Match Document Document Title
DE102011107197A1 Use of a crosslinked sulfonated polymer to separate macromolecules from a solution derived from a biological source, where the crosslinked sulfonated polymer is optionally bonded to a scaffolding containing a sulfonated aryl moiety  
Use of a crosslinked sulfonated polymer for the separation of macromolecules from a solution derived from a biological source, is claimed, where the crosslinked sulfonated polymer is optionally...
DE102011118022B4 Antibodies against the prostate-specific stem cell antigen and its use  
The invention relates to recombinant prostate-specific stem cell antigen (PSCA) binding antibodies. The antibody of the invention contains complementarity determining regions (CDR) with the...
DE102011118022A1 Antibodies to the prostate specific antigen stem cells and the use thereof  
The invention relates to recombinant to prostate-specific stem cell antigen (PSCA) antibody binding. The antibody of the invention comprises complementarity determining regions (CDR) having the...
DE102011056606B3 A method for electrochemical detection of nucleic acid hybridization events  
a method for electrochemical detection of nucleic acid hybridization events is described comprising the steps of a) providing a modified surface, the modification consisting in attaching at least...
DE102011103751A1 Crystallizing epirubicin hydrochloride  
The invention relates to crystalline epirubicin hydrochloride and a process for its preparation The process for preparation of crystalline epirubicin hydrochloride comprising the steps of (A)...
DE69314239C5 Process for Stereoselektivglycosylierung  
A process for the synthesis of a β-anomer enriched nucleoside of the formula which, if appropriate in a suitable solvent, performing a nucleophilic SN2-substituting a sulfonyloxy group (Y) of an...
DE602004036672C5 Nucleic acid-based emulsion beads  
Method for enriching an amplicon comprising: (A) distributing an amplification solution, which comprises a sufficient mixture of reagents that are required for carrying out an amplification...
DE102012008759A1 Nucleoside triphosphate conjugates and methods for their application  
The invention describes a new process for the enzymatic labeling of nucleic acid chains (target sequences) with nucleotide conjugates. These nucleotide conjugates are capable of binding under the...
DE112010004821T5 Processing of amplified DNA fragments for sequencing  
A processing method for trimming the ends of DNA fragments to expose the inner DNA portion for forwarding the original DNA sequence information that allows the application of next generation...
DE102011001743A1 Process for the separation / purification of Biomolekühlen  
The invention relates to an aqueous two-phase extraction methods, wherein the second aqueous phase is in the pores of a porous material.
DE102011009470A1 Biologically active nucleotide molecules for targeted killing of cells, using the same and application kit  
The task was to reliably and effectively as possible kill cells in a wide range of applications, effective in the body, without the aforementioned disadvantages occur a known chemical, physical,...
DE102011006610B3 Aptamers that are specific for immunoglobulin binding cell wall proteins  
The invention relates to an aptamer that containing of protein A, G or L, Protein A, G or L substances and containing at Protein A, G or L microorganisms, in particular Staphylococcus aureus,...
DE102010055566A1 New compounds conjugating gyrase-inhibiting substances with catechol structural units, are gyrase inhibitors, useful as biologically active substances, and for treating bacterial infection  
Compounds (Q) conjugating gyrase-inhibiting substances with catechol structural units, are new. An independent claim is included for the preparation of (Q). ACTIVITY : Antibacterial. MECHANISM OF...
DE102011006612B3 Aminoglycoside specific aptamers  
The invention relates to aptamers that bind to one or more compounds from the group of aminoglycosides, uses the aptamers and methods for detection and enrichment of compounds from the group of...
DE102010038842A1 New aptamer that specifically binds to human tau protein or its fragment, useful e.g. in vitro for isolating, purifying and/or detecting tau protein, and to treat cerebral infarction, pick disease and/or progressive supranuclear palsy  
Aptamer that specifically binds to human tau protein or its fragment, is new. Independent claims are included for: (1) kit comprising the aptamer; (2) a method for the purification of human tau...
DE102010033102A1 Determining a locus change i.e. single nucleotide polymorphism on male cattle, comprises determining the weight and/or the proportions of a fetus by molecular markers  
Determining a locus change on male cattle, comprises determining the weight and/or the proportions of a fetus by molecular markers. Independent claims are included for: (1) primers for detection...
