Match Document Document Title
DE102010036356A1 Device for synthesis of radiolabeled compounds  
The invention relates to a device for the synthesis of radiolabeled compounds, comprising - Having a reaction vessel for reacting a precursor compound, the protecting groups, with a radioactive...
DE102008063592B4 Multifunctional laboratory process bags for the clean production of biomolecules  
Process for as many times repeatable providing subsets purified biomolecules or Biologicals a whole the same clonal origin for quality tests or functional tests with steps a) introducing at least...
DE202011103324U1 Therapeutic anti-TIRC7 antibodies for use in immune and other diseases  
A monoclonal antibody or antigen-binding molecule is to bind to an antigen capable of comprising or consisting of the amino acid sequence of one of SEQ ID NOs: 9 to eleventh
DE102009044085A1 A method for in vitro detection and discrimination of pathophysiological conditions  
The present invention relates to the use of defined polynucleotides to form at least one Multigenbiomarkers for producing a multiplex assays as a tool for in vitro detection and / or detection and...
DE102010015792A1 Drug combinations of Magnolia Bark Extract and surface active agents  
Active compound combinations of a) a magnolia bark extract of Magnolia grandiflora containing Magnolol and / or honokiol and b) one or more interface-active substances A, chosen from the group of...
DE102010006245A1 Production and use of anti-bacterial, anti-proliferative and antiphytopathogenic Benzanthrine  
Compound of general structure in which R is a hydrogen atom (H) or an unsubstituted, monosubstituted or polysubstituted C1-C20Alkyl, said alkyl straight, branched, may be cyclic or partially...
DE102010010052A1 Signaling binding molecules, devices, and methods of use thereof  
The invention relates to signaling binding molecules, also referred to as the sensor-actuator molecules, as well as devices and methods for their use. The sensor-actuator molecules comprise at...
DE102010008067A1 Reducing carbon dioxide emission into atmosphere by recycling carbon dioxide in energy- and natural cycle, comprises chemically reacting filtered out carbon dioxide with hydrogen in a controlled production process, to obtain glucose  
Reducing the carbon dioxide emission into the atmosphere by recycling carbon dioxide in energy- and natural cycle, comprises chemically reacting the filtered out carbon dioxide with hydrogen in a...
DE102010007548A1 Microarray consisting of spots, at which mixture of polymerase and sequence specific primers is immobilized and coated with substrate, in which enzyme enabling sequence specific amplification is added, useful to genotype and quantify DNA  
Microarray consisting of spots, at which a mixture of polymerase and sequence-specific primers is immobilized using a method and is additionally coated with a precipitation efficient substrate, in...
DE102010007097A1 Conjugates of [F-18] supports having bioactive organic compounds and their representation  
The present invention relates to novel chemical compounds with under particularly mild conditions 18can be F-fluorinated. In this way, they allow the use of a novel fluorination according to the...
DE10344967B4 Alkoxyl group-containing cyclodextrin derivatives; Processes for their preparation and their use  
Cyclodextrin derivative of the formula (I) A [-Z1-XZ2- (EO / PO)n-R1]m (I)wherein A represents an m-valent cyclodextrin residue which is formed of a cyclodextrin molecule by removal of m hydroxyl...
DE102010004957A1 Biologically active molecules for influencing viral, bacterial, parasite-infected cells and / or tumor cells and methods for their application  
The task was to specifically inhibit viral, bacterial, parasite-infected cells and tumor cells even in the case of mutations effectively. According to the invention biologically active molecules...
DE102006053637B4 Last fluoro-substituted 1,4-Benzothiepin-1,1-dioxide derivatives, pharmaceutical compositions containing them and their use  
Compounds of the formula I, which mean X NH; R1 (C1-C6) Alkyl; R4 F; R4 'H, F; R2, R2 ', R3, R3', R5, R5 'independently of one another H, F, Cl, Br, I, OH, - (CH2) -OH, CH2F, CHF2, CF3, NO2, N3,...
DE102006053635B4 New substituted with benzyl 1,4-Benzothiepin-1,1-dioxide derivatives, pharmaceutical compositions containing them and their use  
Compounds of formula and the pharmaceutically acceptable salts thereof.
DE102008064667B4 A method for producing a Detektionskonjugats  
A method for producing a Detektionskonjugats for use in the analysis of cells for the presence of an analyte, characterized in that a metal is eroded in an aqueous composition containing a...
DE102009046982A1 Solid phase-bound nucleosides  
The invention relates to solid phase-bound nucleosides in which the nucleoside is attached via a 3'-O-disulfide bridge covalently to a solid phase, and a process for their preparation and their use.
