Match Document Document Title
DE102009045006A1 Anti-CD33 antibodies and their use for Immunotargeting in the treatment of CD33-associated diseases  
The invention relates to antibodies against the tumor-associated antigen CD33 and their use for Immunotargeting of CD33-positive cells. The antibodies of the invention are suitable for use in the...
DE102009024732A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-1 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-3, is new. Oligonucleotide, comprising one or more sequences including (5'-gatcttagggatgtccacctc-3') (SEQ ID NO. 1),...
DE102009024731A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-2 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-4, is new. Oligonucleotide, comprising one or more sequences including 5'-tattcctgcccccgtagag-3' (SEQ ID NO. 1),...
DE102009024730A1 New oligonucleotide, comprising specified sequences, is argonaute-3a expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide comprising one or more sequences comprising SEQ ID NOs: 1-7, is new. Oligonucleotide, comprising one or more sequences including agaaaaatgaacgccccaca (SEQ ID NO: 1),...
DE102009024729A1 New oligonucleotide, comprising specified sequences, is argonaute-4 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide, comprising one or more sequences comprising SEQ ID NOs: 1-6, is new. Oligonucleotide, comprising one or more sequences including caggcaaagattggaaaggg (SEQ ID NO: 1),...
DE102009012169B3 Device and method for producing a replica or a derivative of an array of molecules and applications thereof  
A method of manufacturing a replica, or a derivative of an array of molecules wherein said array having a spatial array of separate samples of molecules, said generating comprises at least one...
DE102009013748A1 Determination of interactions constant antibody portions with Fc gamma receptors  
The invention relates to a novel method for the exact determination of the binding of the Fc-portion of IgG antibodies to Fc-gamma receptors and for the simultaneous examination of the antigen...
DE102009015978A1 Method for determining the predisposition of a subject to altered biotransformation and the development of adverse drug reactions in a treatment of the patient with atorvastatin  
The present invention relates to a method of determining a predisposition of a patient for the development of muscular disorders and / or modified biotransformation at a treatment of the patient...
DE112008001507T5 New hybrid compounds of nucleobases and organic redox molecules and their use  
Hybrid combination with i) a unit of a purine or pyrimidine nucleobase or a Dervivat thereof, ii) a redox active moiety and iii) a spacer moiety connecting the Nukleobaseeinheit with the redox...
DE19854973B4 A method for purifying nucleic acids  
Preparation comprising particles having a glass surface, which contains more than 75th% of these particles have a particle size between 0.5 and 15 microns have characterized in that the glass...
DE10004815B4 Human intestinal sodium phosphate cotransporter  
Npt2B polypeptide having an amino acid sequence which is identical to the sequence SEQ ID NO. 01 and sodium phosphate co-transporter having activity.
DE102008029356A1 A method for purifying nucleic acids, in particular of fixed tissue  
The invention relates to a method for purification of nucleic acids, a kit for performing the inventive method, as well as a novel use of magnetic particles for purifying a biological sample. The...
DE102008025328A1 Detecting HIV in a blood sample comprises providing and optionally concentrating the sample, extracting viral nucleic acids, adding the extract to PCR master mix and performing amplification and detecting the amplified viral nucleic acids  
Method (A) for detecting HIV in a sample derived from blood comprises: (a) providing the sample derived from blood; (b) optionally concentrating the sample derived from blood; (c) extracting viral...
DE102008010584A1 Detecting anaerobic microorganisms capable of degrading aromatic compounds comprises using nucleotide sequences coding for a conserved amino acid sequence of 6-oxocyclohexene-1-carbonyl coenzyme A hydrolase  
Detecting anaerobic microorganisms that are capable of degrading aromatic compounds comprises contacting an environmental sample with nucleotide sequences coding for a conserved amino acid...
DE102008008193A1 Roller- or plain bearing forgery-proof marking of a valuable document, comprises a bearing body with a surface, and a marking that enables a clear identification of the bearing body and comprises a synthetic nucleic acid  
The roller- or plain bearing (6) comprises a bearing body with a surface (1), and a marking that enables a clear identification of the bearing body and comprises a synthetic nucleic acid (4)...
DE102008054480A1 Direct sequencing by ATP release  
There is provided a method for sequencing a nucleic acid. In certain embodiments, the method comprises contacting a nucleic acid duplex comprising a template and a nucleic acid annealed to the...
