Title:
Neutrophilenaktivierungsfaktor, Verfahren zu seiner Herstellung und ihn enthaltende pharmazeutische Zusammensetzung
Kind Code:
B4


Abstract:

Neutrophilenaktivierungsfaktor (NAF), der von Human-monozyten abgeleitet ist und die folgende Aminosäuresequenz aufweist:
Ser-Ala-Lys-Glu-Leu-Arg-Cys-Gln-Cys-Ile-Lys-Thr-Tyr-Ser-Lys-Pro-Phe-His-Pro-Lys-Phe-Ile-Lys-Glu-Leu-Arg-Val-Ile-Glu-Ser-Gly-Pro-His-Cys-Ala-Asn-Thr-Glu-Ile-Ile-Val-Lys-Leu-Ser-Asp-Gly-Arg-Glu-Leu-Cys-Leu-Asp-Pro-Lys-Glu-Asn-Trp-Val-Gln-Arg-Val-Val-Glu-Lys-Phe-Leu-Lys-Arg-Ala-Glu-Asn-Ser,
dadurch gekennzeichnet, dass sein aminoterminales Ende wie folgt verkürzt ist:
a. Lys-Glu-Leu-Arg-Cys-Gln-Cys-Ile-Lys-Thr-Tyr-Ser-Lys-Pro-Phe-His-Pro-Lys-Phe-Ile-Lys-Glu-Leu-Arg-Val-Ile-Glu-Ser-Gly-Pro-; oder
Glu-Leu-Arg-Cys-Gln-Cys-Ile-Lys-Thr-Tyr-Ser-Lys-Pro-Phe-His-Pro-Lys-Phe-Ile-Lys-Glu-Leu-Arg-Val-Ile-Glu-Ser-Gly-Pro-.




Inventors:
Aschauer, Heinrich (Wien, AT)
Lindley, Ivan James Daldon (Brunn, AT)
Peveri, Paola (Bern, CH)
Walz, Alfred (Koeniz, CH)
Application Number:
DE3890998
Publication Date:
01/03/2008
Filing Date:
11/12/1988
Assignee:
Novartis AG (Basel, CH)
Theodor Kocher Institut (Bern, CH)



Foreign References:
WO1989004325A11989-05-18
Other References:
J.IMMUNOL. 139, 3474-83 (1987);
J.IMMUNOL. 139, 250-256 (1987);
j.IMMUNOL. 139, 788-793 (1987);
Attorney, Agent or Firm:
Spott, G., Dipl.-Chem. Dr.rer.nat., Pat.-Anw. (München, 80336)
Claims:
1. Neutrophilenaktivierungsfaktor (NAF), der von Human-monozyten abgeleitet ist und die folgende Aminosäuresequenz aufweist:
Ser-Ala-Lys-Glu-Leu-Arg-Cys-Gln-Cys-Ile-Lys-Thr-Tyr-Ser-Lys-Pro-Phe-His-Pro-Lys-Phe-Ile-Lys-Glu-Leu-Arg-Val-Ile-Glu-Ser-Gly-Pro-His-Cys-Ala-Asn-Thr-Glu-Ile-Ile-Val-Lys-Leu-Ser-Asp-Gly-Arg-Glu-Leu-Cys-Leu-Asp-Pro-Lys-Glu-Asn-Trp-Val-Gln-Arg-Val-Val-Glu-Lys-Phe-Leu-Lys-Arg-Ala-Glu-Asn-Ser,
dadurch gekennzeichnet, dass sein aminoterminales Ende wie folgt verkürzt ist:
a. Lys-Glu-Leu-Arg-Cys-Gln-Cys-Ile-Lys-Thr-Tyr-Ser-Lys-Pro-Phe-His-Pro-Lys-Phe-Ile-Lys-Glu-Leu-Arg-Val-Ile-Glu-Ser-Gly-Pro-; oder
Glu-Leu-Arg-Cys-Gln-Cys-Ile-Lys-Thr-Tyr-Ser-Lys-Pro-Phe-His-Pro-Lys-Phe-Ile-Lys-Glu-Leu-Arg-Val-Ile-Glu-Ser-Gly-Pro-.

2. Verfahren zur Herstellung von NAF nach Anspruch 1, dadurch gekennzeichnet, dass man den Überstand von humanen Monozytenkulturen chromatographisch reinigt und das NAF gewinnt.

3. Verfahren zur Herstellung von NAF nach Anspruch 1, dadurch gekennzeichnet, dass man jeweils in an sich bekannter Weise entsprechende Oligonukleotide synthetisiert, reinigt und ligiert, das erhaltene NAF-Gen kloniert, exprimiert und NAF gewinnt und reinigt.

4. Pharmazeutische Zusammensetzung, dadurch gekennzeichnet, dass sie NAF nach Anspruch 1 zusammen mit einem pharmazeutisch annehmbaren Träger oder Verdünnungsmittel enthält.

Description:

Die Erfindung betrifft einen Neutrophilenaktivierungsfaktor (NAF), Verfahren zu seiner Herstellung und ihn enthaltende pharmazeutische Zusammensetzung gemäß den Patentansprüchen.

1. Hintergrund

Die neutrophilen Leukozyten (Neutrophilen) sind die am häufigsten vorkommenden Leukozyten und machen etwa 2/3 der weißen Zellen im menschlichen Blut aus. Ihre hauptsächliche Funktion besteht in einem Schutz des Wirtorganismus gegen mikrobielle Infektionen. Die Neutrophilen sind mobil, sprechen auf chemotaktische Stimulanzien an, die nach einer Infektion gebildet werden, und können zur Abtötung der Mikroorganismen in infiziertes Gewebe eindringen. Dieses Abtöten ist abhängig von der Fähigkeit der Neutrophilen, die Mikroorganismen zu überwältigen und Sauerstoffradikale und mikrobiozide Enzyme freizusetzen (B.M. Babior, New Engl. J. Med. 298 [1978] Seite 659 bis 668, und M. Baggiolini, Experientia 40 [1984] Seiten 906 bis 909). Die Freisetzung solcher Produkte hängt von der Aktivierung der Neutrophilen ab. Substanzen, wie der hierin beschriebene Neutrophilenaktivierungsfaktor, sollten sich daher zur Verbesserung der Aktivierung von Neutrophilen und somit des antimikrobiellen Verteidigungsmechanismus im menschlichen Körper verwenden lassen.

Die WO 89/04325 A1 offenbart ein Neutrophilen aktivierendes Polypeptid, das isoliert wird aus stimulierten humanen mononukleären Zellen. J. IMMUNOL. 139, 250-256 (1987) offenbart ein β-Thromboglobulin-artiges Protein in Mitogen stimulierten humanen Leukozyten.

Es wurde nun gefunden, dass humane Monozyten einen Faktor ausscheiden, der bei menschlichen Neutrophilen eine Exozytose und den respiratorischen Knall (respiratory burt) (Bildung von Sauerstoffradikalen und Freisetzung von Enzym) einleitet und somit neutrophilaktivierende Eigenschaften entwickelt, die bei einer antimikrobiellen Wirksamkeit wichtig sind.

Der Faktor lässt sich aus der Kulturflüssigkeit stimulierter humaner Monozyten erhalten und hat ein scheinbares Molekulargewicht von etwa 6000, genauer von etwa 6500, ermittelt durch SDS-Gelelektrophorese.

