Matches 1 - 50 out of 76 1 2 >


Match Document Document Title
DE102014002256A1 Gene products for diagnosis and treatment  
The invention relates to a pharmaceutical composition comprising an agent that inhibits the expression or activity of a tumor-associated antigen, and a method for the treatment and diagnosis of...
DE10066235C5 Method and medicament for the inhibition of expression of a given gene  
A method for inhibiting the expression of a given target gene in a mammalian cell, wherein a vector for coding at least one consisting of 15 to 2 base pairs oligoribonucleotide with...
DE102012103041A1 New isolated antisense-oligonucleotide comprising sequence that is hybridized to messenger RNA-splicing-sequence of mutation-bearing exons of pre-messenger RNA of titin-gene and induces skipping of exons, used to treat heart disease  
Isolated antisense-oligonucleotide (AO) comprising a sequence that is specifically hybridizable to a messenger RNA (mRNA)-splicing-sequence of mutation-bearing exons of pre-mRNA of titin-gene and...
DE102011118024A1 New procaspase 1 expression inhibitor, useful for preventing and/or treating inflammatory diseases, which are autoinflammatory diseases  
Procaspase 1 expression inhibitor, is new. Independent claims are included for: (1) a small hairpin RNA (shRNA), which is processable to a small interfering RNA (siRNA); (2) a vector, which...
DE102011100581A1 Treatment of hyperproliferative disorders of the genitourinary tract  
The present invention relates to the treatment of a hyperproliferative disease of the Urogenitalstraktes, in particular suitable for this purpose molecules, devices and methods.
DE102010056610A1 A pharmaceutical composition comprising L-DNA  
The invention relates to the use of a L-DNA, which is capable of binding to a L-RNA, in particular in an antisense reaction and is optionally capable of cleaving the L-RNA in the range of a target...
DE102011000036A1 Recombinant plasmid-more-copy CpG motifs and their transformants for use as DNA adjuvant in vaccines Bird  
A transformant of a recombinant plasmid containing multi-copy CpG motifs, is disclosed. The recombinant plasmid containing an immunostimulatory polynucleotide having a sequence of the continuous...
DE102011000036B4 Rekombinante plasmidhaltige Mehrkopie-CpG-Motive und deren Transformanten zur Anwendung als DNA-Adjuvans in Vogel-Impfstoffen  
Ein Transformant eines rekombinanten Plasmids, das Mehrkopie-CpG-Motive enthält, wird offengelegt. Das rekombinante Plasmid, das ein immunostimulatorisches Polynukleotid enthält, das eine Sequenz...
DE102010046866A1 Diagnosing diseases of central nervous system e.g. primary lymphoma, comprises determining content of microRNA highly diagnostic for presence or absence of disease in a sample of cerebrospinal fluid, and comparing with a reference value  
Diagnosing diseases of central nervous system, preferably primary lymphoma, inflammatory changes, neuroepithelial and meningeal tumors, comprises determining the content of at least one microRNA...
DE102010001332A1 Producing medicament comprises imaging amplified genome segments in isolated tumor sample, reproducing and sequencing fusion area of fused amplified genome segments in amplicons and providing sample, which specifically bind to fusion area  
Producing an individual specific medicament, comprises (a) high-resolution imaging of amplified genome segments in an isolated tumor sample using fine-tiling array, optionally after previous total...
DE102010022937A1 Cell-specific activatable biologically active molecules on the basis of siRNA, methods for their activation and application kit for administration  
Task is to provide biologically active substances which are transfected in vitro and in vivo in animals, plants and fungi in or on target cells and only there inhibit the expression of genes...
DE102010007562A1 Dermatological pharmaceutical composition suitable for oligonucleotides  
The present invention relates to a cosmetic and / or dermatological and or pharmaceutical composition for topical application and application of oligonucleotides, in particular antisense...
DE102009054265A1 Producing a gene encoded molecule comprises feeding a nucleic acid comprising a gene encoding the molecule to the arthropod  
Producing a gene encoded molecule in an arthropod in vivo comprises feeding a nucleic acid comprising a gene encoding the molecule to the arthropod. Independent claims are: (1) a composition for...
DE102009024732A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-1 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-3, is new. Oligonucleotide, comprising one or more sequences including (5'-gatcttagggatgtccacctc-3') (SEQ ID NO. 1),...
DE102009024731A1 New oligonucleotide, comprising specified nucleotide sequences, is argonaute-2 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or tumors e.g. breast cancer  
Oligonucleotide, comprising one or more sequences including SEQ ID NOs. 1-4, is new. Oligonucleotide, comprising one or more sequences including 5'-tattcctgcccccgtagag-3' (SEQ ID NO. 1),...
DE102009024730A1 New oligonucleotide, comprising specified sequences, is argonaute-3a expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide comprising one or more sequences comprising SEQ ID NOs: 1-7, is new. Oligonucleotide, comprising one or more sequences including agaaaaatgaacgccccaca (SEQ ID NO: 1),...
