Title:
Interleukin-5 specific recombinant antibodies
United States Patent RE39548
Abstract:
An effective anti-IL-5 recombinant antibody molecule comprising heavy and/or light chain antigen-binding residues from a donor antibody.


Inventors:
Bodmer, Mark William (Cambridge, GB)
Athwal, Diljeet Singh (London, GB)
Emtage, John Spencer (Del Mar, CA, US)
Application Number:
10/012579
Publication Date:
04/03/2007
Filing Date:
12/07/2001
Export Citation:
Assignee:
Celltech R&D Limited (Slough, Berkshire, GB)
Primary Class:
Other Classes:
424/133.1, 424/145.1, 435/69.6, 435/69.7, 435/328, 435/335, 530/388.1, 530/388.23
International Classes:
C12P21/08; C07K16/24; A61K38/00
Field of Search:
424/145.1, 435/328, 424/133.1, 530/388.23, 435/335, 435/69.6, 530/387.3, 530/388.1, 435/69.7
View Patent Images:
US Patent References:
5998586Interleukin-5 specific recombinant antibodiesDecember, 1999Bodmer et al.
5585089Humanized immunoglobulinsDecember, 1996Queen et al.
Foreign References:
EP0120694March, 1984Processes for the production of multichain polypeptides or proteins.
EP0239400August, 1984Recombinant antibodies and methods for their production.
EP0125023November, 1984Recombinant immunoglobulin preparations, methods for their preparation, DNA sequences, expression vectors and recombinant host cells therefor.
WO/1990/007861July, 1990CHIMERIC IMMUNOGLOBULINS SPECIFIC FOR p55 TAC PROTEIN OF THE IL-2 RECEPTOR
WO/1991/009967July, 1991HUMANISED ANTIBODIES
WO/1993/016184August, 1993DESIGN, CLONING AND EXPRESSION OF HUMANIZED MONOCLONAL ANTIBODIES AGAINST HUMAN INTERLEUKIN-5
WO/1993/016814September, 1993APPARATUS FOR THE GENERATION OF ULTRASONIC FIELDS IN LIQUIDS
Other References:
Rudikoff et al Proc NAtl Acad Sci USA vol. 79:1979.
Maniatis et al., “Molecular Cloning: A Laboratory Manual,” vols. 1-3, Second Edition, Cold Spring Harbor Laboratory Press (1989).
Bergent, et al., Br. J. Cancer, 62. 487, (1990).
Cockett, et al., Nucl. Acids Res., 19, 319-325 (1991).
Jones, P. et al., “Replacing the complementarity-determining regions in a human antibody with those from a mouse”. Nature, 321, 522-525, (1986).
Queen, et al., “A humanized antibody that binds to the interleukin 2 receptor”, Proc. Natl. Acad. Sci. USA, 86, 10029-10033 (1989).
Riechmann, et al., “Reshaping human antibodies for therapy”, Nature, 332, 323-327 (1988).
Verhoeyen, et al., Science, 239, 1534-1536 (19888).
Rudikoff et al Proc Natl Acad Sci USA vol. 79:1979, 1982.
Bergent, R.H.J. et al., “Phase I/II Study of Chimeric B72.3 Antibody in Radioimmunotherapy of Colorectal Carcinoma,” British Journal Cancer., 62:487, (1990), Cancer Research Campaign Laboratories, Charing Cross Hospital, London and Celltech Ltd., Slough, United Kingdom.
Cockett, Mark I. et al., “The Use of Engineered E1A Genes to Transactivate the hCMV-MIE Promoter in Permanent CHO Cell Lines.” Nucleic Acids Res., 19(2):319-325, (1991), Celltech Ltd., Slough, United Kingdom.
Jones, Peter T. et al., “Replacing the complementarity-determining regions in a human antibody with those from a mouse,” Nature, 321:522-525, (1986), Laboratory of Molecular Biology, Medical Research Council, Cambridge, United Kingdom.
Kabat et al., “Sequences of Proteins of Immunological Interest,”1987, U.S. Dept. of Health and Human Services, National Institute of Health, USA.
Kabat et al., “Sequences of Proteins of Immunological Interest,” vol. I, Fifth Edition, 1991, U.S. Dept. of Health and Human Services, National Institute of Health, USA.
Mauser, Peter J. et al., “Effects of an Antibody to Interleukin-5 in a Monkey Model of Asthma,” Am. J. Respir. Crit. Care Med., 152:467-472, (1995), Department of Allergy, Schering-Plough Research Institute, Kenilworth, New Jersey.
Queen, Cary L. et al., “A humanized antibody that binds to the interleukin 2 receptor,” Proc. Natl. Acad. Sci. USA, 86:10029-10033, (1989), Protein Design Labs, Palo Alto, CA, Department of Cell Biology, Stanford University, Stanford, CA and Metabolisan Branch, National Cancer Institute, National Institute of Health, Bethesda, MD.
Riechmann, Lutz et al., “Reshaping human antibodies for therapy,” Nature, 332:323-327, (1988), MRC Laboratory of Molecular Biology, Cambridge, United Kingdom, Department of Pathology, University of Cambrigde, Cambridge, United Kingdom.
Rudikoff Stuart et al., “Single amino acid substitution altering antigen-binding specificity,” Proc. Natl. Acad. Sci USA, 79:1979-1983 (1982), Laboratory of Cell Biology, National institutes of Health, Bethesda, MD and Department of Cell Biology, Albert Einstein College of Medicine, Bronx, NY.
Verhoeyen, Martine et al., “Reshaping Human Antibodies: Grafting on Antilysozyme Activity,” Science, 239:1534-1536, (1988), Medical Research Council Laboratory of Moleular Biology, Cambridge, England.
Primary Examiner:
Huff, Sheela J.
Attorney, Agent or Firm:
Trujillo, Doreen Y.
O'connor, Cozen P. C.
Claims:
We claim:

