Match Document Document Title
DE112015005320T5 Janus nanoparticles and methods for making the same  
The present invention is to provide a Janus nanoparticle, with a simple method, a drug may be encapsulated in, and a method of manufacturing the same. According to the present invention, a method...
DE112004002217B4 Protein-forming complex with a c-Jun protein, nucleic acid encoding the same, and methods using the same  
Use of a protein of the following (a) or (b): (a) a protein comprising any of the amino acid sequences of SEQ ID NOS: 95 to 99, SEQ ID NOS: 1 to 69, SEQ ID NOS: 70 to 87, SEQ ID NOS: SEQ ID NOS:...
DE102015115158B4 Method and kit for the diagnosis of epithelial-mesenchymal transition (EMT) of the peritoneum  
A kit for the diagnosis of epithelial-mesenchymal transition (EMT) comprising agents for the detection of markers in a sample, the markers comprising a) an extracellular matrix protein, b) a...
DE102015115158A1 Method and kit for the diagnosis of epithelial-mesenchymal transition (EMT) of the peritoneum  
The invention relates to the field of the diagnosis of epithelial-mesenchymal transition (EMT), eg mesothelial-mesenchymal transition (MMT), in particular EMT of the peritoneum, which often occurs...
DE102015111756A1 Recombinant Orf virus vector  
The invention relates to a recombinant Orf virus vector, a cell containing the recombinant Orf virus vector, a composition containing the recombinant Orf virus vector according to the invention...
DE112015000456T5 Methods and compositions for use in the treatment of inflammatory and autoimmune diseases  
In the present case are methods for treating neuroinflammation by administering a selective protein C activator, such as. Recombinant human WE thrombin and optionally one or more disclosed by the...
DE102014011258A1 Assozziierte tumor antigens for diagnosis and therapy  
The invention relates to a pharmaceutical composition comprising an agent that detects or inhibits the expression or activity of a tumor-associated antigen, and a method for the treatment and...
DE102013019352A1 Tri-specific recombinant antibody derivatives for the treatment of malignant diseases by activation of a NK cell-based immune response  
The invention is an agent for treatment of malignant myeloma and other CD138 positive tumors, which acts through the activation of an anti-tumor immune response after simultaneous stimulation of...
DE102014002256A1 Gene products for diagnosis and treatment  
The invention relates to a pharmaceutical composition comprising an agent that inhibits the expression or activity of a tumor-associated antigen, and a method for the treatment and diagnosis of...
DE102014016541A1 The possibility of diseases especially degenerative cause cell wear, Gewebszersteurung, cell changes of any causes also genetic in nature, thus neoplasia WITH RIBONUKELINSÄUREN which were obtained from cells in to Mom  
In all mammals takes place a metamorphosis in the early embryonic phase. The ribonucleic acids formed during a metamorphosis worry as messengers in the cells in question for a conversion of this...
DE102013111099A1 Permanent gene correction by nukleotidmodifizierter messenger RNA  
The present invention relates to a nukleotidmodifizierte messenger RNA for the permanent correction of a genetic modification on a DNA. The invention also relates to a nukleotidmodifizierte...
DE10297513C5 In vitro production of dendritic cells from CD14 + monocytes  
Use of CD14+ Monocytes isolated from peripheral circulating blood in order to obtain by differentiating at least a mixed population of Langerhans and interstitial dendritic cells, both the...
DE10066235C5 Method and medicament for the inhibition of expression of a given gene  
A method for inhibiting the expression of a given target gene in a mammalian cell, wherein a vector for coding at least one consisting of 15 to 2 base pairs oligoribonucleotide with...
DE19756864C5 Neural progenitor cells, methods for their preparation and their use for the therapy of neural defects  
Isolated, purified precursor cells with neuronal or glial properties from embryonic stem cells, containing at most about 15% primitive embryonic and non-neutral cells obtainable by the following...
DE102011109868A1 Multiple emulsion  
The invention relates to a multiple emulsion for application of at least one pharmaceutical or cosmetic active substance an outer water phase W1, One in the outer water phase W1 dispersed oil...
DE102011118024A1 New procaspase 1 expression inhibitor, useful for preventing and/or treating inflammatory diseases, which are autoinflammatory diseases  
Procaspase 1 expression inhibitor, is new. Independent claims are included for: (1) a small hairpin RNA (shRNA), which is processable to a small interfering RNA (siRNA); (2) a vector, which...
DE102011103438A1 Use of first generation viologen dendrimers or second or higher generation viologen dendrimers for in vitro transporting oligo-nucleotides, ribonucleic acids and single- or double-stranded DNA into eukaryotic cells  
Use of first generation viologen dendrimers (I) or second or higher generation viologen dendrimers for transporting oligo-nucleotides, ribonucleic acids and single- or double-stranded DNA into...