DE102009024729A1 New oligonucleotide, comprising specified sequences, is argonaute-4 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis  
Oligonucleotide, comprising one or more sequences comprising SEQ ID NOs: 1-6, is new. Oligonucleotide, comprising one or more sequences including caggcaaagattggaaaggg (SEQ ID NO: 1),...
DE102009009672A1 Regulatory nucleic acid of a human proteinase 3 variant  
The invention relates to an isolated regulatory nucleic acid comprising a nucleic acid sequence according to SEQ ID NO 2 or a biologically active fragment thereof that is specific amplizierbar and...
DE102009007929A1 Use of L-ribozymes (which are capable of splitting L-RNA in a region of a target sequence) for preparing composition to treat undesired physiological secondary reactions due to administration of a therapeutic molecule containing L-RNA  
Use of L-ribozymes (which are capable of splitting L-RNA in a region of a target sequence of the L-RNA) for preparing a pharmaceutical composition to treat undesired physiological secondary...
DE20122915U1 Peptidomimetics as protease inhibitors  
Compound of the formula 1 in which: - R0 a bond or difluoromethylene and - R1 Hydrogen, an optionally substituted aliphatic group, an optionally substituted cyclic group or an optionally...
DE102008016275A1 Composition, useful e.g. transfection comprises a non-viral gene delivery system containing e.g. cationic lipid, and an agent for partial suppression and/or activation of innate intracellular and/or intercellular immune defense  
Composition for transfection, comprises: (a) a non-viral gene delivery system containing cationic lipid, cationic polymer or a cationic protein, a compound, which exhibits a DNA and/or RNA-binding...
DE102007056488A1 Composition, useful e.g. transfection comprises a non-viral gene delivery system containing e.g. cationic lipid, and an agent for partial suppression and/or activation of innate intracellular and/or intercellular immune defense  
Composition for transfection, comprises: (a) a non-viral gene delivery system containing cationic lipid, cationic polymer or a cationic protein, a compound, which exhibits a DNA and/or RNA-binding...
DE102007041654A1 Use of marker sequences for the diagnosis of rheumatoid arthritis, where the marker sequences of a complementary DNA (cDNA) from the specific sequence is determined in a patient  
Use of marker sequences for the diagnosis of rheumatoid arthritis, is claimed, where at least a marker sequence of a complementary DNA (cDNA) from the SEQ ID NO. 1-488 (not defined) or a protein...
DE102007041656A1 Use of marker sequences for the diagnosis of rheumatoid arthritis, where the marker sequences of a complementary DNA (cDNA) from the specific sequence is determined in a patient  
Use of marker sequences for the diagnosis of rheumatoid arthritis, is claimed, where at least a marker sequence of a complementary DNA (cDNA) from the SEQ ID NO. 1-488 (not defined) or a protein...
DE102007044093A1 Nucleic acid-containing cosmetic and / or pharmaceutical preparations for the induction of antimicrobial peptides in epithelial tissues Deck  
The present invention relates to cosmetic and / or pharmaceutical Preparations for the treatment of epithelial integument by induction antimicrobial peptides in the treated epithelial integument...
DE102007041657A1 Marker sequences for multiple sclerosis and their use  
The This invention relates to novel marker sequences for Multiple Sclerosis and their diagnostic use, including a A method for screening potential drugs for Multiple Sclerosis by these marker...
DE102006050655A1 Pharmaceutical composition useful for treating allergic diseases comprises RNA and an allergen  
Pharmaceutical composition comprises RNA and an allergen. ACTIVITY : Antiallergic; Antiasthmatic; Dermatological; Antiinflammatory; Ophthalmological. No biological data given. MECHANISM OF ACTION...
DE10066235B4 Targeted inhibition of gene expression by administration of double stranded oligoribonucleotide to a cell, useful for treating humans, animals and plants against viral infection  
A new method to inhibit the expression of a predetermined target gene in a cell, comprises introducing an oligoribonucleotide with double stranded structure (dsRNA) or a vector coding for the...
DE10080167B4 Medicament for inhibiting the expression of a given gene  
drug with at least one 15 and 49 base pairs containing oligoribonucleotide with double Structure (dsRNA) for inhibiting the expression of a given target gene in mammalian cells, wherein the...
DE102006035618A1 New nucleic acid useful as immuno-stimulating adjuvant for manufacture of a composition for treatment of cancer diseases e.g. colon carcinomas and infectious diseases e.g. influenza and malaria  
Nucleic acid (I) is new. Nucleic acid of formula G lX mG n (I) is new. G = guanosine, uracil or an analog; X = guanosine, uracil, adenosine, thymidine, cytosine or an analog; l = 1-40; m >= 3; and...
DE102006032424A1 Treatment of T-cell malignancies  
The This invention relates to the use of inhibitors BCL11B for the treatment of T-cell malignancies.
DE202007009679U1 Compositions and uses thereof for the treatment of muscle wasting conditions  
Composition, which is suitable for administration to an animal comprising a modified oligonucleotide 7-75 consecutive ribose contains, which together by achiral 5 'to 3'...
DE102006016365A1 Composition for inhibiting expression of one or more target genes in a eukaryotic cell comprises one or more genetic constructs comprising a target gene and a small interfering RNA tag  
Composition for inhibiting expression of one or more target genes in a eukaryotic cell comprises one or more genetic constructs comprising a target gene and a small interfering RNA (siRNA) tag,...
