Match Document Document Title
DE102018103924A1 Gentherapeutic treatment of deafness  
The present invention relates to a viral vector, in particular an adeno-associated virus (AAV) vector, and its use in the gene therapy of deafness, in particular of deafness, which is based on one...
DE102018100619A1 Gentherapeutic treatment of deafness  
The present invention relates to a viral vector, in particular an adeno-associated virus (AAV) vector, and its use in the gene therapy of deafness, especially DFNB93 deafness.
DE112015005320T5 Janus nanoparticles and methods for making the same  
The present invention is to provide a Janus nanoparticle, with a simple method, a drug may be encapsulated in, and a method of manufacturing the same. According to the present invention, a method...
DE102015115158B4 Method and kit for the diagnosis of epithelial-mesenchymal transition (EMT) of the peritoneum  
A kit for the diagnosis of epithelial-mesenchymal transition (EMT) comprising agents for the detection of markers in a sample, the markers comprising a) an extracellular matrix protein, b) a...
DE112004002217B4 Protein-forming complex with a c-Jun protein, nucleic acid encoding the same, and methods using the same  
Use of a protein of the following (a) or (b): (a) a protein comprising any of the amino acid sequences of SEQ ID NOS: 95 to 99, SEQ ID NOS: 1 to 69, SEQ ID NOS: 70 to 87, SEQ ID NOS: SEQ ID NOS:...
DE102015115158A1 Method and kit for the diagnosis of epithelial-mesenchymal transition (EMT) of the peritoneum  
The invention relates to the field of the diagnosis of epithelial-mesenchymal transition (EMT), eg mesothelial-mesenchymal transition (MMT), in particular EMT of the peritoneum, which often occurs...
DE102011000036B4 Rekombinante plasmidhaltige Mehrkopie-CpG-Motive und deren Transformanten zur Anwendung als DNA-Adjuvans in Vogel-Impfstoffen  
Ein Transformant eines rekombinanten Plasmids, das Mehrkopie-CpG-Motive enthält, wird offengelegt. Das rekombinante Plasmid, das ein immunostimulatorisches Polynukleotid enthält, das eine Sequenz...
DE102015111756A1 Recombinant Orf virus vector  
The invention relates to a recombinant Orf virus vector, a cell containing the recombinant Orf virus vector, a composition containing the recombinant Orf virus vector according to the invention...
DE112015000456T5 Methods and compositions for use in the treatment of inflammatory and autoimmune diseases  
In the present case are methods for treating neuroinflammation by administering a selective protein C activator, such as. Recombinant human WE thrombin and optionally one or more disclosed by the...
DE102014011258A1 Assozziierte tumor antigens for diagnosis and therapy  
The invention relates to a pharmaceutical composition comprising an agent that detects or inhibits the expression or activity of a tumor-associated antigen, and a method for the treatment and...
DE102013019352A1 Tri-specific recombinant antibody derivatives for the treatment of malignant diseases by activation of a NK cell-based immune response  
The invention is an agent for treatment of malignant myeloma and other CD138 positive tumors, which acts through the activation of an anti-tumor immune response after simultaneous stimulation of...
DE102014002256A1 Gene products for diagnosis and treatment  
The invention relates to a pharmaceutical composition comprising an agent that inhibits the expression or activity of a tumor-associated antigen, and a method for the treatment and diagnosis of...
DE102006016365B4 RNA interference Tags  
Composition for inhibiting the expression of a target gene in a eukaryotic cell, wherein the cell was not obtained under destruction of human embryos, by means of RNA interference, characterized...
DE102014016541A1 The possibility of diseases especially degenerative cause cell wear, Gewebszersteurung, cell changes of any causes also genetic in nature, thus neoplasia WITH RIBONUKELINSÄUREN which were obtained from cells in to Mom  
In all mammals takes place a metamorphosis in the early embryonic phase. The ribonucleic acids formed during a metamorphosis worry as messengers in the cells in question for a conversion of this...
DE102013111099A1 Permanent gene correction by nukleotidmodifizierter messenger RNA  
The present invention relates to a nukleotidmodifizierte messenger RNA for the permanent correction of a genetic modification on a DNA. The invention also relates to a nukleotidmodifizierte...
DE102005055128B4 Viral vector, the use thereof for the therapy of hepatocellular carcinoma and pharmaceutical compositions comprising the vector  
Vector comprising a nucleic acid sequence of SEQ ID NO: first
DE10297513C5 In vitro production of dendritic cells from CD14 + monocytes  
Use of CD14+ Monocytes isolated from peripheral circulating blood in order to obtain by differentiating at least a mixed population of Langerhans and interstitial dendritic cells, both the...
