCTATGAGTTTTTGAACCTCAGTTTCTTCATATTCTTGTTTTAG
LycopersiconAGCTAGGAGTTTTGAGAAGTCATCAGTTT
esculentumAAACTGATGACTTCTCAAAACTCCTAGCTCTAAAACAAGAATATGA1210
Gly11TermAGAAACTGAGGTTCAAAAACTCATAGCAGAAATCGAAATCGCCATT
GGA-TGACTTGATCCTTCTTCCTTCCCACAAGAATC
TGAGTTTTTGAACCTCA1211
TGAGGTTCAAAAACTCA1212
White leavesGTGGGAAGGAAGAAGGATCAAGAATGGCGATTTCGATTTCTGCTA1213
ImmutansTGAGTTTTGGAACCTGAGTTTCTTCATATTCTTGTTTTAGAGCTAGG
LycopersiconAGTTTTGAGAAGTCATCAGTTTTATGCAA
esculentumTTGCATAAAACTGATGACTTCTCAAAACTCCTAGCTCTAAAACAAG1214
Ser13TermAATATGAAGAAACTCAGGTTCCAAAACTCATAGCAGAAATCGAAAT
TCA-TGACGCCATTCTTGATCCTTCTTCCTTCCCAC
TGGAACCTGAGTTTCTT1215
AAGAAACTCAGGTTCCA1216
White leavesAAGAAGGATCAAGAATGGCGATTTCGATTTCTGCTATGAGTTTTGG1217
ImmutansAACCTCAGTTTCTTGATATTCTTGTTTTAGAGCTAGGAGTTTTGAGA
LycopersiconAGTCATCAGTTTTATGCAATTCCCAGAA
esculentumTTCTGGGAATTGCATAAAACTGATGACTTCTCAAAACTCCTAGCTC1218
Ser16TermTAAAACAAGAATATCAAGAAACTGAGGTTCCAAAACTCATAGCAGA
TCA-TGAAATCGAAATCGCCATTCTTGATCCTTCTT
AGTTTCTTGATATTCTT1219
AAGAATATCAAGAAACT1220
White leavesAGGATCAAGAATGGCGATTTCGATTTCTGCTATGAGTTTTGGAACC1221
ImmutansTCAGTTTCTTCATAGTCTTGTTTTAGAGCTAGGAGTTTTGAGAAGTC
LycopersiconATCAGTTTTATGCAATTCCCAGAACCCA
esculentumTGGGTTCTGGGAATTGCATAAAACTGATGACTTCTCAAAACTCCTA1222
Tyr17TermGCTCTAAAACAAGACTATGAAGAAACTGAGGTTCCAAAACTCATAG
TAT-TAGCAGAAATCGAAATCGCCATTCTTGATCCT
TCTTCATAGTCTTGTTT1223
AAACAAGACTATGAAGA1224
White leavesAAGAATGGCGATTTCGATTTCTGCTATGAGTTTTGGAACCTCAGTT1225
ImmutansTCTTCATATTCTTGATTTAGAGCTAGGAGTTTTGAGAAGTCATCAGT
LycopersiconTTTATGCAATTCCCAGAACCCATGTCGG
esculentumCCGACATGGGTTCTGGGAATTGCATAAAACTGATGACTTCTCAAAA1226
Cys19TermCTCCTAGCTCTAAATCAAGAATATGAAGAAACTGAGGTTCCAAAAC
TGT-TGATCATAGCAGAAATCGAAATCGCCATTCTT
TATTCTTGATTTAGAGC1227
GCTCTAAATCAAGAATA1228
White leavesCGCGTCCGATAAAAAAATCAAGAATGGCGATTTCCATATCTGCTAT1229
ImmutansGAGTTTTCGAACTTGAGTTTCTTCTTCATATTCAGCATTTTTGTGCA
Capsicum annuumATTCCAAGAACCCATTTTGTTTGAATTC
Ser13TermGAATTCAAACAAAATGGGTTCTTGGAATTGCACAAAAATGCTGAAT1230
TCA-TGAATGAAGAAGAAACTCAAGTTCGAAAACTCATAGCAGATATGGAAAT
CGCCATTCTTGATTTTTTTATCGGACGCG
TCGAACTTGAGTTTCTT1231
AAGAAACTCAAGTTCGA1232
White leavesAAAAATCAAGAATGGCGATTTCCATATCTGCTATGAGTTTTCGAAC1233
ImmutansTTCAGTTTCTTCTTGATATTCAGCATTTTTGTGCAATTCCAAGAACC
Capsicum annuumCATTTTGTTTGAATTCTCTATTTTCACT
Ser17TermAGTGAAAATAGAGAATTCAAACAAAATGGGTTCTTGGAATTGCACA1234
TCA-TGAAAAATGCTGAATATCAAGAAGAAACTGAAGTTCGAAAACTCATAGC
AGATATGGAAATCGCCATTCTTGATTTTT
TTCTTCTTGATATTCAG1235
CTGAATATCAAGAAGAA1236
White leavesCAAGAATGGCGATTTCCATATCTGCTATGAGTTTTCGAACTTCAGT1237
ImmutansTTCTTCTTCATATTGAGCATTTTTGTGCAATTCCAAGAACCCATTTT
Capsicum annuumGTTTGAATTCTCTATTTTCACTTAGGAA
Ser19TermTTCCTAAGTGAAAATAGAGAATTCAAACAAAATGGGTTCTTGGAAT1238
TCA-TGATGCACAAAAATGCTCAATATGAAGAAGAAACTGAAGTTCGAAAACT
CATAGCAGATATGGAAATCGCCATTCTTG
TTCATATTGAGCATTTT1239
AAAATGCTCAATATGAA1240
White leavesCGATTTCCATATCTGCTATGAGTTTTCGAACTTCAGTTTCTTCTTCA1241
ImmutansTATTCAGCATTTTAGTGCAATTCCAAGAACCCATTTTGTTTGAATTC
Capsicum annuumTCTATTTTCACTTAGGAATTCTCATAG
Leu21TermCTATGAGAATTCCTAAGTGAAAATAGAGAATTCAAACAAAATGGGT1242
TTG-TAGTCTTGGAATTGCACTAAAATGCTGAATATGAAGAAGAAACTGAAGT
TCGAAAACTCATAGCAGATATGGAAATCG
AGCATTTTAGTGCAATT1243
AATTGCACTAAAATGCT1244
White leavesTTCCATATCTGCTATGAGTTTTCGAACTTCAGTTTCTTCTTCATATT1245
ImmutansCAGCATTTTTGTGAAATTCCAAGAACCCATTTTGTTTGAATTCTCTA
Capsicum annuumTTTTCACTTAGGAATTCTCATAGAACT
Cys22TermAGTTCTATGAGAATTCCTAAGTGAAAATAGAGAATTCAAACAAAAT1246
TGC-TGAGGGTTCTTGGAATTTCACAAAAATGCTGAATATGAAGAAGAAACTG
AAGTTCGAAAACTCATAGCAGATATGGAA
TTTTTGTGAAATTCCAA1247
TTGGAATTTCACAAAAA1248
White leavesTTCGGCACGAGGGAGAAGGAGCAGACCGAGGTGGCCGTCGAGG1249
ImmutansAGTCCTTCCCCTTCAGGTAGACGGCTCCTCCTGACGAGCCACTGG
Oryza sativaTCACCGCCGAGGAGAGCTGGGTGGTTAAGCTCG
Glu22TermCGAGCTTAACCACCCAGCTCTCCTCGGCGGTGACCAGTGGCTCGT1250
GAG-TAGCAGGAGGAGCCGTCTACCTGAAGGGGAAGGACTCCTCGACGGCC
ACCTCGGTCTGCTCCTTCTCCCTCGTGCCGAA
CCTTCAGGTAGACGGCT1251
AGCCGTCTACCTGAAGG1252
White leavesGAGCAGACCGAGGTGGCCGTCGAGGAGTCCTTCCCCTTCAGGGA1253
ImmutansGACGGCTCCTCCTGACTAGCCACTGGTCACCGCCGAGGAGAGCT
Oryza sativaGGGTGGTTAAGCTCGAGCAGTCCGTGAACATTT
Glu28TermAAATGTTCACGGACTGCTCGAGCTTAACCACCCAGCTCTCCTCGG1254
CAG-TAGCGGTGACCAGTGGCTAGTCAGGAGGAGCCGTCTCCCTGAAGGGG
AAGGACTCCTCGACGGCCACCTCGGTCTGCTC
CTCCTGACTAGCCACTG1255
CAGTGGCTAGTCAGGAG1256
White leavesGTCGAGGAGTCCTTCCCCTTCAGGGAGACGGCTCCTCCTGACGA1257
ImmutansGCCACTGGTCACCGCCTAGGAGAGCTGGGTGGTTAAGCTCGAGC
Oryza sativaAGTCCGTGAACATTTTCCTCACGGAGTCAGTCA
Glu34TermTGACTGACTCCGTGAGGAAAATGTTCACGGACTGCTCGAGCTTAA1258
GAG-TAGCCACCCAGCTCTCCTAGGCGGTGACCAGTGGCTCGTCAGGAGGA
GCCGTCTCCCTGAAGGGGAAGGACTCCTCGAC
TCACCGCCTAGGAGAGC1259
GCTCTCCTAGGCGGTGA1260
White leavesGAGGAGTCCTTCCCCTTCAGGGAGACGGCTCCTCCTGACGAGCC1261
ImmutansACTGGTCACCGCCGAGTAGAGCTGGGTGGTTAAGCTCGAGCAGT
Oryza sativaCCGTGAACATTTTCCTCACGGAGTCAGTCATCA
Glu35TermTGATGACTGACTCCGTGAGGAAAATGTTCACGGACTGCTCGAGCT1262
GAG-TAGTAACCACCCAGCTCTACTCGGCGGTGACCAGTGGCTCGTCAGGA
GGAGCCGTCTCCCTGAAGGGGAAGGACTCCTC
CCGCCGAGTAGAGCTGG1263
CCAGCTCTACTCGGCGG1264
White leavesCTTCCCCTTCAGGGAGACGGCTCCTCCTGACGAGCCACTGGTCAC1265
ImmutansCGCCGAGGAGAGCTGAGTGGTTAAGCTCGAGCAGTCCGTGAACA
Oryza sativaTTTTCCTCACGGAGTCAGTCATCACGATACTT
Trp37TermAAGTATCGTGATGACTGACTCCGTGAGGAAAATGTTCACGGACTG1266
TGG-TGACTCGAGCTTAACCACTCAGCTCTCCTCGGCGGTGACCAGTGGCTC
GTCAGGAGGAGCCGTCTCCCTGAAGGGGAAG
GAGAGCTGAGTGGTTAA1267
TTAACCACTCAGCTCTC1268
White leavesTCCGGAGGAGGAAGGGGGATTCGACGAGGAGCTCACCCTCGCCG1269
ImmutansGCGAGGACGGCGACTGAGTCGTCAGATTCGAGCAGTCCTTCAAC
Triticum aestivumGTATTCCTCACGGATACTGTCATCTTTATACTC
Trp22TermGAGTATAAAGATGACAGTATCCGTGAGGAATACGTTGAAGGACTG1270
TGG-TGACTCGAATCTGACGACTCAGTCGCCGTCCTCGCCGGCGAGGGTGA
GCTCCTCGTCGAATCCCCCTTCCTCCTCCGGA
GGCGACTGAGTCGTCAG1271
CTGACGACTCAGTCGCC1272
White leavesGAGGAAGGGGGATTCGACGAGGAGCTCACCCTCGCCGGCGAGG1273
ImmutansACGGCGACTGGGTCGTCTGATTCGAGCAGTCCTTCAACGTATTCC
Triticum aestivumTCACGGATACTGTCATCTTTATACTCGATATTC
Arg25TermGAATATCGAGTATAAAGATGACAGTATCCGTGAGGAATACGTTGAA1274
AGA-TGAGGACTGCTCGAATCAGACGACCCAGTCGCCGTCCTCGCCGGCGA
GGGTGAGCTCCTCGTCGAATCCCCCTTCCTC
GGGTCGTCTGATTCGAG1275
CTCGAATCAGACGACCC1276
White leavesGGGGGATTCGACGAGGAGCTCACCCTCGCCGGCGAGGACGGCG1277
ImmutansACTGGGTCGTCAGATTCTAGCAGTCCTTCAACGTATTCCTCACGGA
Triticum aestivumTACTGTCATCTTTATACTCGATATTCTGTATC
Glu21TermGATACAGAATATCGAGTATAAAGATGACAGTATCCGTGAGGAATAC1278
GAG-TAGGTTGAAGGACTGCTAGAATCTGACGACCCAGTCGCCGTCCTCGCC
GGCGAGGGTGAGCTCCTCGTCGAATCCCCC
TCAGATTCTAGCAGTCC1279
GGACTGCTAGAATCTGA1280
White leavesGGATTCGACGAGGAGCTCACCCTCGCCGGCGAGGACGGCGACTG1281
ImmutansGGTCGTCAGATTCGAGTAGTCCTTCAACGTATTCCTCACGGATACT
Triticum aestivumGTCATCTTTATACTCGATATTCTGTATCGTG
Gln28TermCACGATACAGAATATCGAGTATAAAGATGACAGTATCCGTGAGGAA1282
CAG-TAGTACGTTGAAGGACTACTCGAATCTGACGACCCAGTCGCCGTCCTC
GCCGGCGAGGGTGAGCTCCTCGTCGAATCC
GATTCGAGTAGTCCTTC1283
GAAGGACTACTCGAATC1284
White leavesCGAGCAGTCCTTCAACGTATTCCTCACGGATACTGTCATCTTTATA1285
ImmutansCTCGATATTCTGTAGCGTGACCGCGACTACGCAAGGTTCTTCGTG
Triticum aestivumCTCGAGACCATCGCCAGGGTGCCCTATTTC
Tyr46TermGAAATAGGGCACCCTGGCGATGGTCTCGAGCACGAAGAACCTTG1286
TAT-TAGCGTAGTCGCGGTCACGCTACAGAATATCGAGTATAAAGATGACAG
TATCCGTGAGGAATACGTTGAAGGACTGCTCG
ATTCTGTAGCGTGACCG1287
CGGTCACGCTACAGAAT1288

EXAMPLE 9

Altering Amino Acid Content of Plants

[0134] Another aim of biotechnology is to generate plants, especially crop plants, with added value traits. An example of such a trait is improved nutritional quality in food crops. For example, lysine, tryptophan and threonine, which are essential amino acids in the diet of humans and many animals, are limiting nutrients in most cereal crops. Consequently, grain-based diets, such as those based on corn, barley, wheat, rice, maize, millet, sorghum, and the like, must be supplemented with more expensive synthetic amino acids or amino-acid-containing oilseed protein meals. Increasing the lysine content of these grains or of any of the feed component crops would result in significant added value.

[0135] Naturally occurring mutants of plants that have different levels of particular essential amino acids have been identified. However, these mutants are generally not the result of increased free amino acid, but are instead the result of shifts in the overall protein profile of the grain. For example, in maize, reduced levels of lysine-deficient endosperm proteins (prolamines) are complemented by elevated levels of more lysine-rich proteins (albumins, globulins and glutelins). While nutritionally superior, these mutants are associated with reduced yields and poor grain quality, limiting their agronomic usefulness.

[0136] An alternative approach is to generate plants with mutations that render key amino acid biosynthetic enzymes insensitive to feedback inhibition. Many such mutations are known and mutation results in increased free amino acid. The increased production can optionally be coupled to increased expression of an abundant storage protein comprising the chosen amino acid. Alternatively, a normally abundant protein can be engineered to contain more of the target amino acid.

[0137] The attached table discloses exemplary oligonucleotide base sequences which can be used to generate site-specific mutations that remove feedback inhibition in plant amino acid biosynthetic enzymes. 21