Monozyten sind phagozytische Zellen, welche Neutrophilen ähneln. Im Gegensatz zu Neutrophilen sind Monozyten jedoch langlebig. Sie wandern vom Blut in alle möglichen Gewebestellen, wo sie sich in Makrophagen umwandeln. Die Umwandlung von Monozyten in Makrophagen lässt sich auch bei Zellkulturversuchen beobachten. Die Makrophagen im Gewebe haben eine Reihe von Funktionen, und vorwiegend die Funktion einer Phagozytose von unerwünschtem Material und einer Produktion einer großen Vielfalt an Peptiden und Proteinen, welche ausgeschieden werden. Die Makrophagen sammeln sich am Ort einer anhaltenden Infektion, und gerade an diesen Stellen dürfte die Bildung von NAF durch diese Zellen das Verteidigungsvermögen der Neutrophilen des Wirts verbessern und somit eine pathophysiologisch relevante Funktion haben.

NAF zeichnet sich durch seine Eigenschaft zur Aktivierung von Neutrophilen aus, nämlich durch die Einleitung des sogenannten respiratorischen Knalls unter Bildung von Sauerstoffradikalen und die Einleitung einer Enzymfreisetzung. Das Molekül von NAF weist folgende Eigenschaften auf: ein scheinbares Molekulargewicht von etwa 6500 in der SDS-Gelelektrophorese, einen isoelektrischen Punkt von etwa 8,6, eine Wärmebeständigkeit bis zu 80°C, eine Resistenz gegenüber einer Anzahl an Denaturierungsmitteln und eine Susceptibilität gegenüber Proteasen, und aufgrund dieser Eigenschaften dürfte NAF daher ein Polypeptid sein. Die Wirkung von NAF auf humane Neutrophilen ähnelt der Wirkung der beiden bekannten chemotaktischen Stimulanzien, nämlich dem Anaphylatoxin C5a und dem bakteriellen Peptid N-Formyl-L-methionyl-L-leucyl-L-phenyl-alanin (fMLP), wobei diese Wirkung jedoch von einem Oberflächenrezeptor vermittelt wird, an den sich NAF bindet und der sich von den Rezeptoren der bekannten Agonisten von humanen Neutrophilen unterscheidet. NAF wird durch Züchtung humaner Monozyten erzeugt, nicht jedoch von humanen Lymphozyten. Die Bildung von NAF ist abhängig von der Anwesenheit eines Stimulus, wie von bakteriellem Lipopolysaccharid (LPS), Phytohämagglutinin (PHA) oder Concanavalin A (ConA) und von der Konzentration des Stimulus sowie der Inkubationszeit.

Die Bildung von NAF wird durch Cycloheximid gehemmt, und dies zeigt, dass man es mit einer de novo Synthese von Protein zu tun hat.

Monozyten und Makrophagen sind, wie bereits erwähnt, reichliche Quellen für eine Vielzahl an biologisch aktiven Peptiden und Proteinen (C.F. Nathan, J. Clin. Invest. 79 [1987] Seiten 319 bis 326). Sie sind nachgewiesenerweise für die Bildung von drei unterschiedlichen Cytokinen veranwortlich, nämlich von Interleukin 1 (IL-1), dem Tumornekrosefaktor (TNF) und α-Interferon (IFN-α). Aus einer Reihe von Arbeiten geht hervor, dass Monozyten und Makrophagen auch Faktoren erzeugen, die auf Neutrophile einwirken, welche sich von den oben erwähnten unterscheiden. Auf diese Faktoren wird wegen ihrer Wirksamkeit auf Neutrophile im Folgenden näher eingegangen. In verschiedenen Veröffentlichungen wird darüber berichtet, dass Alveolarmakrophagen Faktoren freisetzen, die für Neutrophile chemotaktisch sind (J.A. Kazmierowski et al., J. Clin. Invest. 59 [1977], Seiten 273 bis 281; W.W. Merrill et al., J. Clin. Invest. 65 [1980], Seiten 268 bis 270, und G.W. Hunninghake et al., J. Clin. Invest. 66 [1980], Seiten 473 bis 483), und welche die antimikrobielle Verteidigung in der Lunge verbessern können. Anschließend ist auch gezeigt worden, dass diese Faktoren eine Verbesserung der mikrobioziden Wirksamkeit von Neutrophilen ergeben (J.E. Pennington et al., J. Infect. Dis. 148 [1983], Seiten 101 bis 109, und J. Clin. Invest. 75 [1985], Seiten 1230 bis 1237). Eine Reinigung durch Gelfiltration und durch chromatographische Fokussierung hat zur Identifizierung eines proteasesensitiven Faktors (der als NAF bezeichnet wird) geführt, welcher durch Alveolarmakrophagen gebildet wird, ein Molekulargewicht von 6000 hat und über einen isoelektrischen Punkt von 7,6 verfügt. Dieser Faktor ist den Berichten zufolge schwach chemotaktisch und unterstützt die Abtötung phagozytosischer Bakterien durch Neutrophile, ohne dass er selbst weder die Bildung von Sauerstoffradikalen, noch die Freisetzung von Enzymen einleitet. Ein ähnlicher Mechanismus einer verbesserten antimikrobiellen Aktivität wird auch von anderen Autoren (A. Ferrante et al., Clin. Exp. Immunol. 56 [1984], Seiten 559 bis 566) beschrieben, von denen gezeigt wird, dass humane Neutrophile mit Kulturmedien von Monozyten oder Makrophagen versetzt werden müssen, um die Abtötung von Neigleria fowleri einzuleiten. Granulozytenaktivierende Mediatoren (GRAM), die von durch LPS stimulierten humanen Monozyten gebildeten werden, werden von anderen Autoren (A. Kapp et al., J. Invest. Dermatol. 86 [1986], Seiten 523 bis 528, und F.E. Maly et al., Lymphokine Res. 5 [1986], Seiten 21 bis 33) beschrieben. Darin werden zwei Arten an GRAM beschrieben, nämlich eine überwiegende Art mit einem scheinbaren Molekulargewicht von 60000 und eine untergeordnete Art mit einem scheinbaren Molekulargewicht von 10000, die bei humanen Neutrophilen die Wirkung eines verzögerten respiratorischen Knalls hervorrufen, was sich durch eine Chemilumineszenz ergibt. Diese Faktoren sind sensitiv gegenüber Wärme und Trypsin, und ihre Bildung ist abhängig von einer Stimulation der Monozyten mit LPS und scheinbar auch von einer de novo Synthese von Protein.

In mehreren Veröffentlichungen werden Faktoren beschrieben, die von Monozyten und/oder Makrophagen abgeleitet sind, welche eine chemotaktische Wirksamkeit gegenüber Neutrophilen aufweisen. In einem dieser Berichte wird ein als "mononuclear cell-derived chemotaxin" (MOC) bezeichneter Faktor beschrieben, bei dem es sich anscheinend um ein Peptid mit einem Molekulargewicht von 10000 handelt, das sich von GRAM unterscheidet (E. Kownatzki et al., Clin. Exp. Immunol. 64 [1986], Seiten 214 bis 222). Ferner ist auch ein neutrophiler chemotaktischer Faktor bekannt, der von menschlichen Blutmonozyten gebildet wird, welche durch LPS stimuliert werden, und dieser Faktor hat ein Molekulargewicht von etwa 10000 und weist einen isoelektrischen Punkt von 8 bis 8,5 auf (T. Yoshimura et al., J. Immunol. 139 [1987], Seiten 788 bis 793). Schließlich ist auch berichtet worden, dass peritoneale Makrophagen von Ratten in einer Kultur mit LPS die Freisetzung eines selektiven neutrophilen chemotaktischen Faktors stimulieren (F.Q. Cunha et al., J. Med. Biol. Res. 19 [1986], Seiten 775 bis 777, und Eur. J. Pharmacol. 129 [1986], Seiten 65 bis 76).

Die in diesen Berichten enthaltene vorläufige biochemische Information lässt keinerlei Spekulation über strukturelle Ähnlichkeiten und Unterschiede zwischen den verschiedenen beschriebenen Faktoren zu.

