Match Document Document Title
DE102017125888A1 New engineered T cell receptors and their use in immunotherapy  
The present invention relates to antigen-recognizing constructs against COL6A3 antigens. In particular, the invention provides novel engineered T cell receptor (TCR) based molecules which are...
DE102017115966A1 Polypeptide molecule with improved dual specificity  
The present invention relates to a bispecific polypeptide molecule comprising a first polypeptide chain and a second polypeptide chain which provide a binding region derived from a T cell receptor...
DE102007063902B3 Aptamers that bind to a target molecule involved in hemostasis  
Aptamer that binds to a target molecule involved in hemostasis, wherein the aptamer is an aptamer that binds to activated protein C, the aptamer having a dissociation constant KD in the range of ‚Č•...
DE102015009439B4 Triple Target HIV-1 NAT for the detection of all known genotypes  
A primer / probeset for the detection of HIV, in particular HIV-1, comprising at least one primer / probeset 1 consisting of oligonucleotides comprising SEQ ID NOs 1, 2 and 3; Primer / probeset 2...
DE112015001085T5 Antibodies, uses and procedures  
The present invention relates to anti-human OX40L antibodies, new medical uses and methods.
DE102015216558A1 PROCEDURE AND TEST KIT FOR FAST ISOLATION OF NUCLEIC ACIDS BY SMOKE SURFACES  
The invention relates to a method for isolating nucleic acids from nucleic acid-containing samples, characterized in that free nucleic acids released by lysis are bound to a solid phase with a...
DE19858588B4 The dye-labeled oligonucleotide for labeling a nucleic acid molecule  
The dye-labeled oligonucleotide for labeling a a target sequence section comprising a nucleic acid molecule, wherein the dye-labeled oligonucleotide comprises the following components: a) - a loop...
DE102014001464A1 RNAi technology  
Ribonucleic acids (RNAs) can be blocked by small inhibitory RNAs. In this way, genes off. This mechanism known as RNA interference was first described by Andrew Fire and Craig Mello. For the...
DE102013111487A1 The bispecific antibody fragment and pharmaceutical combination preparation with such a  
The invention relates to a bispecific antibody fragment (10) with a first detection point (12) and at least a second detection point (14), which specifically recognize each at least one structure...
DE102013105144A1 The pharmaceutical combination product with an anti-idiotype antibody fragment  
The invention relates to a pharmaceutical combination preparation (10), in particular to suppression of an immune response, preferably a humoral immune response against a therapeutic organism...
DE112004000265B4 Novel photolabile protecting groups for improved methods for the preparation of oligonucleotide arrays  
Use of a compound having the general formula (1): in which R1 COOY, wherein Y is selected from the group consisting of an optionally substituted alkyl group having up to 10 carbon atoms with the...
DE102013006487A1 Iterative assembly and disassembly of predetermined, artificial DNA constructs and the specific exchange of functional genetic elements  
Versatile Assemblierungsverfahren for DNA constructs of higher order for the integration of molecular function have been described and patented. no uniform concepts found in the practical work of...
DE102013006487A9 Iterative assembly and disassembly of predetermined, artificial DNA constructs and the specific exchange of functional genetic elements  
Versatile Assemblierungsverfahren for DNA constructs of higher order for the integration of molecular function have been described and patented. no uniform concepts found in the practical work of...
DE102012110664A1 In coatings, bonding agents or adhesives for oxide surfaces usable peptides  
The present invention relates to peptides, particularly dodecapeptides containing coating agents, adhesion promoters or adhesives for oxide surfaces, a multilayer composite or a coated substrate...
DE102012103730A1 Detection method for Mycobacterium avium ssp. paratuberculosis  
The present application relates to a method for the specific detection and optionally quantification of Mycobacterium avium ssp. paratuberculosis (MAP) in a sample of an individual. According to...
DE102012101557A1 Using microRNAs or genes as markers for the identification, diagnosis and treatment of individual non-ischemic cardiomyopathies or memory disorders of the heart  
The invention relates to the use of certain microRNAs and / or genes, both individually and in combination of several in the form of profiles as markers to identify individual non-ischemic...
DE102011121238A1 SINGLE DOMAIN ANTIBODIES Clostridium difficile TOXINS  
The invention relates to antigen-binding polypeptides comprising the CDR1, CDR2, and CDR3 region of a VHH domain of a camelid-Heavy chain antibody. The polypeptides bind specifically in the field...