TABLE 19
Genome-Altering Oligos Conferring Amino Acid Overproduction
Phenotype, Gene,
Plant & TargetedSEQ ID
AlterationAltering OligosNO:
Met OverproductionTATCCTCCAGGATCTTAAGATTTCCTCCTAATTTCGTCCGTCAGCT1289
CGSGAGCATTAAAGCCCATAGAAACTGTAGCAACATCGGTGTTGCACA
Arabidopsis thalianaGATCGTGGCGGCTAAGTGGTCCAACAACCC
Arg77HisGGGTTGTTGGACCACTTAGCCGCCACGATCTGTGCAACACCGAT1290
CGT-CATGTTGCTACAGTTTCTATGGGCTTTAATGCTCAGCTGACGGACGAA
ATTAGGAGGAAATCTTAAGATCCTGGAGGATA
TAAAGCCCATAGAAACT1291
AGTTTCTATGGGCTTTA1292
Met OverproductionTCTTAAGATTTCCTCCTAATTTCGTCCGTCAGCTGAGCATTAAAGC1293
CGSCCGTAGAAACTGTAACAACATCGGTGTTGCACAGATCGTGGCGG
Arabidopsis thalianaCTAAGTGGTCCAACAACCCATCCTCCGCGTT
Ser81AsnAACGCGGAGGATGGGTTGTTGGACCACTTAGCCGCCACGATCTG1294
AGC-AACTGCAACACCGATGTTGTTACAGTTTCTACGGGCTTTAATGCTCAGC
TGACGGACGAAATTAGGAGGAAATCTTAAGA
AAACTGTAACAACATCG1295
CGATGTTGTTACAGTTT1296
Met OverproductionTTTCCTCCTAATTTCGTCCGTCAGCTGAGCATTAAAGCCCGTAGAA1297
CGSACTGTAGCAACATCAGTGTTGCACAGATCGTGGCGGCTAAGTGGT
Arabidopsis thalianaCCAACAACCCATCCTCCGCGTTACCTTCGG
Gly84SerCCGAAGGTAACGCGGAGGATGGGTTGTTGGACCACTTAGCCGCC1298
GGT-AGTACGATCTGTGCAACACTGATGTTGCTACAGTTTCTACGGGCTTTAA
TGCTCAGCTGACGGACGAAATTAGGAGGAAA
GCAACATCAGTGTTGCA1299
TGCAACACTGATGTTGC1300
Met OverproductionTTCCTCCTAATTTCGTCCGTCAGCTGAGCATTAAAGCCCGTAGAAA1301
CGSCTGTAGCAACATCGATGTTGCACAGATCGTGGCGGCTAAGTGGTC
Arabidopsis thalianaCAACAACCCATCCTCCGCGTTACCTTCGGC
Gly84AspGCCGAAGGTAACGCGGAGGATGGGTTGTTGGACCACTTAGCCGC1302
GGT-GATCACGATCTGTGCAACATCGATGTTGCTACAGTTTCTACGGGCTTTA
ATGCTCAGCTGACGGACGAAATTAGGAGGAA
CAACATCGATGTTGCAC1303
GTGCAACATCGATGTTG1304
Met OverproductionTATCGTCACTCATCCTCCGCTTCCCTCCCAACTTCGTCCGCCAGC1305
CGSTCAGCACCAAGGCCCACCGCAACTGCAGCAACATCGGCGTCGCG
Fragraria vescaCAGATCGTCGCGGCTTCGTGGTCCAACAAAGA
Arg73HisTCTTTGTTGGACCACGAAGCCGCGACGATCTGCGCGACGCCGAT1306
CGC-CACGTTGCTGCAGTTGCGGTGGGCCTTGGTGCTGAGCTGGCGGACGA
AGTTGGGAGGGAAGCGGAGGATGAGTGACGATA
CAAGGCCCACCGCAACT1307
AGTTGCGGTGGGCCTTG1308
Met OverproductionTCCTCCGCTTCCCTCCCAACTTCGTCCGCCAGCTCAGCACCAAGG1309
CGSCCCGCCGCAACTGCAACAACATCGGCGTCGCGCAGATCGTCGCG
Fragraria vescaGCTTCGTGGTCCAACAAAGACTCCGACCTTTC
Ser77AsnGAAAGGTCGGAGTCTTTGTTGGACCACGAAGCCGCGACGATCTG1310
AGC-AACCGCGACGCCGATGTTGTTGCAGTTGCGGCGGGCCTTGGTGCTGA
GCTGGCGGACGAAGTTGGGAGGGAAGCGGAGGA
CAACTGCAACAACATCG1311
CGATGTTGTTGCAGTTG1312
Met OverproductionTTCCCTCCCAACTTCGTCCGCCAGCTCAGCACCAAGGCCCGCCG1313
CGSCAACTGCAGCAACATCAGCGTCGCGCAGATCGTCGCGGCTTCGT
Fragraria vescaGGTCCAACAAAGACTCCGACCTTTCGGCGGTGC
Gly80SerGCACCGCCGAAAGGTCGGAGTCTTTGTTGGACCACGAAGCCGCG1314
GGC-AGCACGATCTGCGCGACGCTGATGTTGGTGCAGTTGCGGCGGGCCTT
GGTGCTGAGCTGGCGGACGAAGTTGGGAGGGAA
GCAACATCAGCGTCGCG1315
CGCGACGCTGATGTTGC1316
Met OverproductionTCCCTCCCAACTTCGTCCGCCAGCTCAGCACCAAGGCCCGCCGC1317
CGSAACTGCAGCAACATCGACGTCGCGCAGATCGTCGCGGCTTCGTG
Fragraria vescaGTCCAACAAAGACTCCGACCTTTCGGCGGTGCC
Gly80AspGGCACCGCCGAAAGGTCGGAGTCTTTGTTGGACCACGAAGCCGC1318
GGC-GACGACGATCTGCGCGACGTCGATGTTGCTGCAGTTGCGGCGGGCCT
TGGTGCTGAGCTGGCGGACGAAGTTGGGAGGGA
CAACATCGACGTCGCGC1319
GCGCGACGTCGATGTTG1320
Met OverproductionTCTCCTCCCTCATCCTCCGCTTCCCTCCCAACTTCCAGCGCCAGC1321
CGSTAAGCACCAAGGCGAGCCGCAACTGCAGCAACATCGGCGTCGCG
Glycine maxCAAATCGTCGCCGCTTCGTGGTCGAACAACAG
Arg68HisCTGTTGTTCGACCACGAAGCGGCGACGATTTGCGCGACGCCGAT1322
CGC-CACGTTGCTGCAGTTGCGGCTCGCCTTGGTGCTTAGCTGGCGCTGGA
AGTTGGGAGGGAAGCGGAGGATGAGGGAGGAGA
CCAAGGCGAGCCGCAAC1323
GTTGCGGCTCGCCTTGG1324
Met OverproductionTCCTCCGCTTCCCTCCCAACTTCCAGCGCCAGCTAAGCACCAAGG1325
CGSCGCGCCGCAACTGCAACAACATCGGCGTCGCGCAAATCGTCGCC
Glycine maxGCTTCGTGGTCGAACAACAGCGACAACTCTCC
Ser72AsnGGAGAGTTGTCGCTGTTGTTCGACCACGAAGCGGCGACGATTTG1326
AGC-AACCGCGACGCCGATGTTGTTGCAGTTGCGGCGCGCCTTGGTGCTTA
GCTGGCGCTGGAAGTTGGGAGGGAAGCGGAGGA
CAACTGCAACAACATCG1327
CGATGTTGTTGCAGTTG1328
Met OverproductionTTCCCTCCCAACTTCCAGCGCCAGCTAAGCACCAAGGCGCGCCG1329
CGSCAACTGCAGCAACATCAGCGTCGCGCAAATCGTCGCCGCTTCGT
Glycine maxGGTCGAACAACAGCGACAACTCTCCGGCCGCCG
Gly75SerCGGCGGCCGGAGAGTTGTCGCTGTTGTTCGACCACGAAGCGGCG1330
GGC-AGCACGATTTGCGCGACGCTGATGTTGCTGCAGTTGCGGCGCGCCTT
GGTGCTTAGCTGGCGCTGGAAGTTGGGAGGGAA
GCAACATCAGCGTCGCG1331
CGCGACGCTGATGTTGC1332
Met OverproductionTCCCTCCCAACTTCCAGCGCCAGCTAAGCACCAAGGCGCGCCGC1333
CGSAACTGCAGCAACATCGACGTCGCGCAAATCGTCGCCGCTTCGTG
Glycine maxGTCGAACAACAGCGACAACTCTCCGGCCGCCGG
Gly75AspCCGGCGGCGGGAGAGTTGTCGCTGTTGTTCGACCACGAAGCGGC1334
GGC-GACGACGATTTGCGCGACGTCGATGTTGCTGCAGTTGCGGCGCGCCT
TGGTGCTTAGCTGGCGCTGGAAGTTGGGAGGGA
CAACATCGACGTCGCGC1335
GCGCGACGTCGATGTTG1336
Met OverproductionTGTCTTCTCTGATTTTCAGGTTTCCTCCTAATTTCGTGAGGCAGCT1337
CGSAAGCATTAAGGCTCACAGGAATTGCAGCAATATTGGCGTGGCTCA
Solanum tuberosumAGTTGTGGCGGCTTCCTGGTCTAACAACCA
Arg70HisTGGTTGTTAGACCAGGAAGCCGCCACAACTTGAGCCACGCCAATA1338
AGG-CACTTGCTGCAATTCCTGTGAGCCTTAATGCTTAGCTGCCTCACGAAAT
TAGGAGGAAACCTGAAAATCAGAGAAGACA
TAAGGCTCACAGGAATT1339
AATTCCTGTGAGCCTTA1340
Met OverproductionTTTTCAGGTTTCCTCCTAATTTCGTGAGGCAGCTAAGCATTAAGGC1341
CGSTAGGAGGAATTGCAACAATATTGGCGTGGCTCAAGTTGTGGCGG
Solanum tuberosumCTTCCTGGTCTAACAACCAAGCCGGTCCTGA
Ser74AsnTCAGGACCGGCTTGGTTGTTAGACCAGGAAGCCGCCACAACTTG1342
AGC-AACAGCCACGCCAATATTGTTGCAATTCCTCCTAGCCTTAATGCTTAGC
TGCCTCACGAAATTAGGAGGAAACCTGAAAA
GAATTGCAACAATATTG1343
CAATATTGTTGCAATTC1344
Met OverproductionTTTCCTCCTAATTTCGTGAGGCAGCTAAGCATTAAGGCTAGGAGG1345
CGSAATTGCAGCAATATTAGCGTGGCTCAAGTTGTGGCGGCTTCCTGG
Solanum tuberosumTCTAACAACCAAGCCGGTCCTGAATTCACTC
Gly77SerGAGTGAATTCAGGACCGGCTTGGTTGTTAGACCAGGAAGCCGCC1346
GGC-AGCACAACTTGAGCCACGCTAATATTGCTGCAATTCCTCCTAGCCTTAA
TGCTTAGCTGCCTCACGAAATTAGGAGGAAA
GCAATATTAGCGTGGGT1347
AGCCACGCTAATATTGC1348
Met OverproductionTTCCTCCTAATTTCGTGAGGCAGCTAAGCATTAAGGCTAGGAGGA1349
CGSATTGCAGCAATATTGACGTGGCTCAAGTTGTGGCGGCTTCCTGGT
Solanum tuberosumCTAACAACCAAGCCGGTCCTGAATTCACTCC
Gly77AspGGAGTGAATTCAGGACCGGCTTGGTTGTTAGACCAGGAAGCCGC1350
GGC-GACCACAACTTGAGCCACGTCAATATTGCTGCAATTCCTCCTAGCCTTA
ATGCTTAGCTGCCTCACGAAATTAGGAGGAA
CAATATTGACGTGGCTC1351
GAGCCACGTCAATATTG1352
Met OverproductionCTTCCTCTCTTATCCTTCGCTTTCCTCCCAACTTTGTCCGTCAGCT1353
CGSCAGCACCAAGGCTCGCCACAACTGCAGCAACATTGGTGTCGCAC
MesembryanthemumAGGTCGTCGCTGCCTCCTGGTCCAACAACTC
crystallinumGAGTTGTTGGACCAGGAGGCAGCGACGACCTGTGCGACACCAAT1354
Arg73HisGTTGCTGCAGTTGTGGCGAGCCTTGGTGCTGAGCTGACGGACAA
CGC-CACAGTTGGGAGGAAAGCGAAGGATAAGAGAGGAAG
GGCTCGCCACAACTGCA1355
TGCAGTTGTGGCGAGCC1356
Met OverproductionTCCTTCGCTTTCCTCCCAACTTTGTCCGTCAGCTCAGCACCAAGG1357
CGSCTCGCCGCAACTGCAACAACATTGGTGTCGCACAGGTCGTCGCT
MesembryanthemumGCCTCCTGGTCCAACAACTCCGATGCCGGCGC
crystallinumGCGCCGGCATCGGAGTTGTTGGACCAGGAGGCAGCGACGACCT1358
Ser77AsnGTGCGACACCAATGTTGTTGCAGTTGCGGCGAGCCTTGGTGCTG
AGC-AACAGCTGACGGACAAAGTTGGGAGGAAAGCGAAGGA
CAACTGCAACAACATTG1359
CAATGTTGTTGCAGTTG1360
Met OverproductionTTTCCTCCCAACTTTGTCCGTCAGCTCAGCACCAAGGCTCGCCGC1361
CGSAACTGCAGCAACATTAGTGTCGCACAGGTCGTCGCTGCCTCCTG
MesembryanthemumGTCCAACAACTCCGATGCCGGCGCCACCTCTT
crystallinumAAGAGGTGGCGCCGGCATCGGAGTTGTTGGACCAGGAGGCAGC1362
Gly80SerGACGACCTGTGCGACACTAATGTTGCTGCAGTTGCGGCGAGCCT
GGT-AGTTGGTGCTGAGCTGACGGACAAAGTTGGGAGGAAA
GCAACATTAGTGTCGCA1363
TGCGACACTAATGTTGC1364
Met OverproductionTTCCTCCCAACTTTGTCCGTCAGCTCAGCACCAAGGCTCGCCGCA1365
CGSACTGCAGCAACATTGATGTCGCACAGGTCGTCGCTGCCTCCTGGT
MesembryanthemumCCAACAACTCCGATGCCGGCGCCACCTCTTG
crystallinumCAAGAGGTGGCGCCGGCATCGGAGTTGTTGGACCAGGAGGCAG1366
Gly80AspCGACGACCTGTGCGACATCAATGTTGCTGCAGTTGCGGCGAGCC
GGT-GATTTGGTGCTGAGCTGACGGACAAAGTTGGGAGGAA
CAACATTGATGTCGCAC1367
GTGCGACATCAATGTTG1368
Met OverproductionCCTCTGCTACCATCCTCCGCTTTCCGCCAAACTTTGTCCGCCAGC1369
CGSTTAGCACCAAGGCACACGGCAACTGCAGCAACATCGGCGTCGCG
Zea maysCAGATCGTCGCCGCCGCGTGGTCCGACTGCCC
Arg41HisGGGCAGTCGGACCACGCGGCGGCGACGATCTGCGCGACGCCGA1370
CGC-CACTGTTGCTGCAGTTGCGGTGTGCCTTGGTGCTAAGCTGGCGGACA
AAGTTTGGCGGAAAGCGGAGGATGGTAGCAGAGG
CAAGGCACACCGCAACT1371
AGTTGCGGTGTGCCTTG1372
Met OverproductionTCCTCCGCTTTCCGCCAAACTTTGTCCGCCAGCTTAGCACCAAGG1373
CGSCACGCCGCAACTGCAACAACATCGGCGTCGCGCAGATCGTCGCC
Zea maysGCCGCGTGGTCCGACTGCCCCGCCGCTCGCCC
Ser45AsnGGGCGAGCGGCGGGGCAGTCGGACCACGCGGCGGCGACGATCT1374
AGC-AACGCGCGACGCCGATGTTGTTGCAGTTGCGGCGTGCCTTGGTGCTA
AGCTGGCGGACAAAGTTTGGCGGAAAGCGGAGGA
CAACTGCAACAACATCG1375
CGATGTTGTTGCAGTTG1376
Met OverproductionTTTCCGCCAAACTTTGTCCGCCAGCTTAGCACCAAGGCACGCCGC1377
CGSAACTGCAGCAACATCAGCGTCGCGCAGATCGTCGCCGCCGCGTG
Zea maysGTCCGACTGCCCCGCCGCTCGCCCCCACTTAG
Gly48SerCTAAGTGGGGGCGAGCGGCGGGGCAGTCGGACCACGCGGCGG1378
GGC-AGCCGACGATCTGCGCGACGCTGATGTTGCTGCAGTTGCGGCGTGCC
TTGGTGCTAAGCTGGCGGACAAAGTTTGGCGGAAA
GCAACATCAGCGTCGCG1379
CGCGACGCTGATGTTGC1380
Met OverproductionTTCCGCCAAACTTTGTCCGCCAGCTTAGCACCAAGGCACGCCGCA1381
CGSACTGCAGCAACATCGACGTCGCGCAGATCGTCGCCGCCGCGTGG
Zea maysTCCGACTGCCCCGCCGCTCGCCCCCACTTAGG
Gly48AspCCTAAGTGGGGGCGAGCGGCGGGGCAGTCGGACCACGCGGCG1382
GGC-GACGCGACGATCTGCGCGACGTCGATGTTGCTGCAGTTGCGGCGTGC
CTTGGTGCTAAGCTGGCGGACAAAGTTTGGCGGAA
CAACATCGACGTCGCGG1383
GCGCGACGTCGATGTTG1384
Met OverproductionGTATGAATGATCTGTGGGTGAAACACTGTGGGATTAGTCATACAG1385
TSGAAGTTTCAAGGATCGTGGAATGACTGTTTTGGTTAGTCAAGTTAA
Arabidopsis thalianaTCGTCTGAGAAAGATGAAACGACCTGTGGT
Leu205ArgACCACAGGTCGTTTCATCTTTCTCAGACGATTAACTTGACTAACCA1386
CTT-CGTAAACAGTCATTCCACGATCCTTGAAACTTCCTGTATGACTAATCCC
ACAGTGTTTCACCCACAGATCATTCATAC
CAAGGATCGTGGAATGA1387
TCATTCCACGATCCTTG1388
Met OverproductionGCATGACTGATTTGTGGGTCAAACACTGTGGGATTAGCCATACTG1389
TSGTAGTTTTAAGGATCGTGGGATGACTGTTTTGGTGAGTCAAGTTAA
Solanum tuberosumTCGCTTGCGGAAAATGCATAAACCGGTTGT
Leu198ArgACAACCGGTTTATGCATTTTCCGCAAGCGATTAACTTGACTCACCA1390
CTT-CGTAAACAGTCATCCCACGATCCTTAAAACTACCAGTATGGCTAATCCC
ACAGTGTTTGACCCACAAATCAGTCATGC
TAAGGATCGTGGGATGA1391
TCATCCCACGATCCTTA1392
Lys OverproductionTCATTGGGCACACAGTGAACTGCTTTGGCTCTAGAATCAAAGTGA1393
DHPSTAGGCAACACAGGAAACAACTCAACCAGAGAAGCCGTCCACGCA
Zea maysACAGAACAGGGATTTGCTGTTGGCATGCATGC
Ser157AsnGCATGCATGCCAACAGCAAATCCCTGTTCTGTTGCGTGGACGGCT1394
AGC-AACTCTCTGGTTGAGTTGTTTCCTGTGTTGCCTATCACTTTGATTCTAG
AGCCAAAGCAGTTCACTGTGTGCCCAATGA
CACAGGAAACAACTCAA1395
TTGAGTTGTTTCCTGTG1396
Lys OverproductionGCTCTAGAATCAAAGTGATAGGCAACACAGGAAGCAACTCAACCA1397
DHPSGAGAAGCCGTCCACGAAACAGAACAGGGATTTGCTGTTGGCATG
Zea maysCATGCGGCTCTCCACATCAATCCTTACTACGG
Ala166ValCCGTAGTAAGGATTGATGTGGAGAGCCGCATGCATGCCAACAGC1398
GCA-GAAAAATCCCTGTTCTGTTTCGTGGACGGCTTCTCTGGTTGAGTTGCTT
CCTGTGTTGCCTATCACTTTGATTCTAGAGC
CGTCCACGAAACAGAAC1399
GTTCTGTTTCGTGGACG1400
Lys OverproductionGGCTCTAGAATCAAAGTGATAGGCAACACAGGAAGCAACTCAACC1401
DHPSAGAGAAGCCGTCCACACAACAGAACAGGGATTTGCTGTTGGCAT
Zea maysGCATGCGGCTCTCCACATCAATCCTTACTACG
Ala166ThrCGTAGTAAGGATTGATGTGGAGAGCCGCATGCATGCCAACAGCA1402
GCA-ACAAATCCCTGTTCTGTTGTGTGGACGGCTTCTCTGGTTGAGTTGCTTC
CTGTGTTGCCTATCACTTTGATTCTAGAGCC
CCGTCCACACAACAGAA1403
TTCTGTTGTGTGGACGG1404
Lys OverproductionTTATTGGGCATACAGTTAACTGCTTTGGCACTAAAATTAAAGTGGT1405
DHPSCGGCAACACAGGAAATAACTCAACAAGGGAGGCTATTCACGCAAC
Oryza sativaTGAGCAGGGATTCGCTGTAGGTATGCACGC
Ser24AsnGCGTGCATACCTACAGCGAATCCCTGCTCAGTTGCGTGAATAGCC1406
AGT-AATTCCCTTGTTGAGTTATTTCCTGTGTTGCCGACCACTTTAATTTTAGT
GCCAAAGCAGTTAACTGTATGCCCAATAA
CACAGGAAATAACTCAA1407
TTGAGTTATTTCCTGTG1408
Lys OverproductionGCACTAAAATTAAAGTGGTCGGCAACACAGGAAGTAACTCAACAA1409
DHPSGGGAGGCTATTCACGTAACTGAGCAGGGATTCGCTGTAGGTATG
Oryza sativaCACGCGGCTCTCCACATCAATCCTTACTACGG
Ala133ValCCGTAGTAAGGATTGATGTGGAGAGCCGCGTGCATACCTACAGC1410
GCA-GTAGAATCCCTGCTCAGTTACGTGAATAGCCTCCCTTGTTGAGTTACTT
CCTGTGTTGCCGACCACTTTAATTTTAGTGC
TATTCACGTAACTGAGC1411
GCTCAGTTACGTGAATA1412
Lys OverproductionGGCACTAAAATTAAAGTGGTCGGCAACACAGGAAGTAACTCAACA1413
DHPSAGGGAGGCTATTCACACAACTGAGCAGGGATTCGCTGTAGGTAT
Oryza sativaGCACGCGGCTCTCCACATCAATCCTTACTACG
Ala133ThrCGTAGTAAGGATTGATGTGGAGAGCCGCGTGCATACCTACAGCG1414
GCA-ACAAATCCCTGCTCAGTTGTGTGAATAGCCTCCCTTGTTGAGTTACTTC
CTGTGTTGCCGACCACTTTAATTTTAGTGCC
CTATTCACACAACTGAG1415
CTCAGTTGTGTGAATAG1416
Lys OverproductionTCATCGGGCATACTGTTAACTGCTTTGGAGCCAACATTAAAGTGAT1417
DHPS 1AGGCAACACGGGAAATAACTCAACCAGAGAAGCTGTTCACGCGA
Triticum aestivumCAGAGCAGGGATTTGCTGTTGGCATGCATGC
Ser65AsnGCATGCATGCCAACAGCAAATCCCTGCTCTGTCGCGTGAACAGCT1418
AGT-AATTCTCTGGTTGAGTTATTTCCCGTGTTGCCTATCACTTTAATGTTGG
CTCCAAAGCAGTTAACAGTATGCCCGATGA
CACGGGAAATAACTCAA1419
TTGAGTTATTTCCCGTG1420
Lys OverproductionGAGCCAACATTAAAGTGATAGGCAACACGGGAAGTAACTCAACCA1421
DHPS 1GAGAAGCTGTTCACGTGACAGAGCAGGGATTTGCTGTTGGCATG
Triticum aestivumCATGCAGCTCTTCATGTCAATCCTTACTACGG
Ala174ValCCGTAGTAAGGATTGACATGAAGAGCTGCATGCATGCCAACAGCA1422
GCG-GTGAATCCCTGCTCTGTCACGTGAACAGCTTCTCTGGTTGAGTTACTTC
CCGTGTTGCCTATCACTTTAATGTTGGCTC
TGTTCACGTGACAGAGC1423
GCTCTGTCACGTGAACA1424
Lys OverproductionGGAGCCAACATTAAAGTGATAGGCAACACGGGAAGTAACTCAACC1425
DHPS 1AGAGAAGCTGTTCACACGACAGAGCAGGGATTTGCTGTTGGCAT
Triticum aestivumGCATGCAGCTCTTCATGTCAATCCTTACTACG
Ala174ThrCGTAGTAAGGATTGACATGAAGAGCTGCATGCATGCCAACAGCAA1426
GCG-ACGATCCCTGCTCTGTCGTGTGAACAGCTTCTCTGGTTGAGTTACTTCC
CGTGTTGCCTATCACTTTAATGTTGGCTCC
CTGTTCACAGGACAGAG1427
CTCTGTCGTGTGAACAG1428
Lys OverproductionTCATCGGGCACACTGTTAACTGCTTTGGAACTAACATTAAAGTGAT1429
DHPS 2AGGCAACACGGGAAATAACTCAACTAGAGAAGCGATTCACGCTTC
Triticum aestivumAGAGCAGGGATTTGCTGTTGGCATGCATGC
Ser154AsnGCATGCATGCCAACAGCAAATCCCTGCTCTGAAGCGTGAATCGCT1430
AGT-AATTCTCTAGTTGAGTTATTTCCCGTGTTGCCTATCACTTTAATGTTAGT
TCCAAAGCAGTTAACAGTGTGCCCGATGA
CACGGGAAATAACTCAA1431
TTGAGTTATTTCCCGTG1432
Lys OverproductionGAACTAACATTAAAGTGATAGGCAACACGGGAAGTAACTCAACTA1433
DHPS 2GAGAAGCGATTCACGTTTCAGAGCAGGGATTTGCTGTTGGCATGC
Triticum aestivumATGCAGCTCTCCATGTCAATCCTTACTATGG
Ala163ValCCATAGTAAGGATTGACATGGAGAGCTGCATGCATGCCAACAGCA1434
GCT-GTTAATCCCTGCTCTGAAACGTGAATCGCTTCTCTAGTTGAGTTACTTC
CCGTGTTGCCTATCACTTTAATGTTAGTTC
GATTCACGTTTCAGAGC1435
GCTCTGAAACGTGAATC1436
Lys OverproductionGGAACTAACATTAAAGTGATAGGCAACACGGGAAGTAACTCAACT1437
DHPS 2AGAGAAGCGATTCACACTTCAGAGCAGGGATTTGCTGTTGGCATG
Triticum aestivumCATGCAGCTCTCCATGTCAATCCTTACTATG
Ala163ThrCATAGTAAGGATTGACATGGAGAGCTGCATGCATGCCAACAGCAA1438
GCT-ACTATCCCTGCTCTGAAGTGTGAATCGCTTCTCTAGTTGAGTTACTTCC
CGTGTTGCCTATCACTTTAATGTTAGTTCC
CGATTCACACTTCAGAG1439
CTCTGAAGTGTGAATCG1440
Lys OverproductionCTCATTGGGCATACTGTGAACTGCTTTGGCTCTAGAATTAAAGTGA1441
DHPSTAGGCAACACAGGAAATAACTCAACCAGAGAAGCTGTTCACGCAA
Coix lacryma-jobiCAGAGCAGGGATTTGCTGTTGGCATGCATG
Ser154AsnCATGCATGCCAACAGCAAATCCCTGCTCTGTTGCGTGAACAGCTT1442
AGT-AATCTCTGGTTGAGTTATTTCCTGTGTTGCCTATCACTTTAATTCTAGA
GCCAAAGCAGTTCACAGTATGCCCAATGAG
CACAGGAAATAACTCAA1443
TTGAGTTATTTCCTGTG1444
Lys OverproductionGCTCTAGAATTAAAGTGATAGGCAACACAGGAAGTAACTCAACCA1445
DHPSGAGAAGCTGTTCACGTAACAGAGCAGGGATTTGCTGTTGGCATGC
Coix lacryma-jobiATGCAGCTCTCCACATCAATCCTTACTATGG
Ala163ValCCATAGTAAGGATTGATGTGGAGAGCTGCATGCATGCCAACAGCA1446
GCA-GTAAATCCCTGCTCTGTTACGTGAACAGCTTCTCTGGTTGAGTTACTTC
CTGTGTTGCCTATCACTTTAATTCTAGAGC
TGTTCACGTAACAGAGC1447
GCTCTGTTACGTGAACA1448
Lys OverproductionGGCTCTAGAATTAAAGTGATAGGCAACACAGGAAGTAACTCAACC1449
DHPSAGAGAAGCTGTTCACACAACAGAGCAGGGATTTGCTGTTGGCATG
Coix lacryma-jobiCATGCAGCTCTCCACATCAATCCTTACTATG
Ala163ThrCATAGTAAGGATTGATGTGGAGAGCTGCATGCATGCCAACAGCAA1450
GCA-ACAATCCCTGCTCTGTTGTGTGAACAGCTTCTCTGGTTGAGTTACTTCC
TGTGTTGCCTATCACTTTAATTCTAGAGCC
CTGTTCACACAACAGAG1451
CTCTGTTGTGTGAACAG1452
Lys OverproductionTCATTGGTCACACAGTCAATTGTTTTGGAGGGTCCATCAAAGTCAT1453
DHPSCGGGAACACTGGAAACAACTCCACAAGGGAAGCAATCCATGCAA
Nicotiana tabacumCTGAACAGGGATTTGCTGTAGGTATGCATGC
Ser136AsnGCATGCATACCTACAGCAAATCCCTGTTCAGTTGCATGGATTGCTT1454
AGC-AACCCCTTGTGGAGTTGTTTCCAGTGTTCCCGATGACTTTGATGGACC
CTCCAAAACAATTGACTGTGTGACCAATGA
CACTGGAAACAACTCCA1455
TGGAGTTGTTTCCAGTG1456
Lys OverproductionGAGGGTCCATCAAAGTCATCGGGAACACTGGAAGCAACTCCACAA1457
DHPSGGGAAGCAATCCATGTAACTGAACAGGGATTTGCTGTAGGTATGC
Nicotiana tabacumATGCAGCTCTTCACATTAATCCCTACTATGG
Ala145ValCCATAGTAGGGATTAATGTGAAGAGCTGCATGCATACCTACAGCA1458
GCA-GTAAATCCCTGTTCAGTTACATGGATTGCTTCCCTTGTGGAGTTGCTTC
CAGTGTTCCCGATGACTTTGATGGACCCTC
AATCCATGTAACTGAAC1459
GTTCAGTTACATGGATT1460
Lys OverproductionGGAGGGTCCATCAAAGTCATCGGGAACACTGGAAGCAACTCCAC1461
DHPSAAGGGAAGCAATCCATACAACTGAACAGGGATTTGCTGTAGGTAT
Nicotiana tabacumGCATGCAGCTCTTCACATTAATCCCTACTATG
Ala145ThrCATAGTAGGGATTAATGTGAAGAGCTGCATGCATACCTACAGCAA1462
GCA-ACAATCCCTGTTCAGTTGTATGGATTGCTTCCCTTGTGGAGTTGCTTCC
AGTGTTCCCGATGACTTTGATGGACCCTCC
CAATCCATACAACTGAA1463
TTCAGTTGTATGGATTG1464
Lys OverproductionTTATAGGCCATACCGTTAACTGTTTTGGCGGAAGCATCAAAGTCAT1465
DHPSTGGAAACACTGGAAACAATTCGACTAGAGAAGCAATCCACGCGAC
Arabidopsis thalianaTGAACAAGGATTCGCGGTTGGAATGCATGC
Ser142AsnGCATGCATTCCAACCGCGAATCCTTGTTCAGTCGCGTGGATTGCT1466
AGC-AACTCTCTAGTCGAATTGTTTCCAGTGTTTCCAATGACTTTGATGCTTC
CGCCAAAACAGTTAACGGTATGGCCTATAA
CACTGGAAACAATTCGA1467
TCGAATTGTTTCCAGTG1468
Lys OverproductionGCGGAAGCATCAAAGTCATTGGAAACACTGGAAGCAATTCGACTA1469
DHPSGAGAAGCAATCCACGTGACTGAACAAGGATTCGCGGTTGGAATG
Arabidopsis thalianaCATGCTGCTCTTCATATAAACCCTTACTATGG
Ala151ValCCATAGTAAGGGTTTATATGAAGAGCAGCATGCATTCCAACCGCG1470
GCG-GTGAATCCTTGTTCAGTCACGTGGATTGCTTCTCTAGTCGAATTGCTTC
CAGTGTTTCCAATGACTTTGATGCTTCCGC
AATCCACGTGACTGAAC1471
GTTCAGTCACGTGGATT1472
Lys OverproductionGGCGGAAGCATCAAAGTCATTGGAAACACTGGAAGCAATTCGACT1473
DHPSAGAGAAGCAATCCACACGACTGAACAAGGATTCGCGGTTGGAAT
Arabidopsis thalianaGCATGCTGCTCTTCATATAAACCCTTACTATG
Ala151ThrCATAGTAAGGGTTTATATGAAGAGCAGCATGCATTCCAACCGCGA1474
GCG-ACGATCCTTGTTCAGTCGTGTGGATTGCTTCTCTAGTCGAATTGCTTCC
AGTGTTTCCAATGACTTTGATGCTTCCGCC
CAATCCACACGACTGAA1475
TTCAGTCGTGTGGATTG1476
Lys OverproductionTTATTGCTCATACAGTCAACTGTTTTGGTGGGAAAATTAAGGTTAT1477
DHPSTGGAAATACTGGAAACAACTCCACCAGGGAAGCAATTCATGCCAC
Glycine maxTGAGCAGGGTTTTGCTGTTGGAATGCATGC
Ser103AsnGCATGCATTCCAACAGCAAAACCCTGCTCAGTGGCATGAATTGCT1478
AGC-AACTCCCTGGTGGAGTTGTTTCCAGTATTTCCAATAACCTTAATTTTCC
CACCAAAACAGTTGACTGTATGAGCAATAA
TACTGGAAACAACTCCA1479
TGGAGTTGTTTCCAGTA1480
Lys OverproductionGTGGGAAAATTAAGGTTATTGGAAATACTGGAAGCAACTCCACCA1481
DHPSGGGAAGCAATTCATGTCACTGAGCAGGGTTTTGCTGTTGGAATGC
Glycine maxATGCTGCCCTTCACATAAACCCTTACTATGG
Ala112ValCCATAGTAAGGGTTTATGTGAAGGGCAGCATGCATTCCAACAGCA1482
GCC-GTCAAACCCTGCTCAGTGACATGAATTGCTTCCCTGGTGGAGTTGCTT
CCAGTATTTCCAATAACCTTAATTTTCCCAC
AATTCATGTCACTGAGC1483
GCTCAGTGACATGAATT1484
Lys OverproductionGGTGGGAAAATTAAGGTTATTGGAAATACTGGAAGCAACTCCACC1485
DHPSAGGGAAGCAATTCATACCACTGAGCAGGGTTTTGCTGTTGGAATG
Glycine maxCATGCTGCCCTTCACATAAACCCTTACTATG
Ala112ThrCATAGTAAGGGTTTATGTGAAGGGCAGCATGGATTCCAACAGCAA1486
GCC-ACCAACCCTGCTCAGTGGTATGAATTGCTTCCCTGGTGGAGTTGCTTC
CAGTATTTCCAATAACCTTAATTTTCCCACC
CAATTCATACCACTGAG1487
CTCAGTGGTATGAATTG1488
Trp OverproductionCTTGCAGGAGACATATTTCAGATCGTGCTGAGTCAACGTTTTGAG1489
ASCGGCGAACATTTGCAAACCCCTTTGAAGTTTATAGAGCACTAAGA
Arabidopsis thalianaGTTGTGAATCCAAGTCCGTATATGGGTTATT
Asp341AsnAATAACCCATATACGGACTTGGATTCACAACTCTTAGTGCTCTATA1490
GAG-AACAACTTCAAAGGGGTTTGCAAATGTTCGCCGCTCAAAACGTTGACT
CAGCACGATCTGAAATATGTCTCCTGCAAG
CATTTGCAAACCCCTTT1491
AAAGGGGTTTGCAAATG1492
Trp OverproductionGCTGCAGGAGACATATTTCAAATCGTTTTAAGTCAACGCTTTGAGA1493
ASGAAGAACATTTGCTAACCCATTTGAAGTGTACAGAGCATTAAGAAT
Nicotiana tabacumTGTGAATCCAAGCCCATATATGACTTACA
Asp326AsnTGTAAGTCATATATGGGCTTGGATTCACAATTCTTAATGCTCTGTA1494
GAC-AACCACTTCAAATGGGTTAGCAAATGTTCTTCTCTCAAAGCGTTGACTT
AAAACGATTTGAAATATGTCTCCTGCAGC
CATTTGCTAACCCATTT1495
AAATGGGTTAGCAAATG1496
Trp OverproductionCTAGCTGGTGACATTTTTCAAGTAGTCTTAAGCCAGCGTTTTGAGA1497
ASGGCGTACATTTGCTAACCCCTTTGAGGTGTACCGTGCATTGCGTA
Oryza sativaTTGTCAATCCTAGTCCTTATATGGCCTATC
Asp323AsnGATAGGCCATATAAGGACTAGGATTGACAATACGCAATGCACGGT1498
GAC-AACACACCTCAAAGGGGTTAGCAAATGTACGCCTCTCAAAACGCTGGC
TTAAGACTACTTGAAAAATGTCACCAGCTAG
CATTTGCTAACCCCTTT1499
AAAGGGGTTAGCAAATG1500
Trp OverproductionCTTGCTGGTGACATATTCCAGATCGTACTAAGTCAGCGTTTTGAAA1501
ASGGCGAACGTTCGCAAACCCATTTGAAATCTATAGATCACTGAGGA
Ruta graveolensTTGTTAATCCAAGCCCATATATGACTTATT
Asp354AsnAATAAGTCATATATGGGCTTGGATTAACAATCCTCAGTGATCTATA1502
GAC-AACGATTTCAAATGGGTTTGCGAACGTTCGCCTTTCAAAACGCTGACTT
AGTACGATCTGGAATATGTCACCAGCAAG
CGTTCGCAAACCCATTT1503
AAATGGGTTTGCGAACG1504
Trp OverproductionCTGGCTGGGGACATATTCCAGCTTGTCCTAAGTCAGCGTTTTGAA1505
ASCGGCGAACATTTGCAAATCCATTTGAAGTCTACCGAGCATTGAGA
Catharanthus roseusATTGTCAACCCAAGTCCATATATGACTTATT
Asp354AsnAATAAGTCATATATGGACTTGGGTTGACAATTCTCAATGCTCGGTA1506
GAT-AATGACTTCAAATGGATTTGCAAATGTTCGCCGTTCAAAACGCTGACTT
AGGACAAGCTGGAATATGTCCCCAGCCAG
CATTTGCAAATCCATTT1507
AAATGGATTTGCAAATG1508

EXAMPLE 10

Production of Modified Starch in Plants

[0138] A principal aim of biotechnology is the improvement of crop plants for food value, agriculture, and to produce a range of plant-derived raw materials. Along with oils, fats and proteins, polysaccharides constitute the main raw materials derived from plants, and apart from cellulose, the storage polymer starch is the most important polysaccharide raw material. Starch is derived from a range of plants, but maize is the most important cultivated plant for the production of starch.

[0139] The polysaccharide starch is a polymer made up of glucose molecules. However, starch is not a homogeneous raw material and is, in fact, a highly complex mixture of various types of molecules which differ from each other, for example, in their degree of polymerization and in the degree of branching of the glucose chains. For example, amylose-starch is a basically non-branched polymer made up of α-1,4-glycosidically branched glucose molecules, and amylopectin-starch is a complex mixture of variously branched glucose chains. The branching results from additional α-1,6-glycosidic linkages. In plants from which starch is typically isolated, for example maize or potato, the starch is approximately 25% amylose-starch and 75% amylopectin-starch.

[0140] In maize, various mutants in starch metabolism are known, for example waxy, sugary, shrunken and opaque-2. In addition to producing a modified starch, these mutations greatly improve grain quality in maize, and thus expand the use of maize not only as the food but also for the important industrial materials in food chemistry. It would therefore be advantageous to be able readily to obtain mutants in these genes in particular maize genotypes as well as other plants. Such plants can be obtained, for example, using traditional breeding methods and through specific genetic modification by means of recombinant DNA techniques.

[0141] The attached tables disclose exemplary oligonucleotide base sequences which can be used to generate site-specific mutations in genes involved in starch metabolism. 22