Nach den für den Gegenstand der vorliegenden Erfindung maßgeblichen Prioritätsdaten ist von van Damme et al. (J. Van Damme et al., J. Exp. Med. 167 [1988], Seiten 1364 bis 1376) die Reinigung eines Peptids beschrieben worden, das möglicherweise dem NAF entspricht, und von Gregory et al. (H. Gregory et al., Biochem. Biophys. Res. Commun. 151 [1988], Seiten 893 bis 890) über eine Sequenz, die mit der von NAF identisch ist, für ein Peptid berichtet worden, das aus dem Überstand von lektinstimulierten humanen Lymphozyten gereinigt worden ist. Die für MDNCF kodierende cDNA (T. Yoshimura et al., Proc. Nat. Acad. Sci. USA 84 [1987], Seiten 9233 bis 9237) ist vor kurzer Zeit cloniert worden (K. Matsushima et al., J. Exp. Med. 167 [1988], Seiten 1883 bis 1893), wobei sich ergeben hat, dass es sich dabei um die 3-10C cDNA handelt (J. Schmid und C. Weissmann, J. Immunol. 139 [1987], Seiten 250 bis 256). Schmid und Weissmann haben auch gezeigt, dass das Peptid, für welches die 3-10C cDNA kodiert, strukturell homolog ist mit dem Blättchenfaktor 4, β-Thromboglobulin, dem das Bindegewebe aktivierenden Peptid III (CTAP-III) und dem durch Gamma-Interferon induzierbaren Peptid (Gamma-IP-10). Diese Moleküle sind auch homolog zu dem aus 73 Resten bestehenden Peptid, das über das Melanomwachstum stimulierende Eigenschaften verfügt (MGSA) (A. Richmond et al., EMBO J. 7 [1988], Seiten 2025 bis 2033), dessen Sequenz ziemlich ähnlich ist mit der Sequenz, die sich durch die aus Fibroblasten isolierte gro-cDNA ergibt (A. Anisowicz et al., Proc. Nat. Acad. USA 84 [1987], Seiten 7188 bis 7192). Es ist auch bereits über ein von Mausmakrophagen abgeleitetes inflammatorisches Protein (MIP) berichtet worden, das möglicherweise mit den oben beschriebenen Proteinen verwandt ist (G. Davatelis et al., J. Exp. Med. 167 [1988], Seiten 1939 bis 1944) und bei dem es sich anscheinend um einen Vertreter aus einer Familie von Peptiden handelt, zu denen auch RANTES gehört, bei welchem es sich um ein 8 kd Produkt einer cDNA handelt, die aus IL-2 abhängigen und antigengetriebenen humanen T-Zellklonen isoliert worden ist (T.J. Schall et al., J. Immunol. 141 [1988], Seiten 1018 bis 1029). Die Funktionen dieser Peptide sind weitgehend unbekannt. Über MGSA und CTAP-III (C.W. Castor et al., Proc. Nat. Acad. Sci. USA 80 [1983], Seiten 765 bis 769) wird berichtet, dass es sich dabei um ein Mitogen handelt, während der Blättchenfaktor 4 über eine immunmodulatorische Wirksamkeit verfügen soll (A.D. Barone et al., J. Biol. Chem. 263 [1988], Seiten 8710 bis 8715).

Die erhaltenen Ergebnisse legen nahe, dass NAF eine selektive Aktivierung von Neutrophilen durch einen rezeptorvermittelten Prozeß ergibt, welcher dem durch chemotaktische Agonisten eingeleiteten Vorgang ähnelt.

2. Zusammenfassung der Erfindung

Es wurde gefunden, dass das erfindungsgemäße NAF gemäß Anspruch 1 die Bildung von Sauerstoffradikalen und die Enzymfreisetzung in humanen Neutrophilen durch Wirkung über einen selektiven Rezeptor einleitet, der sich von allen bisher beschriebenen Rezeptoren unterscheidet.

Die gesamte Aminosäuresequenz von NAF, welcher aus mit LPS stimulierten humanen Monozyten gereinigt worden ist, ist bestimmt worden, und es ist auch ein für die hauptsächliche Art an NAF kodierendes Gen synthetisiert und als ein rekombinantes Peptid exprimiert worden, das die gleichen neutrophilaktivierenden Eigenschaften wie sein natürliches Homologes aufweist.

Gegenstand der Erfindung ist somit NAF gemäß Anspruch 1 und seine Isolierung aus natürlichen Quellen, wie Humanmonozyten.

Ferner bezieht sich die Erfindung auf synthetischen und insbesondere rekombinanten NAF gemäß Anspruch 1, und auf seine Herstellung und Expression.

3. Detaillierte Beschreibung

Die vollständige Aminosäuresequenz von NAF ist durch bekannte Sequenzierungsmethoden wie folgt bestimmt worden:
Ser-Ala-Lys-Glu-Leu-Arg-Cys-Gln-Cys-Ile-Lys-Thr-Tyr-Ser-Lys-Pro-Phe-His-Pro-Lys-Phe-Ile-Lys-Glu-Leu-Arg-Val-Ile-Glu-Ser-Gly-Pro-His-Cys- Ala-Asn-Thr-Glu-Ile-Ile-Val-Lys-Leu-Ser-Asp-Gly-Arg-Glu-Leu-Cys-Leu-Asp-Pro-Lys-Glu-Asn-Trp-Val-Gln-Arg-Val-Val-Glu-Lys-Phe-Leu-Lys-Arg-Ala- Glu-Asn-Ser.

Durch Edman-Abbau des vollständigen Proteins und der typtischen Fragmente T 7-26 und T 27-47, die nach Spaltung des SH-methylierten und aminosuccinylierten NAF erhalten worden sind, ergibt sich die Sequenz bis zur Stellung 47. Nach Hydrolyse mit 75-prozentiger Ameisensäure und Edman-Abbau erhält man zwei etwa äquimolare Sequenzen von 20 Aminosäuren, denen ein einzelnes Muster folgt, das der aminoterminalen Sequenz von NAF nach der Stellung 20 entspricht. Die Sequenz des carboxyterminalen Peptids A 53-72 wird durch Subtraktion bestimmt und durch Analyse des typtischen Peptids T 61-72 bestätigt. Mit Carboxypeptidase A und B ergibt sich kein feststellbares Spaltprodukt, wobei nach Behandlung von 1 nMol NAF mit Carboxypeptidase Y jedoch 120 pMol Serin freigesetzt werden, was zeigt, dass Serin der Carboxyterminus ist.

Durch Analyse verschiedener Ansätze von NAF ergibt sich eine gewisse aminoterminale Heterogenität. Die obige Sequenz gilt für die vorwiegende Komponente (etwa 70 Prozent), welche für die biologische Wirksamkeit weitgehend verantwortlich sein dürfte. Es sind jedoch auch noch die folgenden drei weiteren Varianten identifiziert worden:

Sequenz 1 (etwa 17 Prozent)

  • Ala-Val-Leu-Pro-Arg-Ser-Ala-Lys-Glu-Leu-Arg-Cys-Gln-Cys-Ile-Lys-Thr-Tyr-Ser-Lys-Pro-Phe-His-Pro-Lys-Phe-Ile-Lys-Glu-Leu-Arg-Val-Ile-Glu-S er-Gly-Pro-

Hierbei handelt es sich um die obige vollständige Sequenz, welche am N-Terminus durch Ala-Val-Leu-Pro-Arg- erweitert ist (das vollständige Protein hat somit 77 Aminosäuren).