DE102011120550B4 Compositions, methods and kits for the detection of Adenovirusnukleins√§uren  
A method for detecting a specific adenovirus-target nucleic acid in a sample comprising the steps of: (A) contacting a sample suspected of containing at least an adenovirus nucleic acid comprising...
DE69132920C5 Method for the production of filamentous bacteriophage antibody-presenting by use of phagemids and the bacteriophage produced Daduchus  
A filamentous bacteriophage particle, on whose surface a binding molecule is presented, which is a Fab or single-chain Fv antibody molecule comprising a binding domain capable of binding to the...
DE102011055247A1 Multianalyt reporter system  
The invention relates to a mediator probe for binding to a target molecule and / or a detection molecule comprising a probe region and a mediator-region as well as a method for detecting at least...
DE102011054413A1 Monoclonal anti-idiotype antibody Ganglidiomab  
The present invention relates to an anti-idiotypic antibody which mimics the disialoganglioside GD2. GD2 is expressed on neuroectodermal tumors. Further comprises a corresponding hybridoma cell...
DE102011107197A1 Use of a crosslinked sulfonated polymer to separate macromolecules from a solution derived from a biological source, where the crosslinked sulfonated polymer is optionally bonded to a scaffolding containing a sulfonated aryl moiety  
Use of a crosslinked sulfonated polymer for the separation of macromolecules from a solution derived from a biological source, is claimed, where the crosslinked sulfonated polymer is optionally...
DE102011118022B4 Antibodies against the prostate-specific stem cell antigen and its use  
The invention relates to recombinant prostate-specific stem cell antigen (PSCA) binding antibodies. The antibody of the invention contains complementarity determining regions (CDR) with the...
DE102011118022A1 Antibodies to the prostate specific antigen stem cells and the use thereof  
The invention relates to recombinant to prostate-specific stem cell antigen (PSCA) antibody binding. The antibody of the invention comprises complementarity determining regions (CDR) having the...
DE102011056606B3 A method for electrochemical detection of nucleic acid hybridization events  
a method for electrochemical detection of nucleic acid hybridization events is described comprising the steps of a) providing a modified surface, the modification consisting in attaching at least...
DE602004036672C5 Nucleic acid-based emulsion beads  
Method for enriching an amplicon comprising: (A) distributing an amplification solution, which comprises a sufficient mixture of reagents that are required for carrying out an amplification...
DE102012008759A1 Nucleoside triphosphate conjugates and methods for their application  
The invention describes a new process for the enzymatic labeling of nucleic acid chains (target sequences) with nucleotide conjugates. These nucleotide conjugates are capable of binding under the...
DE112010004821T5 Processing of amplified DNA fragments for sequencing  
A processing method for trimming the ends of DNA fragments to expose the inner DNA portion for forwarding the original DNA sequence information that allows the application of next generation...
DE102011009470A1 Biologically active nucleotide molecules for targeted killing of cells, using the same and application kit  
The task was to reliably and effectively as possible kill cells in a wide range of applications, effective in the body, without the aforementioned disadvantages occur a known chemical, physical,...
DE102011006610B3 Aptamers that are specific for immunoglobulin binding cell wall proteins  
The invention relates to an aptamer that containing of protein A, G or L, Protein A, G or L substances and containing at Protein A, G or L microorganisms, in particular Staphylococcus aureus,...
DE102011006612B3 Aminoglycoside specific aptamers  
The invention relates to aptamers that bind to one or more compounds from the group of aminoglycosides, uses the aptamers and methods for detection and enrichment of compounds from the group of...
DE202011103324U1 Therapeutic anti-TIRC7 antibodies for use in immune and other diseases  
A monoclonal antibody or antigen-binding molecule is to bind to an antigen capable of comprising or consisting of the amino acid sequence of one of SEQ ID NOs: 9 to eleventh
DE102009044085A1 A method for in vitro detection and discrimination of pathophysiological conditions  
The present invention relates to the use of defined polynucleotides to form at least one Multigenbiomarkers for producing a multiplex assays as a tool for in vitro detection and / or detection and...
DE102010010052A1 Signaling binding molecules, devices, and methods of use thereof  
The invention relates to signaling binding molecules, also referred to as the sensor-actuator molecules, as well as devices and methods for their use. The sensor-actuator molecules comprise at...