DE102006016365B4 RNA interference Tags  
Composition for inhibiting the expression of a target gene in a eukaryotic cell, wherein the cell was not obtained under destruction of human embryos, by means of RNA interference, characterized...
DE102005055128B4 Viral vector, the use thereof for the therapy of hepatocellular carcinoma and pharmaceutical compositions comprising the vector  
Vector comprising a nucleic acid sequence of SEQ ID NO: first
DE102005055128A1 Viraler Vektor, dessen Verwendung zur Therapie von Leberzellkarzinomen und pharmazeutische Mittel umfassend den Vektor  
Die Erfindung betrifft einen viralen Vektor, der Nukleinsäure-Sequenzen umfasst, die IL-12 und ein Kostimulator-Protein kodieren und ferner einen AFP-Promotor und MER-I-Enhancer umfassen. Die...
DE102005053947A1 Neue Arzneimittel  
Die vorliegende Erfindung betrifft die Verwendung eines Modulators des Tryptophanmetabolimus zur Herstellung eines Arzneimittels zur Therapie und/oder Prophylaxe einer Immunparalyse und/oder...
DE112004002170T5 Improved methods and compositions for RNA interference  
process to weaken the expression of a target nucleotide sequence in a eukaryotic Cell, said method comprising: introducing double-stranded RNA (DsRNA) into the eukaryotic cell to the expression of...
DE202006010725U1 Composition containing modified oligonucleotide with achiral internucleotide phosphate bonds, useful for treating muscular atrophy or promoting muscle growth  
Composition (A) for administering to an animal comprises a modified oligonucleotide (ON), containing 7-75 consecutive ribose groups, linked together by achiral 5' to 3' internucleotide phosphate...
DE102004054731A1 New pharmaceutical composition comprising an oligonucleotide that is adapted to target nucleic acids encoding CD40, useful for preventing or treating an inflammatory, immune or autoimmune disorder  
A pharmaceutical composition comprising an oligonucleotide that is adapted to target nucleic acids encoding CD40, thus modulating the expression of CD40 mammalian cells, and an amphoteric liposome...
DE102005001784A1 Double strand molecule oligoribonucleotide/salt to induce dismantling of mRNA for cellular synthesis, and to transport neurotransmitter acetyl chlorine is used for reduction of sweat secretion  
A double strand molecule oligoribonucleotide/salt is used to induce dismantling of mRNA for cellular synthesis, and to transport neurotransmitter acetyl choline. Independent claims are included...
DE102005003788A1 siRNA molecules for the treatment of blood vessels  
The This invention relates to a nucleic acid molecule, a genetic construct, siRNA molecules and a composition or the nucleic acid molecule and / or the genetic construct and / the siRNA molecules...
DE102004056659A1 New pharmaceutical composition comprising an oligonucleotide that is adapted to target nucleic acids encoding CD40, useful for preventing or treating an inflammatory, immune or autoimmune disorder  
A pharmaceutical composition comprising an oligonucleotide that is adapted to target nucleic acids encoding CD40, thus modulating the expression of CD40 mammalian cells, and an amphoteric liposome...
DE102004054730A1 Serum stable amphoteric liposomes  
The Invention relates to amphoteric liposomal formulations, the special show serum stability and the intracellular Delivery of oligonucleotides suitable.
DE102004038535A1 Cellular infiltration of nucleic acid agents  
The Invention is the use of at least a first, Phosphorothioate-modified nucleic acid to improve the cellular uptake at least a second nucleic acid. It further relates to a pharmaceutical...
DE102004038535B4 Cellular infiltration of nucleic acid agents  
Using a phosphorothioate-modified nucleic acid to improve the effect of an siRNA-containing drug.
DE102004010547A1 Oligoribonucleotides for the treatment of irritative and / or inflammatory skin conditions by RNA interference  
The duplexed oligoribonucleotide or a physiologically acceptable Salt thereof, which is capable of degradation of mRNA of one or more in inflammation and / or to induce irritation of the skin...
DE102004011687A1 VGLUT specific dsRNA compounds  
The present invention provides dsRNAs ready for the VGLUT are specific and the phenomenon trigger the RNA interference can. Further, host cells containing these dsRNAs are provided. According to a...
DE102004007032A1 Antisense oligonucleotides hybridizing with mRNA or a gene sequence to code structures inhibiting skin or hair pigmentation act in melanine synthesis, expression of melanosome structures and/or melanosome transfer  
An oligonucleotide or physiologically-compatible salt able to hybridize with mRNA or a gene sequence to code one or more structures involved in skin or hair pigmentation takes part in (a) actual...
DE102004002351A1 New RNA aptamers specific for lipopolysaccharide-binding protein, useful for diagnosis and treatment of sepsis, inhibit the lipopolysaccharide-induced signaling cascade  
RNA aptamers (I), or their alleles and/or derivatives, that bind specifically to lipopolysaccharide-binding protein (LBP) are new. An independent claim is also included for a method for preparing...

Matches 1 - 50 out of 76 1 2 >