DE102010036356A1 Device for synthesis of radiolabeled compounds  
The invention relates to a device for the synthesis of radiolabeled compounds, comprising - Having a reaction vessel for reacting a precursor compound, the protecting groups, with a radioactive...
DE202011103324U1 Therapeutic anti-TIRC7 antibodies for use in immune and other diseases  
A monoclonal antibody or antigen-binding molecule is to bind to an antigen capable of comprising or consisting of the amino acid sequence of one of SEQ ID NOs: 9 to eleventh
DE102011018627B4 Modified nucleotides  
Compound of structure (I): or a salt, a conjugated base, a tautomer or a dissociated form thereof, P1 being a phosphate group; P2 is a phosphate group; Nus is a nucleoside structural unit...
DE102009044085A1 A method for in vitro detection and discrimination of pathophysiological conditions  
The present invention relates to the use of defined polynucleotides to form at least one Multigenbiomarkers for producing a multiplex assays as a tool for in vitro detection and / or detection and...
DE102010015792A1 Drug combinations of Magnolia Bark Extract and surface active agents  
Active compound combinations of a) a magnolia bark extract of Magnolia grandiflora containing Magnolol and / or honokiol and b) one or more interface-active substances A, chosen from the group of...
DE102010006245B4 Mayamycin compounds, processes for their preparation, their uses and those containing cosmetic product  
Compound of general structure in which R is a hydrogen atom (H) or an unsubstituted, monosubstituted or polysubstituted C1-C20Alkyl, said alkyl straight, branched, may be cyclic or partially...
DE102010006245A1 Production and use of anti-bacterial, anti-proliferative and antiphytopathogenic Benzanthrine  
Compound of general structure in which R is a hydrogen atom (H) or an unsubstituted, monosubstituted or polysubstituted C1-C20Alkyl, said alkyl straight, branched, may be cyclic or partially...
DE102010010052A1 Signaling binding molecules, devices, and methods of use thereof  
The invention relates to signaling binding molecules, also referred to as the sensor-actuator molecules, as well as devices and methods for their use. The sensor-actuator molecules comprise at...
DE102010008067A1 Reducing carbon dioxide emission into atmosphere by recycling carbon dioxide in energy- and natural cycle, comprises chemically reacting filtered out carbon dioxide with hydrogen in a controlled production process, to obtain glucose  
Reducing the carbon dioxide emission into the atmosphere by recycling carbon dioxide in energy- and natural cycle, comprises chemically reacting the filtered out carbon dioxide with hydrogen in a...
DE102010007548A1 Microarray consisting of spots, at which mixture of polymerase and sequence specific primers is immobilized and coated with substrate, in which enzyme enabling sequence specific amplification is added, useful to genotype and quantify DNA  
Microarray consisting of spots, at which a mixture of polymerase and sequence-specific primers is immobilized using a method and is additionally coated with a precipitation efficient substrate, in...
DE102010007097A1 Conjugates of [F-18] supports having bioactive organic compounds and their representation  
The present invention relates to novel chemical compounds with under particularly mild conditions 18can be F-fluorinated. In this way, they allow the use of a novel fluorination according to the...
DE102010004957A1 Biologically active molecules for influencing viral, bacterial, parasite-infected cells and / or tumor cells and methods for their application  
The task was to specifically inhibit viral, bacterial, parasite-infected cells and tumor cells even in the case of mutations effectively. According to the invention biologically active molecules...
DE102009046982A1 Solid phase-bound nucleosides  
The invention relates to solid phase-bound nucleosides in which the nucleoside is attached via a 3'-O-disulfide bridge covalently to a solid phase, and a process for their preparation and their use.
DE102009046981A1 Process for the preparation of trinucleotides  
The invention relates to a process for the preparation of protected trinucleotides using a combination of specific protecting groups.
DE102009051438A1 fluorescent dyes  
The present invention relates to novel compounds useful as fluorescent dyes. In particular, the present invention relates to a new class of derivatized with chromophores, pharmacologically active...
DE102009045006A1 Anti-CD33 antibodies and their use for Immunotargeting in the treatment of CD33-associated diseases  
The invention relates to antibodies against the tumor-associated antigen CD33 and their use for Immunotargeting of CD33-positive cells. The antibodies of the invention are suitable for use in the...
DE202009016292U1 As emulsifier acting composition for water-solubilized hydrophobic compounds  
Composition having an HLB value of greater than 10, which as an emulsifier for a solubilized preparation of at least one raw material and / or the active ingredient, which is not or only sparingly...