Sequenz 2 (etwa 8 Prozent), erfindungsgemäß

  • Lys-Glu-Leu-Arg-Cys-Gln-Cys-Ile-Lys-Thr-Tyr-Ser-Lys-Pro-Phe-His-Pro-Lys-Phe-Ile-Lys-Glu-Leu-Arg-Val-Ile-Glu-Ser-Gly-Pro-

Hierbei handelt es sich um die obige vollständige Sequenz, welche am N-Terminus durch Ser-Ala verkürzt ist (das vollständige Protein hat somit 70 Aminosäuren).

Sequenz 3 (etwa 5 Prozent), erfindungsgemäß

  • Glu-Leu-Arg-Cys-Gln-Cys-Ile-Lys-Thr-Tyr-Ser-Lys-Pro-Phe-His-Pro-Lys-Phe-Ile-Lys-Glu-Leu-Arg-Val-Ile-Glu-Ser-Gly-Pro-

Hierbei handelt es sich um die obige vollständige Sequenz, welche am N-Terminus durch Ser-Ala-Lys- verkürzt ist (das vollständige Protein hat somit 69 Aminosäuren).

Alle diese Sequenzen lassen sich mit der vorhergesagten Sequenz aus der 3-10C cDNA, welche aus 99 Aminosäuren besteht, in eine Linie bringen (J. Schmid und C. Weissmann, J. Immunol. 139 [1987], Seiten 250 bis 254). Das überwiegende Peptid von NAF entspricht den Stellungen 28 bis 99 der Aminosäuresequenz 3-10C, während die drei obigen Varianten an den Stellungen 23 (Sequenz 1), 30 (Sequenz 2) und 31 (Sequenz 3) hiervon beginnen.

Ein Vergleich der von der 3-10C cDNA abgeleiteten Sequenz mit den Daten der obigen Sequenz legt nahe, dass mononukleäre Phagozyten einen Vorläufer von NAF synthetisieren, welcher intrazellulär verarbeitet wird. Das Restpeptid 77 könnte die größte ausgeschiedene Form von NAF sein, da es der von cDNA abgeleiteten Sequenz minus dem vorhergesagten Signalpeptid aus 22 Aminosäuren entspricht. Die vorwiegende Art an NAF aus 72 Resten und die Analogen mit 70 und 69 Resten können von weiteren posttranslationalen Modifikationen herrühren.

Alle Formen von NAF haben vier Cysteinreste, die erwartungsgemäß zwischenkettige Disulfidbrücken bilden und die für die Wirksamkeit wichtig zu sein scheinen, da sich Mercaptoethanol als Hemmstoff erweist (P. Peveri et al., J. Exp. Med. 167 [1988], Seiten 1547 bis 1560). Die Disulfidbrücken dürften die Stellungen 7 bis 34 und 9 bis 50 verbinden, wie dies auch bei β-Thromboglobulin und beim Blättchenfaktor 4 der Fall ist, welche teilweise homolog zum NAF sind.

Infolge der Homologität zu β-Thromboglobulin hat NAF zwei intramolekulare Disulfidbrücken. Das berechnete Molekulargewicht von 8384,7 ist demnach eindeutig höher als das durch SDS-Gelelektrophorese gefundene scheinbare Molekulargewicht.

Die Herstellung von NAF aus natürlichen Quellen, wie Humanmonozyten, ergibt schlechte Ausbeuten und erfordert aufwendige und komplizierte Reinigungsstufen.

Zur Erzeugung von NAF in größeren Mengen und besserer Ausbeute sind daher synthetische Verfahren angezeigt, wie eine chemische Gesamtsynthese oder Verfahren unter Anwendung von rekombinanter DNA. Die Herstellung von synthetischem NAF, beispielsweise durch rekombinante DNA-Methoden unter Einschluß einer Expression in einem prokaryontischen oder eukaryontischen Expressionssystem, wie in Escherichia coli, gehört daher ebenfalls zur Erfindung. Ferner gehört zur Erfindung auch synthetischer NAF, nämlich durch Syntheseverfahren, wie rekombinante DNA-Verfahren, erzeugter NAF gemäß Anspruch 1. Der synthetische NAF, nämlich der beispielsweise aus Bakterien isolierte rekombinante NAF, hat die gleiche Aminosäuresequenz wie natürlicher NAF und die gleichen biologischen Eigenschaften und Wirksamkeiten. Unter einem rekombinanten NAF wird ein durch rekombinante DNA-Verfahren erhaltener NAF verstanden.

Die Herstellung von NAF durch rekombinante DNA-Methoden wird unter Anwendung an sich bekannter Verfahren durchgeführt, nämlich durch Synthese, Reinigung und Verknüpfung entsprechender Oligonukleotide, Klonierung des Gens für den synthetischen NAF, Expression in beispielsweise Escherichia coli und schließlich Gewinnung und Reinigung des rekombinanten NAF. Hierzu wird beispielsweise ein Gen, das für die 72 Aminosäuren von NAF kodiert, synthetisiert, was vorzugsweise unter Kodonoptimierung erfolgt, worauf eine Klonierung und Expression in Escherichia coli erfolgen.

Bei einer Western-Blot-Analyse roher Bakterienextrakte unter Verwendung eines Antiserums, das gegen natürlichen NAF aufgezogen wurde, ergibt sich eine einzelne Bande, die zusammen mit natürlichem NAF wandert. Ein bis zur Homogenität gereinigter rekombinanter NAF hat identische aminoterminale und carboxyterminale Sequenzen, wie die 72 Aminosäuren von natürlichem NAF. Bei der Prüfung an Humanneutrophilen ergibt sich, dass dieser NAF die gleiche Wirksamkeit und Stärke wie natürlicher NAF hat, was die Einleitung einer Chemotaxis, den raschen Anstieg an cytosolfreiem Ca2+, die Aktivierung des respiratorischen Knalls sowie die Freisetzung spezifischer und azurophiler granulärer Inhaltsstoffe betrifft.

Die 13 zeigt den Aufbau eines Gens von synthetischem NAF. Die Kodierungssequenz der 3-10C cDNA weist Veränderungen auf, um eine Expression in Escherichia coli zu erleichtern. Am Ende 3' ist der natürlich vorkommende Terminator TAA durch einen Dreifachterminator TAATAATGA ersetzt, und unmittelbar danach ist eine Stelle BamHi angeordnet. Am Ende 5' sind die Stellen SphI und ClaI angeordnet, welche eine Insertion in den Klonierungsvektor und den Expressionsvektor ermöglichen. An der Base 34 ist eine Restriktionsstelle TaqI ausgebildet, um später Manipulierungen am Ende 5' durch Veränderungen des Kodons Arg von AGA zu CGA vorzunehmen.

Ein blockweises Anschmelzen (Oligonukleotide 1-2, 3-4 und 5-6) bringt keinen Vorteil gegenüber der gleichzeitigen Verknüpfung aller sechs Oligonukleotide. Durch Phosphorylierung in Stellung 5' aller Oligonukleotide ergeben sich Verknüpfungsprodukte, die größer als erwartet sind, doch ist, falls die terminalen Oligonukleotide (1 und 6) nicht phosphoryliert sind, das Produkt mit dem höchsten Molekulargewicht das vollständige Gen mit 248/240 Basen. Das Gen wird in die Schnittstelle SphI/BamHI pBS M13 eingebaut und in Escherichia coli transformiert. Aus sechs der erhaltenen ampicillinresistenten Kolonien isolierte Plasmid-DNA wird mit ClaI/BamHI geschnitten, wodurch sich auf einem 1,4-prozentigen Agarosegel jeweils eine Bande von 237 bp ergibt. Eine DNA-Sequenzierung zeigt, dass die Klone die korrekte Sequenz enthalten. Die ClaI/BamHI Bande eines korrekten Klons wird vom Gel entfernt und in den Trp Promotorvektor pIL402 (Term) kloniert. Als mögliches Mittel zur Erhöhung einer Expression kann ein synthetischer Transkriptionsterminator (siehe Beispiel 17) in diesen Vektor eingebaut werden, der am Ende 3' des Humangens GM-CSF an der Stelle BamHI angeordnet ist. Das NAF-Gen wird daher zwischen dieser Stelle BamHI und der Stelle ClaI unterhalb der Stelle der Transkriptionsinitiierung in den Promotor eingesetzt, um so das Gen GM-GSF zu ersetzen. Das erhaltene NAF-Expressionsplasmid, nämlich das Plasmid p(NAF)-6T3, geht aus der 14 hervor.