1. A recombinant antibody molecule that specifically binds human Interleukin-5 antigen comprising a composite heavy chain and a composite light chain, said composite heavy chain and light chain forming a variable domain comprising acceptor antibody framework residues, said variable domain comprising corresponding donor residues from murine monoclonal 39D10 heavy chain variable region consisting of the sequence of SEQ ID No:6 at residues 31-35, 50-65 and 95-102 and at framework residues 23, 24, 27-30, 37, 49, 73, 76, 77, and 78, and corresponding donor residues from murine monoclonal antibody 39D10 light chain variable region consisting of the sequence of SEQ ID No:8 at residues 24—34, 50-56 and 89-97 and at framework residues 22, 68, and 71 according to the Kabat numbering system.

2. An antibody molecule according to claim 1 wherein the acceptor antibody framework residues for the composite heavy chain are human group III heavy chain residues, and the acceptor antibody framework residues for the composite light chain are human group I light chain residues.

3. A recombinant antibody molecule that specifically binds human Interleukin-5 antigen, comprising the a heavy chain variable region amino acid sequence comprising residues 20-135 of SEQ ID No: 28, and the a light chain variable region amino acid sequence comprising residues 21-128 of SEQ ID No: 26.

4. A composition comprising the antibody molecule of any one of claims 1, 2, or 3 in combination with a pharmaceutically acceptable carrier, diluent or excipient.

5. A recombinant antibody molecule that specifically binds human interleukin-5 antigen comprising a composite heavy chain and a composite light chain, said composite heavy chain and light chain forming a variable domain comprising acceptor antibody framework residues, said variable domain comprising corresponding donor residues from murine monoclonal antibody 39D10 heavy chain variable region consisting of the sequence of SEQ ID NO:6 at residues 31-35, 50-65 and 95-102 and at framework residues 24, 27-30, 37, 49, 73, 76 and 78, and corresponding donor residues from murine monoclonal antibody 39D10 light chain variable region consisting of the sequence of SEQ ID No:8 at residues 24-34, 50-56 and 89-97 and at framework residues 68 and 71 according to the Kabat number system.

6. A recombinant antibody molecule that specifically binds human Interleukin-5 antigen, comprising a heavy chain variable region encoded by SEQ ID No: 27 and a light chain variable region encoded by SEQ ID No:25.

7. A composition comprising the antibody molecule of any one of claims 5 or 6 in combination with a pharmaceutically acceptable carrier, diluent, or excipient.

Description:

The present invention relates to a recombinant antibody molecule (RAM), and especially a humanized antibody molecule (HAM) having specificity for human interleukin-5 (hIL-5), the nucleic acids which encode the heavy and light chain variable domains of said recombinant antibody, a process for producing said antibody using recombinant DNA technology and the therapeutic use of the recombinant antibody.

In the present application, the term “recombinant antibody molecule” (RAM) is used to describe an antibody produced by a process involving the use of recombinant DNA technology. The term “humanized antibody molecule” (HAM) is used to describe a molecule being derived from a human immunoglobulin. The antigen binding site may comprise either complete variable domains fused onto constant domains or one of more complementary determining regions (CDRs) grafted onto appropriate framework regions in the variable domain. The abbreviation “MAb” is used to indicate a monoclonal antibody.

The term “recombinant antibody molecule” includes not only complete immunoglobulin molecules but also any antigen binding immunoglobulin fragments, such as Pv, Fab and F(ab′)2 fragments, and any derivatives thereof, such as single chain Fv fragments.

Natural immunoglobulins have been used in assay, diagnosis and, to a limited extent, therapy. The use of immunoglobullins in therapy has been hindered as most antibodies of potential use as therapeutic agents are MAbs produced by fusions of a rodent spleen cells with rodent myeloma cells. These MAbs are therefore essentially rodent proteins. The use of these MAbs as therapeutic agents in human can give rise to an undesirable immune response termed the HAMA (Human Anti-mouse Antibody) response. The use of rodent MAbs as therapeutic agents in humans is inherently limited by the fact that the human subject will mount as immunological response to the MAb which would either remove it entirely or at least reduce its effectiveness.

A number of techniques to reduce the antigenic characteristics of such non-human MAbs have been developed. These techniques generally involve the use of recombinant DNA technology to manipulate DNA sequences encoding the polypeptide chains of the antibody molecule. These methods are generally termed “humanization” techniques.