TABLE 20
Genome-Altering Oligos Conferring Increased Starch
Phenotype, Gene,
Plant & TargetedSEQ ID
AlterationAltering OligosNO:
Increased StarchGAACTTGAGACTGAGAAAAGGGATCCAAGGACAGTTGCTTCCATT1509
ADPGPPATTCTTGGAGGTGGAAAAGGAACTCGACTCTTTCCTCTCACAAAA
Arabidopsis thalianaCGCCGCGCCAAGCCTGCCGTTCCTATCGGGG
Ala99LysCCCCGATAGGAACGGCAGGCTTGGCGCGGCGTTTTGTGAGAGGA1510
GCA-AAAAAGAGTCGAGTTCCTTTTCCACCTCCAAGAATAATGGAAGCAACT
GTCCTTGGATCCCTTTTCTCAGTCTCAAGTTC
GAGGTGGAAAAGGAACT1511
AGTTCCTTTTCCACCTC1512
Increased StarchCAAAACGCCGCGCCAAGCCTGCCGTTCCTATCGGGGGAGCCTAT1513
ADPGPPAGGTTGATAGATGTACTAATGAGCAATTGTATTAACAGCGGAATCA
Arabidopsis thalianaACAAAGTCTACATACTCACACAATATAACTC
Pro127LeuGAGTTATATTGTGTGAGTATGTAGACTTTGTTGATTCCGCTGTTAA1514
CCA-CTATACAATTGCTCATTAGTACATCTATCAACCTATAGGCTCCCCCGAT
AGGAACGGCAGGCTTGGCGCGGCGTTTTG
AGATGTACTAATGAGCA1515
TGCTCATTAGTACATCT1516
Increased StarchTCACACAATATAACTCAGCATCATTGAACAGGCATTTAGCCCGTGC1517
ADPGPPTTACAACTCCAATAATCTTGGCTTTGGAGATGGCTATGTTGAGGTT
Arabidopsis thalianaCTTGCGGCCACTCAAACGCCAGGAGAATC
Gly162AsnGATTCTCCTGGCGTTTGAGTGGCCGCAAGAACCTCAACATAGCCA1518
GGA-AATTCTCCAAAGCCAAGATTATTGGAGTTGTAAGCACGGGGTAAATGC
CTGTTCAATGATGCTGAGTTATATTGTGTGA
CTCCAATAATCTTGGCT1519
AGCCAAGATTATTGGAG1520
Increased StarchTCACACAATATAACTCAGCATCATTGAACAGGCATTTAGCCCGTGC1521
ADPGPPTTACAACTCCAATAACCTTGGCTTTGGAGATGGCTATGTTGAGGTT
Arabidopsis thalianaCTTGCGGCCACTCAAACGCCAGGAGAATC
Gly162AsnGATTCTCCTGGCGTTTGAGTGGCCGCAAGAACCTCAACATAGCCA1522
GGA-AACTCTCCAAAGCCAAGGTTATTGGAGTTGTAAGCACGGGCTAAATGC
CTGTTCAATGATGCTGAGTTATATTGTGTGA
CTCCAATAACCTTGGCT1523
AGCCAAGGTTATTGGAG1524
Increased StarchGTTTGAGAGAAGAAAGGTAGACCCGCAAAATGTGGCTGCAATCAT1525
ADPGPPTCTAGGAGGAGGCAAAGGAGCTAAACTCTTCCCTCTTACAATGAG
Arabidopsis thalianaAGCCGCAACACCAGCTGTAAATATTCATCTT
Asn100LysAAGATGAATATTTACAGCTGGTGTTGCGGCTCTCATTGTAAGAGG1526
AAT-AAAGAAGAGTTTAGCTCCTTTGCCTCCTCCTAGAATGATTGCAGCCAC
ATTTTGCGGGTCTACCTTTCTTCTCTCAAAC
GGAGGCAAAGGAGCTAA1527
TTAGCTCCTTTGCCTCC1528
Increased StarchCTTGTGTCTTCAAATTATGTTAGGTTCCTGTTGGTGGATGCTACAG1529
ADPGPPGCTGATCGATATCCTGATGAGTAACTGTATTAACAGCTGCATCAAC
Arabidopsis thalianaAAGATATTTGTGCTGACACAGTTCAACTC
Pro128LeuGAGTTGAACTGTGTCAGCACAAATATCTTGTTGATGCAGCTGTTAA1530
CCG-CTGTACAGTTACTCATCAGGATATCGATCAGCCTGTAGCATCCACCAA
CAGGAACCTAACATAATTTGAAGACACAAG
CGATATCCTGATGAGTA1531
TACTCATCAGGATATCG1532
Increased StarchTGACACAGTTCAACTCAGCTTCCCTTAATCGACATTTAGCACGAAC1533
ADPGPPTTATTTTGGGAATAATATAAACTTTGGAGGTGGTTTCGTAGAGGTA
Arabidopsis thalianaCAAACACTATGACAATAATAACTCTCAGC
Gly163AsnGCTGAGAGTTATTATTGTCATAGTGTTTGTACCTCTACGAAACCAC1534
GGC-AATCTCCAAAGTTTATATTATTCCCAAAATAAGTTCGTGCTAAATGTCG
ATTAAGGGAAGCTGAGTTGAACTGTGTCA
TGGGAATAATATAAACT1535
AGTTTATATTATTCCCA1536
Increased StarchTGACACAGTTCAACTCAGCTTCCCTTAATCGACATTTAGCACGAAC1537
ADPGPPTTATTTTGGGAATAACATAAACTTTGGAGGTGGTTTCGTAGAGGTA
Arabidopsis thalianaCAAACACTATGACAATAATAACTCTCAGC
Gly163AsnGCTGAGAGTTATTATTGTCATAGTGTTTGTACCTCTACGAAACCAC1538
GGC-AACCTCCAAAGTTTATGTTATTCCCAAAATAAGTTCGTGCTAAATGTCG
ATTAAGGGAAGCTGAGTTGAACTGTGTCA
TGGGAATAACATAAACT1539
AGTTTATGTTATTCCCA1540
Increased StarchTTGAGGAACAACCAACGGCAGATCCAAAAGCTGTTGCCTCTGTCA1541
ADPGPPTTCTAGGTGGTGGTAAAGGAACTCGTCTTTTTCCTCTTACAAGCA
LycopersiconGAAGAGCTAAACCAGCTGTTCCTATTGGTGG
esculentumCCACCAATAGGAACAGCTGGTTTAGCTCTTCTGCTTGTAAGAGGA1542
Val94LysAAAAGACGAGTTCCTTTACCACCACCTAGAATGACAGAGGCAACA
GTT-AAAGCTTTTGGATCTGCCGTTGGTTGTTCCTCAA
TGGTGGTAAAGGAACTC1543
GAGTTCCTTTACCACCA1544
Increased StarchCAAGCAGAAGAGCTAAACCAGCTGTTCCTATTGGTGGTTGTTACC1545
ADPGPPGGCTAATTGATGTACAAATGAGTAACTGCATTAACAGTGGCATAC
LycopersiconGGAAAATTTTCATCTTAACACAGTTCAATTC
esculentumGAATTGAACTGTGTTAAGATGAAAATTTTCCGTATGCCACTGTTAA1546
Pro122LeuTGCAGTTACTCATTTGTACATCAATTAGCCGGTAACAACCACCAAT
CCA-CAAAGGAACAGCTGGTTTAGCTCTTCTGGTTG
TGATGTACAAATGAGTA1547
TACTCATTTGTACATCA1548
Increased StarchCACAGTTCAATTCCTTTTCCCTCAATCGTCACCTTGCCCGCACGTA1549
ADPGPPTAATTTTGGAAATAATGTGGGTTTTGGAGATGGATTTGTGGAGGTT
LycopersiconTTAGCTGCAACCCAGACTCCAGGGGATGC
esculentumGCATCCCCTGGAGTCTGGGTTGCAGCTAAAACCTCCACAAATCCA1550
Gly158AsnTCTCCAAAACCCACATTATTTCCAAAATTATACGTGCGGGCAAGGT
GGA-AATGACGATTGAGGGAAAAGGAATTGAACTGTG
TGGAAATAATGTGGGTT1551
AACCCACATTATTTCCA1552
Increased StarchCACAGTTCAATTCCTTTTCCCTCAATCGTCACCTTGCCCGCACGTA1553
ADPGPPTAATTTTGGAAATAACGTGGGTTTTGGAGATGGATTTGTGGAGGT
LycopersiconTTTAGCTGCAACCCAGACTCCAGGGGATGC
esculentumGCATCCCCTGGAGTCTGGGTTGCAGCTAAAACCTCCACAAATCCA1554
Gly158AsnTCTCCAAAACCCACGTTATTTCCAAAATTATACGTGCGGGCAAGGT
GGA-AACGACGATTGAGGGAAAAGGAATTGAACTGTG
TGGAAATAACGTGGGTT1555
AACCCACGTTATTTCCA1556
Increased StarchACGTAGATTTGGAAAAAAGAGACCCAAGTACAGTTGTAGCAATTAT1557
ADPGPPACTAGGTGGAGGTAAAGGAACTCGTCTCTTCCCTCTCACCAAGCG
Cicer arietinumACGAGCCAAGCCTGCTGTTCCAATTGGAGG
Ala101LysCCTCCAATTGGAACAGCAGGCTTGGCTCGTCGCTTGGTGAGAGG1558
GCT-AAAGAAGAGACGAGTTCCTTTACCTCCACCTAGTATAATTGCTACAACT
GTACTTGGGTCTCTTTTTTCCAAATCTACGT
TGGAGGTAAAGGAACTC1559
GAGTTCCTTTACCTCCA1560
Increased StarchCCAAGCGACGAGCCAAGCCTGCTGTTCCAATTGGAGGTGCTTATA1561
ADPGPPGGCTGATAGATGTACTAATGAGTAACTGCATCAATAGTGGGATCA
Cicer arietinumACAAAGTATACATTCTCACTCAATTTAATTC
Pro129LeuGAATTAAATTGAGTGAGAATGTATACTTTGTTGATCCCACTATTGA 1562
CCA-CTATGCAGTTACTCATTAGTACATCTATCAGCCTATAAGCACCTCCAAT
TGGAACAGCAGGCTTGGCTCGTCGCTTGG
AGATGTACTAATGAGTA1563
TACTCATTAGTACATCT1564
Increased StarchCTCAATTTAATTCAGCCTCACTCAACAGGCATATTGCACGTGCTTA1565
ADPGPPTAACTCTGGTACTAATGTCACTTTTGGAGATGGCTATGTTGAGGTT
Cicer arietinumCTTGCAGCAACTCAAACTCCAGGGGAGCA
Gly165AsnTGCTCCCGTGGAGTTTGAGTTGCTGCAAGAACCTCAACATAGCCA1566
GGA-AATTCTCCAAAAGTGACATTAGTACCAGAGTTATAAGCACGTGCAATAT
GCCTGTTGAGTGAGGCTGAATTAAATTGAG
TGGTACTAATGTCACTT1567
AAGTGACATTAGTACCA1568
Increased StarchCTCAATTTAATTCAGCCTCACTCAACAGGCATATTGCACGTGCTTA1569
ADPGPPTAACTCTGGTACTAACGTCACTTTTGGAGATGGCTATGTTGAGGTT
Cicer arietinumCTTGCAGCAACTCAAACTCCAGGGGAGCA
Gly165AsnTGCTCCCCTGGAGTTTGAGTTGCTGCAAGAACCTCAACATAGCCA1570
GGA-AACTCTCCAAAAGTGACGTTAGTACCAGAGTTATAAGCACGTGCAATAT
GCCTGTTGAGTGAGGCTGAATTAAATTGAG
TGGTACTAACGTCACTT1571
AAGTGACGTTAGTACCA1572
Increased StarchATATTGGAGAGGCGTCGGGCAAACCCTAAGAATGTGGCTGCAATC 1573
ADPGPPATACTGCCAGGCGGTAAAGGGACACACCTATTCCCTCTCACCAAT
Ipomoea batatasCGAGCTGCAACCCCTGCTGTTCCACTTGGAG
Ala94LysCTCCAAGTGGAACAGCAGGGGTTGCAGCTCGATTGGTGAGAGGG1574
GCA-AAAAATAGGTGTGTCCCTTTACCGCCTGGCAGTATGATTGCAGCCACA
TTCTTAGGGTTTGCCCGACGCCTCTCCAATAT
CAGGCGGTAAAGGGACA1575
TGTCCCTTTACCGCCTG1576
Increased StarchCCAATCGAGCTGCAACCCCTGCTGTTCCACTTGGAGGATGCTATA1577
ADPGPPGGTTGATCGACATTCTAATGAGCAACTGCATCAACAGCGGGGTTA
Ipomoea batatasACAAGATCTTTGTGCTGACCCAGTTCAATTC
Pro122LeuGAATTGAACTGGGTCAGCACAAAGATCTTGTTAACCCCGCTGTTG1578
CCA-CTAATGCAGTTGCTCATTAGAATGTCGATCAACCTATAGCATCCTCCAA
GTGGAACAGCAGGGGTTGCAGCTCGATTGG
CGACATTCTAATGAGCA1579
TGCTCATTAGAATGTCG1580
Increased StarchTGACCCAGTTCAATTCAGCTTCTCTTAACCGTCACATTTCCCGTAC1581
ADPGPPCGTCTTTGGCAATAATGTGAGCTTCGGAGATGGATTTGTTGAGGT
Ipomoea batatasGCTGGCTGCAACCCAAACACAAGGGGAAAC
Gly157AsnGTTTCCCCTTGTGTTTGGGTTGCAGCCAGCACCTCAACAAATCCA1582
GGT-AATTCTCCGAAGCTCACATTATTGCCAAAGACGGTACGGGAAATGTGA
CGGTTAAGAGAAGCTGAATTGAACTGGGTCA
TGGCAATAATGTGAGCT1583
AGCTCACATTATTGCCA1584
Increased StarchTGACCCAGTTCAATTCAGCTTCTCTTAACCGTCACATTTCCCGTAC1585
ADPGPPCGTCTTTGGCAATAACGTGAGCTTCGGAGATGGATTTGTTGAGGT
Ipomoea batatasGCTGGCTGCAACCCAAACACAAGGGGAAAC
Gly157AsnGTTTCCCCTTGTGTTTGGGTTGCAGCCAGCACCTCAACAAATCCA1586
GGT-AACTCTCCGAAGCTCACGTTATTGCCAAAGACGGTACGGGAAATGTGA
CGGTTAAGAGAAGCTGAATTGAACTGGGTCA
TGGCAATAACGTGAGCT1587
AGCTCACGTTATTGCCA1588
Increased StarchCATTCCGGAGGAACTTTGCGGATCCAAATGAGGTTGCTGCTGTTA1589
ADPGPPTATTGGGTGGTGGCAAAGGGACTCAACTTTTTCCTCTCACAAGCA
Oryza sativaCAAGGGCCACGCCTGCTGTTCCTATTGGAGG
Thr96LysCCTCCAATAGGAACAGCAGGCGTGGCCCTTGTGCTTGTGAGAGG1590
ACC-AAAAAAAAGTTGAGTCCCTTTGCCACCACCCAATATAACAGCAGCAAC
CTCATTTGGATCCGCAAAGTTCCTCCGGAATG
TGGTGGCAAAGGGACTC1591
GAGTCCCTTTGCCACCA1592
Increased StarchCAAGCACAAGGGCCACGCCTGCTGTTCCTATTGGAGGATGCTATA1593
ADPGPPGGCTTATCGATATCCTCATGAGCAACTGTTTCAACAGTGGCATAAA
Oryza sativaCAAGATATTCATAATGACTCAATTCAACTC
Pro124LeuGAGTTGAATTGAGTCATTATGAATATCTTGTTTATGCCACTGTTGA1594
CCC-CTCAACAGTTGCTCATGAGGATATCGATAAGCCTATAGCATCCTCCAAT
AGGAACAGCAGGCGTGGCCCTTGTGCTTG
CGATATCCTCATGAGCA1595
TGCTCATGAGGATATCG1596
Increased StarchTGACTCAATTCAACTCAGCATCTCTTAATCGTCACATTCATCGTAC1597
ADPGPPGTACCTTGGTGGTAATATCAACTTTACTGATGGTTCTGTTGAGGTA
Oryza sativaTTAGCCGCTACACAAATGCCTGGGGAGGC
Gly159AsnGCCTCCCCAGGCATTTGTGTAGCGGCTAATACCTCAACAGAACCA1598
GGA-AATTCAGTAAAGTTGATATTACCACCAAGGTACGTACGATGAATGTGA
CGATTAAGAGATGCTGAGTTGAATTGAGTCA
TGGTGGTAATATCAACT1599
AGTTGATATTACCACCA1600
Increased StarchTGACTCAATTCAACTCAGCATCTCTTAATCGTCACATTCATCGTAC1601
ADPGPPGTACCTTGGTGGTAACATCAACTTTACTGATGGTTCTGTTGAGGTA
Oryza sativaTTAGCCGCTACACAAATGCCTGGGGAGGC
Gly159AsnGCCTCCCCAGGCATTTGTGTAGCGGCTAATACCTCAACAGAACCA1602
GGA-AACTCAGTAAAGTTGATGTTACCACCAAGGTACGTACGATGAATGTGA
CGATTAAGAGATGCTGAGTTGAATTGAGTCA
TGGTGGTAACATCAACT1603
AGTTGATGTTACCACCA1604
Increased StarchGTCCTTCAGGAGGATTAAGCGATCCGAACGAGGTTGCGGCCGTC1605
ADPGPPATACTCGGCGGCGGCAAAGGGACTCAGCTCTTCCCACTCACGAG
Triticum aestivumCACAAGGGCCACACCTGCTGTTCCTATTGGAGG
Thr80LysCCTCCAATAGGAACAGCAGGTGTGGCCCTTGTGCTCGTGAGTGG1606
ACC-AAAGAAGAGCTGAGTCCCTTTGCCGCCGCCGAGTATGACGGCCGCAA
CCTCGTTCGGATCGCTTAATCCTCCTGAAGGAC
CGGCGGCAAAGGGACTC1607
GAGTCCCTTTGCCGCCG1608
Increased StarchCGAGCACAAGGGCCACACCTGCTGTTCCTATTGGAGGATGTTACA1609
ADPGPPGGCTCATCGACATTCTCATGAGCAACTGCTTCAACAGTGGCATCA
Triticum aestivumACAAGATATTCGTCATGACCCAGTTCAACTC
Pro108LeuGAGTTGAACTGGGTCATGACGAATATCTTGTTGATGCCACTGTTG1610
CCC-CTCAAGCAGTTGCTCATGAGAATGTCGATGAGCCTGTAACATCCTCCA
ATAGGAACAGCAGGTGTGGCCCTTGTGCTCG
CGACATTCTCATGAGCA1611
TGCTCATGAGAATGTCG1612
Increased StarchTGACCCAGTTCAACTCGGCCTCCCTTAATCGTCACATTCACCGCA1613
ADPGPPCCTACCTCGGCGGGAATATCAATTTCACTGATGGATCCGTTGAGG
Triticum aestivumTATTGGCCGCGACGCAAATGCCCGGGGAGGC
Gly143AsnGCCTCCCCGGGCATTTGCGTCGCGGCCAATACCTCAACGGATCC1614
GGA-AATATCAGTGAAATTGATATTCCCGCCGAGGTAGGTGCGGTGAATGTG
ACGATTAAGGGAGGCCGAGTTGAACTGGGTCA
CGGCGGGAATATCAATT1615
AATTGATATTCCCGCCG1616
Increased StarchTGACCCAGTTCAACTCGGCCTCCCTTAATCGTCACATTCACCGCA1617
ADPGPPCCTACCTCGGCGGGAACATCAATTTCACTGATGGATCCGTTGAGG
Triticum aestivumTATTGGCCGCGACGCAAATGCCCGGGGAGGC
Gly143AsnGCCTCCCCGGGCATTTGCGTCGCGGCCAATACCTCAACGGATCC1618
GGA-AACATCAGTGAAATTGATGTTCCCGCCGAGGTAGGTGCGGTGAATGTG
ACGATTAAGGGAGGCCGAGTTGAACTGGGTCA
CGGCGGGAACATCAATT1619
AATTGATGTTCCCGCCG1620
Increased StarchCCTCCCGAAAGAATTATGCTGATGCAAGCCACGTTTCTGCTGTCA1621
ADPGPPTTTTGGGTGGAGGCAAAGGAGTTCAACTCTTTCCTCTGACAAGCA
Oryza sativaCAAGGGCTACCCCCGCTGTTCCTGTTGGAGG
Thr95LysCCTCCAACAGGAACAGCGGGGGTAGCCCTTGTGCTTGTCAGAGG1622
ACT-AAAAAAGAGTTGAACTCCTTTGCCTCCACCCAAAATGACAGCAGAAAC
GTGGCTTGCATCAGCATAATTCTTTCGGGAGG
TGGAGGCAAAGGAGTTC1623
GAACTCCTTTGCCTCCA1624
Increased StarchCAAGCACAAGGGCTACCCCCGCTGTTCCTGTTGGAGGATGTTACA1625
ADPGPPGGCTTATTGACATCCTTATGAGCAATTGCTTCAATAGCGGAATAAA
Oryza sativaTAAAATATTTGTGATGACTCAGTTCAATTC
Pro123LeuGAATTGAACTGAGTCATCACAAATATTTTATTTATTCCGCTATTGAA1626
CCT-CTTGCAATTGCTCATAAGGATGTCAATAAGCCTGTAACATCCTCCAACA
GGAACAGCGGGGGTAGCCCTTGTGCTTG
TGACATCCTTATGAGCA1627
TGCTCATAAGGATGTCA1628
Increased StarchTGACTCAGTTCAATTCTGCTTCTCTTAATCGCCATATCCATCATACA1629
ADPGPPTACCTTGGTGGGAATATCAACTTTACTGATGGGTCTGTGCAGGTA
Oryza sativaTTGGCTGCTACACAAATGCCTGACGAACC
Gly158AsnGGTTCGTCAGGCATTTGTGTAGCAGCCAATACCTGCACAGACCCA1630
GGG-AATTCAGTAAAGTTGATATTCCCACCAAGGTATGTATGATGGATATGGC
GATTAAGAGAAGCAGAATTGAACTGAGTCA
TGGTGGGAATATCAACT1631
AGTTGATATTCCCACCA1632
Increased StarchTGACTCAGTTCAATTCTGCTTCTCTTAATCGCCATATCCATCATACA1633
ADPGPPTACCTTGGTGGGAACATCAACTTTACTGATGGGTCTGTGCAGGTA
Oryza sativaTTGGCTGCTACACAAATGCCTGACGAACC
Gly158AsnGGTTCGTCAGGCATTTGTGTAGCAGCCAATACCTGCACAGACCCA1634
GGG-AACTCAGTAAAGTTGATGTTCCCACCAAGGTATGTATGATGGATATGG
CGATTAAGAGAAGCAGAATTGAACTGAGTCA
TGGTGGGAACATCAACT1635
AGTTGATGTTCCCACCA1636
Increased StarchCCTTCCGCAGGAATTACGCCGATCCGAACGAGGTCGCGGCCGTC1637
ADPGPPATACTCGGCGGTGGCAAAGGGACTCAGCTCTTCCCTCTCACAAG
Triticum pestivumCACAAGGGCCACACCTGCTGTTCCTATTGGAGG
Thr99LysCCTCCAATAGGAACAGCAGGTGTGGCCCTTGTGCTTGTGAGAGG1638
ACC-AAAGAAGAGCTGAGTCCCTTTGCCACCGCCGAGTATGACGGCCGCGA
CCTCGTTCGGATCGGCGTAATTCCTGCGGAAGG
CGGTGGCAAAGGGACTC1639
GAGTCCCTTTGCCACCG1640
Increased StarchCAAGCACAAGGGCCACACCTGCTGTTCCTATTGGAGGATGTTACA1641
ADPGPPGGCTCATCGATATTCTCATGAGCAACTGCTTCAATAGTGGCATCAA
Triticum aestivumCAAGATATTCGTCATGACGCAGTTCAACTC
Pro127LeuGAGTTGAACTGCGTCATGACGAATATCTTGTTGATGCCACTATTGA1642
CCC-CTCAGCAGTTGCTCATGAGAATATCGATGAGCCTGTAACATCCTCCAA
TAGGAACAGCAGGTGTGGCCCTTGTGCTTG
CGATATTCTCATGAGCA1643
TGCTCATGAGAATATCG1644
Increased StarchTGACGCAGTTCAACTCGGCCTCTCTTAATCGTCACATTCACCGCA1645
ADPGPPCCTACCTCGGCGGGAATATCAATTTCACTGATGGATCTGTTGAGG
Triticum aestivumTATTGGCCGCGACGCAAATGCCCGGGGAGGC
Gly162AsnGCCTCCCCGGGCATTTGCGTCGCGGCCAATACCTCAACAGATCC1646
GGA-AATATCAGTGAAATTGATATTCCCGCCGAGGTAGGTGCGGTGAATGTG
ACGATTAAGAGAGGCCGAGTTGAACTGCGTCA
CGGCGGGAATATCAATT1647
AATTGATATTCCCGCCG1648
Increased StarchTGACGCAGTTCAACTCGGCCTCTCTTAATCGTCACATTCACCGCA1649
ADPGPPCCTACCTCGGCGGGAACATCAATTTCACTGATGGATCTGTTGAGG
Triticum aestivumTATTGGCCGCGACGCAAATGCCCGGGGAGGC
Gly162AsnGCCTCCCCGGGCATTTGCGTCGCGGCCAATACCTCAACAGATCC1650
GGA-AACATCAGTGAAATTGATGTTCCCGCCGAGGTAGGTGCGGTGAATGTG
ACGATTAAGAGAGGCCGAGTTGAACTGCGTCA
CGGCGGGAACATCAATT1651
AATTGATGTTCCCGCCG1652
Increased StarchCTTTTCGGAGGAATTATGCTGATCCTAATGAAGTCGCTGCCGTCA1653
ADPGPPTTTTGGGTGGTGGTAAAGGGACTCAGCTTTTCCCTCTCACAAGCA
Zea maysCAAGGGCCACCCCTGCTGTTCCTATTGGAGG
Thr96LysCCTCCAATAGGAACAGCAGGGGTGGCCCTTGTGCTTGTGAGAGG1654
ACC-AAAGAAAAGCTGAGTCCCTTTACCACCACCCAAAATGACGGCAGCGAG
TTCATTAGGATCAGCATAATTCCTCCGAAAAG
TGGTGGTAAAGGGACTC1655
GAGTCCCTTTACCACCA1656
Increased StarchCAAGCACAAGGGCCACCCCTGCTGTTCCTATTGGAGGATGTTACA1657
ADPGPPGGCTTATTGATATCCTCATGAGCAACTGTTTCAACAGTGGCATAAA
Zea maysCAAGATATTTGTTATGACTCAGTTCAACTC
Pro124LeuGAGTTGAACTGAGTCATAACAAATATCTTGTTTATGCCACTGTTGA1658
CCC-CTCAACAGTTGCTCATGAGGATATCAATAAGCCTGTAACATCCTCCAAT
AGGAACAGCAGGGGTGGCCCTTGTGCTTG
TGATATCCTCATGAGCA1659
TGCTCATGAGGATATCA1660
Increased StarchTGACTCAGTTCAACTCAGCTTCTCTTAACCGTCACATTCATCGTAC1661
ADPGPPCTATCTTGGTGGGAATATCAACTTCACTGATGGATCTGTTGAGGT
Zea maysGCTGGCTGCAACACAAATGCCTGGGGAGGC
Gly159AsnGCCTCCCCAGGCATTTGTGTTGCAGCCAGCACCTCAACAGATCCA1662
GGG-AATTCAGTGAAGTTGATATTCCCACCAAGATAGGTACGATGAATGTGA
CGGTTAAGAGAAGCTGAGTTGAACTGAGTCA
TGGTGGGAATATCAACT1663
AGTTGATATTCCCACCA1664
Increased StarchTGACTCAGTTCAACTCAGCTTCTCTTAACCGTCACATTCATCGTAC1665
ADPGPPCTATCTTGGTGGGAACATCAACTTCACTGATGGATCTGTTGAGGT
Zea maysGCTGGCTGCAACACAAATGCCTGGGGAGGC
Gly159AsnGCCTCCCCAGGCATTTGTGTTGCAGCCAGCACCTCAACAGATCCA1666
GGG-AACTCAGTGAAGTTGATGTTCCCACCAAGATAGGTACGATGAATGTGA
CGGTTAAGAGAAGCTGAGTTGAACTGAGTCA
TGGTGGGAACATCAACT1667
AGTTGATGTTCCCACCA1668
Increased StarchCTTGAGAGGCAAAAGAAGGGCGATGCAAGGACAGTAGTAGCAAT1669
ADPGPPCATTCTAGGAGGGGGAAAGGGAACTCGTCTTTTCCCCCTCACCAA
Solanum tuberosumACGTCGTGCTAAGCCTGCCGTTCCAATGGGAG
Ala58LysCTCCCATTGGAACGGCAGGCTTAGCACGACGTTTGGTGAGGGGG1670
GCG-AAGAAAAGACGAGTTCCCTTTCCCCCTCCTAGAATGATTGCTACTACTG
TCCTTGCATCGCCCTTCTTTTGCCTCTCAAG
GAGGGGGAAAGGGAACT1671
AGTTCCCTTTCCCCCTC1672
Increased StarchCCAAACGTCGTGCTAAGCCTGCCGTTCCAATGGGAGGAGCATATA1673
ADPGPPGGCTAATTGATGTACTAATGAGCAACTGTATTAACAGTGGCATCAA
Solanum tuberosumCAAAGTATACATTCTCACTCAATTCAACTC
Pro86LeuGAGTTGAATTGAGTGAGAATGTATACTTTGTTGATGCCACTGTTAA1674
CCA-CTATACAGTTGCTCATTAGTACATCAATTAGCCTATATGCTCCTCCCAT
TGGAACGGCAGGCTTAGCACGACGTTTGG
TGATGTACTAATGAGCA1675
TGCTCATTAGTACATCA1676
Increased StarchCTCAATTCAACTCAGCCTCACTTAACAGGCATATAGCTCGTGCTTA1677
ADPGPPCAACTTTGGCAATAATGTCACATTCGAGAGTGGCTATGTCGAGGT
Solanum tuberosumCTTAGCAGCAACTCAAACACCAGGTGAATT
Gly122AsnAATTCACCTGGTGTTTGAGTTGCTGCTAAGACCTCGACATAGCCA1678
GGG-AATCTCTCGAATGTGACATTATTGCCAAAGTTGTAAGCACGAGCTATAT
GCCTGTTAAGTGAGGCTGAGTTGAATTGAG
TGGCAATAATGTCACAT1679
ATGTGACATTATTGCCA1680
Increased StarchCTCAATTCAACTCAGCCTCACTTAACAGGCATATAGCTCGTGCTTA1681
ADPGPPCAACTTTGGCAATAACGTCACATTCGAGAGTGGCTATGTCGAGGT
Solanum tuberosumCTTAGCAGCAACTCAAACACCAGGTGAATT
Gly122AsnAATTCACCTGGTGTTTGAGTTGCTGCTAAGACCTCGACATAGCCA1682
GGG-AACCTCTCGAATGTGACGTTATTGCCAAAGTTGTAAGCACGAGCTATAT
GCCTGTTAAGTGAGGCTGAGTTGAATTGAG
TGGCAATAACGTCACAT1683
ATGTGACGTTATTGCCA1684
Increased StarchTATTTGAATCTCCAAAAGCTGACCCAAAAAATGTGGCTGCAATTGT1685
ADPGPPGCTGGGTGGTGGTAAAGGGACTCGCCTCTTTCCTCTTACTAGCAG
Beta vulgarisGAGAGCTAAGCCAGCAGTGCCAATTGGAGG
Ala98LysCCTCCAATTGGCACTGCTGGCTTAGCTCTCCTGCTAGTAAGAGGA1686
GCT-AAAAAGAGGCGAGTCCCTTTACCACCACCCAGCACAATTGCAGCCACA
TTTTTTGGGTCAGCTTTTGGAGATTCAAATA
TGGTGGTAAAGGGACTC1687
GAGTCCCTTTACCACCA1688
Increased StarchTATTTGAATCTCCAAAAGCTGACCCAAAAAATGTGGCTGCAATTGT1689
ADPGPPGCTGGGTGGTGGTAACGGGACTCGCCTCTTTCCTCTTACTAGCAG
Beta vulgarisGAGAGCTAAGCCAGCAGTGCCAATTGGAGG
Ala98LysCCTCCAATTGGCACTGCTGGCTTAGCTCTCCTGCTAGTAAGAGGA1690
GCT-AACAAGAGGCGAGTCCCGTTACCACCACCCAGCACAATTGCAGCCAC
ATTTTTTGGGTCAGCTTTTGGAGATTCAAATA
TGGTGGTAACGGGACTC1691
GAGTCCCGTTACCACCA1692
Increased StarchCTAGCAGGAGAGCTAAGCCAGCAGTGCCAATTGGAGGGTGTTAC1693
ADPGPPAGGCTGATTGATGTGCTTATGAGCAACTGCATCAACAGTGGCATT
Beta vulgarisAGAAAGATTTTCATTCTTACCCAGTTCAATTC
Pro126LeuGAATTGAACTGGGTAAGAATGAAAATCTTTCTAATGCCACTGTTGA1694
CCT-CTTTGCAGTTGCTCATAAGCACATCAATCAGCCTGTAACACCCTCCAA
TTGGCACTGCTGGCTTAGCTCTCCTGCTAG
TGATGTGCTTATGAGCA1695
TGCTCATAAGCACATCA1696
Increased StarchCCCAGTTCAATTCGTTTTCGCTTAATCGTCATCTTGCTCGAACCTA1697
ADPGPPTAATTTTGGAGATAATGTGAATTTTGGGGATGGCTTTGTGGAGGTT
Beta vulgarisTTTGCTGCTACACAAACACCTGGAGAATC
Gly162AsnGATTCTCCAGGTGTTTGTGTAGCAGCAAAAACCTCCACAAAGCCA1698
GGT-AATTCCCCAAAATTCACATTATCTCCAAAATTATAGGTTCGAGCAAGAT
GACGATTAAGCGAAAACGAATTGAACTGGG
TGGAGATAATGTGAATT1699
AATTCACATTATCTCCA1700
Increased StarchCCCAGTTCAATTCGTTTTCGCTTAATCGTCATCTTGCTCGAACCTA1701
ADPGPPTAATTTTGGAGATAACGTGAATTTTGGGGATGGCTTTGTGGAGGT
Beta vulgarisTTTTGCTGCTACACAAACACCTGGAGAATC
Gly162AsnGATTCTCCAGGTGTTTGTGTAGCAGCAAAAACCTCCACAAAGCCA1702
GGT-AACTCCCCAAAATTCACGTTATCTCCAAAATTATAGGTTCGAGCAAGAT
GACGATTAAGCGAAAACGAATTGAACTGGG
TGGAGATAACGTGAATT1703
AATTCACGTTATCTCCA1704