DE102010007548A1 Microarray consisting of spots, at which mixture of polymerase and sequence specific primers is immobilized and coated with substrate, in which enzyme enabling sequence specific amplification is added, useful to genotype and quantify DNA  
Microarray consisting of spots, at which a mixture of polymerase and sequence-specific primers is immobilized using a method and is additionally coated with a precipitation efficient substrate, in...
DE102010007097A1 Conjugates of [F-18] supports having bioactive organic compounds and their representation  
The present invention relates to novel chemical compounds with under particularly mild conditions 18can be F-fluorinated. In this way, they allow the use of a novel fluorination according to the...
DE102009045006A1 Anti-CD33 antibodies and their use for Immunotargeting in the treatment of CD33-associated diseases  
The invention relates to antibodies against the tumor-associated antigen CD33 and their use for Immunotargeting of CD33-positive cells. The antibodies of the invention are suitable for use in the...
DE102009024757B4 Methods and apparatus for controlling a chemical reaction by means of pressure using high-pressure optimized biocomponents  
A method for controlling a chemical reaction by means of compressed using high pressure optimized bio, where a combination of high-pressure-optimized and low-pressure-optimized bio, which can each...
DE102009024732A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-1 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-3, is new. Oligonucleotide, comprising one or more sequences including (5'-gatcttagggatgtccacctc-3') (SEQ ID NO. 1),...
DE102009024731A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-2 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-4, is new. Oligonucleotide, comprising one or more sequences including 5'-tattcctgcccccgtagag-3' (SEQ ID NO. 1),...
DE102009024730A1 New oligonucleotide, comprising specified sequences, is argonaute-3a expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide comprising one or more sequences comprising SEQ ID NOs: 1-7, is new. Oligonucleotide, comprising one or more sequences including agaaaaatgaacgccccaca (SEQ ID NO: 1),...
DE102009024729A1 New oligonucleotide, comprising specified sequences, is argonaute-4 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide, comprising one or more sequences comprising SEQ ID NOs: 1-6, is new. Oligonucleotide, comprising one or more sequences including caggcaaagattggaaaggg (SEQ ID NO: 1),...
DE102009012169B3 Device and method for producing a replica or a derivative of an array of molecules and applications thereof  
A method of manufacturing a replica, or a derivative of an array of molecules wherein said array having a spatial array of separate samples of molecules, said generating comprises at least one...
DE102009013748A1 Determination of interactions constant antibody portions with Fc gamma receptors  
The invention relates to a novel method for the exact determination of the binding of the Fc-portion of IgG antibodies to Fc-gamma receptors and for the simultaneous examination of the antigen...
DE102009013748B4 Determination of interactions constant antibody portions with Fc gamma receptors  
A recombinant expression vector comprising sequences for the recombinant expression of at least one fusion protein on the surface of a mammalian cell comprising a) an extracellular portion of a...
DE102009015978A1 Method for determining the predisposition of a subject to altered biotransformation and the development of adverse drug reactions in a treatment of the patient with atorvastatin  
The present invention relates to a method of determining a predisposition of a patient for the development of muscular disorders and / or modified biotransformation at a treatment of the patient...
DE102008063592B4 Multifunctional laboratory process bags for the clean production of biomolecules  
Process for as many times repeatable providing subsets purified biomolecules or Biologicals a whole the same clonal origin for quality tests or functional tests with steps a) introducing at least...
DE112008001507T5 New hybrid compounds of nucleobases and organic redox molecules and their use  
Hybrid combination with i) a unit of a purine or pyrimidine nucleobase or a Dervivat thereof, ii) a redox active moiety and iii) a spacer moiety connecting the Nukleobaseeinheit with the redox...
DE102008029356A1 A method for purifying nucleic acids, in particular of fixed tissue  
The invention relates to a method for purification of nucleic acids, a kit for performing the inventive method, as well as a novel use of magnetic particles for purifying a biological sample. The...
DE102008025328B4 Compositions and methods for amplification of HIV viruses by multiplex PCR in multiple genomes areas  
A method for the detection of HIV-1 and HIV-2 derived from in blood samples, comprising a) provide from blood-derived samples, b) concentrating the blood-derived sample, c) extraction of viral...