Early methods for humanizing MAbs involved the production of chimeric antibodies in which an antigen binding site comprising the complete variable domains of one antibody are fused to constant domains derived from another antibody. Methods for carrying out such chimerisation procedures are described in EP 0120694 (Celltech Limited) and EP 0125023 (Genetech Inc. and City of Hope), Humanized chimeric antibodies, however, still contain a significant portion of non-human amino acid sequences, and can still ellcit some HAMA response, particularly if administered over a prolonged period [Begent et al. Br. J. Cancer, 62, 487 (1990)].

An alternative approach described in EP-A-0239400 (Winter), involves the grafting of the complementarity determining region (CDRs) of a mouse MAb on to framework regions of the variable domains of a human immunoglobulin using recombinant DNA techniques. There are three CDRs (CDR1, CDR2 and CDR3) in each of the heavy and light chain variable domains. Such CDR-grafted humanized antibodies are much less likely to give rise to a HAMA response than humanized chimeric antibodies in view of the much lower proportion of non-human amino acid sequences which they contain. In Riechmann et al [Nature, 332 323-324 (1988)] it was found that the transfer of the CDRs alone, as defined by Kabat [Sequences or Proteins of Immunological Interest. US Department of Health and Human Services. NTH, USA (1987)], was not sufficient to provide satisfactory antigen binding activity in the CDR-grafted product. Riechmann et al. found that it was necessary to convert a number of residues outside the CDRs, in particular in the loop adjacent CDR1. However, the binding affinity of the best CDR-grafted antibodies obtained was still significantly less than that of the original MAb.

In WO 91/09967, Adair et al. described CDR-grafted antibody heavy and light chains, and determined a hierarchy of donor residues.

In WO 93/16184, Chou et al. described the design, cloning and expression of humanized monoclonal antibodies against human interleukin-5. A method for selecting human antibody sequences to be used as human frameworks for humanization of an animal antibody is suggested, comprising the steps of comparing human variable domain sequences with the variable domain sequences of the animal MAb that is to be humanized for percentage identities, sequence ambiguities and similar PIN-region spacing, PIN-region spacing is defined as the number of residues between the cysteine residues forming the intra domain disulfide bridges. The human antibody having the best combination of these features is selected. A method for determining which variable domain residues of an animal MAb which should be selected for humanization is also suggested, comprising determining potential minimum residues (residues which comprise CDR structural loops and the residues required to support and/or orientate the CDR structural loops) and maximum residues (residues which comprise Kabat CDRs, CDR structural loops, residues required to support and/or orientate the CDR structural loops and residues which fall within about 10 Å of a CDR structural loop and posses a water solvent accessible surface of about 5 Å2 or greater) of the animal monoclonal antibody. Furthermore, computer modelling is performed on all possible recombinant antibodies, comprising the human antibody framework sequence into which minimum and maximum residues have been inserted. The minimum or maximum residues are selected based on the combination which produces a recombinant antibody having a computer-model structure closest to that of the animal monoclonal antibody. The humanized and-IL-5 antibody obtained appears to have lost a substantial amount of its affinity for the hIL-5 molecule.

It is an aim of the present invention to provide a humanized antibody molecule having improved affinity for the hIL-5 molecule.

Accordingly the present invention provides a RAM having affinity for human IL-5 and comprising antigen binding regions derived from heavy and/or light chain variable domains of a donor antibody having affinity for human IL-5, the RAM having a binding affinity similar to that of the donor antibody.

The RAM of invention may comprise antigen binding regions from any suitable donor anti-IL5 antibody. Typically the donor anti-IL-5 antibody is a rodent MAb. Preferably the donor antibody is MAb 39D10.

The variable domains of the heavy and light chains of MAb 39D10 are hereinafter specifically described with reference to FIGS. 1 and 2.

According to one preferred aspect of the invention, the RAM of the present invention is an anti-IL-5 antibody molecule having affinity for the human IL-5 antigen comprising a composite heavy chain and a complementary light chain, said composite heavy chain having a variable domain comprising predominantly acceptor antibody heavy chain framework residues and donor antibody heavy chain antigen-binding residues, said donor antibody having affinity for human IL-5, wherein said composite heavy chain comprises donor residues at least at positions 31-35, 50-65 and 95-102 (according to the Kabat numbering system) [Kabat et al., sequences of Proteins of Immunological Interest, Vol I. Fifth Edition, 1991, US Department of Health and Human Services, National Institute of Health].

Preferably, the composite heavy chain framework additionally comprises donor residues at positions 23, 24, 27-30, 37, 49, 73 and 76-78 or 24, 27-30, 37, 49, 73, 76 and 78.

According to a second preferred aspect of the present invention, there is provided an anti-IL-5 antibody molecule having affinity for a human IL-5 antigen comprising a composite light chain and a complementary heavy chain, said composite light chain having a variable domain comprising predominantly acceptor antibody light chain framework residues and donor antibody light chain antigen-binding residues, said donor antibody having affinity for human IL-5, wherein said composite light chain comprises donor residues at least at positions 24-30, 50-56 and 89-97 (according to the Kabat numbering system).

Preferably, the composite light chain framework additionally comprises donor residues at positions 22, 68 and 71 or at positions 68 and 71.