[0142] 23

TABLE 21
Oligonucleotides to produce plants with waxy starch
Phenotype, Gene,
Plant & TargetedSEQ ID
AlterationAltering OligosNO:
Waxy starchGAATCCAGGTAAACGGGTAGTTCATAATGGCAACTGTGACTGCTT1705
GBSSCTTCTAACTTTGTGTGAAGAACTTCACTTTTCAACAATCATGGTGCT
Arabidopsis thalianaTCTTCATGCTCTGATGTCGCTCAGATTAC
Ser12TermGTAATCTGAGCGACATCAGAGCATGAAGAAGCACCATGATTGTTG1706
TCA-TGAAAAAGTGAAGTTCTTCACACAAAGTTAGAAGAAGCAGTCACAGTTG
CCATTATGAACTACCCGTTTACCTGGATTC
CTTTGTGTGAAGAACTT1707
AAGTTCTTCACACAAAG1708
Waxy starchATCCAGGTAAACGGGTAGTTCATAATGGCAACTGTGACTGCTTCTT1709
GBSSCTAACTTTGTGTCATGAACTTCACTTTTCAACAATCATGGTGCTTCT
Arabidopsis thalianaTCATGCTCTGATGTCGCTCAGATTACCT
Arg13TermAGGTAATCTGAGCGACATCAGAGCATGAAGAAGCACCATGATTGT1710
AGA-TGATGAAAAGTGAAGTTCATGACACAAAGTTAGAAGAAGCAGTCACAGT
TGCCATTATGAACTACCCGTTTACCTGGAT
TTGTGTCATGAACTTCA1711
TGAAGTTCATGACACAA1712
Waxy starchTAAACGGGTAGTTCATAATGGCAACTGTGACTGCTTCTTCTAACTT1713
GBSSTGTGTCAAGAACTTGACTTTTCAACAATCATGGTGCTTCTTCATGCT
Arabidopsis thalianaCTGATGTCGCTCAGATTACCTTAAAAGG
Ser15TermCCTTTTAAGGTAATCTGAGCGACATCAGAGCATGAAGAAGCACCAT1714
TCA-TGAGATTGTTGAAAAGTCAAGTTCTTGACACAAAGTTAGAAGAAGCAGT
CACAGTTGCCATTATGAACTACCCGTTTA
AAGAACTTGACTTTTCA1715
TGAAAAGTCAAGTTCTT1716
Waxy starchTGACTGCTTCTTCTAACTTTGTGTCAAGAACTTGACTTTTCAACAAT1717
GBSSCATGGTGCTTCTTGATGCTCTGATGTCGCTCAGATTACCTTAAAAG
Arabidopsis thalianaGCCAATCCTTGACTCATTGTGGGTTAAG
Ser24TermCTTAACCCACAATGAGTCAAGGATTGGCCTTTTAAGGTAATCTGAG1718
TCA-TGACGACATCAGAGCATCAAGAAGCACCATGATTGTTGAAAAGTGAAG
TTCTTGACACAAAGTTAGAAGAAGCAGTCA
TGCTTCTTGATGCTCTG1719
CAGAGCATCAAGAAGCA1720
Waxy starchTGCTTCTTCTAACTTTGTGTCAAGAACTTCACTTTTCAACAATCATG1721
GBSSGTGCTTCTTCATGATCTGATGTCGCTCAGATTACCTTAAAAGGCCA
Arabidopsis thalianaATCCTTGACTCATTGTGGGTTAAGGTCA
Cys25TermTGACCTTAACCCACAATGAGTCAAGGATTGGCCTTTTAAGGTAATC1722
TGC-TGATGAGCGACATCAGATCATGAAGAAGCACCATGATTGTTGAAAAGT
GAAGTTCTTGACACAAAGTTAGAAGAAGCA
TCTTCATGATCTGATGT1723
ACATCAGATCATGAAGA1724
Waxy starchGTAACAGCTTCACAGTTGGTGTCACATGTCCATGGTGGAGCAACG1725
GBSSTCTTCACCGGATACTTAAACAAACTTGGCCCAGGTTGGCCTCAGG
Antirrhinum majusAACCAGCAATTCACTCACAATGGGTTGAGAT
Lys24TermATCTCAAGCCATTGTGAGTGAATTGCTGGTTCGTGAGGCCAACCTG1726
AAA-TAAGGCCAAGTTTGTTTAAGTATCGGGTGAAGACGTTGCTCCACCATG
GACATGTGACACCAACTGTGAAGGTGTTAC
CGGATACTTAAACAAAC1727
GTTTGTTTAAGTATCCG1728
Waxy starchCACAGTTGGTGTCACATGTCCATGGTGGAGCAAGGTCTTCACCGG1729
GBSSATAGTAAAACAAACTAGGGCGAGGTTGGCCTCAGGAACCAGCAAT
Antirrhinum majusTCACTCACAATGGGTTGAGATCAATAAACAT
Leu27TermATGTTTATTGATCTCAACCCATTGTGAGTGAATTGCTGGTTCCTGA1730
TTG-TAGGGCCAACCTGGGCCTAGTTTGTTTTAGTATCGGGTGAAGACGTTG
CTCCACCATGGACATGTGACACCAACTGTG
AACAAACTAGGCCCAGG1731
CCTGGGCCTAGTTTGTT1732
Waxy starchTTGGTGTCACATGTCCATGGTGGAGCAACGTCTTCACCGGATACT1733
GBSSAAAACAAACTTGGCCTAGGTTGGCCTCAGGAACCAGCAATTCACT
Antirrhinum majusCACAATGGGTTGAGATCAATAAACATGGTTG
Gln29TermCAACCATGTTTATTGATCTCAACCCATTGTGAGTGAATTGCTGGTT1734
GAG-TAGCCTGAGGCCAACCTAGGCCAAGTTTGTTTTAGTATCCGGTGAAGA
CGTTGCTCCACCATGGACATGTGACACCAA
ACTTGGCCTAGGTTGGC1735
GCCAACCTAGGCCAAGT1736
Waxy starchGGTGGAGCAACGTCTTCACCGGATACTAAAACAAACTTGGCCCAG1737
GBSSGTTGGCCTCAGGAACTAGCAATTCACTCACAATGGGTTGAGATCA
Antirrhinum majusATAAACATGGTTGATAAGCTTCAAATGAGGA
Gln35TermTCCTCATTTGAAGCTTATCAACCATGTTTATTGATGTCAACCCATTG1738
GAG-TAGTGAGTGAATTGCTAGTTCCTGAGGCCAACCTGGGCCAAGTTTGTTT
TAGTATCCGGTGAAGACGTTGCTCCACC
TCAGGAACTAGCAATTC1739
GAATTGCTAGTTCCTGA1740
Waxy starchGGAGCAACGTCTTCACCGGATACTAAAACAAACTTGGCCCAGGTT1741
GBSSGGCCTCAGGAACCAGTAATTCACTCACAATGGGTTGAGATCAATAA
Antirrhinum majusACATGGTTGATAAGCTTCAAATGAGGAACA
Gln36TermTGTTCCTCATTTGAAGCTTATCAACCATGTTTATTGATCTCAACCCA1742
CAA-TAATTGTGAGTGAATTACTGGTTCCTGAGGCCAACCTGGGCCAAGTTT
GTTTTAGTATCCGGTGAAGACGTTGCTCC
GGAACCAGTAATTCACT1743
AGTGAATTACTGGTTCC1744
Waxy starchGTGATGGCGACTATAACTGCCTCACACTTTGTTTCTCATGTCTGTG1745
GBSSGGGGTGCCACTTCTTGAGAATCAAAAGTGGGGTTGGGTCAATTAG
Ipomoea batatasCCCTGAGGAGCCAAGCTGTGACTCACAATG
Gly20TermCATTGTGAGTCACAGCTTGGCTCCTCAGGGCTAATTGACCCAACC1746
GGA-TGACCACTTTTGATTCTCAAGAAGTGGCACCCCCACAGACATGAGAAA
CAAAGTGTGAGGCAGTTATAGTCGCCATCAC
CCACTTCTTGAGAATCA1747
TGATTCTCAAGAAGTGG1748
Waxy starchATGGCGACTATAACTGCCTCACACTTTGTTTCTCATGTCTGTGGGG1749
GBSSGTGCCACTTCTGGATAATCAAAAGTGGGGTTGGGTCAATTAGCCC
Ipomoea batatasTGAGGAGCCAAGCTGTGACTCACAATGGGT
Glu21TermACCCATTGTGAGTCACAGCTTGGCTCCTCAGGGCTAATTGACCCA1750
GAA-TAAACCCCACTTTTGATTATCCAGAAGTGGCACCCCCACAGACATGAG
AAACAAAGTGTGAGGCAGTTATAGTCGCCAT
CTTCTGGATAATCAAAA1751
TTTTGATTATCCAGAAG1752
Waxy starchCGACTATAACTGCCTCACACTTTGTTTCTCATGTCTGTGGGGGTGC1753
GBSSCACTTCTGGAGAATGAAAAGTGGGGTTGGGTCAATTAGCCCTGAG
Ipomoea batatasGAGCCAAGCTGTGACTCACAATGGGTTGAG
Ser22TermCTCAACCCATTGTGAGTCACAGCTTGGCTCCTCAGGGCTAATTGA1754
TCA-TGACCCAACCCCACTTTTCATTCTCCAGAAGTGGCACCCCCACAGACAT
GAGAAACAAAGTGTGAGGCAGTTATAGTCG
TGGAGAATGAAAAGTGG1755
CCACTTTTCATTCTCCA1756
Waxy starchACTATAACTGCCTCACACTTTGTTTCTCATGTCTGTGGGGGTGCCA1757
GBSSCTTCTGGAGAATCATAAGTGGGGTTGGGTCAATTAGCCCTGAGGA
Ipomoea batatasGCCAAGCTGTGACTCACAATGGGTTGAGAC
Lys23TermGTCTCAACCCATTGTGAGTCACAGCTTGGCTCCTCAGGGCTAATT1758
AAA-TAAGACCCAACCCCACTTATGATTCTCCAGAAGTGGCACCCCCACAGA
CATGAGAAACAAAGTGTGAGGCAGTTATAGT
GAGAATCATAAGTGGGG1759
CCCCACTTATGATTCTC1760
Waxy starchCCTCACACTTTGTTTCTCATGTCTGTGGGGGTGCCACTTCTGGAGA1761
G BSSATCAAAAGTGGGGTAGGGTCAATTAGCCCTGAGGAGCCAAGCTGT
Ipomoea batatasGACTCACAATGGGTTGAGACCTGTGAACAA
Leu26TermTTGTTCACAGGTCTCAACCCATTGTGAGTCACAGCTTGGCTCCTCA1762
TTG-TAGGGGCTAATTGACCCTACCCCACTTTTGATTCTCCAGAAGTGGCACC
CCCACAGACATGAGAAACAAAGTGTGAGG
AGTGGGGTAGGGTCAAT1763
ATTGACCCTACCCCACT1764
Waxy starchCATCGGCGATTGTTGCTCCTTACTGCTCTCTCACAGAATGGCAACG1765
GBSSGTGACGGGGTCTTAGGTGGTGTCGAGAAGCGCGTGCTTCAATTCC
AstragalusCAGGGAAGAACAGAAGCCAAAGTGAATTCA
membranaeusTGAATTCACTTTGGCTTCTGTTCTTCCCTGGGAATTGAAGCACGCG1766
Tyr8TermCTTCTCGACACCACCTAAGACCCCGTCACCGTTGCCATTCTGTGA
TAT-TAGGAGAGCAGTAAGGAGCAACAATCGCCGATG
GGGTCTTAGGTGGTGTC1767
GACACCACCTAAGACCC1768
Waxy starchATTGTTGCTCCTTACTGCTCTCTCACAGAATGGCAACGGTGACGG1769
GBSSGGTCTTATGTGGTGTAGAGAAGCGCGTGCTTCAATTCCCAGGGAA
AstragalusGAACAGAAGCCAAAGTGAATTCACCTCAGAA
membranaeusTTCTGAGGTGAATTCACTTTGGCTTCTGTTCTTCCCTGGGAATTGA1770
Ser11TermAGCACGCGCTTCTCTACACCACATAAGACCCCGTCACCGTTGCCA
TCG-TAGTTCTGTGAGAGAGCAGTAAGGAGCAACAAT
TGTGGTGTAGAGAAGCG1771
CGCTTCTCTACACCACA1772
Waxy starchTGTTGCTCCTTACTGCTCTCTCACAGAATGGCAACGGTGACGGGG1773
GBSSTCTTATGTGGTGTCGTGAAGCGCGTGCTTCAATTCCCAGGGAAGA
AstragalusACAGAAGCCAAAGTGAATTCACCTCAGAAGA
membranaeusTCTTCTGAGGTGAATTCACTTTGGCTTCTGTTCTTCCCTGGGAATT1774
Arg12TermGAAGCACGCGCTTCACGACACCACATAAGACCCCGTCACCGTTGC
AGA-TGACATTCTGTGAGAGAGCAGTCAGGAGCAACA
TGGTGTCGTGAAGCGCG1775
CGCGCTTCACGACACCA1776
Waxy starchACTGCTCTCTCACAGAATGGCAACGGTGACGGGGTCTTATGTGGT1777
GBSSGTCGAGAAGCGCGTGATTCAATTCCCAGGGAAGAACAGAAGCCAA
AstragalusAGTGAATTCACCTCAGAAGATAAATCTGAAT
membranaeusATTGAGATTTATCTTCTGAGGTGAATTCACTTTGGCTTCTGTTCTTC1778
Cys15TermCCTGGGAATTGAATCACGCGCTTCTCGACACCACATAAGACCCCG
TGC-TGATCACCGTTGCCATTCTGTGAGAGAGCAGT
AGCGCGTGATTCAATTC1779
GAATTGAATCACGCGCT1780
Waxy starchCACAGAATGGCAACGGTGACGGGGTCTTATGTGGTGTCGAGAAG1781
GBSSCGCGTGGTTCAATTCCTAGGGAAGAACAGAAGCCAAAGTGAATTC
AstragalusACCTCAGAAGATAAATCTCAATAGCCAAGCAT
membranaeusATGCTTGGCTATTGAGATTTATCTTCTGAGGTGAATTCACTTTGGCT1782
Gln19TermTCTGTTCTTCCCTAGGAATTGAAGCACGCGCTTCTCGACACCACAT
CAG-TAGAAGACCCCGTCACCGTTGCCATTCTGTG
TCAATTCCTAGGGAAGA1783
TCTTCCCTAGGAATTGA1784
Waxy starchTGTAGCTTGGTAGATTCCCCTTTTTGTCGACCACACATCACATGGC1785
GBSSAAGCATCACAGCTTGACACCACTTTGTGTCAAGAAGCCAAACTTCA
Solanum tuberosumCTAGACACCAAATCAACCTTGTCACAGAT
Ser7TermATCTGTGACAAGGTTGATTTGGTGTCTAGTGAAGTTTGGCTTCTTG1786
TCA-TGAACACAAAGTGGTGTCAAGCTGTGATGCTTGCCATGTGATGTGTGG
TCTACAAAAAGGGGAATCTACCAAGCTACA
CACAGCTTGACACCACT1787
AGTGGTGTCAAGCTGTG1788
Waxy starchTCCCCTTTTTGTAGACCACACATCACATGGCAAGCATCACAGCTTC1789
GBSSACACCACTTTGTGTGAAGAAGCCAAACTTCACTAGACACCAAATCA
Solanum tuberosumACCTTGTCACAGATAGGACTCAGGAACCA
Ser12TermTGGTTCCTGAGTCCTATCTGTGACAAGGTTGATTTGGTGTCTAGTG1790
TCA-TGAAAGTTTGGCTTCTTCACACAAAGTGGTGTGAAGCTGTGATGCTTGC
CATGTGATGTGTGGTCTACAAAAAGGGGA
CTTTGTGTGAAGAAGCC1791
GGCTTCTTCACACAAAG1792
Waxy starchCCCTTTTTGTAGACCACACATCACATGGCAAGCATCACAGCTTCAC1793
GBSSACCACTTTGTGTCATGAAGCCAAACTTCACTAGACACCAAATCAAC
Solanum tuberosumCTTGTCACAGATAGGACTCAGGAACCATA
Arg13TermTATGGTTCCTGAGTCCTATCTGTGACAAGGTTGATTTGGTGTCTAG1794
AGA-TGATGAAGTTTGGCTTCATGACACAAAGTGGTGTGAAGCTGTGATGCTT
GCCATGTGATGTGTGGTCTACAAAAAGGG
TTGTGTCATGAAGCCAA1795
TTGGCTTCATGACACAA1796
Waxy starchTTGTAGACCACACATCACATGGCAAGCATCACAGCTTCACACCACT1797
GBSSTTGTGTCAAGAAGCTAAACTTCACTAGACACCAAATCAACCTTGTC
Solanum tuberosumACAGATAGGACTCAGGAACCATACTCTGA
Gln15TermTCAGAGTATGGTTCCTGAGTCCTATCTGTGACAAGGTTGATTTGGT1798
CAA-TAAGTCTAGTGAAGTTTAGCTTCTTGACACAAAGTGGTGTGAAGCTGTG
ATGCTTGCCATGTGATGTGTGGTCTACAA
CAAGAAGCTAAACTTCA1799
TGAAGTTTAGCTTCTTG1800
Waxy starchCCACACATCACATGGCAAGCATCACAGCTTCACACCACTTTGTGTC1801
GBSSAAGAAGCCAAACTTGACTAGACACCAAATCAACCTTGTCACAGATA
Solanum tuberosumGGACTCAGGAACCATACTCTGACTCACAA
Sen17TermTTGTGAGTCAGAGTCTGGTTCCTGAGTCCTATCTGTGACAAGGTTG1802
TCA-TGAATTTGGTGTCTAGTCAAGTTTGGCTTGTTGACACAAAGTGGTGTGA
AGCTGTGATGCTTGCCATGTGATGTGTGG
CCAAACTTGACTAGACA1803
TGTCTAGTCAAGTTTGG1804
Waxy starchGTCGATCACTCTTCTCTCACCGCCGAAACAGATTTTGACACAAAAA1805
GBSSTGGCAACAATAACGTGATCTTCAATGCCGACGAGAACCGCGTGCT
Pisum sativumTCAATTACCAAGGAAGATCAGCAGAGTCTA
Gly6TermTAGACTCTGCTGATCTTCCTTGGTCATTGAAGCACGCGGTTCTCGT1806
GGA-TGACGGCATTGAAGATCACGTTATTGTTGCCATTTTTGTGTCAAAATCT
GTTTCGGCGGTGAGAGAAGAGTGATCGAC
CAATAACGTGATCTTCA1807
TGAAGATCACGTTATTG1808
Waxy starchACTCTTCTCTCACCGCCGAAACAGATTTTGACACAAAAATGGCAAC1809
GBSSAATAACGGGATCTTGAATGCCGACGAGAACCGCGTGCTTCAATTA
Pisum sativumCCAAGGAAGATCAGCAGAGTCTAAACTGAA
Ser8TermTTCAGTTTAGACTCTGCTGATCTTCCTTGGTCATTGAAGCACGCGG1810
TCA-TGATTCTCGTCGGCATTCAAGATCCCGTTATTGTTGCCATTTTTGTGTCA
AAATCTGTTTCGGCGGTGAGAGAAGAGT
GGGATCTTGAATGCCGA1811
TCGGCATTCAAGATCCC1812
Waxy starchACCGCCGAAACAGATTTTGACACAAAAATGGCAACAATAACGGGA1813
GBSSTCTTCAATGCCGACGTGAACCGCGTGCTTCAATTACCAAGGAAGA
Pisum sativumTCAGCAGAGTCTAAACTGAATTTGCCTCAGA
Arg12TermTCTGAGGCAAATTCAGTTTAGACTCTGCTGATCTTCCTTGGTCATT1814
AGA-TGAGAAGCACGCGGTTCACGTCGGCATTGAAGATCCCGTTATTGTTGC
CATTTTTGTGTCAAAATCTGTTTCGGCGGT
TGCCGACGTGAACCGCG1815
CGCGGTTCACGTCGGCA1816
Waxy starchAGATTTTGACACAAAAATGGCAACAATAACGGGATCTTCAATGCCG1817
GBSSACGAGAACCGCGTGATTCAATTACCAAGGAAGATCAGCAGAGTCT
Pisum sativumAAACTGAATTTGCCTCAGATACACTTCAAT
Cys15TermATTGAAGTGTCTCTGAGGCAAATTCAGTTTAGACTCTGCTGATCTT1818
TGC-TGACCTTGGTCATTGAATCACGCGGTTCTCGTCGGCATTGAAGATCCC
GTTATTGTTGCCATTTTTGTGTCAAAATCT
ACCGCGTGATTCAATTA1819
TAATTGAATCACGCGGT1820
Waxy starchCACAAAAATGGCAACAATAACGGGATCTTCAATGCCGACGAGAAC1821
GBSSCGCGTGCTTCAATTAGCAAGGAAGATCAGCAGAGTCTAAACTGAA
Pisum sativumTTTGCCTCAGATACACTTCAATAACAACCAA
Tyr18TermTTGGTTGTTATTGAAGTGTATCTGAGGCAAATTCAGTTTAGACTCT1822
TAC-TAGGCTGATCTTCCTTGCTAATTGAAGCACGCGGTTCTCGTCGGCATTG
AAGATCCCGTTATTGTTGCCATTTTTGTG
TTCAATTAGCAAGGAAG1823
CTTCCTTGCTAATTGAA1824
Waxy starchTCTACACCGGAGAGAGCACCATGGCAACTGTAATAGCTGCACATT1825
GBSSTCGTTTCCAGGAGCTGACACTTGAGCATCCATGCATTAGAGACTAA
Manihot esculentaGGCTAATAATTTGTCTCACACTGGACCCTG
Ser14TermCAGGGTCCAGTGTGAGACAAATTATTAGCCTTAGTCTCTAATGCAT1826
TCA-TGAGGATGCTCAAGTGTCAGCTCCTGGAAACGAAATGTGCAGCTATTA
CAGTTGCCATGGTGCTCTCTCCGGTGTAGA
CAGGAGCTGACACTTGA1827
TCAAGTGTCAGCTCCTG1828
Waxy starchCCGGAGAGAGCACCATGGCAACTGTAATAGCTGCACATTTCGTTT1829
GBSSCCAGGAGCTCACACTAGAGCATCCATGCATTAGAGACTAAGGCTA
Manihot esculentaATAATTTGTCTCACACTGGACCCTGGACCCA
Leu16TermTGGGTCCAGGGTCCAGTGTGAGACAAATTATTAGCCTTAGTCTCTA1830
TTG-TAGATGCATGGATGCTCTAGTGTGAGCTCCTGGAAACGAAATGTGCAG
CTATTACAGTTGCCATGGTGCTCTCTCCGG
CTCACACTAGAGCATCC1831
GGATGCTCTAGTGTGAG1832
Waxy starchTGGCAACTGTAATAGCTGCACATTTCGTTTCCAGGAGCTCACACTT1833
GBSSGAGCATCCATGCATGAGAGACTAAGGCTAATAATTTGTCTCACACT
Manihot esculentaGGACCCTGGACCCAAACTATCACTCCCAA
Leu21TermTTGGGAGTGATAGTTTGGGTCCAGGGTCCAGTGTGAGACAAATTA1834
TTA-TGATTAGCCTTAGTCTCTCATGCATGGATGCTCAAGTGTGAGCTCCTGG
AAACGAAATGTGCAGCTATTACAGTTGCCA
CCATGCATGAGAGACTA1835
TAGTCTCTCATGCATGG1836
Waxy starchGCAACTGTAATAGCTGCACATTTCGTTTCCAGGAGCTCACACTTGA1837
GBSSGCATCCATGCATTATAGACTAAGGCTAATAATTTGTCTCACACTGG
Manihot esculentaACCCTGGACCCAAACTATCACTCCCAATG
Glu22TermCATTGGGAGTGATAGTTTGGGTCCAGGGTCCAGTGTGAGACAAAT1838
GAG-TAGTATTAGCCTTAGTCTATAATGCATGGATGCTCAAGTGTGAGCTCCT
GGAAACGAAATGTGCAGCTATTACAGTTGC
ATGCATTATAGACTAAG1839
CTTAGTCTATAATGCAT1840
Waxy starchGTCATAGCTGCACATTTCGTTTCCAGGAGCTCACACTTGAGCATCC1841
GBSSATGCATTAGAGACTTAGGCTAATAATTTGTCTCACACTGGACCCTG
Manihot esculentaGACCCAAACTATCACTCCCAATGGTTTAA
Lys24TermTTAAACCATTGGGAGTGATAGTTTGGGTCCAGGGTCCAGTGTGAG1842
AAG-TAGACAAATTATTAGCCTAAGTCTCTAATGCATGGATGCTCAAGTGTGA
GCTCCTGGAAACGAAATGTGCAGCTATTAC
TAGAGACTTAGGCTAAT1843
ATTAGCCTAAGTCTCTA1844
Waxy starchACAACTCCTCCGTCACCGGTATAAGCATGGCAACGGTATCGATGG1845
GBSSCATCGTGCGTGGCGTGAAAAGGCGCGTGGAGTACAGAGACAAAA
Phaseolus vulgarisGTGAAATCTTCGGGTCAGATGAGCCTGAACCG
Ser12TermCGGTTCAGGCTCATCTGACCCGAAGATTTCACTTTTGTCTCTGTCC1846
TCA-TGATCCACGCGCCTTTTCACGCCACGCACGATGCCATCGATACCGTTG
CCATGCTTATACCGGTGACGGAGGAGTTGT
CGTGGCGTGAAAAGGCG1847
CGCCTTTTCACGCCACG1848
Waxy starchCACCGGTCTAAGCATGGCAACGGTATCGATGGCATCGTGCGTGGC1849
GBSSGTCAAAAGGCGCGTGAAGTACAGAGACAAAAGTGAAATCTTCGGG
Phaseolus vulgarisTCAGATGAGCCTGAACCGTCATGAATTGAAA
Trp16TermTTTCAATTCATGACGGTTCAGGCTCATCTGACCCGAAGATTTCACT1850
TGG-TGATTTGTCTCTGTACTTCACGCGCCTTTTGACGCCACGCACGATGCCA
TCGATACCGTTGGCATGCTTATACCGGTG
GGCGCGTGAAGTACAGA1851
TCTGTACTTCACGCGCC1852
Waxy starchATAAGCATGGCAACGGTCTCGATGGCATCGTGCGTGGCGTCAAAA1853
GBSSGGCGCGTGGAGTACATAGACAAAAGTGAAATCTTCGGGTCAGATG
Phaseolus vulgarisAGCCTGAACCGTCATGAATTGAAATACGATG
Glu19TermCATCGTATTTCAATTCATGACGGTTCAGGCTCATCTGACCCGAAGA1854
GAG-TAGTTTCACTTTTGTCTATGTACTCCACGCGCCTTTTGACGCCACGCAC
GATGCCATCGATACCGTTGCCATGCTTAT
GGAGTACATAGACAAAA1855
TTTTGTCTATGTACTCC1856
Waxy starchATGGCAACGGTATCGATGGCATCGTGCGTGGGGTCAAAAGGCGC1857
GBSSGTGGAGTACAGAGACATAAGTGAAATCTTCGGGTCAGATGAGCCT
Phaseolus vulgarisGAACCGTCATGAATTGAAATACGATGGGTTGA
Lys21TermTCAACCCATCGTATTTCAATTCATGACGGTTCAGGCTCATCTGACC1858
AAA-TAACGAAGATTTCACTTATGTCTCTGTACTCCACGCGCCTTTTGACGCC
ACGCACGATGCCATCGATACCGTTGCCAT
CAGAGACATAAGTGAAA1859
TTTCACTTATGTCTCTG1860
Waxy starchACGGTATCGATGGCATCGTGCGTGGCGTCAAAAGGCGCGTGGAG1861
GBSSTACAGAGACAAAAGTGTAATCTTCGGGTCAGATGAGCCTGAACCG
Phaseolus vulgarisTCATGAATTGAAATACGATGGGTTGAGATCTC
Lys23TermGAGATCTCAACCCATCGTATTTCAATTCATGACGGTTCAGGCTCAT1862
AAA-TAACTGACCCGAAGATTACACTTTTGTCTCTGTACTCCACGCGCCTTTT
GACGCCACGCACGATGCCATCGATACCGT
CAAAAGTGTAATCTTCG1863
CGAAGATTACACTTTTG1864
Waxy starchGCGCCTAGCTCGAAAAGGTCGTCATTGAGAGGCTGCACCAATGG1865
GBSSGTTCCATTCCTAATTAGTGTTCTTATCAAACAAACAGTGTTGGTTCA
Triticum aestivumCTGAAACTGTCGCCTCACATCCAATTCCAG
Tyr7TermCTGGAATTGGATGTGAGGCGACAGTTTCAGTGAACCAACACTGTT1866
TAT-TAGTGTTTGATAAGAACACTAATTAGGAATGGAACCCATTGGTGCAGCC
TCTCAATGACGACCTTTTCGAGCTAGGCGC
CCTAATTAGTGTTCTTA1867
TAAGAACACTAATTAGG1868
Waxy starchCCTAGCTCGAAAAGGTCGTCATTGAGAGGCTGCACCAATGGGTTC1869
GBSSCATTCCTAATTATTGATCTTATCAAACAAACAGTGTTGGTTCACTGA
Triticum aestivumAACTGTCGCCTCACATCCAATTCCAGCAA
Cys8TermTTGCTGGAATTGGATGTGAGGCGACAGTTTCAGTGAACCAACACT1870
TGT-TGAGTTTGTTTGATAAGATCAATAATTAGGAATGGAACCCATTGGTGCA
GCCTCTCAATGACGACCTTTTCGAGCTAGG
AATTATTGATCTTATCA1871
TGATAAGATCAATAATT1872
Waxy starchTCGAAAAGGTCGTCATTGAGAGGCTGCACCAATGGGTTCCATTCC1873
GBSSTAATTATTGTTCTTAGCAAACAAACAGTGTTGGTTCACTGAAACTGT
Triticum aestivumCGCCTCACATCCAATTCCAGCAATCTTGT
Tyr10TermACAAGATTGCTGGAATTGGATGTGAGGCGACAGTTTCAGTGAACC1874
TAT-TAGAACACTGTTTGTTTGCTAAGAACAATAATTAGGAATGGAACCCATT
GGTGCAGCCTCTCAATGACGACCTTTTCGA
TGTTCTTAGCAAACAAA1875
TTTGTTTGCTAAGAACA1876
Waxy starchCGAAAAGGTCGTCATTGAGAGGCTGCACCAATGGGTTCCATTCCT1877
GBSSAATTATTGTTCTTATTAAACAAACAGTGTTGGTTCACTGAAACTGTC
Triticum aestivumGCCTCACATCCAATTCCAGCAATCTTGTA
Gln11TermTACAAGATTGCTGGAATTGGATGTGAGGCGACAGTTTCAGTGAAC1878
CAA-TAACAACACTGTTTGTTTAATAAGAACAATAATTAGGAATGGAACCCATT
GGTGCAGCCTCTCAATGACGACCTTTTCG
GTTCTTATTAAACAAAC1879
GTTTGTTTAATAAGAAC1880
Waxy starchAGGCTGCACCAATGGGTTCCATTCCTAATTATTGTTCTTATCAAACA1881
GBSSAACAGTGTTGGTTGACTGAAACTGTCGCCTCACATCCAATTCCAGC
Triticum aestivumAATCTTGTCACAATGAAGTTATGTTCCT
Ser17TermAGGAACATAACTTCATTGTTACAAGATTGCTGGAATTGGATGTGAG1882
TCA-TGAGCGACAGTTTCAGTCAACCAACACTGTTTGTTTGATAAGAACAATA
ATTAGGAATGGAACCCATTGGTGCAGCCT
TGTTGGTTGACTGAAAC1883
GTTTCAGTCAACCAACA1884
Waxy starchCAGCTCGCCACCTCCGGCACCGTCCTCGGCATCACCGACAGGTT1885
GBSSCCGGCGTGCAGGTTTCTAGGGCGTGAGGCCCCGGAGCCCGGCG
Triticum aestivumGATGCGGCTCTCGGCATGAGGACCGTCGGAGCTA
Gln28TermTAGCTCCGACGGTCCTCATGCCGAGAGCCGCATCCGCCGGGCTC1886
CAG-TAGCGGGGCCTCACGCCCTAGAAACCTGCACGCCGGAACCTGTCGGT
GATGCCGAGGACGGTGCCGGAGGTGGCGAGCTG
CAGGTTTCTAGGGCGTG1887
CACGCCCTAGAAACCTG1888
Waxy starchGGTTTCCAGGGCGTGAGGCCCCGGAGCCCGGCGGATGCGGCTCT1889
GBSSCGGCATGAGGACCGTCTGAGCTAGCGCCGCCCCAACGCAAAGCC
Triticum aestivumGGAAAGCGCACCGCGGGACCCGGCGGTGCCTCT
Gly46TermAGAGGCACCGCCGGGTCCCGCGGTGCGCTTTCCGGCTTTGCGTT1890
GGA-TGAGGGGCGGCGCTAGCTCAGACGGTCCTCATGCCGAGAGCCGCATC
CGCCGGGCTCCGGGGCCTCACGCCCTGGAAACC
GGACCGTCTGAGCTAGC1891
GCTAGCTCAGACGGTCC1892
Waxy starchCGGAGCCCGGCGGATGCGGCTCTCGGCATGAGGACCGTCGGAG1893
GBSSCTAGCGCCGCCCCAACGTAAAGCCGGAAAGCGCACCGCGGGACC
Triticum aestivumCGGCGGTGCCTCTCCATGGTGGTGCGCGCCACCG
Gln53TermCGGTGGCGCGCACCACCATGGAGAGGCACCGCCGGGTCCCGCG1894
CAA-TAAGTGCGCTTTCCGGCTTTACGTTGGGGCGGCGCTAGCTCCGACGG
TCCTCATGCCGAGAGCCGCATCCGCCGGGCTCCG
CCCCAACGTAAAGCCGG1895
CCGGCTTTACGTTGGGG1896
Waxy starchGCGGATGCGGCTCTCGGCATGAGGACCGTCGGAGCTAGCGCCGC1897
GBSSCCCAACGCAAAGCCGGTAAGCGCACCGCGGGACCCGGCGGTGC
Triticum aestivumCTCTCCATGGTGGTGCGCGCCACCGGCAGCGGCG
Lys56TermCGCCGCTGCCGGTGGCGCGCACCACCATGGAGAGGCACCGCCG1898
AAA-TAAGGTCCCGCGGTGCGCTTACCGGCTTTGCGTTGGGGCGGCGCTAG
CTCCGACGGTCCTCATGCCGAGAGCCGCATCCGC
AAAGCCGGTAAGCGCAC1899
GTGCGCTTACCGGCTTT1900
Waxy starchCTCTCCATGGTGGTGCGCGCCACCGGCAGCGGCGGCATGAACCT1901
GBSSCGTGTTCGTCGGCGCCTAGATGGCGCCCTGGACCAAGACCGGCG
Triticum aestivumGCCTCGGCGACGTCCTCGGGGGCCTCCCCCCAG
Glu85TermCTGGGGGGAGGCCCCCGAGGACGTCGCCGAGGCCGCCGGTCTT1902
GAG-TAGGCTCCAGGGCGCCATCTAGGCGCCGACGAACACGAGGTTCATGC
CGCCGCTGCCGGTGGCGCGCACCACCATGGAGAG
TCGGCGCCTAGATGGCG1903
CGCCATCTAGGCGCCGA1904
Waxy starchGTGGTCTCTCGCTGCAGGTAGCCACACCCTGCGCGCGCGATGGC1905
GBSSGGCTCTGGTCACGTCGTAGCTCGCCACCTCCGGCACCGTCCTCG
Triticum aestivumGCATCACCGACAGGTTCCGGCGTGCAGGTTTTC
Gln8TermGAAAACCTGCACGCCGGAACCTGTCGGTGATGCCGAGGACGGTG1906
CAG-TAGCCGGAGGTGGCGAGCTACGACGTGACCAGAGCCGCCATCGCGC
GCGCAGGGTGTGGCTACCTGCAGCGAGAGACGAC
TCACGTCGTAGCTCGCC1907
GGCGAGCTACGACGTGA1908
Waxy starchCAGCTCGCCACCTCCGGCACCGTCCTCGGCATCACCGACAGGTT1909
GBSSCCGGCGTGCAGGTTTTTAGGGTGTGAGGCCCCGGAGCCCGGCAG
Triticum aestivumATGCGCCGCTCGGCATGAGGACTACCGGAGCGA
Gln28TermTCGCTCCGGTCGTCCTCATGCCGAGCGGCGCATCTGCCGGGCTC1910
GAG-TAGCGGGGCCTCACACCCTAAAAACCTGCACGCCGGAACCTGTCGGT
GATGCCGAGGACGGTGCCGGAGGTGGCGAGCTG
CAGGTTTTTAGGGTGTG1911
CACACCCTAAAAACCTG1912
Waxy starchCCCCGGAGCCCGGCAGATGCGCCGCTCGGCATGAGGACTACCGG1913
GBSSAGCGAGCGCCGCCCCGTAGCAACAAAGCCGGAAAGCGCACCGCG
Triticum aestivumGGACCCGGCGGTGCCTCTCCATGGTGGTGCGCG
Lys52TermCGCGCACCACCATGGAGAGGCACCGCCGGGTCCCGCGGTGCGC1914
AAG-TAGTTTCCGGCTTTGTTGCTACGGGGCGGCGCTCGCTCCGGTAGTCCT
CATGCCGAGCGGCGCATCTGCCGGGCTCCGGGG
CCGCCCCGTAGCAACAA1915
TTGTTGCTACGGGGCGG1916
Waxy starchCGGAGCCCGGCAGATGCGCCGCTCGGCATGAGGACTACCGGAG1917
GBSSCGAGCGCCGCCCCGAAGTAACAAAGCCGGAAAGCGCACCGCGG
Triticum aestivumGACCCGGCGGTGCCTCTCCATGGTGGTGCGCGCCA
Gln53TermTGGCGCGCACCACCATGGAGAGGCACCGCCGGGTCCCGCGGTG1918
CAA-TAACGCTTTCCGGCTTTGTTACTTCGGGGCGGCGCTCGCTCCGGTAGT
CCTCATGCCGAGCGGCGCATCTGCCGGGCTCCG
CCCCGAAGTAACAAAGC1919
GCTTTGTTACTTCGGGG1920
Waxy starchAGCCCGGCAGATGCGCCGCTCGGCATGAGGACTACCGGAGCGAG1921
GBSSCGCCGCCCCGAAGCAATAAAGCCGGAAAGCGCACCGCGGGACCC
Triticum aestivumGGCGGTGCCTCTCCATGGTGGTGCGCGCCACGG
Gln54TermCCGTGGCGCGCACCACCATGGAGAGGCACCGCCGGGTCCCGCG1922
CAA-TAAGTGCGCTTTCCGGCTTTATTGCTTCGGGGCGGCGCTCGCTCCGGT
AGTCCTCATGCCGAGCGGCGCATCTGCCGGGCT
CGAAGCAATAAAGCCGG1923
CCGGCTTTATTGCTTCG1924
Waxy starchCAGCTCGCCACCTCCGGCACCGTCCTCGGCATCACCGACAGGTT1925
GBSSCCGGCGTGCAGGTTTCTAGGGCGTGAGGCCCCGGAACCCGGCG
Triticum durumGATGCGGCCCTCGTCATGAGGACTATCGGAGCGA
Gln28TermTCGCTCCGATAGTCCTCATGACGAGGGCCGCATCCGCCGGGTTC1926
CAG-TAGCGGGGCCTCACGCCCTAGAAACCTGCACGCCGGAACCTGTCGGT
GATGCCGAGGACGGTGCCGGAGGTGGCGAGCTG
CAGGTTTCTAGGGCGTG1927
CACGCCCTAGAAACCTG1928
Waxy starchCCCCGGAACCCGGCGGATGCGGCCCTCGTCATGAGGACTATCGG1929
GBSSAGCGAGCGCCGCCCCGTAGCAAAGCCGGAAAGCGCACCGCGGG
Triticum durumAGCCGGCGGTGCCTCTCCATGGTGGTGCGCGCCA
Lys52TermTGGCGCGCACCACCATGGAGAGGCACCGCCGGCTCCCGCGGTG1930
AAG-TAGCGCTTTCCGGCTTTGCTACGGGGCGGCGCTCGCTCCGATAGTCCT
CATGACGAGGGCCGCATCCGCCGGGTTCCGGGG
CCGCCCCGTAGCAAAGC1931
GCTTTGCTACGGGGCGG1932
Waxy starchCGGAACCCGGCGGATGCGGCCCTCGTCATGAGGACTATCGGAGC1933
GBSSGAGCGCCGCCCCGAAGTAAAGCCGGAAAGCGCACCGCGGGAGC
Triticum durum CGGCGGTGCCTCTCCATGGTGGTGCGCGCCACGG
Gln53TermCCGTGGCGCGCACCACCATGGAGAGGCACCGCCGGCTCCCGCG1934
CAA-TAAGTGCGCTTTCCGGCTTTACTTCGGGGCGGCGCTCGCTCCGATAGT
CCTCATGACGAGGGCCGCATCCGCCGGGTTCCG
CCCCGAAGTAAAGCCGG1935
CCGGCTTTACTTCGGGG1936
Waxy starchGCGGATGCGGCCCTCGTCATGAGGACTATCGGAGCGAGCGCCGC1937
GBSSCCCGAAGCAAAGCCGGTAAGCGCACCGCGGGAGCCGGCGGTGC
Triticum durumCTCTCCATGGTGGTGCGCGCCACGGGCAGCGGCG
Lys56TermCGCCGCTGCCCGTGGCGCGCACCACCATGGAGAGGCACCGCCG1938
AAA-TAAGCTCCCGCGGTGCGCTTACCGGCTTTGCTTCGGGGCGGGGCTCG
CTCCGATAGTCCTCATGACGAGGGCCGCATCCGC
AAAGCCGGTAAGCGCAC1939
GTGCGCTTACCGGCTTT1940
Waxy starchTATCGGAGCGAGCGCCGCCCCGAAGCAAAGCCGGAAAGCGCACC1941
GBSSGCGGGAGCCGGCGGTGACTCTCCATGGTGGTGCGCGCCACGGG
Triticum durumCAGCGGCGGCATGAACCTCGTGTTCGTCGGCGCC
Cys64TermGGCGCCGACGAACACGAGGTTCATGCCGCCGCTGCCCGTGGCGC1942
TGC-TGAGCACCACCATGGAGAGTCACCGCCGGCTCCCGCGGTGCGCTTTC
CGGCTTTGCTTCGGGGCGGCGCTCGCTCCGATA
CGGCGGTGACTCTCCAT1943
ATGGAGAGTCACCGCCG1944
Waxy starchCAGCTCGCCACCTCCGGCACCGTCCTCGGCATCACCGACAGGTT1945
GBSSCCGGCGTGCAGGTTTTTAGGGTGTGAGGCCCCGGAGCCCGGCAG
Triticum turgidumATGCGCCGCTCGGCATGAGGACTACCGGAGCGA
Gln28TermTCGCTCCGGTAGTCCTCATGCCGAGCGGCGCATCTGCGGGGCTC1946
CAG-TAGCGGGGCCTCACACCCTAAAAACGTGCACGCCGGAACCTGTCGGT
GATGCCGAGGACGGTGCCGGAGGTGGCGAGCTG
CAGGTTTTTAGGGTGTG1947
CACACCCTAAAAACCTG1948
Waxy starchCCCCGGAGCCCGGCAGATGCGCCGCTCGGCATGAGGACTACCGG1949
GBSSAGCGAGCGCCGCCCCGTAGCAACAAAGCCGGAAAGCGCACCGCG
Triticum turgidumGGACCCGGCGGTGCCTCTCCATGGTGGTGCGCG
Lys52TermCGCGCACCACCATGGAGAGGCACCGCCGGGTCCCGCGGTGCGC1950
AAG-TAGTTTCCGGCTTTGTTGCTACGGGGCGGCGCTCGCTCCGGTAGTCCT
CATGCCGAGCGGCGCATCTGCCGGGCTCCGGGG
CCGCCCCGTAGCAACAA1951
TTGTTGCTACGGGGCGG1952
Waxy starchCGGAGCCCGGCAGATGCGCCGCTCGGCATGAGGACTACCGGAG1953
GBSSCGAGCGCCGCCCCGAAGTAACAAAGCCGGAAAGCGCACCGCGG
Triticum turgidumGACCCGGCGGTGCCTCTCCATGGTGGTGCGCGCCA
Gln53TermTGGCGCGCACCACCATGGAGAGGCACCGCCGGGTCCCGCGGTG1954
CAA-TAACGCTTTCCGGCTTTGTTACTTCGGGGCGGCGCTCGCTCCGGTAGT
CCTCATGCCGAGCGGCGCATCTGCCGGGCTCCG
CCCCGAAGTAACAAAGC1955
GCTTTGTTACTTCGGGG1956
Waxy starchAGCCCGGCAGATGCGCCGCTCGGCATGAGGACTACCGGAGCGAG1957
GBSSCGCCGCCCCGAAGCAATAAAGCCGGAAAGCGCACCGCGGGACCC
Triticum turgidumGGCGGTGCCTCTCCATGGTGGTGCGCGCCACGG
Gln54TermCCGTGGCGCGCACCACCATGGAGAGGCACCGCCGGGTCCCGCG1958
CAA-TAAGTGCGCTTTCCGGCTTTATTGCTTCGGGGCGGCGCTCGCTCCGGT
AGTCCTCATGCCGAGCGGCGCATCTGCCGGGCT
CGAAGCAATAAAGCCGG1959
CCGGCTTTATTGCTTCG1960
Waxy starchGATGCGCCGCTCGGCATGAGGACTACCGGAGCGAGCGCCGCCCC1961
GBSSGAAGCAACAAAGCCGGTAAGCGCACCGCGGGACCCGGCGGTGC
Triticum turgidumCTCTCCATGGTGGTGCGCGCCACGGGCAGCGCCG
Lys57TermCGGCGCTGCCCGTGGCGCGCACCACCATGGAGAGGCACCGCCG1962
AAA-TAAGGTCCCGCGGTGCGCTTACCGGCTTTGTTGCTTCGGGGCGGCGC
TCGCTCCGGTAGTCCTCATGCCGAGCGGCGCATC
AAAGCCGGTAAGCGCAC1963
GTGCGCTTACCGGCTTT1964
Waxy starchCAGCTCGCCACCTCCGCCACCGTCCTCGGCATCACCGACAGGTTC1965
GBSSCGCCATGCAGGTTTCTAGGGCGTGAGGCCCCGGAGCCCGGCAGA
Aegilops speltoidesTGCGCCGCTCGGCATGAGGACTGTCGGAGCGA
Gln28TermTCGCTCCGACAGTCCTCATGCCGAGCGGCGCATCTGCCGGGCTC1966
CAG-TAGCGGGGCCTCACGCCCTAGAAACCTGCATGGCGGAACCTGTCGGT
GATGCCGAGGACGGTGGCGGAGGTGGCGAGCTG
CAGGTTTCTAGGGCGTG1967
CACGCCCTAGAAACCTG1968
Waxy starchGGTTTCCAGGGCGTGAGGCCCCGGAGCCCGGCAGATGCGCCGCT1969
GBSSCGGCATGAGGACTGTCTGAGCGAGCGCCGCCCCGAAGCAACAAA
Aegilops speltoidesGCCGGAAAGCGCACCGCGGGACCCGGCGGTGCC
Gly46TermGGCACCGCCGGGTCCCGCGGTGCGCTTTCCGGCTTTGTTGCTTC1970
GGA-TGAGGGGCGGCGCTCGCTCAGACAGTCCTCATGCCGAGCGGCGCATC
TGCCGGGCTCCGGGGCCTCACGCCCTGGAAACC
GGACTGTCTGAGCGAGC1971
GCTCGCTCAGACAGTCC1972
Waxy starchCCCCGGAGCCCGGCAGATGCGCCGCTCGGCATGAGGACTGTCGG1973
GBSSAGCGAGCGCCGCCCCGTAGCAACAAAGCCGGAAAGCGCACCGCG
Aegilops speltoidesGGACCCGGCGGTGCCTCTCGATGGTGGTGCGCG
Lys52TermCGCGCACCACCATCGAGAGGCACCGCCGGGTCCCGCGGTGCGCT1974
AAG-TAGTTCCGGCTTTGTTGCTACGGGGCGGCGCTCGCTCCGACAGTCCTC
ATGCCGAGCGGCGCATCTGCCGGGCTCCGGGG
CCGCCCCGTAGCAACAA1975
TTGTTGCTACGGGGCGG1976
Waxy starchCGGAGCCCGGCAGATGCGCCGCTCGGCATGAGGACTGTCGGAG1977
GBSSCGAGCGCCGCCCCGAAGTAACAAAGCCGGAAAGCGCACCGCGG
Aegilops speltoidesGACCCGGCGGTGCCTCTCGATGGTGGTGCGCGCCA
Gln53TermTGGCGCGCACCACCATCGAGAGGCACCGCCGGGTCCCGCGGTG1978
CAA-TAACGCTTTCCGGCTTTGTTACTTCGGGGCGGCGCTCGCTCCGACAGT
CCTCATGCCGAGCGGCGCATCTGCCGGGCTCCG
CCCCGAAGTAACAAAGC1979
GCTTTGTTACTTCGGGG1980
Waxy starchAGCCCGGCAGATGCGCCGCTCGGCATGAGGACTGTCGGAGCGAG1981
GBSSCGCCGCCCCGAAGCAATAAAGCCGGAAAGCGCACCGCGGGACCC
Aegilops speltoidesGGCGGTGCCTCTCGATGGTGGTGCGCGCCACCG
Gln54TermCGGTGGCGCGCACCACCATCGAGAGGCACCGCCGGGTCCCGCG1982
CAA-TAAGTGCGCTTTCCGGCTTTATTGCTTCGGGGCGGCGCTCGCTCCGAC
AGTCCTCATGCCGAGCGGCGCATCTGCCGGGCT
CGAAGCAATAAAGCCGG1983
CCGGCTTTATTGCTTCG1984
Waxy starchAGTGCAGAGATCTTCCACAGCAACAGCTAGACAACCACCATGTCG1985
GBSSGCTCTCACCACGTCCTAGCTCGCCACCTCGGCCACCGGCTTCGG
Oryza glaberrimaCATCGCTGACAGGTCGGCGCCGTCGTCGCTGC
Gln8TermGCAGCGACGACGGCGCCGACCTGTCAGCGATGCCGAAGCCGGT1986
GAG-TAGGGCCGAGGTGGCGAGCTAGGACGTGGTGAGAGCCGACATGGTG
GTTGTCTAGCTGTTGCTGTGGAAGATCTCTGCACT
CCACGTCCTAGCTCGCC1987
GGCGAGCTAGGACGTGG1988
Waxy starchTCCACAGCAACAGCTAGACAACCACCATGTCGGCTCTCACCACGT1989
GBSSCCCAGCTCGCCACCTAGGCCACCGGCTTCGGCATCGCTGACAGG
Oryza glaberrimaTCGGCGCCGTCGTCGCTGCTCCGCCACGGGTT
Ser12TermAACCCGTGGCGGAGCAGCGACGACGGCGCCGACCTGTCAGCGAT1990
TCG-TAGGCCGAAGCCGGTGGCCTAGGTGGCGAGCTGGGACGTGGTGAGA
GCCGACATGGTGGTTGTCTAGCTGTTGCTGTGGA
CGCCACCTAGGCCACCG1991
CGGTGGCCTAGGTGGCG1992
Waxy starchCGGCTCTCACCACGTCCCAGCTCGCCACCTCGGCCACCGGCTTC1993
GBSSGGCATCGCTGACAGGTAGGCGCCGTCGTCGCTGCTCCGCCACGG
Oryza glaberrimaGTTCCAGGGCCTCAAGCCCCGCAGCCCCGCCGG
Ser22TermCCGGCGGGGCTGCGGGGCTTGAGGCCCTGGAACCCGTGGCGGA1994
TCG-TAGGCAGCGACGACGGCGCCTACCTGTCAGCGATGCCGAAGCCGGTG
GCCGAGGTGGCGAGCTGGGACGTGGTGAGAGCCG
TGACAGGTAGGCGCCGT1995
ACGGCGCCTACCTGTCA1996
Waxy starchCCACGTCCCAGCTCGCCACCTCGGCCACCGGCTTCGGCATCGCT1997
GBSSGACAGGTCGGCGCCGTAGTCGCTGCTCCGCCACGGGTTCCAGGG
Oryza glaberrimaCCTCAAGCCCCGCAGCCCCGCCGGCGGCGACGC
Ser25TermGCGTCGCCGCCGGCGGGGCTGCGGGGCTTGAGGCCCTGGAACC1998
TCG-TAGCGTGGCGGAGCAGCGACTACGGCGCCGACCTGTCAGCGATGCCG
AAGCCGGTGGCCGAGGTGGCGAGCTGGGACGTGG
GGCGCCGTAGTCGCTGC1999
GCAGCGACTACGGCGCC2000
Waxy starchCGTCCCAGCTCGCCACCTCGGCCACCGGCTTCGGCATCGCTGAC2001
GBSSAGGTCGGCGCCGTCGTAGCTGCTCCGCCACGGGTTCCAGGGCCT
Oryza glaberrimaCAAGCCCCGCAGCCCCGCCGGCGGCGACGCGAC
Ser26TermGTCGCGTCGCCGCCGGCGGGGCTGCGGGGCTTGAGGCCCTGGA2002
TCG-TAGACCCGTGGCGGAGCAGCTACGACGGCGCCGACCTGTCAGCGATG
CCGAAGCCGGTGGCCGAGGTGGCGAGCTGGGACG
GCCGTCGTAGCTGCTCC2003
GGAGCAGCTACGACGGC2004
Waxy starchTCCACAGCAAGAGCTAAACAGCCGACCGTGTGCACCACCATGTCG2005
GBSSGCTGTCACCACGTCCTAGCTCGCCACCTCGGCCACCGGCTTCGG
Oryza sativaCATCGCCGACAGGTCGGCGCCGTCGTCGCTGG
Gln8TermGCAGCGACGACGGCGCCGACCTGTCGGCGATGCCGAAGCCGGT2006
CAG-TAGGGCCGAGGTGGCGAGCTAGGACGTGGTGAGAGCCGACATGGTG
GTGCACACGGTCGGCTGTTTAGCTCTTGCTGTGGA
CCACGTCCTAGCTCGCC2007
GGCGAGCTAGGACGTGG2008
Waxy starchCTAAACAGCCGACCGTGTGCACCACCATGTCGGCTCTCACCACGT2009
GBSSCCCAGCTCGCCACCTAGGCCACCGGCTTCGGCATCGCCGACAGG
Oryza sativaTCGGCGCCGTCGTCGCTGCTTCGCCACGGGTT
Ser12TermAACCCGTGGCGAAGCAGCGACGACGGCGCCGACCTGTCGGCGAT2010
TCG-TAGGCCGAAGCCGGTGGCCTAGGTGGCGAGCTGGGACGTGGTGAGA
GCCGACATGGTGGTGCACACGGTCGGCTGTTTAG
CGCCACCTAGGCCACCG2011
CGGTGGCCTAGGTGGCG2012
Waxy starchCGGCTCTCACCACGTCCCAGCTCGCCACCTCGGCCACCGGCTTC2013
GBSSGGCATCGCCGACAGGTAGGCGCCGTCGTCGCTGCTTCGCCACGG
Oryza sativaGTTCCAGGGCCTCAAGCCCCGTAGCCCAGCCGG
Ser22TermCCGGCTGGGCTACGGGGCTTGAGGCCCTGGAACCCGTGGCGAA2014
TCG-TAGGGAGCGACGACGGCGCCTACCTGTCGGCGATGCCGAAGCCGGTG
GCCGAGGTGGCGAGCTGGGACGTGGTGAGAGCCG
CGACAGGTAGGCGCCGT2015
ACGGCGCCTACCTGTCG2016
Waxy starchCCACGTCCCAGCTCGCCACCTCGGCCACCGGCTTCGGCATCGCC2017
GBSSGACAGGTCGGCGCCGTAGTCGCTGCTTCGCCACGGGTTCCAGGG
Oryza sativaCCTCAAGCCCCGTAGCCCAGCCGGCGGGGACGC
Ser25TermGCGTCCCCGCCGGCTGGGCTACGGGGCTTGAGGCCCTGGAACCC2018
TCG-TAGGTGGCGAAGCAGCGACTACGGCGCCGACCTGTCGGCGATGCCGA
AGCCGGTGGCCGAGGTGGCGAGCTGGGACGTGG
GGCGCCGTAGTCGCTGC2019
GCAGCGACTACGGCGCC2020
Waxy starchCGTCCCAGCTCGCCACCTCGGCCACCGGCTTCGGCATCGCCGAC2021
GBSSAGGTCGGCGCCGTCGTAGCTGCTTCGCCACGGGTTCCAGGGCCT
Oryza sativaCAAGCCCCGTAGCCCAGCCGGCGGGGACGCATC
Ser26TermGATGCGTCCCCGCCGGCTGGGCTACGGGGCTTGAGGCCCTGGAA2022
TCG-TAGCCCGTGGCGAAGCAGCTACGACGGCGCCGACCTGTCGGCGATGC
CGAAGCCGGTGGCCGAGGTGGCGAGCTGGGACG
GCCGTCGTAGCTGCTTC2023
GAAGCAGCTACGACGGC2024
Waxy starchGTCTCTCACTGCAGGTAGCCACACCCTGTGCGCGGCGCCATGGC2025
GBSSGGCTCTGGCCACGTCCTAGCTCGCCACCTCCGGCACCGTCCTCG
Hordeum vulgareGCGTCACCGACAGATTCCGGCGTCCAGGTTTTC
Gln8TermGAAAACCTGGACGCCGGAATCTGTCGGTGACGCCGAGGACGGTG2026
GAG-TAGCCGGAGGTGGCGAGCTAGGACGTGGCCAGAGCCGGCATGGCGC
CGCGCACAGGGTGTGGCTACCTGCAGTGAGAGAC
CCACGTCCTAGCTCGCC2027
GGCGAGCTAGGACGTGG2028
Waxy starchATGGCGGCTCTGGCCACGTCCCAGCTCGCCACGTCCGGCACCGT2029
GBSSCCTCGGCGTCACCGACTGATTCCGGCGTCCAGGTTTTGAGGGCCT
Hordeum vulgareCAGGCCCCGGAACCCGGCGGATGCGGCGCTTG
Arg21TermCAAGCGCGGCATCCGCCGGGTTCCGGGGCCTGAGGCCGTGAAAA2030
AGA-TGACCTGGACGCCGGAATCAGTCGGTGACGCCGAGGACGGTGCCGG
AGGTGGCGAGCTGGGACGTGGCCAGAGCCGCCAT
TCACCGACTGATTCCGG2031
CCGGAATCAGTCGGTGA2032
Waxy starchCAGCTCGCCACCTCCGGCACCGTCCTCGGCGTCACCGACAGATT2033
GBSSCCGGCGTCCAGGTTTTTAGGGCCTCAGGCCCCGGAACCCGGCGG
Hordeum vulgareATGCGGCGCTTGGTCTGAGGACTATCGGAGCAA
Gln28TermTTGCTCCGATAGTCCTCATACCAAGCGCCGCATCCGCCGGGTTCC2034
CAG-TAGGGGGCCTGAGGCCCTAAAAACCTGGACGCCGGAATCTGTCGGTG
ACGCCGAGGACGGTGCCGGAGGTGGCGAGCTG
CAGGTTTTTAGGGCCTC2035
GAGGCCCTAAAAACCTG2036
Waxy starchGGTTTTCAGGGCCTCAGGCCGCGGAACCCGGCGGATGCGGCGCT2037
GBSSTGGTATGAGGACTATCTGAGCAAGCGCCGCCCCGAAGCAAAGGC
Hordeum vulgareGGAAAGCGGACCGCGGGAGCCGGCGGTGCCTCT
Gly46TermAGAGGCACCGCCGGCTCCCGCGGTGCGCTTTCCGGCTTTGCTTC2038
GGA-TGAGGGGCGGCGCTTGCTCAGATAGTCCTCATACCAAGCGCCGCATC
CGCCGGGTTCCGGGGCCTGAGGCCCTGAAAACC
GGACTATCTGAGCAAGC2039
GCTTGCTCAGATAGTCC2040
Waxy starchCCCCGGAACCCGGCGGATGCGGCGCTTGGTATGAGGACTATCGG2041
GBSSAGCAAGCGCCGCCCCGTAGCAAAGCCGGAAAGCGCACCGCGGG
Hordeum vulgareAGCCGGCGGTGCCTCTCCGTGGTGGTGAGCGCCA
Lys52TermTGGCGCTCACCACCACGGAGAGGCACCGCCGGCTCCCGCGGTGC2042
AAG-TAGGCTTTGCGGCTTTGCTACGGGGCGGCGCTTGCTCCGATAGTCCTC
ATACCAAGCGCCGCATCCGCCGGGTTCCGGGG
CCGCCCCGTAGCAAAGC2043
GCTTTGCTACGGGGCGG2044
Waxy starchACGTCTTTTCTCTCTCTCCTACGCAGTGGATTAATCGGCATGGCGG2045
GBSSCTCTGGCCACGTCGTAGCTCGTCGCAACGCGGGCCGGCCTGGGC
Zea maysGTCCCGGACGCGTCCACGTTCCGCCGCGGCG
Gln8TermCGCCGCGGCGGAACGTGGACGCGTCCGGGACGCCCAGGCCGGC2046
GAG-TAGGCGCGTTGCGACGAGCTACGACGTGGCCAGAGCCGCCATGCCGA
TTAATCCACTGCGTAGGAGAGAGAGAAAAGACGT
CCACGTCGTAGCTCGTC2047
GACGAGCTACGACGTGG2048
Waxy starchGTCGCAACGCGCGCCGGCCTGGGCGTCCCGGACGCGTCCACGTT2049
GBSSCCGCCGCGGCGCCGCGTAGGGCCTGAGGGGGGCCCGGGCGTCG
Zea maysGCGGGGGCGGACACGCTCAGCATGCGGACCAGCG
Gln30TermCGCTGGTCCGCATGCTGAGCGTGTCCGCCGCCGCCGACGCCCGG2050
CAG-TAGGCCCCCCTCAGGCCCTACGCGGCGCCGCGGCGGAACGTGGACG
CGTCCGGGACGCCCAGGCCGGCGCGCGTTGCGAC
GCGCCGCGTAGGGCCTG2051
CAGGCCCTACGCGGCGC2052
Waxy starchTCCCGGACGCGTCCACGTTCCGCCGCGGCGCCGCGCAGGGCCT2053
GBSSGAGGGGGGCCCGGGCGTAGGCGGCGGCGGACACGCTCAGCATG
Zea maysCGGACCAGCGCGCGCGCGGCGCCCAGGCACCAGCA
Ser38TermTGCTGGTGCCTGGGCGCCGCGCGCGCGCTGGTCCGCATGCTGAG2054
TCG-TAGCGTGTCCGCCGCCGCCTACGCCCGGGCCCCCCTCAGGCCCTGCG
CGGCGCCGCGGCGGAACGTGGACGCGTCCGGGA
CCGGGCGTAGGCGGCGG2055
CCGCCGCCTACGCCCGG2056
Waxy starchGCGTCGGCGGCGGCGGACACGCTCAGCATGCGGACCAGCGCGC2057
GBSSGCGCGGCGCCCAGGCACTAGCAGCAGGCGCGCCGCGGGGGCAG
Zea maysGTTCCCGTCGCTCGTCGTGTGCGCCAGCGCCGGCA
Ser57TermTGCCGGCGCTGGCGCACACGACGAGCGACGGGAACCTGCCCCC2058
GAG-TAGGCGGCGCGCCTGCTGCTAGTGCCTGGGCGCCGCGCGCGCGCTG
GTCCGCATGCTGAGCGTGTCCGCCGCCGCCGACGC
CCAGGCACTAGCAGCAG2059
CTGCTGCTAGTGCCTGG2060
Waxy starchTCGGCGGCGGCGGACACGCTCAGCATGCGGACCAGCGCGCGCG2061
GBSSCGGCGCCCAGGCACCAGTAGCAGGCGCGCCGCGGGGGCAGGTT
Zea maysCCCGTCGCTCGTCGTGTGCGCCAGCGCCGGCATGA
Gln58TermTCATGCCGGGGCTGGCGCACACGACGAGCGACGGGAACCTGCCC2062
CAG-TAGCCGCGGCGCGCCTGCTACTGGTGCCTGGGCGCCGCGCGCGCGC
TGGTCCGCATGCTGAGCGTGTCCGCCGCCGCCGA
GGCACCAGTAGCAGGCG2063
CGCCTGCTACTGGTGCC2064