DE10066235C5 Method and medicament for the inhibition of expression of a given gene  
A method for inhibiting the expression of a given target gene in a mammalian cell, wherein a vector for coding at least one consisting of 15 to 2 base pairs oligoribonucleotide with...
DE19756864C5 Neural progenitor cells, methods for their preparation and their use for the therapy of neural defects  
Isolated, purified precursor cells with neuronal or glial properties from embryonic stem cells, containing at most about 15% primitive embryonic and non-neutral cells obtainable by the following...
DE10144906B4 A process for the large scale production of vaccines  
A process for the large scale production of vaccines, in which: (a) a MDCK suspension culture in a serum-free, protein-free or chemically defined Medicare to increasingly wherein(I) the...
DE102004037611B4 Inducible gene expression  
Method for improved inducible gene expression, comprising (I) providing a target nucleic acid to be expressed sequence coding for a therapeutic and / or diagnostic protein or a viral or retroviral...
DE102008047781B4 Peptides that bind to modified by matrix metalloprotease 2 human collagen IV, pharmaceutical preparation and the use thereof  
An oligopeptide having an amino-terminal amino acid sequence Seq. ID No. 1.
DE102011109868A1 Multiple emulsion  
The invention relates to a multiple emulsion for application of at least one pharmaceutical or cosmetic active substance an outer water phase W1, One in the outer water phase W1 dispersed oil...
DE102011118024A1 New procaspase 1 expression inhibitor, useful for preventing and/or treating inflammatory diseases, which are autoinflammatory diseases  
Procaspase 1 expression inhibitor, is new. Independent claims are included for: (1) a small hairpin RNA (shRNA), which is processable to a small interfering RNA (siRNA); (2) a vector, which...
DE102011103438A1 Use of first generation viologen dendrimers or second or higher generation viologen dendrimers for in vitro transporting oligo-nucleotides, ribonucleic acids and single- or double-stranded DNA into eukaryotic cells  
Use of first generation viologen dendrimers (I) or second or higher generation viologen dendrimers for transporting oligo-nucleotides, ribonucleic acids and single- or double-stranded DNA into...
DE102011100581A1 Treatment of hyperproliferative disorders of the genitourinary tract  
The present invention relates to the treatment of a hyperproliferative disease of the Urogenitalstraktes, in particular suitable for this purpose molecules, devices and methods.
DE102011018586A1 New vector system, useful e.g. as a part of a viral or non-viral gene transfer vector to control targeted expression of a therapeutic DNA sequence and as a part of transfer construct or gene construct for modifying embryonic stem cells  
Vector system is new, where the vector system is a part of a viral or non-viral gene transfer vector, in which a desired gene, a complementary DNA (cDNA) or a functional DNA segment linked to the...
DE102010036997A1 LOV domain protein for photosensitive Desfunktionalisierung  
The present invention relates to the use of a protein comprising a LOV domain to photosensitive Desfunktionalisierung a molecule and a method for photosensitive Desfunktionalisierung a target...
DE102010056610A1 A pharmaceutical composition comprising L-DNA  
The invention relates to the use of a L-DNA, which is capable of binding to a L-RNA, in particular in an antisense reaction and is optionally capable of cleaving the L-RNA in the range of a target...
DE10009143B4 Detection of human papillomavirus  
A method for the detection of human papillomavirus (HPV) in biological material, comprising the steps of: a) Extraction / isolation of nucleic acids from the biological material, and b) detecting...
DE10237517B4 A process for the enrichment or depletion of biomolecules from liquid or fluid media using Schichtdoppelhydroxiden and use of other on a layered double hydroxide or incorporated biomolecules as inorganic Vector  
A process for the removal or recovery or purification of at least one biomolecule, which contains, as building blocks nucleotides, nucleosides, amino acids, monosaccharides and / or fatty acids...
DE102011000036A1 Recombinant plasmid-more-copy CpG motifs and their transformants for use as DNA adjuvant in vaccines Bird  
A transformant of a recombinant plasmid containing multi-copy CpG motifs, is disclosed. The recombinant plasmid containing an immunostimulatory polynucleotide having a sequence of the continuous...
DE102010046866A1 Diagnosing diseases of central nervous system e.g. primary lymphoma, comprises determining content of microRNA highly diagnostic for presence or absence of disease in a sample of cerebrospinal fluid, and comparing with a reference value  
Diagnosing diseases of central nervous system, preferably primary lymphoma, inflammatory changes, neuroepithelial and meningeal tumors, comprises determining the content of at least one microRNA...