According to a third preferred aspect of the present invention, there is provided an anti-IL-5 antibody molecule having affinity for a human IL-5 antigen comprising a composite heavy chain according to the first aspect of the invention and a composite light chain according to the second aspect of the invention.

Preferably, each RAM of the invention has an affinity constant for human IL-5 of greater than 10−9M.

It will be appreciated that the invention is widely applicable to the production of anti-IL-5 RAMs in general. Thus, the donor antibody may be any anti-IL-5 antibody derived from any animal. The acceptor antibody may be derived from an animal of the same species and may even be of the same antibody class or sub-class. More usually, however, the donor and acceptor antibodies are derived from animals from different species. Typically, the donor anti-IL-5 antibody is a non-human antibody, such as rodent MAb, and the acceptor antibody is a human antibody.

Any appropriate acceptor variable framework sequence may be used having regard to class or type of the donor antibody from which the antigen binding regions are derived. Preferably, the type of acceptor framework used is of the same or similar or type as that of the donor antibody. Conveniently, the framework chosen has the most homology to the donor antibody. Preferably, the human group II gamma germ line frameworks are used for the composite heavy chain and the human group I kappa germ line frameworks are used for the composite light chains.

The constant region domains of the RAMs of the invention may be selected having regard to the proposed functions of the antibody, in particular the effector functions which may be required. For example, the constant regions domains may be human IgA, IgE, IgG or IgM domains. In particular, IgG human constant region domains may be used, especially of the IgG1 and IgG3 isotype, when the humanized antibody molecule is intended for therapeutic uses, and antibody effector functions are required. Alternatively, IgG2 and IgG4 isotypes may be used where the humanized antibody molecule is intended for therapeutic purposes and antibody effector functions are not required, e.g. for specifically binding to and neutralizing the biological activity of human IL-5. Modified human constant region domains may also be used in which one or more amino acid residues have been altered or deleted to change a particular effector function. Preferably, the constant region domains of the RAMs are human IgG4.

The residue designations given above and elsewhere in the present application are numbered according to the Kabat numbering [Kabat et al. Sequences of Proteins of Immunological Interest, Vol I. Fifth Edition, 1991, US Department of Health and Human Services, National Institute of Health]. Thus, the residue designations do not always correspond directly with a linear numbering of the amino acid residues. The actual linear amino acid sequence may contain fewer or additional amino acids than in the Kabat numbering, corresponding to a shortening of, or insertion into, the basic variable domain structure.

Also the anti-IL-5 antibody molecules of the present invention may have attached to them effector or reporter molecules. Alternatively, the procedure of recombinant DNA technology may be used to produce immunoglobulin molecules in which the Fc fragment or CH3 domain of a complete immunoglobuln has been replaced by, or has been attached thereto by peptide linkage, a functional non-immunoglobulin protein, such as an enzyme, cytokine, growth factor or toxin molecule.

Thus, the remainder of the antibody molecules need not comprise only sequences from immunoglobulins. For instance, a gene may be constructed in which a DNA sequence encoding part of a human immunoglobulin chain is fused to a DNA sequence encoding the amino acid sequence of a polypeptide effector or reporter molecule.

Further aspects of the invention include DNA sequences coding for the composite heavy chain and the composite light chain. The cloning and expression vectors containing the DNA sequences, host cells transformed with the DNA sequences and the processes for producing the antibody molecules comprising expressing the DNA sequences in the transformed host cells are also further aspects of the invention.

The general methods by which vectors may be constructed, transfection methods and culture methods are well known in the art and form no part of the invention.

The DNA sequences which encode the anti-IL-5 donor amino acid sequences may be obtained by methods well known in the art (see, for example, International Patent Application No. WO 93/16184). For example, the anti-IL-5 coding sequences may be obtained by genomic cloning or cDNA cloning from suitable hybridoma cell lines, e.g. the 39D10 cell line. Positive clones may be screened using appropriate probes for the heavy and light chains required. Also PCR cloning may be used.

The DNA coding for acceptor amino acid sequences may be obtained in any appropriate way. For example, DNA sequences coding for preferred human acceptor frameworks such as human group I light chains and human group III heavy chains, are widely available to workers in the art.

The standard techniques of molecules biology may be used to prepare the desired DNA sequences. The sequences may be synthesized completely or in part using oligonucleotide synthesis techniques. Site-directed mutagenesis and polymerase chain reaction (PCR) techniques may be used as appropriate. For example, oligonucleotide directed synthesis as described by Jones et al. [Nature, 321, 522 (1986)] may be used. Also ologonucleotide directed mutagenesis of a pre-existing variable regions as, for example, described by Verhoeyen et al. [Science, 239, 1534-1536 (1988)] may be used. Also enzymatic filling in of gapped oligonucleotides using T4 DNa polymerase as, for example, described by Queen et al. [Proc. Natl. Acad. Sci. USA, 86, 10029-10033 (1989) and WO 90/07861] may be used.

Any suitable host cell and vector system may be used for the expression of DNA sequences coding for the RAM. Preferably, eucaryotic, e.g. mammalian, host cell expression systems are used. In particular, suitable mammalian host cells include CHO cells and myeloma or hybridoma cell lines.