DE102007062962A1 New surface protein mutant of hepatitis B virus HBV surface antigen (HBsAg)  
The invention relates to sequences of a new mutant or variant of the hepatitis B surface antigen (HBsAg) and methods, these genomic and protein variant and antibodies directed against them from...
DE19520398B4 Magnetic pigment  
reagent composition for isolating nucleic acids from a sample comprising (A) magnetic particles having a Glass surface, (B) a chaotropic salt solution, (C) optionally a washing solution and (D)...
DE102008012336A1 Separation of charged absolute electrostatic repulsion / hydrophilic interaction  
In one aspect includes a method of conducting an electrostatic repulsion / hydrophilic interaction chromatography to a protein, a peptide or an amino acid, the Providing a column with an...
DE102007041476A1 Aptamers that bind to a party to the hemostasis target molecule  
The Invention relates to an aptamer that binds to an haemostasis participating target molecule binds with the aptamer an aptamer is that binds to activated protein C, wherein the aptamer with a...
DE102007044765A1 A process for the liquid phase synthesis of a polymer  
The Invention relates to a process for the liquid phase synthesis of a n monomers formed polymer.
DE202007018725U1 Oligonucleotide probes and containing these diagnostic kits for the determination of linezolid resistance  
Oligonucleotide probe hybridizing specifically with ribosomal RNA of microorganisms, the specific ribosomal to an under hybridization conditions RNA of the microorganism, the induced by a...
DE102005029811B4 Oligonucleotide arrays, methods for their use, and their use  
oligonucleotide arrays comprising at least two by at least one spacer linked hybridizable oligonucleotide as primer sequences, characterized in that the spacer is selected from functionalized...
DE102007035730A1 Determining linezolid-resistance in microorganism comprises contacting microorganism with oligonucleotide-probe that can bind to microorganism ribosomal RNA showing point mutation caused by linezolid-resistance and detecting microorganism  
Determination of linezolid-resistance in microorganisms present in a sample, comprises contacting the sample with at least an oligonucleotide-probe, which can bind under hybridization conditions...
DE102007035250A1 A method for separating non-proteinaceous biomolecules, in particular nucleic acids from protein-containing samples  
The This invention relates to a process for isolating non-proteinaceous biomolecules, in particular nucleic acids, wherein on a solid phase, a protein degradation is carried out.
DE102006035392A1 Prognostic markers for predicting the five-year progression-free survival of patients with colon cancer based on expression profiles of biological samples  
The Invention relates to the use of gene expression profiles for Prediction of the five-year progression-or relapse-free survival of patients undergoing colorectal a was removed carcinoma in UICC...
DE102007015775A1 A method for detecting Paratuberkolose  
The This invention relates to a method for specifically and sensitive detection of Mycobacterium avium ssp. paratuberculosis (MAP). In fecal, tissue and organ samples using a real-time PCR methods
DE102006050091A1 Process for the selective localization of active ingredients to and in mitochondria and corresponding active ingredients  
The This invention relates to novel processes for the selective localization of active ingredients both at and in mitochondria within living cells and agents that through without further aids...
DE102007010252A1 Set of control genes for normalizing gene expression data from blood samples comprises seven RNA sequences  
Set of control genes for normalizing gene expression data from blood samples comprises seven RNA sequences corresponding to GenBank accession numbers NM001562, NM001228, NM001993, NM002209,...
DE102007010311A1 Organism-specific hybridizable nucleic acid molecule  
The This invention relates to a method for producing a organism-specific hybridizable nucleic acid molecule, a product made by this method nucleic acid molecule, a kit which comprises at least one...
DE102007009073A1 Crosslinked poly(meth)acrylic acid cation exchanger, e.g. for water treatment, is obtained by polymerizing pearl-form monomer drops while supplying monomers, crosslinker and optionally initiator  
Production of crosslinked poly(meth)acrylic acid type cation exchangers (I) involves polymerizing pearl-form monomer drops in a (preferably aqueous) continuous phase, while supplying a mixture of...
DE102007005804A1 Secreted luciferase Lu164M3 and their use  
The Invention relates to the nucleotide and amino acid sequence and the type and use of Lu164M3 and the Use of secreted luciferases.
DE102007005803A1 Secreted luciferase MLuc7 and their use  
The Invention relates to the nucleotide and amino acid sequence and the type and use of the secreted luciferase MLuc7.