DE19925052B4 Protein complexes for the targeted transport of (poly) peptides and nucleic acids and site-specific integration of DNA vectors  
Transport system to protein complex-based composition comprising a recombinase, z. B. HIV-1 integrase (10) which is fused to a sequence-specific DNA-binding domain (DBD) (6), which replaces a...
DE102010001332A1 Producing medicament comprises imaging amplified genome segments in isolated tumor sample, reproducing and sequencing fusion area of fused amplified genome segments in amplicons and providing sample, which specifically bind to fusion area  
Producing an individual specific medicament, comprises (a) high-resolution imaging of amplified genome segments in an isolated tumor sample using fine-tiling array, optionally after previous total...
DE102010010288A1 Medicament, useful to prevent or treat e.g. ulcerative colitis, comprises polypeptide sequences of cysteine-rich protein 61 (CCN1) and/or cyclic arginine-glycine-aspartic acid peptide, or nucleic acid encoding polypeptide sequence of CCN1  
Medicament comprises polypeptide sequences of cysteine-rich protein 61 (CCN1 or CYR61) comprising sequences of SEQ ID NO: 001 (where sequence is not defined) and/or a cyclic RGD...
DE102010007562A1 Dermatological pharmaceutical composition suitable for oligonucleotides  
The present invention relates to a cosmetic and / or dermatological and or pharmaceutical composition for topical application and application of oligonucleotides, in particular antisense...
DE102004037652B4 Process for the modulation of gene expression by changing the CpG content  
Method for the targeted modulation of gene expression, comprising: (I) providing a target nucleic acid sequence to be expressed, (Ii) modifying the target nucleic acid sequence, wherein the number...
DE102009054265A1 Producing a gene encoded molecule comprises feeding a nucleic acid comprising a gene encoding the molecule to the arthropod  
Producing a gene encoded molecule in an arthropod in vivo comprises feeding a nucleic acid comprising a gene encoding the molecule to the arthropod. Independent claims are: (1) a composition for...
DE10164805B4 Method and means for modification of human angiogenesis  
A method of transporting a nucleic acid molecule in eukaryotic cells, cell cultures or tissue, in particular cells and tissues of mammals, wherein human embryonic stem cells are excluded, and...
DE102009024732A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-1 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-3, is new. Oligonucleotide, comprising one or more sequences including (5'-gatcttagggatgtccacctc-3') (SEQ ID NO. 1),...
DE102009024731A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-2 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-4, is new. Oligonucleotide, comprising one or more sequences including 5'-tattcctgcccccgtagag-3' (SEQ ID NO. 1),...
DE102009024730A1 New oligonucleotide, comprising specified sequences, is argonaute-3a expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide comprising one or more sequences comprising SEQ ID NOs: 1-7, is new. Oligonucleotide, comprising one or more sequences including agaaaaatgaacgccccaca (SEQ ID NO: 1),...
DE102009024729A1 New oligonucleotide, comprising specified sequences, is argonaute-4 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide, comprising one or more sequences comprising SEQ ID NOs: 1-6, is new. Oligonucleotide, comprising one or more sequences including caggcaaagattggaaaggg (SEQ ID NO: 1),...
DE102009021592A1 ASLV vector system  
The invention provides a viral self-inactivating (SIN) vector on the basis of the Avian sarcoma leukosis virus (ASLV) ready and a split-packaging system which comprises a first helper plasmid...
DE10106493B4 A process for the production of nucleic acids  
A process for the preparation of nucleic acids comprising the steps of Bacterial cells contained (a) Cultivation of the nucleic acid in a medium without components and complex (B) isolating the...
DE102009009672A1 Regulatory nucleic acid of a human proteinase 3 variant  
The invention relates to an isolated regulatory nucleic acid comprising a nucleic acid sequence according to SEQ ID NO 2 or a biologically active fragment thereof that is specific amplizierbar and...
DE102007008596B4 Biologically active molecules on the basis of PNA and siRNA, methods for their cell-specific activation and application kit for administration  
Biologically active molecules on the basis of PNA and siRNA for the biologically inactive transfection into a target cell, to inhibit in these after biological activation by bonding to mRNA and,...
DE102009007929A1 Use of L-ribozymes (which are capable of splitting L-RNA in a region of a target sequence) for preparing composition to treat undesired physiological secondary reactions due to administration of a therapeutic molecule containing L-RNA  
Use of L-ribozymes (which are capable of splitting L-RNA in a region of a target sequence of the L-RNA) for preparing a pharmaceutical composition to treat undesired physiological secondary...
DE102009006606A1 Non-viral transfection  
Non-viral transfection, consisting of polymer / nucleic acid complexes and nanofibers, wherein the polymer / nucleic acid complexes are composed of at least one nucleic acid and at least one...