Thus, according to a further aspect of the present invention a process for producing an anti-IL-5 RAM is provided comprising:

(a) producing in a first expression vector a first operon having a DNA sequence which encodes a composite heavy chain, as defined according to the first preferred aspect of the invention;

(b) optionally producing in the first or a second expression vector a second operon having a DNA sequence which encodes a complementary light chain, which may be a composite light chain as defined according to the second preferred aspect of the invention;

(c) transfecting a host cell with the or each vector; and

(d) culturing a transfected cell line to produce the RAM.

Alternatively, the process may involve the use of sequences encoding a composite light chain and a complementary heavy chain.

For the production of RAMs comprising both heavy and light chains, the cell lines may be transfected with two vectors. The first vector may contain an operon encoding a composite or complementary heavy chain and the second vector may contain an operon encoding a complementary or composite light chain. Preferably, the vectors are identical except insofar as the coding sequences and selectable markers are concerned so as to ensure as far as possible that each polypeptide chain is equally expressed. In a preferred alternative, a single vector may be used, the vector including the sequences encoding both the heavy chain and the light chain.

The DNA in the coding sequences for the heavy and light chains may comprise cDNA or genomic DNA or both.

The present invention also includes therapeutic and diagnostic compositions comprising the RAMS and uses of such compositions in therapy and diagnosis.

Accordingly, in a further aspect the invention provides a therapeutic or diagnostic composition comprising a RAM according to previous aspects of the invention in combination with a pharmaceutically acceptable excipient, diluent or carrier.

These compositions can be prepared using the RAMs of the present invention, for instance as whole antibodies, single chain Pv fragments or antibody fragments, such as Fab or Fv fragments. Such composition have IL-5 blocking or antagonistic effects and can be used to suppress IL-5 activity.

The compositions according to the invention may be formulated in accordance with conventional practice for administration by any suitable route, and may generally be in a liquid form [e.g. a solution of the RAM in a sterile physiologically acceptable buffer] for administration by for example an intravenous, intraperitoneal or intramuscular route; in spray form, for example for administration by a nasal or buccal route; or in a form suitable for implantation.

The invention also provides a method of therapy or diagnosis comprising administering an effective amount, preferably 0.1 to 10 mg/kg body weight, of a RAM according to previous aspects of the invention to a human or animal subject. The exact dosage and total dose will vary according to the intended use of the RAM and on the age and condition of the patient to be treated. The RAM may be administered as a single dose, or in a continuous manner over a period of time. Doses may be repeated as appropriate.

The RAM according to previous aspects of the invention may be used for any of the therapeutic uses for which anti-IL-5 antibodies, e.g. 39D10, have been used or may be used in the future.

IL-5 is a primary activator or eosinophils, and blocking the function of this cytokine with antibodies has been shown to prevent or reduce eosinophilia which is associated with certain allergic diseases. Thus the RA according to the invention may be used for this purpose, and in particular may be of use in the treatment of asthma, where it may be expected to prevent the accumulation and activation of eosinophilis in asthmatic lungs, thereby reducing bronchial inflammation and airway narrowing. For use in the treatment of asthma the RAM according to the invention may advantageously be a single chain Fv fragment, formulated as a spray, for administration for example via the nasal route.

A preferred protocol for obtaining an anti-IL-5 antibody molecule in accordance with the present invention is set out below. This protocol is given without prejudice to the generality of the invention as hereinbefore described and defined.

The 39D10 rat monoclonal antibody raised against human IL-5 is used as the donor antibody. The variable domains of the heavy and light chains of 39D10 have previously been cloned (WO 93/16184) and the nucleotide and predicted amino acid sequences of these domains are shown in FIGS. 1 and 2. The appropriate acceptor heavy and light chain variable domains must be determined and the amino acid sequence known. The RAM is then designed starting from the basis of the acceptor sequence.

1. The CDRs

At a first step, donor residues are substituted for acceptor residues in the CDRs. For this purpose, the CDRs are preferably defined as follows:

    • heavy chain:
    • CDR1: residues 31-35
    • CDR2: residues 50-65
    • CDR3: residues 95-102 light chain;
    • CDR1: residues 24-34
    • CDR2: residues 50 to 56
    • CDR3: residues 89 to 97

The positions at which donor residues are to be substituted for acceptor residues in the framework are then chosen as follows, first of all with respect to the heavy chain and subsequently with respect to the light chain.

2. HEAVY CHAIN

2.1. Donor residues are used either at all of positions 24, 27 to 30, 37, 49, 73, 76 and 78 or at all of positions 23, 24, 27 to 30, 37, 49, 73 and 76 to 78 of the heavy chain.