Eine Silber-Anfärbe-Analyse und eine Western-Blot-Analyse von Extrakten von mit Indolacrylsäure induziertem Escherichia coli, welche p(NAF)-6T3 enthalten, zeigen die zeitabhängige Bildung eines Peptids, das zusammen mit natürlichem NAF wandert und mit einem Antiserum gegen natürlichen NAF reagiert.

Das obige Expressionssystem kann auch zur Herstellung der oben erwähnten Varianten von NAF oder von sonstigen biologisch aktiven Fragmenten von NAF, wie von aminoabgestumpften Fragmenten von NAF, verwendet werden.

Die biologischen Eigenschaften von NAF sind artspezifisch. Die Wirksamkeit beim Hasen ähnelt weitgehend der Wirksamkeit beim Menschen. Orientierende Versuche an Mäusen, Ratten und Meerschweinchen haben keine klare Aktivität gezeigt.

NAF eignet sich indikationsmäßig zur Behandlung von Zuständen, welche lokal oder systemisch begleitet oder verursacht werden durch eine Modifizierung der Anzahl oder des Aktivierungszustands von PMN (polymorphkernige Neutrophile). Durch NAF kommt es zu einer extensiven Modifizierung dieser Parameter von PMN, und NAF eignet sich daher indikationsmäßig zur Anwendung bei der Behandlung von Zuständen, bei denen eine Erhöhung der Anzahl oder des Aktivierungszustands der PMN zu einer klinischen Verbesserung beispielsweise bei Infektionen durch Bakterien, Mykoplasmen, Hefe, Pilze und Viren führt. Ferner eignet sich NAF zur Anwendung bei entzündlichen Krankheiten, wie Psoriasis, arthritischen Zuständen und Asthma, oder von Zuständen mit abnormal niedriger Neutrophilenzahl und/oder allgemein niedrigem Neutrophilenspiegel, sowie zur Herstellung von Antagonisten für solche Indikationen.

3. Beschreibung der FigurenFig. 1: Bildung von NAF mittels Induktion durch LPS:

Mononukleäre Zellen, die wie im Beispiel 1 beschrieben abgetrennt worden sind, werden in Kulturplatten mit 24 Vertiefungen (5 × 106 Zellen in 1 ml) gegeben und mit LPS in den angegebenen Konzentrationen stimuliert. Die Medien werden zu verschiedenen Zeitspannen gesammelt, durch Zentrifugieren geklärt (20000 Upm während 20 Minuten bei 4°C) und bezüglich ihrer NAF-Aktivität untersucht. Hierzu werden Zellen aus einem einzelnen Donor verwendet, wobei Mittelwerte aus Doppelkulturen gebildet werden. Die dabei erhaltenen Ergebnisse sind für vier ähnliche Versuche repräsentativ, bei denen Zellen unterschiedlicher Donoren verwendet werden.

Fig. 2: Herstellung von NAF durch mononukleäre Phagozyten, jedoch nicht durch Lymphozyten:

  • a) Man züchtet die gesamte mononukleäre Zellfraktion (⦁, ∎, 5 × 106 Zellen/ml) und die davon abgeleiteten anhaftenden Zellen (o, ☐) in Anwesenheit (⦁, o) und Abwesenheit (∎, ☐) von 100 ng LPS während 24 Stunden.
  • b) Man züchtet Monozyten (o, 106 Zellen/ml) und Lymphozyten (∆, 4 × 106 Zellen/ml), die durch Auswaschen gereinigt worden sind, in Anwesenheit von 100 ng LPS.

Die Kurven sind mittlere Relativwerte für die Freisetzung von Elastase aus getrennten Versuchen 5 (a) und 6 (b), die jeweils doppelt durchgeführt werden. Die Versuchsdaten sind normalisiert, wobei dem nach 24 Stunden erhaltenen Wert von ⦁ im Feld a und dem nach 24 Stunden erhaltenen Wert von o im Feld b der Wert 1,0 zugeordnet wird, und wobei die anderen Werte (Mittelwert ± S.F.) in Relation dazu berechnet werden. Diese Art an Darstellung wird gewählt, um einmal der jeweiligen Veränderung bei der Bildung von NAF und zum anderen Mal dem Ansprechen der zur Prüfung von NAF verwendeten Neutrophilen Rechnung zu tragen.

Fig. 3: Reinigung von NAF durch Chromatographie mit Phosphocellulose

In dieser Figur wird die Verteilung von Protein (Absorbanz bei 280 nm, ---), NAF (o) und IL-1 (∆) gezeigt. Die Fraktionen mit den höchsten NAF-Aktivitäten sind in der angegebenen Weise zusammengefasst.

Fig. 4: Reinigung von NAF durch HPLC-Gelfiltration

  • a) Verteilung von Protein (Absorption bei 280 nm) und Elutionszeiten von Molekulargewichtmarkierern (Pfeile: 1 = MG 66 200, 2 = MG 42 700, 3 = MG 21 500, 4 = MG 6 500 und 5 = MG 1 255).
  • b) Profil der NAF-Aktivität.

Fig. 5: Reinigung von NAF durch Chromatographie über Hydroxylapatit

Teilweise gereinigter NAF wird auf die Säule unter einer niedrigen Salzkonzentration gegeben und dann mit einem Puffer, der 1 molar an NaCl ist, eluiert. Die Balken zeigen die NAF-Aktivität.

Fig. 6: Reinigung von NAF durch Chromatographie über Heparin-Sepharose:

Teilweise gereinigter NAF wird auf die Säule unter einer niedrigen Salzkonzentration gegeben und dann mit einem Puffer, der 1,5 molar an NaCl ist, eluiert. Die Balken zeigen die NAF-Aktivität.

Fig. 7: Reinigung von NAF durch Umkehrphasen-HPLC auf einer C4-Säule

  • a) Gereinigter NAF wird auf eine RP-Säule mit 0,1-prozentiger Trifluoressigsäure gegeben. Die Säule wird mit einem linearen Gradienten von Acetonitril in 0,1-prozentiger Trifluoressigsäure entwickelt.
  • b) Die Balken zeigen die NAF-Aktivität.

Fig. 8: Reinigung von NAF durch Umkehrphasen-HPLC auf einer CN-Propyl-Säule

  • a) Gereinigter NAF wird auf eine CN-Propyl-Säule von Bakerbond in 0,1-prozentiger Trifluoressigsäure gegeben. Die Säule wird mit einem linearen Gradienten von n-Propanol in 0,1-prozentiger Trifluoressigsäure entwickelt.
  • b) Die Balken zeigen die NAF-Aktivität.

Fig. 9: Reinigung von NAF durch chromatographische Fokussierung

Teilweise gereinigter NAF wird auf eine Säule zur chromatographischen Fokussierung gegeben. Die Säule wird mit Polypuffer 96-HCl, pH-Wert = 7,0, entwickelt. Entsprechende Fraktionen werden bezüglich ihrer NAF-Aktivität (-∎-) und ihres pH-Werts (--∎--) geprüft.