DE102011100581A1 Treatment of hyperproliferative disorders of the genitourinary tract  
The present invention relates to the treatment of a hyperproliferative disease of the Urogenitalstraktes, in particular suitable for this purpose molecules, devices and methods.
DE102011018586A1 New vector system, useful e.g. as a part of a viral or non-viral gene transfer vector to control targeted expression of a therapeutic DNA sequence and as a part of transfer construct or gene construct for modifying embryonic stem cells  
Vector system is new, where the vector system is a part of a viral or non-viral gene transfer vector, in which a desired gene, a complementary DNA (cDNA) or a functional DNA segment linked to the...
DE102010036997A1 LOV domain protein for photosensitive Desfunktionalisierung  
The present invention relates to the use of a protein comprising a LOV domain to photosensitive Desfunktionalisierung a molecule and a method for photosensitive Desfunktionalisierung a target...
DE102010056610A1 A pharmaceutical composition comprising L-DNA  
The invention relates to the use of a L-DNA, which is capable of binding to a L-RNA, in particular in an antisense reaction and is optionally capable of cleaving the L-RNA in the range of a target...
DE102011000036A1 Recombinant plasmid-more-copy CpG motifs and their transformants for use as DNA adjuvant in vaccines Bird  
A transformant of a recombinant plasmid containing multi-copy CpG motifs, is disclosed. The recombinant plasmid containing an immunostimulatory polynucleotide having a sequence of the continuous...
DE102011000036B4 Rekombinante plasmidhaltige Mehrkopie-CpG-Motive und deren Transformanten zur Anwendung als DNA-Adjuvans in Vogel-Impfstoffen  
Ein Transformant eines rekombinanten Plasmids, das Mehrkopie-CpG-Motive enthält, wird offengelegt. Das rekombinante Plasmid, das ein immunostimulatorisches Polynukleotid enthält, das eine Sequenz...
DE102010046866A1 Diagnosing diseases of central nervous system e.g. primary lymphoma, comprises determining content of microRNA highly diagnostic for presence or absence of disease in a sample of cerebrospinal fluid, and comparing with a reference value  
Diagnosing diseases of central nervous system, preferably primary lymphoma, inflammatory changes, neuroepithelial and meningeal tumors, comprises determining the content of at least one microRNA...
DE102010001332A1 Producing medicament comprises imaging amplified genome segments in isolated tumor sample, reproducing and sequencing fusion area of fused amplified genome segments in amplicons and providing sample, which specifically bind to fusion area  
Producing an individual specific medicament, comprises (a) high-resolution imaging of amplified genome segments in an isolated tumor sample using fine-tiling array, optionally after previous total...
DE102010010288A1 Medicament, useful to prevent or treat e.g. ulcerative colitis, comprises polypeptide sequences of cysteine-rich protein 61 (CCN1) and/or cyclic arginine-glycine-aspartic acid peptide, or nucleic acid encoding polypeptide sequence of CCN1  
Medicament comprises polypeptide sequences of cysteine-rich protein 61 (CCN1 or CYR61) comprising sequences of SEQ ID NO: 001 (where sequence is not defined) and/or a cyclic RGD...
DE102010007562A1 Dermatological pharmaceutical composition suitable for oligonucleotides  
The present invention relates to a cosmetic and / or dermatological and or pharmaceutical composition for topical application and application of oligonucleotides, in particular antisense...
DE102009054265A1 Producing a gene encoded molecule comprises feeding a nucleic acid comprising a gene encoding the molecule to the arthropod  
Producing a gene encoded molecule in an arthropod in vivo comprises feeding a nucleic acid comprising a gene encoding the molecule to the arthropod. Independent claims are: (1) a composition for...
DE102009024732A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-1 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-3, is new. Oligonucleotide, comprising one or more sequences including (5'-gatcttagggatgtccacctc-3') (SEQ ID NO. 1),...
DE102009024731A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-2 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-4, is new. Oligonucleotide, comprising one or more sequences including 5'-tattcctgcccccgtagag-3' (SEQ ID NO. 1),...
DE102009024730A1 New oligonucleotide, comprising specified sequences, is argonaute-3a expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide comprising one or more sequences comprising SEQ ID NOs: 1-7, is new. Oligonucleotide, comprising one or more sequences including agaaaaatgaacgccccaca (SEQ ID NO: 1),...
DE102009024729A1 New oligonucleotide, comprising specified sequences, is argonaute-4 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide, comprising one or more sequences comprising SEQ ID NOs: 1-6, is new. Oligonucleotide, comprising one or more sequences including caggcaaagattggaaaggg (SEQ ID NO: 1),...
DE102009021592A1 ASLV vector system  
The invention provides a viral self-inactivating (SIN) vector on the basis of the Avian sarcoma leukosis virus (ASLV) ready and a split-packaging system which comprises a first helper plasmid...