3. LIGHT CHAIN

3.1. Donor residues are used either at all of positions 22, 68 and 71 or at all of positions 68 and 71.

The present invention relates to a recombinant anti-IL-5 antibody molecule having a binding affinity substantially equal to that of the donor antibody. The present invention is now described, by way of example only, with references to the accompanying drawings, in which:

FIG. 1 shows the nucleotide and amino acid sequence of the 39D10 heavy chain;

FIG. 2 shows the nucleotide and amino acid sequence of the 39D10 light chain;

FIG. 3 shows the alignment of the 39D10 lightheavy chain variable domain framework regions with the lightheavy chain variable domain framework regions of the consensus sequence of the human group IIII lightheavy chains;

FIG. 4 shows the alignment of the 39D10 heavylight chain variable domain framework regions with the heavylight chain variable domain framework regions of the consensus sequence of the human group IIII heavylight chains;

FIG. 5 shows the nucleotide and amino acid sequence of the CDR grafted anti-IL-5 light chain CTIL-5-gL6; . The first twenty amino acid residues of SEQ ID No: 26 represent a leader sequence. The first amino acid residue of the mature protein is residue 21.

FIG. 6 shows the nucleotide and amino acid sequence of the CDR grafted anti-IL-5 heavy chain CTIL-5-10gH; .The first nineteen amino acid residues SEQ ID No: 28 represent a leader sequence. The first amino acid residue of the mature protein is residue 20.

FIG. 7 shows a map of plasmid pMR14;

FIG. 8 shows a map of plasmid pMR15.1;

FIG. 9 shows the affinity constants and association and disassociation rates of a chimeric 39D10 antibody and the CTIL-5-10gH-gL6 antibody;

FIG. 10 shows a graph of the neutralisation of IL-5 in the TF1 assay by a panel of antibodies;

FIG. 11 shows the results of a competition assay for rat 39D10, a chimeric 39D10 antibody and the CTIL-5-10gH/gL6 antibody; and

FIG. 12 shows the effect of CTIL-5-10gH/gL6 on monkey eosinophilia.

EXAMPLE

1. MATERIAL AND METHODS

39D10 is a rat monoclonal antibody raised against human IL-5. The genes for the variable domains of the heavy and light chains of 39D10 have previously been cloned (WO 93/16184) and the nucleotide and predicted amino acid sequences of these domains are shown in FIGS. 1 and 2. Because of the strategy used in the cloning of the variable domain of the 3gD10 heavy chain, the first five amino acids of the framework regions are unknown. However, a heavy chain was available which contained the leader sequence and the first five amino acids of framework 1 from the antibody YTH 34.5HL. Riechmann et al., [Nature, 332, 323-327 (1988)].

2. MOLECULAR BIOLOGY PROCEDURES

The molecular biology procedures used were as described in Maniatis et al. [Molecular Cloning: A Laboratory Manual, Second Edition, Vols 1 to 3. Cold Spring Harbor Laboratory Press (1989) .

3. CONSTRUCTION OF RECOMBINANT HEAVY AND LIGHT CHAIN GENES

Heavy Chain

A heavy chain Vh region was generated by PCR using the oligonucleotides R3601 and R2155. The sequences of these are:

R3601 5′GCGCGCAAGCTTGCGCCACCATGAAG(A, T)TGTGGTTAAACTGGGTTT3′SEQ ID NO:1
R2155 5′GCAGATGGGCCCTTCGTTGAGGCTG(A, C)(A, G)GAGAC(G, T, A)SEQ ID NO:2

The reaction mixture (100 μl) contained 10 mM Tris-HCl pH 8.3, 1.5 mM MgCl, 50 mM KCl, 0.01% w/v gelatin, 0.25 mM of each deoxyribonucleoside triphosphate, 0.1 μg 39D10 heavy chain DNA, 6 pmoles of R3601 and R2155 and 0.25 units. Taq polymerase. The reaction mixture was heated at 94° C. for 5 minutes and then cycled through 94° C. for 1 minute, 55° C. for 1 minute and 72° C. for 1 minute. After 30 cycles, the reaction was extracted with an equal volume of phenol/chloroform (1:1 v/v), then with chloroform before being precipitated by the addition of 2.5 volumes of ethanol. The PCR product was dissolved in the appropriate buffer, digested with HindIII and ApaI. purified on an agarose gel and ligated into the vector pMR14 (FIG. 7) which had also been digested with HindIII and ApaI. Following transformation into E. coli LM1035, colonies were grown overnight and plasmid DNA analysed for Vh inserts. The nucleotide sequence of the Vh region in plasmid, pARH1217, is shown in FIG. 1.

Light Chain

A Vl light chain gene was generated from the original VL as described in WO 93/16184, clone by PCR with the oligonucleotides R3585 and R3597. The sequence of these are:

R3585 5′GGACTGTTCGAAGCCGCCACCATGAGTGTGCTCACTCAGGTCCT3′SEQ ID NO:3
R3597 5′GGATACAGTTGGTGCAGCATCCGTACGTTT3′SEQ ID NO:4

PCR was carried out as described above. The PCR product was digested with enzymes BstBI and SplI and, after purification, ligated into pMR15.1 (FIG. 8) that had previously been digested with the same enzymes.

A colony was identified, after transformation of E. coli LM1035, that contained a plasmid (pARH1215) with a Vl insert. The nucleotide sequence of the Vl insert is shown in FIG. 2.