Fig. 10: Hervorrufung eines verzögerten respiratorischen Knalls durch teilweise gereinigten NAF

  • a) Herstellung von Superoxid: Neutrophile (3 × 106/ml) werden bei 37°C mit oder ohne 1 μm PAF während 2 Minuten vorbebrütet und dann mit zunehmenden Mengen an NAF stimuliert. Es sind die entsprechenden Meßdaten der Erniedrigung von Cytochrom C nach Zusatz von NAF angegeben.
  • b) Von H2O2 abhängige Chemilumineszenz: Die Verlaufskurven nach Stimulierung mit teilweise gereinigtem NAF und die etwa äquiaktiven Konzentrationen von C5a und fMLP sind in der linken Seite angegeben. Die Initialphase der Wirkung geht aus der rechten Seite hervor. Die Stimulanzien werden in 50 μl an PBS-BSA zugesetzt.

Fig. 11: Unterscheidung zwischen NAF und C5a

C5a und NAF werden während 15 Minuten mit frischem Humanserum oder mit PBS bebrütet, und die Aktivität der Präparationen wird bestimmt (Bildung von Superoxid).

  • a) C5a in PBS,
  • b) C5a in Serum,
  • c) Serum allein,
  • d) NAF in PBS,
  • e) NAF in Serum.

Fig. 12: Bildung von Superoxid als Antwort auf eine sequentielle Stimulierung mit teilweise gereinigtem NAF, C5a und fMLP

  • a) Neutrophile (3 × 106/ml) werden bei 37°C während 5 Minuten vorbebrütet und dann mit unterschiedlichen Agonisten der angegebenen Art (Pfeile) stimuliert.
  • b) Sequentielle oder wiederholte Stimulierung mit NAF und C5a. Bedingungen wie oben bei a).

Die Pfeile zeigen den Zusatz der angegebenen Agonisten. Die Konzentration von C5a beträgt bei a) 0,5 nMol und bei b) 0,2 nMol, und bei fMLP beträgt die Konzentration 20 nMol bei beiden Versuchen. Die Agonisten werden in 50 μl PBS-BSA zugesetzt.

Fig. 13: Nukleotidsequenz von synthetischem NAF-Gen

Die einzelnen Oligonukleotide, nämlich ON-1 bis ON-6, welche zum Aufbau des Gens verwendet werden, sind durch unterbrochene Linien dargestellt. Die (unterstrichenen) Nukleotidzahlen erscheinen an der rechten Seite oberhalb dem Doppelstrang. Die entsprechende Peptidsequenz der vorwiegenden Form ist beginnend vom aminoterminalen Ende (Ser) numeriert. Die Restriktionsstellen ClaI und BamHI sind oberhalb des Doppelstrangs angegeben. Die Stelle TaqI, welche durch Ersatz von C durch A im Kodon für Arginin gebildet wird, ist ebenfalls gezeigt.

Fig. 14: Expressionsvektor p(NAF)-6T3

  • AR
    = Ampicillinresistentes Gen
    Trp P/O
    = Tryptophanpromotor
    T
    = Synthetischer Transkriptionsterminator

Fig. 15: Identität von natürlichem und rekombinantem NAF

Obere Kurven: Veränderungen an cytosolfreiem Ca2+, die durch natürlichen (links) und rekombinanten (rechts) NAF hervorgerufen werden. Neutrophile (4 × 106 Zellen/ml) werden mit 0,1 nMol Quin-2/AM beladen und dann mit 3 nMol NAF (Markierung) stimuliert. Die Veränderungen der Sättigung durch Quin-2 werden so geeicht, wie dies in J. Biol. Chem. 261 (1986), Seiten 10163 bis 10168 (V. von Tscharner et al.) beschrieben ist.

Untere Kurven: Respiratorischer Knall, der durch natürlichen (links) und rekombinanten (rechts) NAF eingeleitet wird. Neutrophile (106 Zellen/ml) werden mit 3, 10 und 30 nMol NAF zur Zeit Null stimuliert, und die Bildung an Wasserstoffperoxid wird durch Chemilumineszenz gemessen (M.P. Wymann et al., Anal. Biochem. 165 [1987], Seiten 371 bis 378).

Fig. 16: Übertritt von Plasma in Hautstellen

  • Nach intradermaler Injektion von NAF oder Endotoxin;
  • Versuchsdauer 4 Stunden;
  • Mittelwert ± Standardfehler der mittleren Antwort bei 3 Hasen.

Fig. 17: Neutrophilenakkumulation an Hautstellen

Simultane Messung mit den Antworten, die in 16 aufgetragen sind.

Fig. 18: Wirkung von Polymyxin B auf die Neutrophilenakkumulation

  • Nach erfolgter intradermaler Injektion von NAF (10–9 Mol pro Stelle), fMLP (10–9 Mol pro Stelle) oder Endotoxin (10–13 Mol pro Stelle);
  • Polymyxin B: 40 μg pro Stelle;
  • Dauer: 2 Stunden;
  • Mittelwert ± Standardfehler der mittleren Antworten bei 3 Hasen.

Fig. 19: Wirkung von Actinomycin D auf die Neutrophilenakkumulation

  • Nach erfolgter Stimulierung von Hautstellen mit NAF (10–9 Mol pro Stelle), fMLP (10–9 Mol pro Stelle) oder Endotoxin (10–13 Mol pro Stelle);
  • Dauer: 2 Stunden;
  • Mittelwert ± Standardfehler der mittleren Antworten bei 3 Hasen.

5. Beispiele

Durch die folgenden Beispiele wird die Erfindung weiter erläutert. Alle Temperaturen sind in Grad Celsius gemessen. Es werden die folgenden Abkürzungen verwendet:

PHA:
Phytohämagglutinin
ConA:
Concanavalin A
LPS:
Escherichia coli Lipopolysaccharid
BSA:
Rinderserumalbumin
fMLP:
N-Formyl-L-methionyl-L-leucyl-L-phenylalanin
PAF:
1-0-Hexadecyl-2-0-acetyl-sn-glycero-3-phospho cholin (Blättchenaktivierungsfaktor)
MEM:
Minimales essentielles Medium nach Eagle (Sero med GmbH, München, BRD), mit 25 μg/ml Neomycin ergänzt und mit 25 mMol NaHCO3 und 20 mMol HEPES auf einen pH-Wert von 7,4 gepuffert
MEM-PPL:
Gleiche Zusammensetzung wie oben, jedoch mit einem zusätzlichen Gehalt von 1% an pasteurisier ter Plasmaproteinlösung (5% PPL-SRK, Laborato rien des Schweizerischen Roten Kreuzes, Bern, Schweiz) und 100 IE/ml Penicillin und Streptomy cin (Gibco AG, Basel, Schweiz)
PBS:
Mit Phosphat gepufferte Kochsalzlösung ohne Ca2+ und Mg2+ (137 mMol NaCl, 2,7 mMol KCl, 8,1 mMol NaH2PO4 und 1,5 mMol KH2PO4, eingestellt auf pH 7,4)
PBS-BSA:
PBS, das mit 0,9 mMol CaCl2, 0,49 mMol MgCl2 und 2,5 mg/ml BSA ergänzt ist
HEPES:
N-2-Hydroxyethylpiperazin-N'-2-ethansulfon säure
PPL-SRK:
Plasmaproteinlösung (Schweizerisches Rotes Kreuz)
NAF:
Neutrophilenaktivierungsfaktor oder -protein
CX:
Cycloheximid
IL-1:
Interleukin-1
SOD:
Superoxid
C5a:
Anaphylatoxin
CPC:
Glas mit eingestellter Porosität
PAGE:
Polyacrylamidgelelektrophorese
GM-CSF:
Granulozyten-Makrophagen-Kolonie stimulierender Faktor
CB:
Cytochalasin B (5 μg/ml)
MES:
2-[N-Morpholino]ethansulfonsäure
HPLC:
Hochdruckflüssigkeitschromatographie
SDS:
Natriumdodecylsulfat