EXAMPLE 11

Altering Fatty Acid Content of Plants

[0143] Improved means to manipulate fatty acid compositions, from biosynthetic or natural plant sources, are needed. For example, oils containing reduced saturated fatty acids are desired for dietary reasons and oils containing increased saturated fatty acids are also needed as alternatives to current sources of highly saturated oil products, such as tropical oils or chemically hydrogenated oils. It would therefore be advantageous to influence directly the production and composition of fatty acids in crop plants.

[0144] Higher plants synthesize fatty acids, primarily palmitic, stearic and oleic acids, in the plastids (i.e., chloroplasts, proplastids, or other related organelles) as part of the Fatty Acid Synthase (FAS) complex. Fatty acid synthesis is the result of the three enzymatic activities: acyl-ACP elongase, acyl-ACP desaturase and acyl-ACP thioesterases specific for each of palmitoyl-, stearoyl- and oleoyl-ACP.

[0145] A variety of enzymes have been identified that influence the relative levels of saturated vs. unsaturated fatty acids in plants. For example, the enzymes stearoyl-acyl carrier protein (stearoyl-ACP) desaturase, oleoyl desaturase and linoleate desaturase produce unsaturated fatty acids from saturated precursors. Similarly, relative enzymatic activities of the various acyl-ACP thioesterases influences the relative acyl-chain composition of the resultant fatty acids. Consequently a reduction or an increase of the activity of these enzymes can alter the properties of oils produced in a plant. In fact, specific targeting of particular enzymatic activities can results in altered levels of particular fatty acids.

[0146] The attached tables disclose exemplary oligonucleotides base sequences which can be used to generate site-specific mutations in plant genes encoding proteins involved in fatty acid biosynthesis. 24