DE102007005655A1 Apparatus and method for purification of nucleic acids  
disclosed A device for purification of nucleic acids by negative chromatography comprising a hollow body each having an opening at the upper and at the lower end, which includes a stationary solid...
DE102006059095A1 Microarray for detecting viruses is divided into fields, each bearing a nucleic acid probe capable of detecting a specific herpes virus  
Microarray for detecting viruses is divided into fields, each bearing a nucleic acid probe capable of detecting a specific virus, namely a herpes simplex virus probe, a varicella zoster virus...
DE102006054202A1 Alleles of oxyR gene from corynebacteria  
The Invention relates to mutants and alleles of the gene of coryneform oxyR Bacteria coding for Variants of the OxyR-transcriptional regulator, and methods for preparing of amino acids by using...
DE102007045173A1 Nucleotide analogs useful for nucleic acid synthesis or sequencing comprise a nucleotide component, a sterically demanding macromolecular ligand, a label and a linker  
Nucleotide analogs (I) comprising a nucleotide component, a sterically demanding macromolecular ligand, a label and a linker are new. Independent claims are also included for: (1) nucleic acid...
DE102006035393A1 Prognostic markers for the classification of the three-year progessionsfreien survival of patients with colon cancer based on expression profiles of biological samples  
The Invention relates to the use of gene expression profiles for Predicting the three-year progression-free survival or recurrence of patients receiving colorectal cancer in UICC stage I or II was...
DE202005021489U1 A composition as for the synthesis of compounds phosphitylated  
Composition, containing a compound capable of forming enolates, and a phosphoramidite.
DE202005021488U1 Mixture of an activator and an additive for preparing phosphitylated compounds  
A Mixture of an activator having the formula I wherein R = alkyl, cycloalkyl, Aryl, aralkyl, heteroalkyl, heteroaryl R1. R2 = Either hydrogen or together form a 5- or 6-membered ring X1, X2 =...
DE102007016151A1 coated implant  
implant with a coating, wherein the implant is an amino-functionalized Parylene, an oligonucleotide and / or an oligopeptide comprising, which have a specific binding affinity for CD 34-positive...
DE102006039479A1 Programmable oligonucleotide  
The Invention relates to methods and apparatus for the preparation of synthetic nucleic acids.
DE102006037580A1 Sandel Perfume receptors  
The Invention relates to the field of olfactory receptors, the receptive influencing Medications and biosensors. The invention further relates to compounds of the general formula (I), in whichX...
DE102006037581A1 Citrusal Perfume receptors  
The Invention relates to the field of olfactory receptors, the empfängsnisbeeinflussenden Medications and biosensors.
DE102006035618A1 New nucleic acid useful as immuno-stimulating adjuvant for manufacture of a composition for treatment of cancer diseases e.g. colon carcinomas and infectious diseases e.g. influenza and malaria  
Nucleic acid (I) is new. Nucleic acid of formula G lX mG n (I) is new. G = guanosine, uracil or an analog; X = guanosine, uracil, adenosine, thymidine, cytosine or an analog; l = 1-40; m >= 3; and...
DE10109466B4 Method and means for modification of human angiogenesis  
process to induce angiogenic processes in tissues of a mammalian organism, comprising the steps of: - Preparation of a ternary complex by complexing a nucleic acid molecule as a functional...
DE102006025154A1 Mutated DNA polymerase with increased reverse transcriptase activity  
The This invention relates to a DNA polymerase with increased reverse Transcriptase activity, which compared to the wild-type variant at least one mutation in their amino acid sequence comprises,...
DE102006025153A1 Mutant DNA polymerases with higher selectivity  
The This invention relates to a DNA polymerase with increased mismatch discrimination, which compared to the wild-type variant at least one mutation in their amino acid sequence comprises, as well...
DE102006020885A1 Inserting a tag sequence into a nucleic acid comprises using an anchor oligonucleotide comprising a hybridizing anchor sequence and a nonhybridizing tag-template sequence  
Inserting a tag sequence into a nucleic acid comprises hybridizing an anchor sequence of an anchor oligonucleotide to a sequence segment of a template nucleic acid and synthesizing a new nucleic...
DE102006019480A1 Use of gene expression profiles to detect any postoperative tissue incompatibility reactions after liver transplantation  
Gene expression profiles obtained from a patient sample in vitro are used to detect any postoperative tissue incompatibility reactions after liver transplantation. An independent claim is also...