DE102010034968A1 Polymerizable compounds and liquid media  
The invention relates to polymerisable compounds of the formula I, wherein P, Sp, R1, R2, A1, A2, A3, Z1, Z3, V, m, n, o, x and y have the meanings given in claim 1, and liquid-crystalline media...
DE102009032502A1 Detection of antigens  
The invention discloses a method for detecting at least one antigen, comprising the steps of: providing magnetic beads coated with antibodies specific for at least one antigen to be detected;...
DE102009024757B4 Methods and apparatus for controlling a chemical reaction by means of pressure using high-pressure optimized biocomponents  
A method for controlling a chemical reaction by means of compressed using high pressure optimized bio, where a combination of high-pressure-optimized and low-pressure-optimized bio, which can each...
DE102009024732A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-1 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-3, is new. Oligonucleotide, comprising one or more sequences including (5'-gatcttagggatgtccacctc-3') (SEQ ID NO. 1),...
DE102009024731A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-2 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-4, is new. Oligonucleotide, comprising one or more sequences including 5'-tattcctgcccccgtagag-3' (SEQ ID NO. 1),...
DE102009024730A1 New oligonucleotide, comprising specified sequences, is argonaute-3a expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide comprising one or more sequences comprising SEQ ID NOs: 1-7, is new. Oligonucleotide, comprising one or more sequences including agaaaaatgaacgccccaca (SEQ ID NO: 1),...
DE102009024729A1 New oligonucleotide, comprising specified sequences, is argonaute-4 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide, comprising one or more sequences comprising SEQ ID NOs: 1-6, is new. Oligonucleotide, comprising one or more sequences including caggcaaagattggaaaggg (SEQ ID NO: 1),...
DE102009022513A1 A method for protecting membranes  
The present invention relates to a method for the protection of membranes by treatment with an aqueous solution containing at least one water-soluble, nucleophilic compound, and the use of this...
DE102009020261A1 A method for solid-phase-aided manufacturing phosphatverbrückter nucleoside conjugates  
The invention relates to a process for preparing phosphatverbrückter nucleoside conjugates. In the method, a cycloSaligenyl-nucleotide is prepared, to which a linker is added, by means of which...
DE102009012169B3 Device and method for producing a replica or a derivative of an array of molecules and applications thereof  
A method of manufacturing a replica, or a derivative of an array of molecules wherein said array having a spatial array of separate samples of molecules, said generating comprises at least one...
DE102009013748A1 Determination of interactions constant antibody portions with Fc gamma receptors  
The invention relates to a novel method for the exact determination of the binding of the Fc-portion of IgG antibodies to Fc-gamma receptors and for the simultaneous examination of the antigen...
DE102009013748B4 Determination of interactions constant antibody portions with Fc gamma receptors  
A recombinant expression vector comprising sequences for the recombinant expression of at least one fusion protein on the surface of a mammalian cell comprising a) an extracellular portion of a...
DE102009015978A1 Method for determining the predisposition of a subject to altered biotransformation and the development of adverse drug reactions in a treatment of the patient with atorvastatin  
The present invention relates to a method of determining a predisposition of a patient for the development of muscular disorders and / or modified biotransformation at a treatment of the patient...
DE102008064667B4 A method for producing a Detektionskonjugats  
A method for producing a Detektionskonjugats for use in the analysis of cells for the presence of an analyte, characterized in that a metal is eroded in an aqueous composition containing a...
DE102008064184A1 Method for increasing the sucrose yield in agricultural cultivation of sugar beet and sugar  
Use of a nucleic acid which is suitable in a plant cell to reduce the enzymatic activity of an invertase, for forming a sucrose storage organ of a plant, wherein the sucrose concentration compared...
DE102008063592B4 Multifunctional laboratory process bags for the clean production of biomolecules  
Process for as many times repeatable providing subsets purified biomolecules or Biologicals a whole the same clonal origin for quality tests or functional tests with steps a) introducing at least...
DE112008001507T5 New hybrid compounds of nucleobases and organic redox molecules and their use  
Hybrid combination with i) a unit of a purine or pyrimidine nucleobase or a Dervivat thereof, ii) a redox active moiety and iii) a spacer moiety connecting the Nukleobaseeinheit with the redox...