TABLE 22
Oligonucleotides to produce plants with reduced palmitate
Phenotype, Gene,
Plant & TargetedSEQ ID
AlterationAltering OligosNO:
Reduced palmitateTTTGGTGGCAGTGTCTTTGAACGCTTCATCTCCTCGTCATGGTGGC2065
Acyl-ACP-thioesteraseCACCTCTGCTACGTAGTCATTCTTTCCTGTACCATCTTCTTCACTTG
Arabidopsis thalianaATCCTAATGGAAAAGGCAATAAGATTGG
Ser8TermCCAATCTTATTGCCTTTTCCATTAGGATCAAGTGAAGAAGATGGTA2066
TCG-TAGCAGGAAAGAATGACTACGTCGCAGAGGTGGCCACCATGACGAGG
AGATGAAGCGTTCAAAGACACTGCCACCAAA
TGCTACGTAGTCATTCT2067
AGAATGACTACGTAGCA2068
Reduced palmitateGGTGGCAGTGTCTTTGAACGCTTCATCTCCTCGTCATGGTGGCCA2069
Acyl-ACP-thioesteraseCCTCTGCTACGTCGTGATTCTTTCCTGTACCATCTTCTTCACTTGAT
Arabidopsis thalianaCCTAATGGAAAAGGCAATAAGATTGGGTC
Ser9TermGACCCAATCTTATTGCCTTTTCCATTAGGATCAAGTGAAGAAGATG2070
TCA-TGAGTACAGGAAAGAATCACGACGTAGCAGAGGTGGCCACCATGACG
AGGAGATGAAGCGTTCAAAGACACTGCCACC
TACGTCGTGATTCTTTC2071
GAAAGAATCACGACGTA2072
Reduced palmitateATCTCCTCGTCATGGTGGCCACCTCTGCTACGTCGTCATTCTTTCC2073
Acyl-ACP-thioesteraseTGTACCATCTTCTTGACTTGATCCTAATGGAAAAGGCAATAAGATT
Arabidopsis thalianaGGGTCTACGAATCTTGCTGGACTCAATTC
Ser17TermGAATTGAGTCCAGCAAGATTCGTCGACCCAATCTTATTGCCTTTTC2074
TCA-TGACATTAGGATCAAGTCAAGAAGATGGTCCAGGAAAGAATGACGACG
TAGCAGAGGTGGCCACCATGACGAGGAGAT
ATCTTCTTGACTTGATC2075
GATCAAGTCAAGAAGAT2076
Reduced palmitateGTGGCCACCTCTGCTACGTCGTCATTCTTTCCTGTACCATCTTCTT2077
Acyl-AGP-thioesteraseCACTTGATCCTAATTGAAAAGGCAATAAGATTGGGTCTACGAATCT
Arabidopsis thalianaTGCTGGACTCAATTCTGCACCTAACTCTG
Gly22TermCAGAGTTAGGTGCAGAATTGAGTCCAGCAAGATTCGTCGACCCAA2078
GGA-TGATCTTATTGCCTTTTCAATTAGGATCAAGTGAAGAAGATGGTCCAGG
AAAGAATGACGACGTAGCAGAGGTGGCCAC
ATCCTAATTGAAAAGGC2079
GCCTTTTCAATTAGGAT2080
Reduced palmitateGCTTGAATTTGTGATCTGATTGGTTAATTGTGGCCACAATGGTTGC2081
Acyl-ACP-thioesteraseTACTGCCGCCACGTGATCATTCTTTCCGTTGACTTCCCCTTCTGGG
Garcinia mangostanaGATGCCAAATCGGGCAATCCCGGAAAAGG
Ser8TermCCTTTTCCGGGATTGCCCGATTTGGCATCCCCAGAAGGGGAAGTC2082
TCA-TGAAACGGAAAGAATGATCACGTGGCGGCAGTAGCAACCATTGTGGCC
ACAATTAACCAATCAGATCACAAATTCAAGC
CGCCACGTGATCATTCT2083
AGAATGATCACGTGGCG2084
Reduced palmitateTGAATTTGTGATCTGATTGGTTAATTGTGGCCACAATGGTTGCTAC2085
Acyl-ACP-thioesteraseTGCCGCCACGTCATGATTCTTTCCGTTGACTTCCCCTTCTGGGGAT
Garcinia mangostanaGCCAAATCGGGCAATCCCGGAAAAGGGTC
Ser9TermGACCCTTTTCCGGGATTGCCCGATTTGGCATCCCCAGAAGGGGAA2086
TCA-TGAGTCAACGGAAAGAATCATGACGTGGCGGCAGTAGCAACCATTGTG
GCCACAATTAACCAATCAGATCACAAATTCA
CACGTCATGATTCTTTC2087
GAAAGAATCATGACGTG2088
Reduced palmitateCTGATTGGTTAATTGTGGCCACAATGGTTGCTACTGCCGCCACGT2089
Acyl-ACP-thioesteraseCATCATTCTTTCCGTAGACTTCCCCTTCTGGGGATGCCAAATCGGG
Garcinia mangostanaCAATCCCGGAAAAGGGTCGGTGAGTTTTGG
Leu13TermCCAAAACTCACCGACCCTTTTCCGGGATTGCCCGATTTGGCATCC2090
TTG-TAGCCAGAAGGGGAAGTCTACGGAAAGAATGATGACGTGGCGGCAGT
AGCAACCATTGTGGCCACAATTAACCAATCAG
CTTTCCGTAGACTTCCC2091
GGGAAGTCTACGGAAAG2092
Reduced palmitateATGGTTGCTACTGCCGCCACGTCATCATTCTTTCCGTTGACTTCCC2093
Acyl-ACP-thioesteraseCTTCTGGGGATGCCTAATCGGGCAATCCCGGAAAAGGGTCGGTG
Garcinia mangostanaAGTTTTGGGTCAATGAAGTCGAAATCCGCGG
Lys21TermCCGCGGATTTCGACTTCATTGACCCAAAACTCACCGACCCTTTTCC2094
AAA-TAAGGGATTGCCCGATTAGGCATCCCCAGAAGGGGAAGTCAACGGAA
AGAATGATGACGTGGCGGCAGTCGCAACCAT
GGGATGCCTAATCGGGC2095
GCCCGATTAGGCATCCC2096
Reduced palmitateGGGATTTCAGCACGAAATTGAAGTTGTTTTTAAAAACCATGGTTGC2097
Acyl-ACP-thioesteraseTACTGCTGTGACATAGGCGTTTTTCCCAGTCACTTCTTCACCTGAC
Gossypium hirsutumTCCTCTGACTCGAAAAACAAGAAGCTCGG
Ser8TermCCGAGCTTCTTGTTTTTCGAGTCAGAGGAGTCAGGTGAAGAAGTG2098
TCG-TAGACTGGGAAAAACGCCTATGTCACAGCAGTAGCAACCATGGTTTTTA
AAAACAACTTCAATTTCGTGCTGAAATCCC
TGTGACATAGGCGTTTT2099
AAAACGCCTATGTCACA2100
Reduced palmitateTGTTTTTAAAAACCATGGTTGCTACTGCTGTGACATCGGCGTTTTT2101
Acyl-ACP-thioesteraseCCCAGTCACTTCTTGACCTGACTCCTCTGACTCGAAAAACAAGAAG
Gossypium hirsutumCTCGGAAGCATCAAGTCGAAGCCATCGGT
Ser16TermACCGATGGCTTCGACTTGATGCTTCCGAGCTTCTTGTTTTTCGAGT2102
TCA-TGACAGAGGAGTCAGGTCAAGAAGTGACTGGGAAAAACGCCGATGTCA
CAGCAGTAGCAACCATGGTTTTTAAAAACA
CACTTCTTGACCTGACT2103
AGTCAGGTCAAGAAGTG2104
Reduced palmitateTTGCTACTGCTGTGACATCGGCGTTTTTCCCAGTCACTTCTTCACC2105
Acyl-ACP-thioesteraseTGACTCCTCTGACTAGAAAAACAAGAAGCTCGGAAGCATCAAGTC
Gossypium hirsutumGAAGCCATCGGTTTCTTCTGGAAGTTTGCA
Ser22TermTGCAAACTTCCAGAAGAAACCGATGGCTTCGACTTGATGCTTCCG2106
TCG-TAGAGCTTCTTGTTTTTCTAGTCAGAGGAGTCAGGTGAAGAAGTGACTG
GGAAAAACGCCGATGTCACAGCAGTCGCAA
CTCTGACTAGAAAAACA2107
TGTTTTTCTAGTCAGAG2108
Reduced palmitateGCTACTGCTGTGACATCGGCGTTTTTCCCAGTCACTTCTTCACCTG2109
Acyl-ACP-thioesteraseACTCCTCTGACTCGTAAAACAAGAAGCTCGGAAGCATCAAGTCGA
Gossypium hirsutumAGCCATCGGTTTGTTCTGGAAGTTTGCAAG
Lys23TermCTTGCAAACTTCCAGAAGAAACCGATGGCTTCGACTTGATGCTTCC2110
AAA-TAAGAGCTTCTTGTTTTACGAGTCAGAGGAGTCAGGTGAAGAAGTGAC
TGGGAAAAACGCCGATGTCACAGCAGTAGC
CTGACTCGTAAAACAAG2111
CTTGTTTTAGGAGTCAG2112
Reduced palmitateCTCCCGCTCGTTGAAAGACAATGGTGGCTACCGCTGCAAGCTCTG2113
Acyl-ACP-thioesteraseCATTCTTCCCCGTGTAGTCCCCGGTCACCTCCTCTAGACCAGGAA
Cuphea hookerianaAGCCCGGAAATGGGTCATCGAGCTTCAGCCC
Ser14TermGGGCTGAAGCTCGATGACCCATTTCCGGGCTTTCCTGGTCTAGAG2114
TCG-TAGGAGGTGACCGGGGACTACACGGGGAAGAATGCAGAGCTTGCAGC
GGTAGCCACCATTGTCTTTCAACGAGCGGGAG
CCCCGTGTAGTCCCCGG2115
CCGGGGACTACACGGGG2116
Reduced palmitateATGGTGGCTACCGCTGCAAGCTCTGCATTCTTCCCCGTGTCGTCC2117
Acyl-ACP-thioesteraseCCGGTCACCTCCTCTTGACCAGGAAAGCCCGGAAATGGGTCATCG
Cuphea hookerianaAGCTTCAGCCCCATCAAGCCCAAATTTGTCG
Arg21TermCGACAAATTTGGGCTTGATGGGGCTGAAGCTCGATGACCCATTTC2118
AGA-TGACGGGCTTTCCTGGTCAAGAGGAGGTGACCGGGGACGACACGGG
GAAGAATGCAGAGCTTGCAGCGGTAGCCACCAT
CCTCCTCTTGACCAGGA2119
TCCTGGTCAAGAGGAGG2120
Reduced palmitateGCTACCGCTGCAAGCTCTGCATTCTTCCCCGTGTCGTCCCCGGTC2121
Acyl-ACP-thioesteraseACCTCCTCTAGACCATGAAAGCCCGGAAATGGGTCATCGAGCTTC
Cuphea hookerianaAGCCCCATCAAGCCCAAATTTGTCGCCAATG
Gly23TermCATTGGCGACAAATTTGGGCTTGATGGGGCTGAAGCTCGATGACC2122
GGA-TGACATTTCCGGGCTTTCATGGTCTAGAGGAGGTGACCGGGGACGAC
ACGGGGAAGAATGCAGAGCTTGCAGCGGTAGC
CTAGACCATGAAAGCCC2123
GGGCTTTCATGGTCTAG2124
Reduced palmitateACCGCTGCAAGCTCTGCATTCTTCCCCGTGTCGTCCCCGGTCACC2125
Acyl-ACP-thioesteraseTCCTCTAGACCAGGATAGCCCGGAAATGGGTCATGGAGCTTCAGC
Cuphea hookerianaCCCATCAAGCCCAAATTTGTCGCCAATGGCG
Lys24TermCGCCATTGGCGACAAATTTGGGCTTGATGGGGCTGAAGCTCGATG2126
AAG-TAGACCCATTTCCGGGCTATCCTGGTCTAGAGGAGGTGACCGGGGAC
GACACGGGGAAGAATGCAGAGCTTGCAGCGGT
GACCAGGATAGCCCGGA2127
TCCGGGCTATCCTGGTC2128
Reduced palmitateGCCACCGCTGCAAGTTCTGCATTCTTCCCCCTGCCGTCCCCGGAC2129
Acyl-ACP-thioesteraseACCTCCTCTAGGCCGTGAAAGCTGGGAAATGGGTCATCGAGCTTG
Cuphea lanceolataAGCCCCCTCAAGCCCAAATTTGTCGCCAATG
Gly23TermCATTGGCGACAAATTTGGGCTTGAGGGGGCTCAAGCTCGATGACC2130
GGA-TGACATTTCCGAGCTTTCACGGCCTAGAGGAGGTGTCCGGGGACGGC
AGGGGGAAGAATGCAGAACTTGCAGCGGTGGC
CTAGGCCGTGAAAGCTC2131
GAGCTTTCACGGCCTAG2132
Reduced palmitateACCGCTGCAAGTTCTGCATTCTTCCCCCTGCCGTCCCCGGACACC2133
Acyl-ACP-thioesteraseTCCTCTAGGCCGGGATAGCTCGGAAATGGGTCATCGAGCTTGAGC
Cuphea lanceolataCCCCTCAAGCCCAAATTTGTCGCCAATGCCG
Lys24TermCGGCATTGGCGACAAATTTGGGCTTGAGGGGGCTCAAGCTCGAT2134
AAG-TAGGACCCATTTCCGAGCTATCCCGGCCTAGAGGAGGTGTCCGGGGA
CGGCAGGGGGAAGAATGCAGAACTTGCAGCGGT
GGCCGGGATAGCTCGGA2135
TCCGAGCTATCCCGGCC2136
Reduced palmitateGCAAGTTCTGCATTCTTCCCCCTGCCGTCCCCGGACACCTCCTCT2137
Acyl-ACP-thioesteraseAGGCCGGGAAAGCTCTGAAATGGGTCATCGAGCTTGAGCCCCCT
Cuphea lanceolataCAAGCCCAAATTTGTCGCCAATGCCGGGTTGA
Gly26TermTCAACCCGGCATTGGCGACAAATTTGGGGTTGAGGGGGCTCAAGC2138
GGA-TGATCGATGACCCATTTCAGAGCTTTCCCGGCCTAGAGGAGGTGTCCG
GGGACGGCAGGGGGAAGAATGCAGAACTTGC
GAAAGCTCTGAAATGGG2139
CCCATTTCAGAGCTTTC2140
Reduced palmitateCATTCTTCCCCCTGCCGTCCCCGGACACCTCCTCTAGGCCGGGAA2141
Acyl-ACP-thioesteraseAGCTCGGAAATGGGTGATCGAGCTTGAGCCCCCTCAAGCCCAAAT
Cuphea lanceolataTTGTCGCCAATGCCGGGTTGAAGGTTAAGGC
Ser29TermGCCTTAACCTTCAACCCGGCATTGGCGACAAATTTGGGCTTGAGG2142
TCA-TGAGGGCTCAAGCTCGATCACCCATTTCCGAGCTTTCCCGGCCTAGAG
GAGGTGTCCGGGGACGGCAGGGGGAAGAATG
AAATGGGTGATCGAGCT2143
AGCTCGATCACCCATTT2144
Reduced palmitateCGTTTAAGTGGATCGGACATTTAAGTGTTTTAATCATGGTAGCTAT2145
Acyl-ACP-thioesteraseGAGTGCTACTGCGTAGCTGTTTCCGGTTTCTTCCCCAAAACCTCAC
Helianthus annuusTCTGGAGCCAAGACATCTGATAAGCTTGG
Ser9TermCCAAGCTTATCAGATGTCTTGGCTCCAGAGTGAGGTTTTGGGGAA2146
TCG-TAGGAAACCGGAAACAGCTACGCAGTCGCACTCATAGCTACCATGATT
AAAACACTTAAATGTCCGATCCACTTAAACG
TACTGCGTAGCTGTTTC2147
GAAACAGCTACGCAGTA2148
Reduced palmitateAGTGTTTTAATCATGGTCGCTATGAGTGCTACTGCGTCGCTGTTTC2149
Acyl-ACP-thioesteraseCGGTTTCTTCCCCATAACCTCACTCTGGAGCCAAGACATCTGATAA
Helianthus annuusGCTTGGAGGTGAACCAGGTAGTGTTGCTG
Lys17TermCAGCAACACTACCTGGTTCACCTCCAAGCTTATCAGATGTCTTGGC2150
AAA-TAATCCAGAGTGAGGTTATGGGGAAGAAACCGGAAACAGCGACGCAG
TAGCACTCATAGCTACCATGATTAAAACACT
CTTCCCCATAACCTCAC2151
GTGAGGTTATGGGGAAG2152
Reduced palmitateATGGTAGCTATGAGTGCTACTGCGTCGCTGTTTCCGGTTTCTTCCC2153
Acyl-ACP-thioesteraseCAAAACCTCACTCTTGAGCCAAGACATCTGATAAGCTTGGAGGTG
Helianthus annuusAACCAGGTAGTGTTGCTGTGCGCGGAATCA
Gly21TermTGATTCCGCGCACAGCAACACTACCTGGTTCACCTCCAAGCTTATC2154
GGA-TGAAGATGTCTTGGCTCAAGAGTGAGGTTTTGGGGAAGAAACCGGAAA
CAGCGACGCAGTAGCACTCATAGCTACCAT
CTCACTCTTGAGCCAAG2155
CTTGGCTCAAGAGTGAG2156
Reduced palmitateGCTATGAGTGCTACTGCGTCGCTGTTTCCGGTTTCTTCCCCAAAAC2157
Acyl-ACP-thioesteraseCTCACTCTGGAGCCTAGACATCTGATAAGCTTGGAGGTGAACCAG
Helianthus annuusGTAGTGTTGCTGTGCGCGGAATCAAGACAA
Lys23TermTTGTCTTGATTCCGCGCACAGCAACACTACCTGGTTCACCTCCAAG2158
AAG-TAGCTTATCAGATGTCTAGGCTCCAGAGTGAGGTTTTGGGGAAGAAAC
CGGAAACAGCGACGCAGTCGCACTCATAGC
CTGGAGCCTAGACATCT2159
AGATGTCTAGGCTCCAG2160
Reduced palmitateATGGTGGCTGCTGCAGCAAGTTCTGCATGCTTCCCTGTTCCATCC2161
Acyl-ACP-thioesteraseCCAGGAGCCTCCCCTTAACCTGGGAAGTTAGGCAACTGGTCATCG
Cuphea palustrisAGTTTGAGCCCTTCCTTGAAGCCCAAGTCAA
Lys21TermTTGACTTGGGCTTCAAGGAAGGGCTCAAACTCGATGACCAGTTGC2162
AAA-TAACTAACTTCCCAGGTTAAGGGGAGGCTCCTGGGGATGGAACAGGG
AAGCATGCAGAACTTGCTGCAGCAGCCACCAT
CCTCCCCTTAACCTGGG2163
CCCAGGTTAAGGGGAGG2164
Reduced palmitateGCTGCAGCAAGTTCTGCATGCTTCCCTGTTCCATCCCCAGGAGCC2165
Acyl-ACP-thioesteraseTCCCCTAAACCTGGGTAGTTAGGCAACTGGTCATCGAGTTTGAGC
Cuphea palustrisCCTTCCTTGAAGCCCAAGTCAATCCCCAATG
Lys24TermCATTGGGGATTGACTTGGGCTTCAAGGAAGGGCTCAAACTCGATG2166
AAG-TAGACCAGTTGCCTAACTACCCAGGTTTAGGGGAGGCTCCTGGGGATG
GAACAGGGAAGCATGCAGAACTTGCTGCAGC
AACCTGGGTAGTTAGGC2167
GCCTAACTACCCAGGTT2168
Reduced palmitateTGCATGCTTCCCTGTTCCATCCCCAGGAGCCTCCCCTAAACCTGG2169
Acyl-ACP-thioesteraseGAAGTTAGGCAACTGATCATCGAGTTTGAGCCCTTCCTTGAAGCC
Cuphea palustrisCAAGTCAATCCCCAATGGCGGATTTCAGGTT
Trp28TermAACCTGAAATCCGCCATTGGGGATTGACTTGGGCTTCAAGGAAGG2170
TGG-TGAGCTCAAACTCGATGATCAGTTGCCTAACTTCCCAGGTTTAGGGGA
GGCTCCTGGGGATGGAACAGGGAAGCATGCA
GGCAACTGATCATCGAG2171
CTCGATGATCAGTTGCC2172
Reduced palmitateCATGCTTCCCTGTTCCATCCCCAGGAGCCTCCCCTAAACCTGGGA2173
Acyl-ACP-thioesteraseAGTTAGGCAACTGGTGATCGAGTTTGAGCCCTTCCTTGAAGCCCA
Cuphea palustrisAGTCAATCCCCAATGGCGGATTTCAGGTTAA
Ser29TermTTAACCTGAAATCCGCCATTGGGGATTGACTTGGGCTTCAAGGAA2174
TCA-TGAGGGCTCAAACTCGATCACCAGTTGCCTAACTTCCCAGGTTTAGGG
GAGGCTCCTGGGGATGGAACAGGGAAGCATG
CAACTGGTGATCGAGTT2175
AACTCGATCACCAGTTG2176
Reduced paimitateATGGTGGCTGCCGCAGCAAGTTCTGCATTCTTCTCCGTTCCAACC2175
Acyl-ACP-thioesteraseCCGGGAATCTCCCCTTAACCCGGGAAGTTCGGTAATGGTGGCTTT
Cuphea hookerianaCAGGTTAAGGCAAACGCCAATGCCCATCCTA
Lys21TermTAGGATGGGCATTGGCGTTTGCCTTAACCTGAAAGCCACCATTAC2178
AAA-TAACGAACTTCCCGGGTTAAGGGGAGATTCCCGGGGTTGGAACGGAG
AAGAATGCAGAACTTGCTGCGGCAGCCACCAT
TCTCCCCTTAACCCGGG2179
CCCGGGTTAAGGGGAGA2180
Reduced palmitateGCCGCAGCAAGTTCTGCATTCTTCTCCGTTCCAACCCCGGGAATC2181
Acyl-ACP-thioesteraseTCCCCTAAACCCGGGTAGTTCGGTAATGGTGGCTTTCAGGTTAAG
Cuphea hookerianaGCAAACGCCAATGCCCATCCTAGTCTAAAGT
Lys24TermACTTTAGACTAGGATGGGCATTGGCGTTTGCCTTAACCTGAAAGC2182
AAG-TAGCACCATTACCGAACTACCCGGGTTTAGGGGAGATTCCCGGGGTTG
GAACGGAGAAGAATGCAGAACTTGCTGCGGC
AACCCGGGTAGTTCGGT2183
ACCGAACTACCCGGGTT2184
Reduced palmitateTTCTCCGTTCCAACCCCGGGAATCTCCCCTAAACCCGGGAAGTTC2185
Acyl-ACP-thioesteraseGGTAATGGTGGCTTTTAGGTTAAGGCAAACGCCAATGCCCATCCT
Cuphea hookerianaAGTCTAAAGTCTGGCAGCCTCGAGACTGAAG
Gln31TermCTTCAGTCTCGAGGCTGCCAGACTTTAGACTAGGATGGGCATTGG2186
CAG-TAGCGTTTGCCTTAACCTAAAAGCCACCATTACCGAACTTCCCGGGTTT
AGGGGAGATTCCCGGGGTTGGAACGGAGAA
GTGGCTTTTAGGTTAAG2187
CTTAACCTAAAAGCCAC2188
Reduced palmitateGTTCCAACCCCGGGAATCTCCCCTAAACCCGGGAAGTTCGGTAAT2189
Acyl-ACP-thioesteraseGGTGGCTTTCAGGTTTAGGCAAACGCCAATGCCCATCCTAGTCTA
Cuphea hookerianaAAGTCTGGCAGCCTCGAGACTGAAGATGACA
Lys33TermTGTCATCTTCAGTCTCGAGGCTGCCAGACTTTAGACTAGGATGGG2190
AAG-TAGCATTGGCGTTTGCCTAAACCTGAAAGCCACCATTACCGAACTTCCC
GGGTTTAGGGGAGATTCCCGGGGTTGGAAC
TTCAGGTTTAGGCAAAC2191
GTTTGCCTAAACCTGAA2192
Reduced palmitateATGTTGAAGCTCTCGTGTAATGCGACTGATAAGTTACAGACCCTCT2193
Acyl-ACP-thioesteraseTCTCGCATTCTCATTAACCGGATCCGGCACACCGGAGAACCGTCT
Brassica rapaCCTCCGTGTCGTGCTCTCATCTGAGGAAAC
Gln21TermGTTTCCTCAGATGAGAGCACGACACGGAGGAGACGGTTCTCCGGT2194
CAA-TAAGTGCCGGATCCGGTTAATGAGAATGCGAGAAGAGGGTCTGTAACT
TATCAGTCGCATTACACGAGAGCTTCAACAT
ATTCTCATTAACCGGAT2195
ATCCGGTTAATGAGAAT2196
Reduced palmitateGCGACTGATAAGTTACAGACCCTCTTCTCGCATTCTCATCAACCGG2197
Acyl-ACP-thioesteraseATCCGGCACACCGGTGAACCGTCTCCTCCGTGTCGTGCTCTCATC
Brassica rapaTGAGGAAACCGGTTCTCGATCCTTTGCGAG
Arg28TermCTCGCAAAGGATCGAGAACCGGTTTCCTCAGATGAGAGCACGACA2198
AGA-TGACGGAGGAGACGGTTCACCGGTGTGCCGGATCCGGTTGATGAGAA
TGCGAGAAGAGGGTCTGTAACTTATCAGTCGC
CACACCGGTGAACCGTC2199
GACGGTTCACCGGTGTG2200
Reduced palmitateCCCTCTTCTCGCATTCTCATCAACCGGATCCGGCACACCGGAGAA2201
Acyl-ACP-thioesteraseCCGTCTCCTCCGTGTAGTGCTCTCATCTGAGGAAACCGGTTCTCG
Brassica rapaATCCTTTGCGAGCGATCGTATCTGCTGATCA
Ser24TermTGATCAGCAGATACGATCGCTCGCAAAGGATCGAGAACCGGTTTC2202
TCG-TAGCTCAGATGAGAGCACTACACGGAGGAGACGGTTCTCCGGTGTGC
CGGATCCGGTTGATGAGAATGCGAGAAGAGGG
CTCCGTGTAGTGCTCTC2203
GAGAGCACTACACGGAG2204
Reduced palmitateCTTCTCGCATTCTCATCAACCGGATCCGGCACACCGGAGAACCGT2205
Acyl-ACP-thioesteraseCTCCTCCGTGTCGTGATCTCATCTGAGGAAACCGGTTCTCGATCC
Brassica rapaTTTGCGAGCGATCGTATCTGCTGATCAAGGA
Cys25TermTCCTTGATCAGCAGATACGATCGCTCGCAAAGGATCGAGAACCGG2206
TGC-TGATTTCCTCAGATGAGATCACGACACGGAGGAGACGGTTCTCCGGTG
TGCCGGATCCGGTTGATGAGAATGCGAGAAG
GTGTCGTGATCTCATCT2207
AGATGAGATCACGACAC2208
Reduced palmitateATTCTTCTTCTATAAACCAAAACCTCAGGAACCATAAAAAAAAAAGG2209
Acyl-ACP-thioesteraseGCATCAAAAATGTAGAAGCTTTCGTGTAATGTGACTAACAACTTAC
Brassica napusACACCTTCTCCTTCTTCTCCGATTCCTC
Leu2TermGAGGAATCGGAGAAGAAGGAGAAGGTGTGTAAGTTGTTAGTCACA2210
TTG-TAGTTACACGAAAGCTTCTACATTTTTGATGCCCTTTTTTTTTTATGGTTC
CTGAGGTTTTGGTTTATAGAAGAAGAAT
AAAAATGTAGAAGCTTT2211
AAAGCTTCTACATTTTT2212
Reduced palmitateTCTTCTTCTATAAACCAAAACCTCAGGAACCATAAAAAAAAAAGGG2213
Acyl-ACP-thioesteraseCATCAAAAATGTTGTAGCTTTCGTGTAATGTGACTAACAACTTACAC
Brassica napusACCTTCTCCTTCTTCTCCGATTCCTCCC
Lys3TermGGGAGGAATCGGAGAAGAAGGAGAAGGTGTGTAAGTTGTTAGTCA2214
AAG-TAGCATTACACGAAAGCTACAACATTTTTGATGCCCTTTTTTTTTTATGG
TTCCTGAGGTTTTGGTTTATAGAAGAAGA
AAATGTTGTAGCTTTCG2215
CGAAAGCTACAACATTT2216
Reduced palmitateCTATAAACCAAAACCTCAGGAACCATAAAAAAAAAAGGGCATCAAA2217
Acyl-ACP-thioesteraseAATGTTGAAGCTTTAGTGTAATGTGACTAACAACTTACACACCTTCT
Brassica napusCCTTCTTCTCCGATTCCTCCCTTTTCAT
Ser5TermATGAAAAGGGAGGAATCGGAGAAGAAGGAGAAGGTGTGTAAGTT2218
TCG-TAGGTTAGTCACATTACACTAAAGCTTCAACATTTTTGATGCCCTTTTTT
TTTTATGGTTCCTGAGGTTTTGGTTTATAG
GAAGCTTTAGTGTAATG2219
CATTACACTAAAGCTTC2220
Reduced palmitateAAACCAAAACCTCAGGAACCATAAAAAAAAAAGGGCATCAAAAATG2221
Acyl-ACP-thioesteraseTTGAAGCTTTCGTGAAATGTGACTAACAACTTACACACCTTCTCCTT
Brassica napusCTTCTCCGATTCCTCCCTTTTCATCCCG
Cys6TermCGGGATGAAAAGGGAGGAATCGGAGAAGAAGGAGAAGGTGTGTA2222
TGT-TGAAGTTGTTAGTCACATTTCACGAAAGCTTCAACATTTTTGATGCCCTT
TTTTTTTTATGGTTCCTGAGGTTTTGGTTT
CTTTCGTGAAATGTGAC2223
GTCACATTTCACGAAAG2224