Teil I: Bildung von NAF durch HumanmonozytenBeispiel 1Bildung von NAF durch Humanmonozyten unter Stimulierung mit LPS

Humanmonozyten werden aus Abstrichen von Donorblut (Laboratorien des Schweizerischen Roten Kreuzes, Bern, Schweiz) durch Zentrifugieren durch einen Ficoll-Paque-Gradienten isoliert. Durch diese Methode werden die Neutrophilen von den sogenannten mononukleären Zellen getrennt, bei denen es sich um ein Gemisch von Monozyten (etwa 20 Prozent) und Lymphozyten (etwa 80 Prozent) handelt. Es werden drei Monozytenpräparationen verwendet: (i) die gesamte mononukleäre Zellfraktion, (ii) Monozyten, die aus der mononukleären Zellfraktion durch Adhärenz angereichert worden sind und (iii) zu 90 Prozent reine Monozyten, die von den Lymphozyten durch Auswaschen in einer Zentrifuge abgetrennt worden sind (G. Garotta et al., Biochem. Biophys. Res. Comm. 140 [1986], Seiten 948 bis 954 und K.J. Clemetson et al., J. Exp. Med. 161 [1985], Seiten 972 bis 983). Die Zellen werden in MEM-PPL gezüchtet und mit zunehmenden Konzentrationen (0,1 ng bis 1 μg/ml) an LPS stimuliert. Zu unterschiedlichen Zeiten werden Teilmengen der Kulturmedien als Proben entnommen, wobei die NAF-Aktivität als die Fähigkeit gemessen wird, die Freisetzung von Elastase aus mit Cytochalasin B vorbehandelten Humanneutrophilen einzuleiten (B. Dewald et al., Biochem. Pharmacol. 36 [1987], Seiten 2505 bis 2510).

Mononukleäre Zellkulturen (5 × 106 Zellen/ml), die aus Monozyten und Lymphozyten in einem Verhältnis von etwa 1:5 bestehen, bilden NAF, wenn sie mit LPS (100 ng/ml) stimuliert worden sind. NAF sammelt sich im Medium während 24 Stunden an, wobei sich seine Bildung zwischen 24 Stunden und 48 Stunden abflacht. In Abwesenheit eines Stimulans wird kein NAF gebildet. Die 1 zeigt den Zeitverlauf und die Konzentrationsabhängigkeit der Wirkungen von LPS, das bereits zwischen 0,1 ng/ml und 1 ng/ml aktiv ist.

Unter Verwendung unterschiedlicher mononukleärer Zellpräparationen wird die NAF-Quelle untersucht. Die 2a zeigt die von LPS abhängige Bildung von NAF durch die gesamte mononukleäre Zellfraktion und die daraus durch Adhärenz selektierten Monozyten. Diese Ergebnisse bestätigen, dass die Bildung von NAF abhängig ist vom LPS, und zeigen, dass NAF durch die Monozyten gebildet wird. Die Anwesenheit von Lymphozyten scheint die Menge der Bildung von NAF nicht zu beeinflussen. Ähnliche Ergebnisse erhält man mit durch Waschen gereinigten Monozyten und Lymphozyten. Die 2b zeigt, dass NAF durch die Monozyten gebildet wird, nicht jedoch durch die Lymphozyten.

Beispiel 2Bildung von NAF durch Humanmonozyten unter Stimulierung mit PHA oder ConA

Eine mononukleäre Zellfraktion von Abstrichen von Humanblut, welche wie im Beispiel 1 beschrieben abgetrennt worden ist, wird unter den im Beispiel 1 angegebenen Bedingungen gezüchtet und mit PHA (5 μg/ml) oder ConA (10 μg/ml) stimuliert. Der Zeitverlauf der Bildung von NAF ähnelt dem Zeitverlauf, der bei mononukleären Zellen, die mit 100 ng/ml LPS stimuliert worden sind, beobachtet wurde. Nach etwa 24 Stunden ist ein Maximum erreicht.

Beispiel 3Hemmung der Bildung von NAF durch Cycloheximid

Die Tatsache, dass NAF nicht unmittelbar nach der Stimulierung der Monozyten, sondern innerhalb einer Zeitdauer von Stunden, in Abhängigkeit von der Konzentration des Stimulans, freigesetzt wird, legt nahe, dass eine de novo Synthese von Protein erforderlich ist und dass die Bildung von NAF in der Tat durch das Stimulans eingeleitet wird. Das Erfordernis einer Synthese von Protein wird durch Versuche gezeigt, bei denen die Bildung von NAF durch Zusatz von Cycloheximid gehemmt wird. Die Ergebnisse eines hierfür repräsentativen Versuchs gehen aus der folgenden Tabelle 1 hervor. Tabelle 1Hemmung der Bildung von NAF durch Cycloheximid

BehandlungMittlere Bildung von NAF nach4 h8 h24 hKeine000LPS72620422633LPS + CX000LPS + CX bei 4 h774966639LPS + CX bei 8 h75218841854

Cycloheximid (CX, 10 μg/ml) wird 4 h oder 8 h nach dem LPS (100 ng/ml) zugesetzt. Die Aktivität ist in Fluoreszenzeinheiten angegeben, und hierdurch wird die Freisetzung an Elastase ausgedrückt.

Teil II: Reinigung von NAFBeispiel 4Abtrennung von NAF und IL-1 durch Chromatographie mit Phosphocellulose

Mononukleäre Zellen, die wie im Beispiel beschrieben aus Abstrichen von Donorblut erhalten worden sind, werden 48 h in MEM-PPL in Anwesenheit von 100 ng/ml LPS in gerührten Kulturflaschen (1,5 l, 5 × 106 Zellen/ml) gezüchtet. Der Kulturüberstand wird gesammelt, bei 20 000 Upm während 20 min bei 4°C zur Entfernung von stückigem Material zentrifugiert und auf eine 10 ml Phosphocellulosesäule (Whatman P 11, 1,4 × 6 cm) gegeben, welche mit 20 mMol Kaliumphosphatpuffer vom pH 7,2, der 20 mMol NaCl und 5 Prozent Glycerin enthält, äquilibriert worden ist. Die Säule wird mit 30 ml des obigen Puffers gewaschen und dann mit 90 ml NaCl unter einem linearen Konzentrationsgradienten (0,02 Mol bis 1,5 Mol) im gleichen Puffer eluiert. Es werden Fraktionen von jeweils 2 ml in 0,1-prozentigem Polyethylenglykol gesammelt und bezüglich ihrer NAF-Aktivität und IL-1-Aktivität geprüft. Die Absorption bei 280 nm wird kontinuierlich als Maßzahl des Proteins überwacht.

Die 3 zeigt das Verteilungsprofil des Proteins (Absorption bei 280 nm) sowie zwei biologische Aktivitäten, nämlich die Freisetzung von Elastase als Maßzahl für die NAF-Aktivität und die Proliferation von Thymozyten als Maßzahl für die IL-1-Aktivität. Der Großteil des Proteins und auch der IL-1-Aktivität befindet sich im Durchflussvolumen. Durch Elution mit einem linearen Gradienten an NaCl ergibt sich eine gewisse IL-1-Aktivität bei niedriger Innenstärke, worauf sich ein Peak an Elastase freisetzender Aktivität anschließt, welche dem NAF entspricht, das bei 0,5 molarer Konzentration an NaCl zu eluieren beginnt und bei einer 0,8 molaren Konzentration an NaCl sein Maximum erreicht. Der Peak ist symmetrisch und schließt sich an eine kleine Schulter an. Durch den Salzgradienten wird auch eine gewisse Menge an UV-absorbierendem Material euliert. Dessen Profil fällt jedoch nicht mit den ermittelten biologischen Aktivitäten zusammen. Wie die 3 zeigt, lassen sich IL-1 und NAF vollständig auftrennen. In Verbindung mit IL-1 gibt es keine Elastase freisetzende Aktivität, und in Verbindung mit NAF besteht keine die Thymozytenproliferation einleitende Aktivität. Die Gewinnung an NAF nach Fraktionierung beträgt nahezu 100 Prozent, was den Schluss zulässt, dass die Medien keine Inhibitoren oder Aktivatoren enthalten.