DE102009046981A1 Process for the preparation of trinucleotides  
The invention relates to a process for the preparation of protected trinucleotides using a combination of specific protecting groups.
DE102009051438A1 fluorescent dyes  
The present invention relates to novel compounds useful as fluorescent dyes. In particular, the present invention relates to a new class of derivatized with chromophores, pharmacologically active...
DE102006022569B4 Spezies-unabhängiges Nachweisverfahren für biologisches Material  
Verwendung mindestens eines ersten Primers zur DNA-Fingerprint-Analyse, wobei der mindestens erste Primer eine Sequenz enthält, die von einer 8 bp langen palindromischen oder GC-reichen Sequenz...
DE102009045006A1 Anti-CD33 antibodies and their use for Immunotargeting in the treatment of CD33-associated diseases  
The invention relates to antibodies against the tumor-associated antigen CD33 and their use for Immunotargeting of CD33-positive cells. The antibodies of the invention are suitable for use in the...
DE202009016292U1 As emulsifier acting composition for water-solubilized hydrophobic compounds  
Composition having an HLB value of greater than 10, which as an emulsifier for a solubilized preparation of at least one raw material and / or the active ingredient, which is not or only sparingly...
DE102010034968A1 Polymerizable compounds and liquid media  
The invention relates to polymerisable compounds of the formula I, wherein P, Sp, R1, R2, A1, A2, A3, Z1, Z3, V, m, n, o, x and y have the meanings given in claim 1, and liquid-crystalline media...
DE102009032502A1 Detection of antigens  
The invention discloses a method for detecting at least one antigen, comprising the steps of: providing magnetic beads coated with antibodies specific for at least one antigen to be detected;...
DE102009024732A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-1 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-3, is new. Oligonucleotide, comprising one or more sequences including (5'-gatcttagggatgtccacctc-3') (SEQ ID NO. 1),...
DE102009024731A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-2 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-4, is new. Oligonucleotide, comprising one or more sequences including 5'-tattcctgcccccgtagag-3' (SEQ ID NO. 1),...
DE102009024730A1 New oligonucleotide, comprising specified sequences, is argonaute-3a expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide comprising one or more sequences comprising SEQ ID NOs: 1-7, is new. Oligonucleotide, comprising one or more sequences including agaaaaatgaacgccccaca (SEQ ID NO: 1),...
DE102009024729A1 New oligonucleotide, comprising specified sequences, is argonaute-4 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide, comprising one or more sequences comprising SEQ ID NOs: 1-6, is new. Oligonucleotide, comprising one or more sequences including caggcaaagattggaaaggg (SEQ ID NO: 1),...
DE102009022513A1 A method for protecting membranes  
The present invention relates to a method for the protection of membranes by treatment with an aqueous solution containing at least one water-soluble, nucleophilic compound, and the use of this...
DE102009020261A1 A method for solid-phase-aided manufacturing phosphatverbrückter nucleoside conjugates  
The invention relates to a process for preparing phosphatverbrückter nucleoside conjugates. In the method, a cycloSaligenyl-nucleotide is prepared, to which a linker is added, by means of which...
DE102009012169B3 Device and method for producing a replica or a derivative of an array of molecules and applications thereof  
A method of manufacturing a replica, or a derivative of an array of molecules wherein said array having a spatial array of separate samples of molecules, said generating comprises at least one...
DE102009013748A1 Determination of interactions constant antibody portions with Fc gamma receptors  
The invention relates to a novel method for the exact determination of the binding of the Fc-portion of IgG antibodies to Fc-gamma receptors and for the simultaneous examination of the antigen...
DE102009015978A1 Method for determining the predisposition of a subject to altered biotransformation and the development of adverse drug reactions in a treatment of the patient with atorvastatin  
The present invention relates to a method of determining a predisposition of a patient for the development of muscular disorders and / or modified biotransformation at a treatment of the patient...
DE10103509B4 Phosphoserinphospatase gene of coryneform bacteria  
Protein, defined by (A) or (B): (A) a protein which comprises an amino acid sequence of SEQ ID No 2 of the sequence list. or(B) a protein comprising an amino acid sequence including substitution,...
DE19823062B4 A process for the production of an alkyl glycoside  
A process for producing an alkyl glycoside, comprising the steps of: a) mixing a hydrated, solid sugar with a straight-chain or branched, saturated or unsaturated alcohol having 8 to 22 carbon...