[0147] 25

TABLE 23
Oligonucleotides to produce plants with increased stearate
Phenotype, Gene,
Plant & TargetedSEQ ID
AlterationAltering OligosNO:
Increased stearateGGGAGAGCTCTAGCTCTGTAGAAAAGAAGGATTCATTCATCATATC2225
stearoyl-ACPCAGAAATGGCTCTATAGTTTAACCCTTTGGTGGCATCTCAGCCTTA
desaturaseCAAATTCCCTTCCTCGACTCGTCCGCCAA
Arabidopsis thalianaTTGGCGGACGAGTCGAGGAAGGGAATTTGTAAGGCTGAGATGCC2226
Lys4 TermACCAAAGGGTTAAACTATAGAGCCATTTCTGGATATGATGAATGAA
AAG-TAGTCCTTCTTTTCTACAGAGCTAGAGCTCTCCC
TGGCTCTATAGTTTAAC2227
GTTAAACTATAGAGCCA2228
Increased stearateCTCTGTAGAAAAGAAGGATTCATTCATCATATCCAGAAATGGCTCT2229
stearoyl-ACPAAAGTTTAACCCTTAGGTGGCATCTCAGCCTTACAAATTCCCTTCC
desaturaseTCGACTCGTCCGCCAACTCCTCTTTCAG
Arabidopsis thalianaCTGAAAGAAGGAGTTGGCGGACGAGTCGAGGAAGGGAATTTGTA2230
Leu8 TermAGGCTGAGATGCCACCTAAGGGTTAAACTTTAGAGCCATTTCTGG
TTG-TAGATATGATGAATGAATCCTTCTTTTCTACAGAG
TAACCCTTAGGTGGCAT2231
ATGCCACCTAAGGGTTA2232
Increased stearateAGAAGGATTCATTCATCATATCCAGAAATGGCTCTAAAGTTTAACC2233
stearoyl-ACPCTTTGGTGGCATCTTAGCCTTACAAATTCCCTTCCTCGACTCGTCC
desaturaseGCCAACTCCTTCTTTCAGATCTCCCAAGT
Arabidopsis thalianaACTTGGGAGATCTGAAAGAAGGAGTTGGCGGACGAGTCGAGGAA2234
Gln12 TermGGGAATTTGTAAGGCTAAGATGCCACCAAAGGGTTAAACTTTAGA
CAG-TAGGCCATTTCTGGATATGATGAATGAATCCTTCT
TGGCATCTTAGCCTTAC2235
GTAAGGCTAAGATGCCA2236
Increased stearateTCATTCATCATATCCAGAAATGGCTCTAAAGTTTAACCCTTTGGTG2237
stearoyl-ACPGCATCTCAGCCTTAGAAATTCCCTTCCTCGACTCGTCCGCCAACTC
desaturaseCTTCTTTCAGATCTCCCAAGTTCCTCTGC
Arabidopsis thalianaGCAGAGGAACTTGGGAGATCTGAAAGAAGGAGTTGGCGGACGAG2238
Phe14 TermTCGAGGAAGGGAATTTCTAAGGCTGAGATGCCACCAAAGGGTTAA
TAC-TAGACTTTAGAGCCATTTCTGGATATGATGAATGA
CAGCCTTAGAAATTCCC2239
GGGAATTTCTAAGGCTG2240
Increased stearateGAGAGCTCGCTCGTGTCTGAAAGAACATCAAACCTCGTATCAAAAA2241
stearoyl-ACPAAAGAAAATGGCATAGAAGCTTAACCCTTTGGCATCTCAGCCTTAC
desaturaseAAACTCCCTTCCTCGGCTCGTCCGCCAAT
Brassica napusATTGGCGGACGAGCCGAGGAAGGGAGTTTGTAAGGCTGAGATGC2242
Leu3 TermCAAAGGGTTAAGCTTCTATGCCATTTTCTTTTTTTTGATACGAGGTT
TTG-TAGTGATGTTCTTTCAGACACGAGCGAGCTCTC
AATGGCATAGAAGCTTA2243
TAAGCTTCTATGCCATT2244
Increased stearateGAGCTCGCTCGTGTCTGAAAGAACATCAAACCTCGTATCAAAAAAA2245
stearoyl-ACPAGAAAATGGCATTGTAGCTTAACCCTTTGGCATCTCAGCCTTACAA
desaturaseACTCCCTTCCTCGGCTCGTCCGCCAATCT
Brassica napusAGATTGGCGGACGAGCCGAGGAAGGGAGTTTGTAAGGCTGAGAT2246
Lys4 TermGCCAAAGGGTTAAGCTACAATGCCATTTTCTTTTTTTTGATACGAG
AAG-TAGGTTTGATGTTCTTTCAGACACGAGCGAGCTC
TGGCATTGTAGCTTAAC2247
GTTAAGCTACAATGCCA2248
Increased stearateTCTGAAAGAACATCAAACCTCGTATCAAAAAAAAGAAAATGGCATT2249
stearoyl-ACPGAAGCTTAACCCTTAGGCATCTCAGCCTTACAAACTCCCTTCCTCG
desaturaseGCTCGTCCGCCAATCTCTACTCTCAGATC
Brassica napusGATCTGAGAGTAGAGATTGGCGGACGAGCCGAGGAAGGGAGTTT2250
Leu8 TermGTAAGGCTGAGATGCCTAAGGGTTAAGCTTCAATGCCATTTTCTTT
TTG-TAGTTTTTGATACGAGGTTTGATGTTCTTTCAGA
TAACCCTTAGGCATCTC2251
GAGATGCCTAAGGGTTA2252
Increased stearateAACATCAAACCTCGTATCAAAAAAAAGAAAATGGCATTGAAGCTTA2253
stearoyl-ACPACCCTTTGGCATCTTAGCCTTACAAACTCCCTTCCTCGGCTCGTCC
desaturaseGCCAATCTCTACTCTCAGATCTCCCAAGT
Brassica napusACTTGGGAGATCTGAGAGTAGAGATTGGCGGACGAGCCGAGGAA2254
Gln11 TermGGGAGTTTGTAAGGCTAAGATGCCAAAGGGTTAAGCTTCAATGCC
CAG-TAGATTTTCTTTTTTTTGATACGAGGTTTGATGTT
TGGCATCTTAGCCTTAC2255
GTAAGGCTAAGATGCCA2256
Increased stearateAACCAAAAGAAAAGGTAAGAAAAAAAACAATGGCTCTCAAGCTCA2257
stearoyl-ACPATCCTTTCCTTTCTTAAACCCAAAAGTTACCTTCTTTCGCTCTTCCA
desaturaseCCAATGGCCAGTACCAGATCTCCTAAGT
Ricinus communisACTTAGGAGATCTGGTACTGGCCATTGGTGGAAGAGCGAAAGAAG2258
Gln27 TermGTAACTTTTGGGTTTAAGAAAGGATTGAGCTTGAGAGCCAT
CAA-TAATGTTTTTTTTCTTACCTTTTTCTTTTGGTT
TCCTTTCTTAAACCCAA2259
TTGGGTTTAAGAAAGGA2260
Increased stearateAAGAAAAAGGTAAGAAAAAAAACAATGGCTCTCAAGCTCAATCCTT2261
stearoyl-ACPTCCTTTCTCAAACCTAAAAGTTACCTTCTTTCGCTCTTCCACCAATG
desaturaseGCCAGTACCAGATCTCCTAAGTTCTACA
Ricinus communisTGTAGAACTTAGGAGATCTGGTACTGGCCATTGGTGGAAGAGCGA2262
Gln29 TermAAGAAGGTAACTTTTAGGTTTGAGAAAGGAAAGGATTGAGCTTGA
CAA-TAAGAGCCATTGTTTTTTTTCTTACCTTTTTCTT
CTCAAACCTAAAAGTTA2263
TAACTTTTAGGTTTGAG2264
Increased stearateAAAAAGGTAAGAAAAAAAACAATGGCTCTCAAGCTCAATCCTTTCC2265
stearoyl-ACPTTTCTCAAACCCAATAGTTACCTTCTTTCGCTCTTCCACCAATGGCC
desaturaseAGTACCAGATCTCCTAAGTTCTACATGG
Ricinus communisCCATGTAGAACTTAGGAGATCTGGTACTGGCCATTGGTGGAAGAG2266
Lys30 TermCGAAAGAAGGTAACTATTGGGTTTGAGAAAGGAAAGGATTGAGCT
AAG-TAGTGAGAGCCATTGTTTTTTTTCTTACCTTTTT
AAACCCAATAGTTACCT2267
AGGTAACTATTGGGTTT2268
Increased stearateTCTCAAACCCAAAAGTTACCTTCTTTCGCTCTTCCACCAATGGCCA2269
stearoyl-ACPGTACCAGATCTCCTTAGTTCTACATGGCCTCTACCCTCAAGTCTGG
desaturaseTTCTAAGGAAGTTGAGAATCTCAAGAAGC
Ricinus communisGCTTCTTGAGATTCTCAACTTCCTTAGAACCAGACTTGAGGGTAGA2270
Lys46 TermGGCCATGTAGAACTAAGGAGATCTGGTACTGGCCATTGGTGGAG
AAG-TAGAGCGAAAGAAGGTAACTTTTGGGTTTGAGA
GATCTCCTTAGTTCTAC2271
GTAGAACTAAGGAGATC2272
Increased stearateTCTTCTGATTCATTTAATCTTTACTCATCAATGGCTCTGAGACTGAA2273
stearoyl-ACPCCCTATCCCCACCTAAACCTTCTCCCTCCCCCAAATGGCCAGTCTC
desaturaseAGATCTCCCAGGTTCCGCATGGCCTCTA
Glycine maxTAGAGGCCATGCGGAACCTGGGAGATCTGAGACTGGCCATTTGG2274
Gln11 TermGGGAGGGAGAAGGTTTAGGTGGGGATAGGGTTCAGTCTCAGAGC
CAA-TAACATTGATGAGTAAAGATTAAATGAATCAGAAGA
TCCCCACCTAAACCTTC2275
GAAGGTTTAGGTGGGGA2276
Increased stearateCTTTACTCATCAATGGCTCTGAGACTGAACCCTATCCCCACCCAAA2277
stearoyl-ACPCCTTCTCCCTCCCCTAAATGGCCAGTCTCAGATCTCCCAGGTTCC
desaturaseGCATGGCCTCTACCCTCCGCTCCGGTTCCA
Glycine maxTGGAACCGGAGCGGAGGGTAGAGGCCATGCGGAACCTGGGAGAT2278
Gln17 TermCTGAGACTGGCCATTTAGGGGAGGGAGAAGGTTTGGGTGGGGAT
CAA-TAAAGGGTTCAGTCTCAGAGCCATTGATGAGTAAAG
CCCTCCCCTAAATGGCC2279
GGCCATTTAGGGGAGGG2280
Increased stearateGCTCTGAGACTGAACCCTATCCCCACCCAAACCTTCTCCCTCCCC2281
stearoyl-ACPCAAATGGCCAGTCTCTGATCTCCCAGGTTCCGCATGGCCTCTACC
desaturaseCTCCGCTCCGGTTCCAAAGAGGTTGAAAATA
Glycine maxTATTTTCAACCTCTTTGGAACCGGAGCGGAGGGTAGAGGCCATGC2282
Arg22 TermGGAACCTGGGAGATCAGAGACTGGCCATTTGGGGGAGGGAGAAG
AGA-TGAGTTTGGGTGGGGATAGGGTTCAGTCTCAGAGC
CCAGTCTCTGATCTCCC2283
GGGAGATCAGAGACTGG2284
Increased stearateCAAATGGCCAGTCTCAGATCTCCCAGGTTCCGCATGGCCTCTACC2285
stearoyl-ACPCTCCGCTCCGGTTCCTAAGAGGTTGAAAATATTAAGAAGCCATTCA
desaturaseCTCCTCCCAGAGAAGTGCATGTTCAAGTAA
Glycine maxTTACTTGAACATGCACTTCTCTGGGAGGAGTGAATGGCTTCTTAAT2286
Lys37 TermATTTTCAACCTCTTAGGAACCGGAGCGGAGGGTAGAGGCCATGCG
AAA-TAAGAACCTGGGAGATCTGAGACTGGCCATTTG
CCGGTTCCTAAGAGGTT2287
AACCTCTTAGGAACCGG2288
Increased stearateCAACAAGCACACACAAGAACAACATCAACAATGGCGATTCGCATC2289
stearoyl-ACPAATACGGCGACGTTTTAATCAGACCTGTACCGTTCATTCGCGTTTC
desaturaseCTCAACCGAAACCTCTCAGATCTCCCAAAT
Helianthus annuusATTTGGGAGATCTGAGAGGTTTCGGTTGAGGAAACGCGAATGAAC2290
Gln11 TermGGTACAGGTCTGATTAAAACGTCGCCGTATTGATGCGAATCGCCA
CAA-TAATTGTTGATGTTGTTCTTGTGTGTGCTTGTTG
CGACGTTTTAATCAGAC2291
GTCTGATTAAAACGTCG2292
Increased stearateAAGCACACACAAGAAGCAACATCAACAATGGCGATTCGCATCAATAC2293
stearoyl-ACPGGCGACGTTTCAATGAGACCTGTACCGTTCATTCGCGTTTCCTCAA
desaturaseCCGAAACCTCTCAGATCTCCCAAATTCGC
Helianthus annuusGCGAATTTGGGAGATCTGAGAGGTTTCGGTTGAGGAAACGCGAAT2294
Ser12 TermGAACGGTACAGGTCTCATTGAAACGTCGCCGTATTGATGCGAATC
TCA-TGAGCCATTGTTGATGTTGTTCTTGTGTGTGCTT
GTTTCAATGAGACCTGT2295
ACAGGTCTCATTGAAAC2296
Increased stearateAAGAACAACATCAACAATGGCGATTCGCATCAATACGGCGACGTTT2297
stearoyl-ACPCAATCAGACCTGTAGCGTTCATTCGCGTTTCCTCAACCGAAACCTC
desaturaseTCAGATCTCCCAAATTCGCCATGGCTTCC
Helianthus annuusGGAAGCCATGGCGAATTTGGGAGATCTGAGAGGTTTCGGTTGAGG2298
Tyr15 TermAAACGCGAATGAACGCTACAGGTCTGATTGAAACGTCGCCGTATT
TAC-TAGGATGCGAATCGCCATTGTTGATGTTGTTCTT
GACCTGTAGCGTTCATT2299
AATGAACGCTACAGGTC2300
Increased stearateCAACATCAACAATGGCGATTCGCATCAATACGGCGACGTTTCAATC2301
stearoyl-ACPAGACCTGTACCGTTGATTCGCGTTTCCTCAACCGAAACCTCTCAGA
desaturaseTCTCCCAAATTCGCCATGGCTTCCACCAT
Helianthus annuusATGGTGGAAGCCATGGCGAATTTGGGAGATCTGAGAGGTTTCGGT2302
Ser17 TermTGAGGAAACGCGAATCAACGGTACAGGTCTGATTGAAACGTCGCC
TCA-TGAGTATTGATGCGAATCGCCATTGTTGATGTTG
GTACCGTTGATTCGCGT2303
ACGCGAATCAACGGTAC2304
Increased stearateACACACAACACACACTCAATCACACACACATCATCATCTTCTTCATC2305
stearoyl-ACPAACGATGGCGCTTTGAATGAGTCCGGTGACGCTTCAACGGGAGAT
desaturaseATATCCTTCATACACTTTTCATCAATCGA
Helianthus annuusTCGATTGATGAAAAGTGTATGAAGGATATATCTCCCGTTGAAGCGT2306
Arg4 TermCACCGGACTCATTCAAAGCGCCATCGTTGATGAAGAAGATGATGA
CGA-TGATGTGTGTGTGATTGAGTGTGTGTTGTGTGT
TGGCGCTTTGAATGAGT2307
ACTCATTCAAAGCGCCA2308
Increased stearateACACACACATCATCATCTTCTTCATCAACGATGGCGCTTCGAATGA2309
stearoyl-ACPGTCCGGTGACGCTTTAACGGGAGATATATCCTTCATACACTTTTCA
desaturaseTCAATCGAAAAATCTCAGATCTCCTAAAT
Helianthus annuusATTTAGGAGATCTGAGATTTTTCGATTGATGAAAAGTGTATGAAGG2310
Gln11 TermATATATCTCCCGTTAAAGCGTCACCGGACTCATTCGAAGCGCCATC
CAA-TAAGTTGATGAAGAAGATGATGATGTGTGTGT
TGACGCTTTAACGGGAG2311
CTCCCGTTAAAGCGTCA2312
Increased stearateACATCATCATCTTCTTCATCAACGATGGCGCTTCGAATGAGTCCGG2313
stearoyl-ACPTGACGCTTCAACGGTAGATATATCCTTCATACACTTTTCATCAATCG
desaturaseAAAAATCTCAGATCTCCTAAATTCGCGA
Helianthus annuusTCGCGAATTTAGGAGATCTGAGATTTTTCGATTGATGAAAAGTGTA2314
Glu13 TermTGAAGGATATATCTACCGTTGAAGCGTCACCGGACTCATTCGAAG
GAG-TAGCGCCATCGTTGATGAAGAAGATGATGATGT
TTCAACGGTAGATATAT2315
ATATATCTACCGTTGAA2316
Increased stearateATCTTCTTCATCAACGATGGCGCTTCGAATGAGTCCGGTGACGCTT2317
stearoyl-ACPCAACGGGAGATATAGCCTTCATACACTTTTCATCAATCGAAAAATC
desaturaseTCAGATCTCCTAAATTCGCGATGGCTTCC
Helianthus annuusGGAAGCCATCGCGAATTTAGGAGATCTGAGATTTTTCGATTGATGA2318
Tyr15 TermAAAGTGTATGAAGGCTATATCTCCCGTTGAAGCGTCACCGGACTC
TAT-TAGATTCGAAGCGCCATCGTTGATGAAGAAGAT
GAGATATAGCCTTCATA2319
TATGAAGGCTATATCTC2320
Increased stearateAACTCAGCCAGCTTGCCCCCAAACAACAGCGCAGAAAAACCTTCA2321
stearoyl-ACPACAACAATGGCTCTCTAGCTCAACCCAGTCACCACCTTCCCTTCAA
desaturaseCACGCTCCCTCAACAACTTCTCCTCCAGAT
Linum usitatissimumATCTGGAGGAGAAGTTGTTGAGGGAGCGTGTTGAAGGGAAGGTG2322
Lys4 TermGTGACTGGGTTGAGCTAGAGAGCCATTGTTGTTGAAGGTTTTTCT
AAG-TAGGCGCTGTTGTTTGGGGGCAAGCTGGCTGAGTT
TGGCTCTCTAGCTCAAC2323
GTTGAGCTAGAGAGCCA2324
Increased stearateGCGCAGAAAAACCTTCAACAACAATGGCTCTCAAGCTCAACCCAG2325
stearoyl-ACPTCACCACCTTCCCTTGAACACGCTCCCTCAACAACTTCTCCTCCAG
desaturaseATCTCCTCGCACCTTTCTCATGGCTGCTTC
Linum usitatissimumGAAGCAGCCATGAGAAAGGTGCGAGGAGATCTGGAGGAGAAGTT2326
Ser13 TermGTTGAGGGAGCGTGTTCAAGGGAAGGTGGTGACTGGGTTGAGCT
TCA-TGATGAGAGCCATTGTTGTTGAAGGTTTTTCTGCGC
CTTCCCTTGAACACGCT2327
AGCGTGTTCAAGGGAAG2328
Increased stearateCTCAAGCTCAACCCAGTCACCACCTTCCCTTCAACACGCTCCCTCA2329
stearoyl-ACPACAACTTCTCCTCCTGATCTCCTCGCACCTTTCTCATGGCTGCTTC
desaturaseCACTTTCAATTCCACCTCCACCAAGTAAG
Linum usitatissimumCTTACTTGGTGGAGGTGGAATTGAAAGTGGAAGCAGCCATGAGAA2330
Arg23 TermAGGTGCGAGGAGATCAGGAGGAGAAGTTGTTGAGGGAGCGTGTT
AGA-TGAGAAGGGAAGGTGGTGACTGGGTTGAGCTTGAG
TCTCCTCCTGATCTCCT2331
AGGAGATCAGGAGGAGA2332
Increased stearateTCCTCCAGATCTCCTCGCACCTTTCTCATGGCTGCTTCCACTTTCA2333
stearoyl-ACPATTCCACCTCCACCTAGTAAGCATCTCCTCCTCCTCGGAATCTCCG
desaturaseCCGATTTCTTTTAAGCGATTGATCGTAGA
Linum usitatissimumTCTACGATCAATCGCTTAAAAGAAATCGGCGGAGATTCCGAGGAG2334
Lys411 TermGAGGAGATGCTTACTAGGTGGAGGTGGAATTGAAAGTGGAAGCA
AAG-TAGGCCATGAGAAAGGTGCGAGGAGATCTGGAGGA
CCTCCACCTAGTAAGCA2335
TGCTTACTAGGTGGAGG2336
Increased stearateATGGCACTGAAACTTTGCTTTCCACCCCACAAGATGCCTTCCTTCC2337
stearoyl-ACPCCGATGCTCGTATCTGATCTCACAGGGTTTTCATGGCTTCAACTAT
desaturaseTCATTCTCCTTCTATGGAGGTCGGAAAAG
Olea europaeapCTTTCCGACCTCCATAGAAGGAGAATGAATAGTTGAAGCCATGAA2338
Arg21 TermAACCCTGTGAGATCAGATACGAGCATCGGGGAAGGAAGGCATCTT
AGA-TGAGTGGGGTGGAAAGCAAAGTTTCAGTGCCAT
CTCGTATCTGATCTCAC2339
GTGAGATCAGATACGAG2340
Increased stearateCCCACAAGATGCCTTCCTTCCCCGATGCTCGTATCAGATCTCACAG2341
stearoyl-ACPGGTTTTCATGGCTTGAACTATTCATTCTCCTTCTATGGAGGTCGGA
desaturaseAAAGTTAAAAAGCCTTTCACGCCTCCACG
Olea europaeapCGTGGAGGCGTGAAAGGCTTTTTAACTTTTCCGACCTCCATAGAA2342
Ser29 TermGGAGAATGAATAGTTCAAGCCATGAAAACCCTGTGAGATCTGATAC
TCA-TGAGAGCATCGGGGAAGGAAGGCATCTTGTGGG
CATGGCTTGAACTATTC2343
GAATAGTTCAAGCCATG2344
Increased stearateGATGCTCGTATCAGATCTCACAGGGTTTTCATGGCTTCAACTATTC2345
stearoyl-ACPATTCTCCTTCTATGTAGGTCGGAAAAGTTAAAAAGCCTTTCACGCC
desaturaseTCCACGAGAGGTACATGTTCAAGTAACCC
Olea europaeapGGGTTACTTGAACATGTACCTCTCGTGGAGGCGTGAAAGGCTTTT2346
Glu37 TermTAACTTTTCCGACCTACATGAAGGAGAATGAATAGTTGAAGCCAT
GAG-TAGGAAAACCCTGTGAGATCTGATACGAGCATC
CTTCTATGTAGGTCGGA2347
TCCGACCTACATAGAAG2348
Increased stearateCGTATCAGATCTCACAGGGTTTTCATGGCTTCAACTATTCATTCTC2349
stearoyl-ACPCTTCTATGGAGGTCTGAAAAGTTAAAAAGCCTTTCACGCCTCCACG
desaturaseAGAGGTACATGTTCAAGTAACCCATTCCT
Olea europaeapAGGAATGGGTTACTTGAACATGTACCTCTCGTGGAGGCGTGAAAG2350
Gly39 TermGCTTTTTAACTTTTCAGACCTCCATAGAAGGAGAATGAATAGTTGA
GGA-TGAAGCCATGAAAACCCTGTGAGATCTGATACG
TGGAGGTCTGAAAAGTT2351
AACTTTTCAGACCTCCA2352
Increased stearateTTCTCGTTTTTGTCGTCCCCTCTGCTCTCTCTCTCTATCAGGCACG2353
stearoyl-ACPGAGAAATGGCACTGTAACTCAGTCCAGTCATGTTTCAATCTCAGAA
desaturaseGCTTCCATTTCTTGCCTCCTATCCGCCTT
Persea americanaAAGGCGGATAGGAGGCAAGAAATGGAAGCTTCTGAGATTGAAACA2354
Lys4 TermTGACTGGACTGAGTTACAGTGCCATTTCTCCGTGCCTGATAGAGA
AAA-TAAGAGAGAGCAGAGGGGACGACAAAAACGAGAA
TGGCACTGTAACTCAGT2355
ACTGAGTTACAGTGCCA2356
Increased stearateCTGCTCTCTCTCTCTATCAGGCACGGAGAAATGGCACTGAAACTCA2357
stearoyl-ACPGTCCAGTCATGTTTTAATCTCAGAAGCTTCCATTTCTTGCCTCCTAT
desaturaseCCGCCTTCCAATCTCAGATCTCCGAGGG
Persea americanaCCCTCGGAGATCTGAGATTGGAAGGCGGATAGGAGGCAAGAAAT2358
Gln11 TermGGAAGCTTCTGAGATTAAAACATGACTGGACTGAGTTTCAGTGCC
CAA-TAAATTTCTCCGTGCCTGATAGAGAGAGAGAGCAG
TCATGTTTTAATCTCAG2359
CTGAGATTAAAACATGA2360
Increased stearateTCTCTCTCTATCAGGCACGGAGAAATGGCACTGAAACTCAGTCCA2361
stearoyl-ACPGTCATGTTTCAATCTTAGAAGCTTCCATTTCTTGCCTCCTATCCGCC
desaturaseTTCCAATCTCAGATCTCCGAGGGTTTTCA
Persea americanaTGAAAACCCTCGGAGATCTGAGATTGGAAGGCGGATAGGAGGCAA2362
Gln13 TermGAAATGGAAGCTTCTAAGATTGAAACATGACTGGACTGAGTTTCAG
CAG-TAGTGCCATTTCTCCGTGCCTGATAGAGAGAGA
TTCAATCTTAGAAGCTT2363
AAGCTTCTAAGATTGAA2364
Increased stearateCTCTCTATCAGGCACGGAGAAATGGCACTGAAACTCAGTCCAGTC2365
stearoyl-ACPATGTTTCAATCTCAGTAGCTTCCATTTCTTGCCTCCTATCCGCCTTC
desaturaseCAATCTCAGATCTCCGAGGGTTTTCATGG
Persea americanaCCATGAAAACCCTCGGAGATCTGAGATTGGAAGGCGGATAGGAG2366
Lys14 TermGCAAGAAATGGAAGCTACTGAGATTGAAACATGACTGGACTGAGT
AAG-TAGTTCAGTGCCATTTCTCCGTGCCTGATAGAGAG
AATCTCAGTAGCTTCCA2367
TGGAAGCTACTGAGATT2368
Increased stearateCCCCGAGATCTCGCTGCCGCTGCTCATGGCGTTCGCGGCGTCCC2369
stearoyl-ACPACACCGCATCGCCGTAGTCCTGCGGCGGCGTGGCGCAGAGGAG
desaturaseGAGCAATGGGATGTCGAAGATGGTGGCCATGGCC
Oryza sativaGGCCATGGCCACCATCTTCGACATCCCATTGCTCCTCCTCTGCGC2370
Tyr12 TermCACGCCGCCGCAGGACTACGGCGATGCGGTGTGGGACGCCGCG
TAC-TAGAACGCCATGAGCAGCGGCAGCGAGATCTCGGGG
TCGCCGTAGTCCTGCGG2371
CCGCAGGACTACGGCGA2372
Increased stearateCTGCTCATGGCGTTCGCGGCGTCCCACACCGCATCGCCGTACTCC2373
stearoyl-ACPTGCGGCGGCGTGGCGTAGAGGAGGAGCAATGGGATGTCGAAGAT
desaturaseGGTGGCCATGGCCTCCACCATCAACAGGGTCA
Oryza sativaTGACCCTGTTGATGGTGGAGGCCATGGCCACCATCTTCGACATCC2374
Gln19 TermCATTGCTCCTCCTCTACGCCACGCCGCCGCAGGAGTACGGCGAT
CAG-TAGGCGGTGTGGGACGCCGCGAACGCCATGAGCAG
GCGTGGCGTAGAGGAGG2375
CCTCCTCTACGCCACGC2376
Increased stearateCCCACACCGCATCGCCGTACTCCTGCGGCGGCGTGGCGCAGAGG2377
stearoyl-ACPAGGAGCAATGGGATGTAGAAGATGGTGGCCATGGCCTCCACCAT
desaturaseCAACAGGGTCAAGACTGCTAAGAAGCCCTACAC
Oryza sativaGTGTAGGGCTTCTTAGCAGTCTTGACCCTGTTGATGGTGGAGGCC2378
Ser26 TermATGGCCACCATCTTCTACATCCCATTGCTCCTCCTCTGCGCCACGC
TCG-TAGCGCCGCAGGAGTACGGCGATGCGGTGTGGG
TGGGATGTAGAAGATGG2379
CCATCTTCTACATCCCA2380
Increased stearateCACACCGCATCGCCGTACTCCTGCGGCGGCGTGGCGCAGAGGAG2381
stearoyl-ACPGAGCAATGGGATGTCGTAGATGGTGGCCATGGCCTCCACCATCAA
desaturaseCAGGGTCAAGACTGCTAAGAAGCCCTACACTC
Oryza sativaGAGTGTAGGGCTTCTTAGCAGTCTTGACCCTGTTGATGGTGGAGG2382
Lys27 TermCCATGGCCACCATCTACGACATCCCATTGCTCCTCCTCTGCGCCA
AAG-TAGCGCCGCCGCAGGAGTACGGCGATGCGGTGTG
GGATGTCGTAGATGGTG2383
CACCATCTACGACATCC2384
Increased stearateTTCTCTCTCTAGGTTGAGCGGTTACCAACAGAAGCACTTAGGAGA2385
stearoyl-ACPGAGAAGCAATGGCGTAGAAGCTTCACCACACGGCCTTCAATCCTT
desaturaseCCATGGCGGTTACCTCTTCGGGACTTCCTCG
Simmondsia chinensisCGAGGAAGTCCCGAAGAGGTAACCGCCATGGAAGGATTGAAGGC2386
Leu3 TermCGTGTGGTGAAGCTTCTACGCCATTGCTTCTCTCTCCTAAGTGCTT
TTG-TAGCTGTTGGTAACCGCTCAACCTAGAGAGAGAA
AATGGCGTAGAAGCTTC2387
GAAGCTTCTACGCCATT2388
Increased stearateCTCTCTCTAGGTTGAGCGGTTACCAACAGAAGCACTTAGGAGAGA2389
stearoyl-ACPGAGCAATGGCGTTGTAGCTTCACCACACGGCCTTCAATCCTTCC
desaturaseATGGCGGTTACCTCTTCGGGACTTCCTCGAT
Simmondsia chinensisATCGAGGAAGTCCCGAAGAGGTAACCGCCATGGAAGGATTGAAG2390
Lys4 TermGCCGTGTGGTGAAGCTACAACGCCATTGCTTCTCTCTCCTAAGTG
AAG-TAGCTTCTGTTGGTAACCGCTCAACCTAGAGAGAG
TGGCGTTGTAGCTTCAC2391
GTGAAGCTACAACGCCA2392
Increased stearateAAGCAATGGCGTTGAAGCTTCACCACACGGCCTTCAATCCTTCCAT2393
stearoyl-ACPGGCGGTTACCTCTTAGGGACTTCCTCGATCGTATCACCTCAGATCT
desaturaseCACCGCGTTTTCATGGCTTCTTCTACAAT
Simmondsia chinensisATTGTAGAAGAAGCCATGAAAACGCGGTGAGATCTGAGGTGATAC2394
Ser19 TermGATCGAGGAAGTCCCTAAGAGGTAACCGCCATGGAAGGATTGAAG
TCG-TAGGCCGTGTGGTGAAGCTTCAACGCCATTGCTT
TACCTCTTAGGGACTTC2395
GAAGTCCCTAAGAGGTA2396
Increased stearateGCAATGGCGTTGAAGCTTCACCACACGGCCTTCAATCCTTCCATG2397
stearoyl-ACPGCGGTTACCTCTTCGTGACTTCCTCGATCGTATCACCTCAGATCTC
desaturaseACCGCGTTTTCATGGCTTCTTCTACAATTG
Simmondsia chinensisCAATTGTAGAAGAAGCCATGAAAACGCGGTGAGATCTGAGGTGAT2398
Gly20 TermACGATCGAGGAAGTCACGAAGAGGTAACCGCCATGGAAGGATTG
GGA-TGAAAGGCCGTGTGGTGAAGCTTCAACGCCATTGC
CCTCTTCGTGACTTCCT2399
AGGAAGTCACGAAGAGG2400
Increased stearateTGGCTCTGAATCTCAACCCCGTTTCCACACCATTTCAGTGTCGTCG2401
stearoyl-ACPATTGCCGTCTTTCTGACCTCGTCAAACGCCTTCTCGCAGATCTCCC
desaturaseAAATTCTTCATGGCTTCCACTCTCAGCAG
Spinacia oleraceaCTGCTGAGAGTGGAAGCCATGAAGAATTTGGGAGATCTGCGAGAA2402
Ser21 TermGGCGTTTGACGAGGTCAGAAAGACGGCAATCGACGACACTGAAAT
TCA-TGAGGTGTGGAAACGGGGTTGAGATTCAGAGCCA
GTCTTTCTGACCTCGTC2403
GACGAGGTCAGAAAGAC2404
Increased stearateAATCTCAACCCCGTTTCCACACCATTTCAGTGTCGTCGATTGCCGT2405
stearoyl-ACPCTTTCTCACCTCGTTAAACGCCTTCTCGCAGATCTCCCAAATTCTT
desaturaseCATGGCTTCCACTCTCAGCAGCTCTTCTC
Spinacia oleraceaGAGAAGAGCTGCTGAGAGTGGAAGCCATGAAGAATTTGGGAGATC2406
Gln24 TermTGCGAGAAGGCGTTTAACGAGGTGAGAAAGACGGCAATCGACGA
CAA-TAACACTGAAATGGTGTGGAAACGGGGTTGAGATT
CACCTCGTTAAACGCCT2407
AGGCGTTTAACGAGGTG2408
Increased stearateTCCACACCATTTCAGTGTCGTCGATTGCCGTCTTTCTCACCTCGTC2409
stearoyl-ACPAAACGCCTTCTCGCTGATCTCCCAAATTCTTCATGGCTTCCACTCT
desaturaseCAGCAGCTCTTCTCCTAAGGAAGCGGAAA
Spinacia oleraceaTTTCCGCTTCCTTAGGAGAAGAGCTGCTGAGAGTGGAAGCCATGA2410
Arg29 TermAGAATTTGGGAGATCAGCGAGAAGGCGTTTGACGAGGTGAGAAA
AGA-TGAGACGGCAATCGACGACACTGAAATGGTGTGGA
CTTCTCGCTGATCTCCC2411
GGGAGATCAGCGAGAAG2412
Increased stearateTTTCAGTGTCGTCGATTGCCGTCTTTCTCACCTCGTCAAACGCCTT2413
stearoyl-ACPCTCGCAGATCTCCCTAATTCTTCATGGCTTCCACTCTCAGCAGCTC
desaturaseTTCTCCTAAGGAAGCGGAAAGCCTGAAGA
Spinacia oleraceaTCTTCAGGCTTTCCGCTTCCTTAGGAGAAGAGCTGCTGAGAGTGG2414
Lys32 TermAAGCCATGAAGAATTAGGGAGATCTGCGAGAAGGCGTTTGACGAG
AAA-TAAGTGAGAAAGACGGCAATCGACGACACTGAAA
GATCTCCCTAATTCTTC2415
GAAGAATTAGGGAGATC2416
Increased stearateAAATAGTCGAGGTGAAAAACAGAGCATCAACAATGGCACTGAATAT2417
stearoyl-ACPCAATGGGGTGTCGTGAAAATCTCACAAAATGTTACCATTTCCTTGT
desaturaseTCTTCAGCCAGATCTGAGCGAGTTTTCAT
Solanum tuberosumATGAAAACTCGCTCAGATCTGGCTGAAGAACAAGGAAATGGTAAC2418
Leu10 TermATTTTGTGAGATTTTCACGACACCCCATTGATATTCAGTGCCATTGT
TTA-TGATGATGCTCTGTTTTTCACCTCGACTATTT
GGTGTCGTGAAAATCTC2419
GAGATTTTCACGACACC2420
Increased stearateATAGTCGAGGTGAAAACAGAGCATCAACAATGGCACTGAATATCA2421
stearoyl-ACPATGGGGTGTCGTTATAATCTCACAAAATGTTACCATTTCCTTGTTCT
desaturaseTCAGCCAGATCTGAGCGAGTTTTCATGG
Solanum tuberosumCCATGAAAACTCGCTCAGATCTGGCTGAAGAACAAGGAAATGGTA2422
Lys11 TermACATTTTGTGAGATTATAACGACACCCCATTGATATTCAGTGCCATT
AAA-TAAGTTGATGCTCTGTTTTTCACCTCGACTAT
TGTCGTTATAATCTCAC2423
GTGAGATTATAACGACA2424
Increased stearateGTGAAAAACAGAGCATCAACAATGGCACTGAATATCAATGGGGTG2425
stearoyl-ACPTCGTTAAAATCTCACTAAATGTTACCATTTCCTTGTTCTTCAGCCAG
desaturaseATCTGAGCGAGTTTTCATGGCTTCAACCA
Solanum tuberosumTGGTTGAAGCCATGAAAACTCGCTCAGATCTGGCTGAAGAACAAG2426
Lys14 TermGAAATGGTAACATTTAGTGAGATTTTAACGACACCCCATTGATATT
AAA-TAACAGTGCCATTGTTGATGCTCTGTTTTTCAC
AATCTCACTAAATGTTA2427
TAACATTTAGTGAGATT2428
Increased stearateACAGAGCATCAACAATGGCACTGAATATCAATGGGGTGTCGTTAAA2429
stearoyl-ACPATCTCACAAAATGTGACCATTTCCTTGTTCTTCAGCCAGATCTGAG
desaturaseCGAGTTTTCATGGCTTCAACCATTCATCG
Solanum tuberosumCGATGAATGGTTGAAGCCATGAAAACTCGCTCAGATCTGGCTGAA2430
Leu16 TermGAACAAGGAAATGGTCACATTTTGTGAGATTTTAACGACACCCCAT
TTA-TGATGATATTCAGTGCCATTGTTGATGCTCTGT
CAAAATGTGACCATTTC2431
GAAATGGTCACATTTTG2432
Increased stearateTGGCTCTGAGGCTGAACCCTAACCCTTCACAGAAGCTCTTTCTCTC2433
stearoyl-ACPTCCTTCTTCATCATGATCTTCTTCTTCTTCATCGTTCTCGCTTCCTC
desaturaseAAATGGCTAGCCTCAGATCTCCAAGGTT
Arachis hypogaeaAACCTTGGAGATCTGAGGCTAGCCATTTGAGGAAGCGAGAACGAT2434
Ser21 TermGAAGAAGAAGAAGATCATGATGAAGAAGGAGAGAGAAAGAGCTTC
TCA-TGATGTGAAGGGTTAGGGTTCAGCCTCAGAGCCA
TTCATCATGATCTTCTT2435
AAGAAGATCATGATGAA2436
Increased stearateACCCTAACCCTTCACAGAAGCTCTTTCTCTCTCCTTCTTCATCATCA2437
stearoyl-ACPTCTTCTTCTTCTTGATCGTTCTCGCTTCCTCAAATGGCTAGCCTCA
desaturaseGTCTCCAAGGTTCCGCATGGCCTCCAC
Arachis hypogaeaGTGGAGGCCATGCGGAACCTTGGAGATCTGAGGCTAGCCATTTGA2438
Ser26 TermGGAAGCGAGAACGATCAAGAAGAAGAAGATGATGATGAAGAAGGA
TCA-TGAGAGAGAAAGAGCTTCTGTGAAGGGTTAGGGT
TTCTTCTTGATCGTTCT2439
AGAACGATCAAGAAGAA2440
Increased stearateCTAACCCTTCACAGAAGCTCTTTCTCTCTCCTTCTTCATCATCATCT2441
stearoyl-ACPTCTTCTTCTTCATAGTTCTCGCTTCCTCAAATGGCTAGCCTCAGAT
desaturaseCTCCAAGGTTCCGCATGGCCTCCACCCT
Arachis hypogaeaAGGGTGGAGGCCATGCGGAACCTTGGAGATCTGAGGCTAGCCAT2442
Ser27 TermTTGAGGAAGCGAGAACTATGAAGAAGAAGAAGATGATGATGAAGA
TCG-TAGAGGAGAGAGAAAGAGCTTCTGTGAAGGGTTAG
TTCTTCATAGTTCTCGC2443
GCGAGAACTATGAAGAA2444
Increased stearateCTTCACAGAAGCTCTTTCTCTCTCCTTCTTCATCATCATCTTCTTCT2445
stearoyl-ACPTCTTCATCGTTCTAGCTTCCTCAAATGGCTAGCCTCAGATCTCCAA
desaturaseGGTTCCGCATGGCCTCCACCCTCCGCAC
Arachis hypogaeaGTGCGGAGGGTGGAGGCCATGCGGAACCTTGGAGATCTGAGGCT2446
Ser29 TermAGCCATTTGAGGAAGCTAGAACGATGAAGAAGAAGAAGATGATGA
TCG-TAGTGAAGAAGGAGAGAGAAAGAGCTTCTGTGAAG
ATCGTTCTAGCTTCCTC2447
GAGGAAGCTAGAACGAT2448
Increased stearateAAAGTTAAAAGCCGTCCAAAACCCAAACCAGGAAAGGCAAACGAA2449
stearoyl-ACPAAGAAAAAATGGCTTAGAATTTTAATGCCATCGCCTCGAAATCTCA
desaturaseGAAGCTCCCTTGCTTTGCTCTTCCACCAAA
Gossypium hirsutumTTTGGTGGAAGAGCAAAGCAAGGGAGCTTCTGAGATTTCGAGGCG2450
Leu3 TermATGGCATTAAAATTCTAAGCCATTTTTTCTTTTCGTTTGCCTTTCCT
TTG-TAGGGTTTGGGTTTTGGACGGCTTTTAACTTT
AATGGCTTAGAATTTTA2451
TAAAATTCTAAGCCATT2452
Increased stearateCCCAAACCAGGAAAGGCAAACGAAAAGAAAAAATGGCTTTGAATTT2453
stearoyl-ACPTAATGCCATCGCCTAGAAATCTCAGAAGCTCCCTTGCTTTGCTCTT
desaturaseCCACCAAAGGCCACCCTTAGATCTCCCAA
Gossypium hirsutumTTGGGAGATCTAAGGGTGGCCTTTGGTGGAAGAGCAAAGCAAGG2454
Ser1-TermGAGCTTCTGAGATTTCTAGGCGATGGCATTAAAATTCAAAGCCATT
TCG-TAGTTTTCTTTTCGTTTGCCTTTCCTGGTTTGGG
CATCGCCTAGAAATCTC2455
GAGATTTCTAGGCGATG2456
Increased stearateCAAACCAGGAAAGGCAAACGAAAAGAAAAAATGGCTTTGAATTTTA2457
stearoyl-ACPATGCCATCGCCTCGTAATCTCAGAAGCTCCCTTGCTTTGCTCTTCC
desaturaseACCAAAGGCCACCCTTAGATCTCCCAAGT
Gossypium hirsutumACTTGGGAGATCTAAGGGTGGCCTTTGGTGGAAGAGCAAAGCAAG2458
Lys11 TermGGAGCTTCTGAGATTACGAGGCGATGGCATTAAAATTCAAAGCCAA
AAA-TAATTTTTTCTTTTCGTTTGCCTTTCCTGGTTTG
TCGCCTCGTAATCTCAG2459
CTGAGATTACGAGGCGA2460
Increased stearateAGGAAAGGCAAACGAAAAGAAAAAATGGCTTTGAATTTTAATGCCA2461
stearoyl-ACPTCGCCTCGAAATCTTAGAAGCTCCCTTGCTTTGCTCTTCCACCAAA
desaturaseGGCCACCCTTAGATCTCCCAAGTTTTCCA
Gossypium hirsutumTGGAAAACTTGGGAGATCTAAGGGTGGCCTTTGGTGGAAGAGCAA2462
Gln13 TermAGCAAGGGAGCTTCTAAGATTTCGAGGCGATGGCATTAAAATTCA
CAG-TAGAAGCCATTTTTTCTTTTCGTTTGCCTTTCCT
CGAAATCTTAGAAGCTC2463
GAGCTTCTAAGATTTCG2464