DE102009009672A1 Regulatory nucleic acid of a human proteinase 3 variant  
The invention relates to an isolated regulatory nucleic acid comprising a nucleic acid sequence according to SEQ ID NO 2 or a biologically active fragment thereof that is specific amplizierbar and...
DE102009007929A1 Use of L-ribozymes (which are capable of splitting L-RNA in a region of a target sequence) for preparing composition to treat undesired physiological secondary reactions due to administration of a therapeutic molecule containing L-RNA  
Use of L-ribozymes (which are capable of splitting L-RNA in a region of a target sequence of the L-RNA) for preparing a pharmaceutical composition to treat undesired physiological secondary...
DE102009006606A1 Non-viral transfection  
Non-viral transfection, consisting of polymer / nucleic acid complexes and nanofibers, wherein the polymer / nucleic acid complexes are composed of at least one nucleic acid and at least one...
DE102009004204A1 Method for enhanced bioactivation of drugs  
Drug with the general formula (I) or (II) having the partial structure . where R1 and R2 Hydrogen, alkyl or aryl.
DE102008063606A1 New nucleic acid construct, comprising first and second expression cassette comprising operatively linked e.g. constitutive expressing promoter, and minimal promoter, respectively, useful to prepare a product e.g. polypeptide or ribozyme  
Nucleic acid construct comprising (a) first expression cassette, which comprises operatively linked (i) a constitutive expressing promoter, and (ii) first component of transactivator system coding...
DE102008043654A1 Diagnostic and / or therapeutic agent, process for its preparation and use  
The invention relates to the fields of materials science and medicine and relates to an agent which can be used for example as a contrast agent for the localization of cancer cells.The object of...
DE102008050860A1 LCMV-GP pseudotype VSV vectors and tumor infiltrating virus producing cells for the treatment of tumors  
The invention relates to recombinant VSV virus and viral vectors containing a glycoprotein GP of the lymphocyte choriomeningitis virus (LCMV), instead of the G protein of VSV, virus producer cells...
DE102008029669A1 New drugs for hepatitis therapy  
The invention relates to the field of the treatment of hepatitis infections and hepatitis diseases, in particular hepatitis type C. In particular, the present invention is the use of an inhibitor...
DE102008023913A1 Composition, useful e.g. transfection comprises a non-viral gene delivery system containing e.g. cationic lipid, and an agent for partial suppression and/or activation of innate intracellular and/or intercellular immune defense  
Composition for transfection, comprises: (a) a non-viral gene delivery system containing cationic lipid, cationic polymer or a cationic protein, a compound, which exhibits a DNA and/or RNA-binding...
DE102008016275A1 Composition, useful e.g. transfection comprises a non-viral gene delivery system containing e.g. cationic lipid, and an agent for partial suppression and/or activation of innate intracellular and/or intercellular immune defense  
Composition for transfection, comprises: (a) a non-viral gene delivery system containing cationic lipid, cationic polymer or a cationic protein, a compound, which exhibits a DNA and/or RNA-binding...
DE102008013623A1 A pharmaceutical composition for diagnosis or treatment of diseases associated zinc finger protein  
The invention relates to nucleic acids to zinc finger proteins, for example, the human ZFY protein or to the human glioblastoma oncogene protein binding, and their uses.
DE102008013622A1 A pharmaceutical composition for the diagnosis or treatment of multiple myeloma  
The invention relates to pharmaceutical or diagnostic compositions containing at M antibody binding nucleic acids.
DE102007056488A1 Composition, useful e.g. transfection comprises a non-viral gene delivery system containing e.g. cationic lipid, and an agent for partial suppression and/or activation of innate intracellular and/or intercellular immune defense  
Composition for transfection, comprises: (a) a non-viral gene delivery system containing cationic lipid, cationic polymer or a cationic protein, a compound, which exhibits a DNA and/or RNA-binding...
DE102008047781A1 Use of an oligopeptide comprising a specific amino acid-sequence for the diagnosis or therapy of a pathological condition in a mammal, preferably human, where the condition is identified by angiogenic processes  
Use of an oligopeptide comprising an amino acid-sequence is claimed. Use of an oligopeptide comprising an amino acid-sequence Thr-Leu-Thr-Tyr-Thr-Trp-Ser or...
DE102008047781B4 Peptides that bind to modified by matrix metalloprotease 2 human collagen IV, pharmaceutical preparation and the use thereof  
An oligopeptide having an amino-terminal amino acid sequence Seq. ID No. 1.
DE102007048591A1 Implant and method for its preparation  
implant, a support and nucleic acid-functionalized comprising calcium phosphate nanoparticles.
DE102007044487A1 Using the reverse cell differentiation program (OCDP) for the treatment of degenerated, properties under pathological state organs  
The This invention relates to a method of treating degenerative and / or being in the pathological state organs by use phenotypically stable ausdifferenzierender or differentiated, but...