CDR Grafting of 39D10

Light Chain

In order to decide on the most appropriate human acceptor frameworks for the CDR loops of 39D10, the main acid sequence of frameworks 1-3 of 39D10 were compared with those of known human kapps light chains, 39D10 was found to be most homologous to human group I light chains. Based on this, it was decided to use the human group I germ line frameworks for the CDR grafting. The homologies between these sequences are shown in FIG. 3. Also shown is the homology between the framework 4 regions of 39D10 and the consensus sequence of known human group I light chains. The residues in 39D10 that differ from the human consensus sequence are underlined. The contribution that these residues might make to antigen binding was analysed and two genes were constructed for the CDR grafted light chain. These were CTIL-5gL5 and CTIL-5gL6 in which, as well, as the CDR residents, either residues 22, 68 and 71 or residues 68 and 71 were also from 39D10 respectively. The nucleotide and amino acid sequences of CTIL-5-gL6 are shown in FIG. 5.

Heavy Chain

CDR grafting of the 39D10 heavy chain was carried out as described for the light chain. The framework regions of 39D10 were found to be most homologous to those of human group III antibodies and, consequently, the consensus sequence of the frameworks of the human group III germ line genes was used to accept the CDRs of the 39D10 heavy chain. As before, the consensus sequence for human group III framework 4 regions was also chosen. A comparison of these sequences is shown in FIG. 4 with the residues in 39D10 that differ from the human consensus sequence underlined.

Analysis of the framework residues in 39D10 that might influence antigen binding was carried out and, based on this, two genes, CTIL-5-9gH and CTIL-5-10gH, were constructed in which either residues 23, 24, 27 to 30, 37, 49, 73 and 76 to 78 or residues 24, 27-30, 37, 49, 73, 76 and 78 respectively were from 39D10. The nucleotide and amino acid sequences of CTIL-5-10gH is shown in FIG. 6.

Expression and Bioactivity of Anti-IL-5 Antibodies

Chimeric (rat/human) and CDR grafted 39D10 were produced for biological evaluation by transient expression of the heavy and light chain pairs after co-transfection into Chinese Hamster ovary (CHO) cells using calcium phosphate precipitation.

On the day prior to transfection, semi-confluent flasks of CHO-L76lh cells (Cockett et al. Nucl. Acids. Res., 19, 319-325, 1991) were trypsinised, the cells counted and T75 flasks set up each with 107 cells. On the next day, the culture medium was changed 3 hours before transfection. For transfection, the calcium phosphate precipitate was prepared by mixing 1.25 ml of 0.25 M CaCl2 containing 50 μg of each of heavy and light chain expression vectors with 1.25 ml of 2×HBS (16.36 g NaCl, 11.9 gm HEPES and 0.4 g Na2HPO4 in 1 liter water with the pH adjusted to 7.1 with NaOH) and adding immediately into the medium of the cells. After 3 hours at 37° C. in a CO2 incubator, the medium and precipitate were removed and the cells shocked by the addition of 15 ml 15% glycerol in phosphate buffered saline (PBS) for 1 minute. The glycerol was removed, the cells washed once with PBS and incubated for 48-96 hours in 25 ml medium containing 10 KM sodium butyrate. Antibody was purified from the culture medium by binding to and elution from protein A—Sepharose, Antibody concentration was determined using a human Ig ELISA (see below).

ELISA

Antibody expression was assessed by transfecting pairs of heavy and light chain genes into CHO cells and, after three days incubation, measuring the amount of antibody accumulating in the culture medium by ELISA.

For the ELISA, Nunc ELISA plates were coated overnight at 4° C. with a F(ab′)2 fragment of a polyclonal goat anti-human Fc fragment specific antibody (Jackson Immunoresearch, code 109-006-098) at 5 μg/ml in coating buffer (15 mM sodium carbonate, 35 mM sodium hydrogen carbonate, pH6.9). Uncoated antibody was removed by washing 5 times with distilled water. Samples and purified standards to be quantiated were diluted to approximately 1 μg/ml in conjugate buffer (0.1M Tris-HCl pH7.0 , 0.1M NaCl, 0.2% v/v Tween 20, 0.2% w/v Hammersten casein). The samples were titrated in the microtite wells in 2-fold dilutions to give a final volume of 0.1 in each well and the plates were incubated at room temperature for 1 hour with shaking. After the first incubation step, the plates were washed 10 times with distilled water and then incubated for 1 hour as before with 0.1 ml of a mouse monoclonal anti-human kapps (clone GD12) peroxidase conjugated anti-body (The Binding Site, code MP135) at a dilution of 1 in 700 in conjugate buffer. The plate was washed again and substrate solution (0.1 ml) added to each well. Substrate solution contained 150 μl N,N,N,N-tetramethylbenzidine (10 mg/ml in DMSO), 150 μl hydrogen peroxide (30% solution) in 10 ml 0.1M sodium acetate/sodium citrate, pH6.0. The plate was developed for 5-10 minutes until the absorbence at 630 nm was approximately 1.0 for the top standard. Absorbence at 630 nm was measured using a plate reader and the concentration of the sample determined by comparing the titration curves with those of the standard. Determination of Affinity Constants for Anti-IL-5 Antibodies