[0148] 26

TABLE 24
Oligonucleotides to produce plants with reduced linolenic acid
Phenotype, Gene,
Plant & TargetedSEQ ID
AlterationAltering OligosNO:
Reducing linolenic acidAATAGAACGACAGAGACTTTTTCCTCTTTTCTTCTTGGGAAGAGGC2465
omega-3 fatty acidTCCAATGGCGAGCTAGGTTTTATCAGAATGTGGTTTTAGACCTCTC
desaturaseCCCAGATTCTACCCTAAACACACAACCTC
Arabidopsis thalianaGAGGTTGTGTGTTTAGGGTAGAATCTGGGGAGAGGTCTAAAACCA2466
Ser4 TermCATTCTGATAAAACCTAGCTCGCCATTGGAGCCTCTTCCCAAGAAG
TCG-TAGAAAAGAGGAAAAAGTCTCTGTCGTTCTATT
GGCGAGCTTGGTTTTAT2467
ATAAAACCAAGCTCGCC2468
Reducing linolenic acidACGACAGAGACTTTTTCCTCTTTTCTTCTTGGGAAGAGGCTCCAAT2469
omega-3 fatty acidGGCGAGCTCGGTTTGATCAGAATGTGGTTTTAGACCTCTCCCCAG
desaturaseATTCTACCCTAAACACACAACCTCTTTTGC
Arabidopsis thalianaGCAAAAGAGGTTGTGTGTTTAGGGTAGAATCTGGGGAGAGGTCTA2470
Leu6 TermAAACCACATTCTGATCAAACCGAGCTCGCCATTGGAGCCTCTTCCC
TTA-TGAAAGAAGAAAAGAGGAAAAAGTCTCTGTCGT
CTCGGTTTGATCAGAAT2471
ATTCTGATCAAACCGAG2472
Reducing linolenic acidACAGAGACTTTTTCCTCTTTTCTTCTTGGGAAGAGGCTCCAATGGC2473
omega-3 fatty acidGAGCTCGGTTTTATGAGAATGTGGTTTTAGACCTCTCCCCAGATTC
desaturaseTACCCTAAACACACAACCTCTTTTGCCTC
Arabidopsis thalianaGAGGCAAAAGAGGTTGTGTGTTTAGGGTAGAATCTGGGGAGAGGT2474
Ser7 TermCTAAAACCACATTCTCATAAAACCGAGCTCGCCATTGGAGCCTCTT
TCA-TGACCAAGAAGAAAAGAGGAAAAAGTCTCTGT
GGTTTTATGAGAATGTG2475
CACATTCTCATAAAACC2476
Reducing linolenic acidAGAGACTTTTTCCTCTTTTCTTCTTGGGAAGAGGCTCCAATGGCGA2477
omega-3 fatty acidGCTCGGTTTTATCATAATGTGGTTTTAGACCTCTCCCCAGATTCTA
desaturaseCCCTAAACACACAACCTCTTTTGCCTCTA
Arabidopsis thalianaTAGAGGCAAAAGAGGTTGTGTGTTTAGGGTAGAATCTGGGGAGAG2478
Glu8 TermGTCTAAAACCACATTATGATAAAACCGAGCTCGCCATTGGAGCCTC
GAA-TAATTCCCAAGAAGAAAAGAGGAAAAAGTCTCT
TTTTATCATAATGTGGT2479
ACCACATTATGATAAAA2480
Reducing linolenic acidTCATCATCTTCTTCTTCTGGGGAGAGAGAGAGAGCAAAAGAGCTC2481
omega-3 fatty acidTAGCAATGGCGAACTAGGTCTTATCCGAATGTGGCATAAGACCTC
desaturaseTCCCCAGAATCTACACCACACCCAGATCCAC
Brassica junceaGTGGATCTGGGTGTGGTGTAGATTCTGGGGAGAGGTCTTATGCCA2482
Leu4 TermCATTCGGATAAGACCTAGTTCGCCATTGCTAGAGCTCTTTTGCTCT
TTG-TAGCTCTCTCTCCCCAGAAGAAGAAGATGATGA
GGCGAACTAGGTCTTAT2483
ATAAGACCTAGTTCGCC2484
Reducing linolenic acidTCTTCTTCTTCTGGGGAGAGAGAGAGAGCAAAAGAGCTCTAGCAA2485
omega-3 fatty acidTGGCGAACTTGGTCTGATCCGAATGTGGCATAAGACCTCTCCCCA
desaturaseGAATCTACACCACACCCAGATCCACTTTCCT
Brassica junceaAGGAAAGTGGATCTGGGTGTGGTGTAGATTCTGGGGAGAGGTCTT2486
Leu6 TermATGCCACATTCGGATCAGACCAAGTTCGCCATTGCTAGAGCTCTTT
TTA-TGATGCTCTCTCTCTCTCCCCAGAAGAAGAAGA
CTTGGTCTGATCCGAAT2487
ATTCGGATCAGACCAAG2488
Reducing linolenic acidTTCTTCTGGGGAGAGAGAGAGAGCAAAAGAGCTCTAGCAATGGCG2489
omega-3 fatty acidAACTTGGTCTTATCCTAATGTGGCATAAGACCTCTCCCCAGAATCT
desaturaseACACCACACCCAGATCCACTTTCCTCTCCA
Brassica junceaTGGAGAGGAAAGTGGATCTGGGTGTGGTGTAGATTCTGGGGAGA2490
Glu8 TermGGTCTTATGCCACATTAGGATAAGACCAAGTTCGCCATTGCTAGA
GAA-TAAGCTCTTTTGCTCTCTCTCTCTCCCCAGAAGAA
TCTTATCCTAATGTGGC2491
GCCACATTAGGATAAGA2492
Reducing linolenic acidCTGGGGAGAGAGAGAGAGCAAAAGAGCTCTAGCAATGGCGAACT2493
omega-3 fatty acidTGGTCTTATCCGAATGAGGCATAAGACCTCTCCCCAGAATCTACAC
desaturaseCACACCCAGATCCACTTTCCTCTCCAACACC
Brassica junceaGGTGTTGGAGAGGAAAGTGGATCTGGGTGTGGTGTAGATTCTGG2494
Cys9 TermGGAGAGGTCTTATGCCTCATTCGGATAAGACCAAGTTCGCCATTG
TGT-TGACTAGAGCTCTTTTGCTCTCTCTCTCTCCCCAG
TCCGAATGAGGCATAAG2495
CTTATGCCTCATTCGGA2496
Reducing linolenic acidATAACAGAATTGCTGAATTCTTGCATTTTTAGCTTCTGGGTTTTCAA2497
omega-3 fatty acidTGGCTGCTGGTTGAGTATTATCAGAATGTGGTTTAAGGCCTCTCCC
desaturaseAAGAATCTACTCACGACCCAGAATTGGT
Ricinus communisACCAATTCTGGGTCGTGAGTAGATTCTTGGGAGAGGCCTTAAACC2498
Trp5 TermACATTCTGATAATACTCAACCAGCAGCCATTGAAAACCCAGAAGCT
TGG-TGAAAAAATGCAAGAATTCAGCAATTCTGTTAT
GCTGGTTGAGTATTATC2499
GATAATACTCAACCAGC2500
Reducing linolenic acidAGAATTGCTGAATTCTTGCATTTTTAGCTTCTGGGTTTTCAATGGCT2501
omega-3 fatty acidGCTGGTTGGGTATGATCAGAATGTGGTTTAAGGCCTCTCCCAAGA
desaturaseATCTACTCACGACCCAGAATTGGTTTTAC
Ricinus communisGTAAAACCAATTCTGGGTCGTGAGTAGATTCTTGGGAGAGGCCTT2502
Leu7 TermAAACCACATTCTGATCATACCCAACCAGCAGCCATTGAAAACCCAG
TTA-TGAAAGCTAAAAATGCAAGAATTCAGCAATTCT
TTGGGTATGATCAGAAT2503
ATTCTGATCATACCCAA2504
Reducing linolenic acidATTGCTGAATTCTTGCATTTTTAGCTTCTGGGTTTTCAATGGCTGCT2505
omega-3 fatty acidGGTTGGGTATTATGAGAATGTGGTTTAAGGCCTCTCCCAAGAATCT
desaturaseACTCACGACCCAGAATTGGTTTTACATC
Ricinus communisGATGTAAAACCAATTCTGGGTCGTGAGTAGATTCTTGGGAGAGGC2506
Ser8 TermCTTAAACCACATTCTCATAATACCCAACCAGCAGCCATTGAAAACC
TCA-TGACAGAAGCTAAAAATGCAAGAATTCAGCAAT
GGTATTATGAGAATGTG2507
CACATTCTCATAATACC2508
Reducing linolenic acidTGCTGAATTCTTGCATTTTTAGCTTCTGGGTTTTCAATGGCTGCTG2509
omega-3 fatty acidGTTGGGTATTATCATAATGTGGTTTAAGGCCTCTCCCAAGAATCTA
desaturaseCTCACGACCCAGAATTGGTTTTACATCGA
Ricinus communisTCGATGTAAAACCAATTCTGGGTCGTGAGTAGATTCTTGFGGAGAG2510
Glu9 TermCGCCTTAAACCACATTATGATAATACCCAACCAGCAGCCATTGAAAA
GAA-TAACCCAGAAGCTAAAAATGCAAGAATTCAGCA
TATTATCATAATGTGGT2511
ACCACATTATGATAATA2512
Reducing linolenic acidGCAAGTTGGTTTTATCAGAATGTGGTCTTAGACCACTCCCAAGAA2513
omega-3 fatty acidTCTACCCTAAGCCCTGAACTGGGGCAGCCACTTCTGCCTCCTCTC
desaturaseACATTAAGTTGAGAATTTCACGTACAGATC
Nicotiana tabacumGATCTGTACGTGAAATTCTCAACTTAATGTGAGAGGAGGCAGAAGT2514
Arg22 TermGGCTGCCCCAGTTCAGGGCTTAGGGTAGFATTCTTGGGAGTGGTCT
AGA-TGAAAGACCACATTCTGATAAAACCCAACTTGC
CTAAGCCCTGAACTGGG2515
CCCAGTTCAGGGCTTAG2516
Reducing linolenic acidCTCCCAAGAATCTACCCTAAGCCCAGAACTGGGGCAGCCACTTCT2517
omega-3 fatty acidGCCTCCTCTCACATTTAGTTGAGAATTTCACGTACAGATCTGAGTG
desaturaseGTTCTGCAATTTCTTTGTCTAATACTAAT
Nicotiana tabacumTATTAGTATTAGACAAAGAAATTGCAGAACCACTCAGATCTGTACG2518
Lys34 TermTGAAATTCTCAACTAAATGTGAGAGGAGGCAGAAGTGGCTGCCCC
AAG-TAGAGTTCTGGGCTTAGGGTAGATTCTTGGGAG
CTCACATTTAGTTGAGA2519
TCTCAACTAAATGTGAG2520
Reducing linolenic acidCAAGAATCTACCCTAAGCCCAGAACTGGGGCAGCCACTTCTGCCT2521
omega-3 fatty acidCCTCTCACATTAAGTAGAGAATTTCACGTACAGATCTGAGTGGTTC
desaturaseTGCAATTTCTTTGTCTAATACTAATAAAGA
Nicotiana tabacumTCTTTATTAGTATTAGACAAAGAAATTGCAGAACCACTCAGATCTGT2522
Leu35 TermACGTGAAATTCTCTACTTAATGTGAGAGGAGGCAGAAGTGGCTGC
TTG-TAGCCCAGTTCTGGGCTTAGGGTAGATTCTTG
CATTAAGTAGAGAATTT2523
AAATTCTCTACTTAATG2524
Reducing linolenic acidAGAATCTACCCTAAGCCCAGAACTGGGGCAGCCACTTCTGCCTCC2525
omega-3 fatty acidTCTCACATTAAGTTGTGAATTTCACGTACAGATCTGAGTGGTTCTG
desaturaseCAATTTCTTTGTCTAATACTAATAAAGAGA
Nicotiana tabacumTCTCTTTATTAGTATTAGACAAAGAAATTGCAGAACCACTCAGATCT2526
Arg36 TermGTACGTGAAATTCACAACTTAATGTGAGAGGAGGCAGAAGTGGCT
AGA-TGAGCCCCAGTTCTGGGCTTAGGGTAGATTCT
TTAAGTTGTGAATTTCA2527
TGAAATTCACAACTTAA2528
Reducing linolenic acidGCGAGTTGGGTTTTATCAGAATGTGGTCTGAGGCCACTCCCGAGG2529
omega-3 fatty acidGTCTATCCTAAGCCATGAACTGGCCACCCTTTGTTGAATTCCAATC
desaturaseCCACAAAGCTGAGATTTTCAAGAACAGATC
Sesamum indicumGATCTGTTCTTGAAAATCTCAGCTTTGTGGGATTGGAATTCAACAA2530
Arg22 TermAGGGTGGCCAGTTCATGGCTTAGGATAGACCCTCGGGAGTGGCC
AGA-TGATCAGACCACATTCTGATAAAACCCAACTCGC
CTAAGCCATGAACTGGC2531
GCCAGTTCATGGCTTAG2532
Reducing linolenic acidCAGAATGTGGTCTGAGGCCACTCCCGAGGGTCTATCCTAAGCCAA2533
omega-3 fatty acidGAACTGGCCACCCTTAGTTGAATTCCAATCCCACAAAGCTGAGATT
desaturaseTTCAAGAACAGATCTTGGAAATGGTTCTTC
Sesamum indicumGAAGAACCATTTCCAAGATCTGTTCTTGAAAATCTCAGCTTTGTGG2534
Leu27 TermGATTGGAATTCAACTAAGGGTGGCCAGTTCTTGGCTTAGGATAGA
TTG-TAGCCCTCGGGAGTGGCCTCAGACCACATTCTG
CCACCCTTAGTTGAATT2535
AATTCAACTAAGGGTGG2536
Reducing linolenic acidAATGTGGTCTGAGGCCACTCCCGAGGGTCTATCCTAAGCCAAGAA2537
omega-3 fatty acidCTGGCCACCCTTTGTAGAATTCCAATCCCACAAAGCTGAGATTTTC
desaturaseAAGAACAGATCTTGGAAATGGTTCTTCATT
Sesamum indicumAATGAAGAACCATTTCCAAGATCTGTTCTTGAAAATCTCAGCTTTGT2538
Leu28 TermGGGATTGGAATTCTACAAAGGGTGGCCAGTTCTTGGCTTAGGATA
TTG-TAGGACCCTCGGGAGTGGCCTCAGACCACATT
CCCTTTGTAGAATTCCA2539
TGGAATTCTACAAAGGG2540
Reducing linolenic acidCTCCCGAGGGTCTATCCTAAGCCAAGAACTGGCCACCCTTTGTTG2541
omega-3 fatty acidAATTCCAATCCCACATAGCTGAGATTTTCAAGAACAGATCTTGGAA
desaturaseATGGTTCTTCATTCTGTTTGTCGAGTGGGA
Sesamum indicumTCCCACTCGACAAACAGAATGAAGAACCATTTCCAAGATCTGTTCT2542
Lys34 TermTGAAAATCTCAGCTATGTGGGATTGGAATTCAACAAAGGGTGGCC
AAG-TAGAGTTCTTGGCTTAGGATAGACCCTCGGGAG
ATCCCACATAGCTGAGA2543
TCTCAGCTATGTGGGAT2544
Reducing linolenic acidCATCAGAGCGGCGATACCTAAGCATTGCTGGGTTAAGAATCCATG2545
omega-3 fatty acidGAAGTCTATGAGTTAGGTCGTCAGAGAGCTAGCCATCGTGTTCGC
desaturaseACTAGCTGCTGGAGCTGCTTACCTCAACAAT
Brassica napusATTGTTGAGGTAAGCAGCTCCAGCAGCTAGTGCGAACACGATGGC2546
Tyr3 TermTAGCTCTCTGACGACCTAACTCATAGACTTCCATGGATTCTTAACC
TAC-TAGCAGCAATGCTTAGGTATCGCCGCTCTGATG
ATGAGTTAGGTCGTCAG2547
CTGACGACCTAACTCAT2548
Reducing linolenic acidGCGGCGATACCTAAGCATTGCTGGGTTAAGAATCCATGGAAGTCT2549
omega-3 fatty acidATGAGTTACGTCGTCTGAGAGCTAGCCATCGTGTTCGCACTAGCT
desaturaseGCTGGAGCTGCTTACCTCAACAATTGGCTTG
Brassica napusCAAGCCAATTGTTGAGGTAAGCAGCTCCAGCAGCTAGTGCGAACA2550
Arg6 TermCGATGGCTAGCTCTCAGACGACGTAACTCATAGACTTCCATGGAT
AGA-TGACTTAACCCAGCAATGCTTAGGTATCGCCGC
ACGTCGTCTGAGAGCTA2551
TAGCTCTCAGACGACGT2552
Reducing linolenic acidGCGATACCTAAGCATTGCTGGGTTAAGAATCCATGGAAGTCTATGA2553
omega-3 fatty acidGTTACGTCGTCAGATAGCTAGCCATCGTGTTCGCACTAGCTGCTG
desaturaseGAGCTGCTTACCTCAACAATTGGCTTGTTT
Brassica napusAAACAAGCCAATTGTTGAGGTAAGCAGCTCCAGCAGCTAGTGCGA2554
Glu7 TermACACGATGGCTAGCTATCTGACGACGTAACTCATAGACTTCCATG
GAG-TAGGATTCTTAACCCAGCAATGCTTAGGTATCGC
TCGTCAGATAGCTAGCC2555
GGCTAGCTATCTGACGA2556
Reducing linolenic acidCCATGGAAGTCTATGAGTTACGTCGTCAGAGAGCTAGCCATCGTG2557
omega-3 fatty acidTTCGCACTAGCTGCTTGAGCTGCTTACCTCAACAATTGGCTTGTTT
desaturaseGGCCTCTCTATTGGATTGCTCAAGGAACCA
Brassica napusTGGTTCCTTGAGCAATCCAATAGAGAGGCCAAACAAGCCAATTGTT2558
Gly17 TermGAGGTAAGCAGCTCAAGCAGCTAGTGCGAACACGATGGCTAGCT
GGA-TGACTCTGACGACGTAACTCATAGACTTCCATGG
TAGCTGCTTGAGCTGCT2559
AGCAGCTCAAGCAGCTA2560
Reducing linolenic acidGCAAGTTGGGTTCTATCAGAATGTGGTCTTAGACCACTACCAAGAA2561
omega-3 fatty acidTATACCCAAAGCCCTGAATAGGGTCTTCTTCCGTTTGCGCCACCAA
desaturaseTTTAAATCTGAGAAGAATTTCACCTTCAC
Solanum tuberosumGTGAAGGTGAAATTCTTCTCAGATTTAAATTGGTGGCGCAAACGGA2562
Arg22 TermAGAAGACCCTATTCAGGGCTTTGGGTATATTCTTGGTAGTGGTCTA
AGA-TGAAGACCACATTCTGATAGAACCCAACTTGC
CAAAGCCCTGAATAGGG2563
CCCTATTCAGGGCTTTG2564
Reducing linolenic acidTGGTCTTAGACCACTACCAAGAATATACCCAAAGCCCAGAATAGG2565
omega-3 fatty acidGTCTTCTTCCGTTTGAGCCACCAATTTAAATCTGAGAAGAATTTCA
desaturaseCCTTCACCTATACGAACAGATCGGAATTGT
Solanum tuberosumACAATTCCGATCTGTTCGTATAGGTGAAGGTGAAATTCTTCTCAGA2566
Cys29 TermTTTAAATTGGTGGCTCAAACGGAAGAAGACCCTATTCTGGGCTTTG
TGC-TGAGGTATATTCTTGGTAGTGGTCTAAGACCA
TCCGTTTGAGCCACCAA2567
TTGGTGGCTCAAACGGA2568
Reducing linolenic acidCACTACCAAGAATATACCCAAAGCCCAGAATAGGGTCTTCTTCCGT2569
omega-3 fatty acidTTGCGCCACCAATTGAAATCTGAGAAGAATTTCACCTTCACCTATA
desaturaseCGAACAGATCGGAATTGTTGGGCATTGAG
Solanum tuberosumCTCAATGCCCAACAATTCCGATCTGTTCGTATAGGTGAAGGTGAAA2570
Leu33 TermTTCTTCTCAGATTTCAATTGGTGGCGCAAACGGAAGAAGACCCTAT
TTA-TGATCTGGGTTTGGGTATATTCTTGGTAGTG
CACCAATTGAAATCTGA2571
TCAGATTTCAATTGGTG2572
Reducing linolenic acidAGAATATACCCAAAGCCCAGAATAGGGTCTTCTTCCGTTTGCGCCA2573
omega-3 fatty acidCCAATTTAAATCTGTGAAGAATTTCACCTTCACCTATACGAACAGAT
desaturaseCGGAATTGTTGGGCATTGAGGGTAAGTG
Solanum tuberosumCACTTACCCTCAATGCCCAACAATTCCGATCTGTTCGTATAGGTGA2574
Arg36 TermAGGTGAAATTCTTCACAGATTTAAATTGGTGGCGCAAACGGAAGAA
AGA-TGAGACCCTATTCTGGGCTTTGGGTATATTCT
TAAATCTGTGAAGAATT2575
AATTCTTCACAGATTTA2576
Reducing linolenic acidCTCTTTATTATCCTCCTCTTCTTTGTTTTTTTTGAGTTCTGAGTCACC2577
omega-3 fatty acidTATGGCAAGTTGAGTGATTTCAGAATGTGGGCTAAGGCCACTTCC
desaturaseAAGAATCTATGCCAGGCCCAGAAGTGGA
Petroselinum crispumTCCACTTCTGGGCCTGGCATAGATTCTTGGAAGTGGCCTTAGCCC2578
Trp4 TermACATTCTGAAATCACTCAACTTGCCATAGGTGACTCAGAACTCAAA
TGG-TGAAAAAACAAAGAAGAGGAGGATAATAAAGAG
GCAAGTTGAGTGATTTC2579
GAAATCACTCAACTTGC2580
Reducing linolenic acidTATCCTCCTCTTCTTTGTTTTTTTTGAGTTCTGAGTCACCTATGGCA2581
omega-3 fatty acidAGTTGGGTGATTTGAGAATGTGGGCTAAGGCCACTTCCAAGAATC
desaturaseTATGCCAGGCCCAGAAGTGGAGCTTCATG
Petroselinum crispumCATGAAGCTCCACTTCTGGGCCTGGCATAGATTCTTGGAAGTGGC2582
Ser7 TermCTTAGCCCACATTCTCAAATCACCCAACTTGCCATAGGTGACTCAG
TCA-TGAAACTCAAAAAAAACAAAGAAGAGGAGGATA
GGTGATTTGAGAATGTG2583
CACATTCTCAAATCACC2584
Reducing linolenic acidTCCTCCTCTTCTTTGTTTTTTTTGAGTTCTGAGTCACCTATGGCAAG2585
omega-3 fatty acidTTGGGTGATTTCATAATGTGGGCTAAGGCCACTTCCAAGAATCTAT
desaturaseGCCAGGCCCAGAAGTGGAGCTTCATGTT
Petroselinum crispumAACATGAAGCTCCACTTCTGGGCCTGGCATAGATTCTTGGAAGTG2586
Glu8 TermGCCTTAGCCCACATTATGAAATCACCCAACTTGCCATAGGTGACTC
GAA-TAAAGAACTCAAAAAAAACAAAGAAGAGGAGGA
TGATTTCATAATGTGGG2587
CCCACATTATGAAATCA2588
Reducing linolenic acidCTCTTCTTTGTTTTTTTTGAGTTCTGAGTCACCTATGGCAAGTTGGG2589
omega-3 fatty acidTGATTTCAGAATGAGGGCTAAGGCCACTTCCAAGAATCTATGCCA
desaturaseGGCCCAGAAGTGGAGCTTCATGTTTCAAC
Petroselinum crispumGTTGAAACATGAAGCTCCACTTCTGGGCCTGGCATAGATTCTTGG2590
Cys9 TermAAGTGGCCTTAGCCCTCATTCTGAAATCACCCAACTTGCCATAGGT
TGT-TGAGACTCAGAACTCAAAAAAAACAAAGAAGAG
TCAGAATGAGGGCTAAG2591
CTTAGCCCTCATTCTGA2592
Reducing linolenic acidATGAAGCAGCAACAGTACAAAGACACCCCAATTCTAAATGGCGTTA2593
omega-3 fatty acidATGGTTTTCATGCTTAAGAAGAAGAAGAAGAAGAGGATTTCGACTT
desaturaseAAGCAATCCTCCTCCATTCAATATTGGTC
Vernicia fordiiGACCAATATTGAATGGAGGAGGATTGCTTAAGTCGAAATCCTCTTC2594
Lys21 TermTTCTTCTTCTTCTTAAGCATGAAAACCATTAACGCCATTTAGAATTG
AAA-TAAGGGTGTCTTTGTACTGTTGCTGCTTCAT
TTCATGCTTAAGAAGAA2595
TTCTTCTTAAGCATGAA2596
Reducing linolenic acidAAGCAGCAACAGTACAAAGACACCCCAATTCTAAATGGCGTTAATG2597
omega-3 fatty acidGTTTTCATGCTAAATAAGAAGAAGAAGAAGAGGATTTCGACTTAAG
desaturaseCAATCCTCCTCCATTCAATATTGGTCAGA
Vernicia fordiiTCTGACCAATATTGAATGGAGGAGGATTGCTTAAGTCGAAATCCTC2598
Glu22 TermTTCTTCTTCTTCTTATTTAGCATGAAAACCATTAACGCCATTTAGAA
GAA-TAATTGGGGTGTCTTTGTACTGTTGCTGCTT
ATGCTAAATAAGAAGAA2599
TTCTTCTTATTTAGCAT2600
Reducing linolenic acidCAGCAACAGTACAAAGACACCCCAATTCTAAATGGCGTTAATGGTT2601
omega-3 fatty acidTTCATGCTAAAGAATAAGAAGAAGAAGAGGATTTCGACTTAAGCAA
desaturaseTCCTCCTCCATTCAATATTGGTCAGATCC
Vernicia fordiiGGATCTGACCAATATTGAATGGAGGAGGATTGCTTAAGTCGAAATC2602
Glu23 TermCTCTTCTTCTTCTTATTCTTTAGCATGAAAACCATTAACGCCATTTA
GAA-TAAGAATTGGGGTGTCTTTGTACTGTTGCTG
CTAAAGAATAAGAAGAA2603
TTCTTCTTATTCTTTAG2604
Reducing linolenic acidCAGCAACAGTACAAAGACACCCCAATTCTAAATGGCGTTAATGGTT2605
omega-3 fatty acidTTCATGCTAAAGAATAAGAAGAAGAAGAGGATTTCGACTTAAGCAA
desaturaseTCCTCCTCCATTCAATATTGGTCAGATCC
Vernicia fordiiGGATCTGACCAATATTGAATGGAGGAGGATTGCTTAAGTCGAAATC2606
Glu24 TermCTCTTCTTCTTCTTATTCTTTAGCATGAAAACCATTAACGCCATTTA
GAA-TAAGAATTGGGGTGTCTTTGTACTGTTGCTG
CTAAAGAATAAGAAGAA2607
TTCTTCTTATTCTTTAG2608
Reducing linolenic acidGGTCCAAGCACAGCCTCTACAACATGTTGGTAATGGTGCAGGGAA2609
omega-3 fatty acidAGAAGATCAAGCTTAGTTTGATCCAAGTGCTCCACCACCCTTCAAG
desaturaseATTGCAAATATCAGAGCAGCAATTCCAAAA
Glycine maxTTTTGGAATTGCTGCTCTGATATTTGCAATCTTGAAGGGTGGTGGA2610
Tyr21 TermGCACTTGGATCAAACTAAGCTTGATCTTCTTTCCCTGCACCATTAC
TAT-TAGCAACATGTTGTAGAGGCTGTGCTTGGACC
CAAGCTTAGTTTGATCC2611
GGATCAAACTAAGCCTG2612
Reducing linolenic acidGGTAATGGTGCAGGGAAAGAAGATCAAGCTTATTTTGATCCAAGT2613
omega-3 fatty acidGCTCCACCACCCTTCTAGATTGCAAATATCAGAGCAGCAATTCCAA
desaturaseAACATTGCTGGGAGAAGAACACATTGAGAT
Glycine maxATCTCAATGTGTTCTTCTCCCAGCAATGTTTTGGAATTGCTGCTCT2614
Lys31 TermGATATTTGCAATCTAGAAGGGTGGTGGAGCACTTGGATCAAAATAA
AAG-TAGGCTTGATCTTCTTTCCCTGCACCATTACC
CACCCTTCTAGATTGCA2615
TGCAATCTAGAAGGGTG2616
Reducing linolenic acidAAAGAAGATCAAGCTTATTTTGATCCAAGTGCTCCACCACCCTTCA2617
omega-3 fatty acidAGATTGCAAATATCTGAGCAGCAATTCCAAAACATTGCTGGGAGAA
desaturaseGAACACATTGAGATCTCTGAGTTATGTTC
Glycine maxGAACATAACTCAGAGATCTCAATGTGTTCTTCTCCCAGCAATGTTTT2618
Arg36 TermGGAATTGCTGCTCAGATATTTGCAATCTTGAAGGGTGGTGGAGCA
AGA-TGACTTGGATCAAAATAAGCTTGATCTTCTTT
CAAATATCTGAGCAGCA2619
TGCTGCTCAGATATTTG2620
Reducing linolenic acidTATTTTGATCCAAGTGCTCCACCACCCTTCAAGATTGCAAATATCA2621
omega-3 fatty acidGAGCAGCAATTCCATAACATTGCTGGGAGAAGAACACATTGAGAT
desaturaseCTCTGAGTTATGTTCTGAGGGATGTGTTGG
Glycine maxCCAACACATCCCTCAGAACATAACTCAGAGATCTCAATGTGTTCTT2622
Leu41 TermCTCCCAGCAATGTTATGGAATTGCTGCTCTGATATTTGCAATCTTG
AAA-TAAAAGGGTGGTGGAGCACTTGGATCAAAATA
CAATTCCATAACATTGC2623
GCAATGTTATGGAATTG2624
Reducing linolenic acidCATCCACCCGCACCCGCACCCGCCCCGCTGACGGCGGCAATGGC2625
omega-3 fatty acidCCGGCTCGTGCTCTCCTAGTGCTCGGGCCTCGCGCCCGTCCGCC
desaturaseGCCTGCGCGCCGGCCGGGGCGCCATTGCGGCGC
Zea maysGCGCCGCAATGGCGCCCCGGCCGGCGCGCAGGCGGCGGACGG2626
Glu8 TermGCGCGAGGCCCGAGCACTAGGAGAGCACGAGCCGGGCCATTGC
GAG-TAGCGCCGTCAGCGGGGCGGGTGCGGGTGCGGGTGGATG
TGCTCTCCTAGTGCTCG2627
CGAGCACTAGGAGAGCA2628
Reducing linolenic acidACCCGCACCCGCACCCGCCCCGCTGACGGCGGCAATGGCCCGG2629
omega-3 fatty acidCTCGTGCTCTCCGAGTGATCGGGCCTCGCGCCCGTCCGCCGCCT
desaturaseGCGCGCCGGCCGGGGCGCCATTGCGGCGCGGTCA
Zea maysTGACCGCGCCGCAATGGCGCCCCGGCCGGCGCGCAGGCGGCGG2630
Cys9 TermACGGGCGCGAGGCCCGATCACTCGGAGAGCACGAGCCGGGCCA
TGC-TGATTGCCGCCGTCAGCGGGGCGGGTGCGGGTGCGGGT
TCCGAGTGATCGGGCCT2631
AGGCCCGATCACTCGGA2632
Reducing linolenic acidCCGCACCCGCACCCGCCCCGCTGACGGCGGCAATGGCCCGGCT2633
omega-3 fatty acidCGTGCTCTCCGAGTGCTAGGGCCTCGCGCCCGTCCGCCGCCTGC
desaturaseGCGCCGGCCGGGGCGCCATTGCGGCGCGGTCACC
Zea maysGGTGACCGCGCCGCAATGGCGCCCCGGCCGGCGCGCAGGCGGC2634
Ser10 TermGGACGGGCGCGAGGCCCTAGCACTCGGAGAGCACGAGCCGGGC
TCG-TAGCATTGCCGCCGTCAGCGGGGCGGGTGCGGGTGCGG
CGAGTGCTAGGGCCTCG2635
CGAGGCCCTAGCACTCG2636
Reducing linolenic acidGCTCGGGCCTCGCGCCCGTCCGCCGCCTGCGCGCCGGCCGGGG2637
omega-3 fatty acidCGCCATTGCGGCGCGGTGACCCCCCGCGCTCTCCGCGGCGCCG
desaturaseCGCCGTCGTCCCGCGTCCGCGTCCATCCACCGCGA
Zea maysTCGCGGTGGATGGACGCGGACGCGGGACGACGGCGCGGCGCCG2638
Ser29 TermCGGAGAGCGCGGGGGGTCACCGCGCCGCAATGGCGCCCCGGCC
TCA-TGAGGCGCGCAGGCGGCGGACGGGCGCGAGGCCCGAGC
GGCGCGGTGACCCCCCG2639
CGGGGGGTCACCGCGCC2640
Reducing linolenic acidCCCCCTCCCCCACGCACACGCACAGATCCATCCGCGGCCATGGC2641
omega-3 fatty acidCCCCGCAATGAGGCCGTAGCAGGAGGCGAGCTGCAAGGCCACCG
desaturaseAGGACCACCGCTCCGAGTTCGACGCCGCCAAGC
Triticum aestivumGCTTGGCGGCGTCGAACTCGGAGCGGTGGTCCTCGGTGGCCTTG2642
Glu8 TermCAGCTCGCCTCCTGCTACGGCCTCATTGCGGGGGCCATGGCCGC
GAG-TAGGGATGGATCTGTGCGTGTGCGTGGGGGAGGGGG
TGAGGCCGTAGCAGGAG2643
CTCCTGCTACGGCCTCA2644
Reducing linolenic acidCCTCCCCCACGCACACGCACAGATCCATCCGCGGCCATGGCCCC2645
omega-3 fatty acidCGCAATGAGGCCGGAGTAGGAGGCGAGCTGCAAGGCCACCGAG
desaturaseGACCACCGCTCCGAGTTCGACGCCGCCAAGCCGC
Triticum aestivumGCGGCTTGGCGGCGTCGAACTCGGAGCGGTGGTCCTCGGTGGCC2646
Gln9 TermTTGCAGCTCGCCTCCTACTCCGGCCTCATTGCGGGGGCCATGGC
CAG-TAGCGCGGATGGATCTGTGCGTGTGCGTGGGGGAGG
GGCCGGAGTAGGAGGCG2647
CGCCTCCTACTCCGGCC2648
Reducing linolenic acidCCCCCACGCACACGCACAGATCCATCCGCGGCCATGGCCCCCGC2649
omega-3 fatty acidAATGAGGCCGGAGCAGTAGGCGAGCTGCAAGGCCACCGAGGACC
desaturaseACCGCTCCGAGTTCGACGCCGCCAAGCCGCCGC
Triticum aestivumGCGGCGGCTTGGCGGCGTCGAACTCGGAGCGGTGGTCCTCGGT2650
Glu10 TermGGCCTTGCAGCTCGCCTACTGCTCCGGCCTCATTGCGGGGGCCA
GAG-TAGTGGCCGCGGATGGATCTGTGCGTGTGCGTGGGGG
CGGAGCAGTAGGCGAGC2651
GCTCGCCTACTGCTCCG2652
Reducing linolenic acidACGCACAGATCCATCCGCGGCCATGGCCCCCGCAATGAGGCCGG2653
omega-3 fatty acidAGCAGGAGGCGAGCTGAAAGGCCACCGAGGACCACCGCTCCGA
desaturaseGTTCGACGCCGCCAAGCCGCCGCCCTTCCGCATC
Triticum aestivumGATGCGGAAGGGCGGCGGCTTGGCGGCGTCGAACTCGGAGCGG2654
Cys13 TermTGGTCCTCGGTGGCCTTTCAGCTCGCCTCCTGCTCCGGCCTCATT
TGC-TGAGCGGGGGCCATGGCCGCGGATGGATCTGTGCGT
GCGAGCTGAAAGGCCAC2655
GTGGCCTTTCAGCTCGC2656
Reducing linolenic acidCTTCACAAATCACAAATCGGAATCAGATCCACCACGACACCCCGG2657
omega-3 fatty acidCGGCAATGGCGGCGTAGGCGACCCAGGAGGCCGACTGCAAGGC
desaturaseTTCCGAGGACGCCCGTCTCTTCTTCGACGCCGC
Oryza sativaGCGGCGTCGAAGAAGAGACGGGCGTCCTCGGAAGCCTTGCAGTC2658
Ser4 TermGGCCTCCTGGGTCGCCTACGCCGCCATTGCCGCCGGGGTGTCGT
TCG-TAGGGTGGATCTGATTCCGATTTGTGATTTGTGAAG
GGCGGCGTAGGCGACCC2659
GGGTCGCCTACGCCGCC2660
Reducing linolenic acidATCACAAATCGGAATCAGATCCACCACGACACCCCGGCGGCAATG2661
omega-3 fatty acidGCGGCGTCGGCGACCTAGGAGGCCGACTGCAAGGCTTCCGAGGA
desaturaseCGCCCGTCTCTTCTTCGACGCCGCCAAGCCCC
Oryza sativaGGGGCTTGGCGGCGTCGAAGAAGAGACGGGCGTCCTCGGAAGC2662
Gln7 TermCTTGCAGTCGGCCTCCTAGGTCGCCGACGCCGCCATTGCCGCCG
CAG-TAGGGGTGTCGTGGTGGATCTGATTCCGATTTGTGAT
CGGCGACCTAGGAGGCC2663
GGCCTCCTAGGTCGCCG2664
Reducing linolenic acidACAAATCGGAATCAGATCCACCACGACACCCCGGCGGCAATGGC2665
omega-3 fatty acidGGCGTCGGCGACCCAGTAGGCCGACTGCAAGGCTTCCGAGGACG
desaturaseCCCGTCTCTTCTTCGACGCCGCCAAGCCCCCGC
Oryza sativaGCGGGGGCTTGGCGGCGTCGAAGAAGAGACGGGCGTCCTCGGA2666
Glu8 TermAGCCTTGCAGTCGGCCTACTGGGTCGCCGACGCCGCCATTGCCG
GAG-TAGCCGGGGTGTCGTGGTGGATCTGATTCCGATTTGT
CGACCCAGTAGGCCGAC2667
GTCGGCCTACTGGGTCG2668
Reducing linolenic acidTCAGATCCACCACGACACCCCGGCGGCAATGGCGGCGTCGGCGA2669
omega-3 fatty acidCCCAGGAGGCCGACTGAAAGGCTTCCGAGGACGCCCGTCTCTTC
desaturaseTTCGACGCCGCCAAGCCCCCGCCCTTCCGCATC
Oryza sativaGATGCGGAAGGGCGGGGGCTTGGCGGCGTCGAAGAAGAGACGG2670
Cys10 TermGCGTCCTCGGAAGCCTTTCAGTCGGCCTCCTGGGTCGCCGACGC
TGC-TGACGCCATTGCCGCCGGGGTGTCGTGGTGGATCTGA
GCCGACTGAAAGGCTTC2671