DE102008064184A1 Method for increasing the sucrose yield in agricultural cultivation of sugar beet and sugar  
Use of a nucleic acid which is suitable in a plant cell to reduce the enzymatic activity of an invertase, for forming a sucrose storage organ of a plant, wherein the sucrose concentration compared...
DE10247073B4 A process for preparing monomeric uronic acids, in particular D-mannuronic acid and D-guluronic acid, and their use as medicaments  
A process for preparing monomeric uronic acids, comprising the steps of: a polyuronic fermenting a producing strain of bacteria, the epimerase gene has been inactivated. b. Isolating the...
DE102007053947B4 A process for the synthesis of sucrose-6-acetic acid ester  
A method for the synthesis of sucrose-6-acetic acid esters, comprising the steps of: (A) the addition of sucrose in a polar aprotic solvent and stirring the solvent to dissolve it and to produce a...
DE102004062386B4 Monacolin K biosynthesis genes  
An isolated DNA molecule comprising a polynucleotide which it is mkA and which has a nucleotide sequence of SEQ ID NO: 2, wherein said polynucleotide encodes a polypeptide having an activity...
DE112008001507T5 New hybrid compounds of nucleobases and organic redox molecules and their use  
Hybrid combination with i) a unit of a purine or pyrimidine nucleobase or a Dervivat thereof, ii) a redox active moiety and iii) a spacer moiety connecting the Nukleobaseeinheit with the redox...
DE102008053549A1 Glucosylglycerol containing composition  
The invention relates to a composition comprising 20-80 wt .-% wt .-% glucosylglycerol and 0.5-20 one or more mono- and / or disaccharides. Surprisingly, it has been found that a particular...
DE102008053284A1 Stabilizer, useful for stabilizing heparin-binding growth factors and for manufacturing medicament e.g. for wound healing and bone regeneration, comprises a compound having an oligophosphate group  
Stabilizer comprises a compound having at least one oligophosphate group. Independent claims are also included for: (1) stabilizing heparin-binding growth factors, comprising contacting the...
DE102008053607A1 Solubilizing agent for metal ions  
The invention relates to a solubilizing agent for metal ions, and sparingly soluble metal compounds containing, as solubilizing agent, an oxidation product of starch, methods for solubilizing...
DE202009017108U1 Monoclonal antibody to Microcephalin (MCPH1)  
A monoclonal antibody or fragment thereof, characterized in that it specifically binds to Microcephalin (MCHP1) and recognizes an epitope which is located in the area of ​​amino acids 1 to 267 of...
DE102005031755B9 Salmonella spp. binding peptides, nucleic acids coding therefor, their uses, and methods and kits for the enrichment, immobilization and detection of Salmonella spp.  
Salmonella spp. binding peptide selected from the sequences SEQ ID NO. 1 to NO. 3, SEQ ID NO. 5 to NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 14 to NO. 16, SEQ ID NO. 18, SEQ ID NO. 20 to NO....
DE19943491B4 Improved compressed  
A process for producing a compressed product of isomaltulose, isomalt, or isomalt variants, wherein the isomalt variants 1,6-GPS and 1,1-GPM-containing mixtures are that through to deviate from...
DE69029370C5 Erythropoietin isoforms  
An isolated biologically active erythropoietin isoform having a single isoelectric point and having a specific number of sialic acids per erythropoietin molecule, said number being selected from...
DE102008044914A1 A process for preparing nucleoside conjugates phosphatverbrückter  
The invention relates to a process for preparing phosphatverbrückter nucleoside conjugates. In the method, a nucleophile is dissolved in a non-aqueous solvent, and dried and then added a...
DE19854973B4 A method for purifying nucleic acids  
Preparation comprising particles having a glass surface, which contains more than 75th% of these particles have a particle size between 0.5 and 15 microns have characterized in that the glass...
DE102008035299A1 Conjugate, particularly bromovinyl-deoxyuridine for manufacture medicament for inhibiting or suppressing metastasis including distant metastases in cytostatic treatment, includes heat shock protein and nucleoside  
A conjugate includes a heat shock protein 27 (Hsp 27) and a nucleoside. The conjugate has a general formula (I), where the conjugate is made of heat shock protein 27 (Hsp 27) and nucleoside. R...
DE10237691B4 A method for detecting single nucleotide polymorphisms (SNP) in genes of drug metabolism and test kit for performing the method  
A method for the detection of single nucleotide polymorphisms in the cytochrome P450 genes, characterized in that a) gene segments of human CYP2 genes from a sample with the amplification primers...