Affinities of the chimeric and CDR grafted anti-IL-5 antibodies were determined using Biospecific Interaction Analysis (BIA). Antibodies were produced in CHO cells by transfection of combination of heavy and light chain genes and purified from culture supernatants on Protein A Sepharose. For affinity measurements, a polyclonal antihuman Fc antibody was bound to the Pharmacia Biosensor chip (12150 relative response units, RU) and used to capture anti-IL-5 which was passed over the chip at 5 μg/ml in 10 mM HEPES. 0.15M NaCl, 3.4 mM EDTA, pH7.4. The amount of anti-IL-5 captured for each run was approximately 1600 RU. Recombinant human IL-5 was then passed over the Sensorchip at various concentrations (0.6 to 5 μg/ml) in the above buffer. The Sensorchip was cleaned after each run with 100 mM HCl and 100 mM orthophosphoric acid to remove bound IL-5 and antibody. The sensorgrams generated were analysed using the kinetics software available with the BIAcore machine.

Values for the affinity constants and association and dissociation rates of two antibodies, chimeric 39D10 and CTIL-5-10gH/-gL6, were determined. The results are shown in FIG. 9. It can be seen that chimeric 39D10 has an extremely high affinity for human IL-5 and that this value has been reproduced in CTIL-5-10gH/-gL6.

Activity of Anti-IL-5 Antibodies in in vitro Bioassay

The activities of various CDR grafted antibodies were compared with that of chimeric 39D10 in an in vitro bioassay using TF1 cells, TF1 is an erythroleukemic cell line that requires GM-CSF for growth. GM-CSF can be replaced by IL-5 but in this instance the cells only survive and do not proliferate. However the dependence on IL-5 for survival means that TF1 cells can be used in a bioassay to compare the activities of various anti-IL-5 antibodies.

Neutralisation by anti-IL-5 antibodies was measured using a constant amount of IL-5 (2 ng/ml) and variable amounts of antibody incubated with 5×104 cells per well in 96 flat bottomed plates for 3 days. For the last 4 hours, cells are cultured in the presence of 500 μg/ml Thiazolyl blue (MIT). This dye is converted into an insoluble purple form by mitochondrial enzymes in viable cells. The insoluble material was dissolved by incubating overnight after addition of 100 μl of 50% dimethyl formamide, 20% SDS pH4.7 and the amount of dye taken up determined spectrophotometrically. The levels of bioactive IL-5 remaining in the presence of the antibodies is extrapolated from a standard curve relating dye uptake to IL-5 concentration.

The activities of various combination of heavy and light chains were evaluated using the TF1 bioassay. The results are shown in FIG. 10. It can be seen that all combinations of CDR grafted heavy and light chains produce antibodies that are equipotent with chimeric 39D10. These results indicate that neither residue 22 in the light chain nor residues 23 or 78 in the heavy chains are required to be 39D10 specific for optimal binding. The combination with the fewer 39D10 specific residues is therefore CTIL-5-10gH/-gL6.

Activity of Anti-IL-5 Antibodies in Competition Assays

Recombinant human IL-5 was diluted to 1 μg/ml in phosphate buffered saline (PBS) and 100 μl allquots added to microtitre plates (Costar Amine Binding plates) and incubated overnight at 4° C. Plates were washed three times with PBS containing 0.5% Tween 20 and any remaining active sites blocked with 2% bovine serum albumin (BSA) in PBS for 30 minutes. The plates were then aspirated and tapped dry. To compare the relative binding activity of the parent rat antibody (39D10) with chimeric and grafted antibodies, serial dilutions were prepared of each anti-IL-5 antibody in PBS/1% BSA and 50 μl added to duplicate wells followed immediately by 50 μl 39D10-biotin conjugate at 0.125 μg/ml. The assay was incubated for 2 hours at room temperature with agitation and then washed twice with PBS. Horseradish-peroxidase conjugated to streptavidin (1 μg/ml) was added to all wells and incubated for a further 30 minutes. Plates were washed four times and 100 μl tetramethyl benzidine. (TMB) substrate added. Colour development was read at 630 am (reference 490 nm) and OD (630-490) was plotted against log (10) antibody concentration.

When the activities of rat 39D10, chimeric 39D10 and CTIL-5-10gH/gL6 were compared in the above competition assay, the results shown in FIG. 11 were obtained. All three antibodies competed equally well with biotinylated-39D10 for binding to IL-5, indicating that the CDR loops of 39D10 had been successfully transferred to the human frameworks.

Effect of Anti-IL-5 Antibody on Monkey Eosinophilia

Anti-IL-5 antibody (CTIL-5-10gH/gL6) was tested in a monkey system which models asthmatic conditions (see Mauser, P. J. et al., Am. J. Resp. Crit. Care Med., 152:467-472, 1995. When administered, one hour before challenge with Ascaris, to responsive monkeys, CTIL-5-10gH/gL6 inhibits lung lavage eosinophilia 75% at a dose of 0.3 mg/kg i.v. This set of monkeys is not hyper-responsive to histamine so the effects of CTIL-5-10gH/gL6 on hyper-responsiveness could not be determined. Three months after this single does, eosinophil accumulation in response to Ascaris challenge is still inhibited 75%.

In the allergic mouse, CTIL-5-10gH/gL6 inhibits pulmonary eosinophilia at 1 mg/kg i.p.