Beispiel 5Reinigung von NAF durch Gelfiltration

Eine Probe von 200 μl an NAF, das durch Chromatographie mit Phosphocellulose teilweise gereinigt worden ist (Beispiel 4), wird auf eine HPLC TSK-G2000 SW Säule (7,5 × 600 mm) mit einer TSK-GSWP Vorsäule (7,5 × 75 mm) gegeben. Man lässt die Säule mit 100 millimolarem NaHPO4 vom pH 7,0, das 100 mMol NaCl enthält, bei einer Geschwindigkeit von 0,5 ml/min laufen. Als Eichstandards werden Rinderserumalbumin (MG 66200), Eialbumin (MG 42700), Sojabohnentrypsininhibitor (MG 21500), Aprotinin (MG 6400) und Actinomycin D (MG 1255) verwendet. NAF eluiert mit einem leicht asymmetrischen Peak unmittelbar nach Aprotinin und viel später als Actinomycin D. Das scheinbare Molekulargewicht von NAF beträgt daher etwa 6500. Vor und nach dem beschriebenen Peak (4) wird keine NAF-Aktivität eluiert.

Beispiel 6Reinigung von NAF durch Hydroxylapatit

Eine Sammlung von Fraktionen, die durch Chromatographie mit Phosphocellulose (Beispiel 4) erhalten worden ist und ein Gesamtvolumen von 15 ml (was etwa 800 ml an nichtfraktioniertem Kulturüberstand entspricht) hat, wird mit einem Puffer (10 millimolares Natriumphosphat, pH 6,9, in 0,1-prozentigem Polyethylenglykol 6000) auf 1:10 verdünnt und auf eine 3 ml Hydroxylapatitsäule (Biogel HTP) gegeben, die mit dem gleichen Puffer äquilibriert worden ist. Die Säule wird dreimal mit 3 ml des gleichen Puffers gewaschen und dann mit dem gleichen Puffer, der jedoch mit 1 molarem NaCl ergänzt ist, eluiert. Durch dieses Verfahren wird NAF von der Säule gewonnen. Nach Elution mit 0,5 molarem Natriumphosphatpuffer vom pH 6,9 ergibt sich keine weitere NAF-Aktivität mehr (5).

Beispiel 7Reinigung von NAF durch Heparin-Sepharose

Eine Probe von 1 ml an NAF, die durch Chromatographie mit Phosphocellulose teilweise gereinigt worden ist (Beipiel 4), wird auf eine 0,5 ml Säule von Heparin-Sepharose 4B gegeben, die mit 10 millimolarem Natriumphosphat vom pH 7,3 äquilibriert worden ist, welches mit 0,1-prozentigem Polyethylenglykol 6000 und 50 millimolarem NaCl ergänzt worden ist. Die Säule wird mit dem gleichen Puffer gewaschen und dann mit 10 millimolarem Natriumphosphat vom pH 7,3 eluiert, das mit 1,5 molarem NaCl ergänzt worden ist. In der nach dem Waschen der Säule anfallenden Durchflußfraktion lässt sich eine kleine Menge an NAF feststellen, wobei der Großteil der an die Säule gebundenen Aktivität jedoch erst mit dem Puffer mit höherer Innenstärke eluiert wird (6).

Beispiel 8Reinigung von NAF durch Umkehrphasenhochdruckflüssigkeitschromatographie auf einer C4 Säule

Eine Probe an NAF, die durch Chromatographie mit Phosphocellulose (Beispiel 4) und anschließend mit Hydroxylapatit (Beispiel 6) gereinigt worden ist, wird auf eine weitporige Umkehrphasensäule C4 (Biorad RP 304) gegeben. Die Säule wird mit einem Gradienten von 0 bis 80 Prozent an Acetonitril in 0,1 Prozent Trifluoressigsäure unter einer Abstufung von 0,66 Prozent/min eluiert. Die Fließgeschwindigkeit beträgt 0,5 ml/min. Die Fraktionen werden gesammelt und unter Vakuum getrocknet. Der Rückstand wird in 100 μl PBS resuspendiert, das 0,1 Prozent Polyethylenglykol 6000 enthält, und bezüglich seiner NAF-Aktivität geprüft. NAF eluiert mit einer Retentionszeit von etwa 60 min, was etwa 40 Prozent Acetonitril entspricht, in Form eines einzigen scharfen Peaks (7).

Beispiel 9Reinigung von NAF durch Umkehrphasenhochdruckflüssigkeitschromatographie auf einer CN-Propyl-Säule

Eine Probe von NAF, die wie im Beispiel 8 beschrieben durch Umkehrphasenchromatographie gereinigt, unter Vakuum getrocknet und in 100 μl PBS, welches 0,1 Prozent Polyethylenglykol enthält, suspendiert worden ist, wird mit einem Volumen an 0,1-prozentiger Trifluoressigsäure verdünnt und auf eine weitporige Cyano(CN)-Propyl-Säule von Bakerbond (Baker Research Products, Phillipsburg, New Jersey, V.St.A.) gegeben. Die Säule wird mit einem Gradienten, der von 0 Prozent bis 50 Prozent an n-Propanol in 0,1-prozentiger Trifluoressigsäure reicht, unter einer Erhöhung von 0,41 Prozent/min eluiert. Die Fließgeschwindigkeit beträgt 0,5 ml/min. Die Fraktionen werden gesammelt und unter Vakuum getrocknet. Der Rückstand wird in 100 μl mit Phosphat gepufferter Kochsalzlösung, welche 0,1 Prozent Polyethylenglykol 6000 enthält, suspendiert und bezüglich der NAF-Aktivität geprüft. NAF eluiert in zwei scharfen Peaks, wobei der größere Peak eine Retentionszeit von 53 min hat, was 22 Prozent n-Propanol entspricht, und der kleinere Peak, der weniger als 30 Prozent der gesamten Aktivität enthält, eine Retentionszeit von 66 min aufweist, was 27,5 Prozent n-Propanol entspricht (8).

Beispiel 10Chromatographische Fokussierung von NAF

Eine Probe von 4 ml an NAF, das durch Chromatographie mit Phosphocellulose (Beispiel 4) teilweise gereinigt worden ist, wird gegen einen Ausgangspuffer, der aus 25 millimolarem Ethanolamin-HCl vom pH 9,4 und aus 0,1 Prozent Polyethylenglykol 6000 besteht, dialysiert und auf eine PBE 94 Säule (0,7 × 19 cm, Pharmacia) gegeben, die mit dem gleichen Puffer äquilibriert worden ist. Die Säule wird dann mit 200 ml Polypuffer 96-HCl (mit Wasser auf 1:10 verdünnt) vom pH 7,0 eluiert, der 0,1 Prozent Polyethylenglykol 6000 enthält. Unter einer Fließgeschwindigkeit von 10 bis 14 ml/h werden alle 10 min Fraktionen gesammelt und auf ihre NAF-Aktivität hin geprüft. Der Großteil der Aktivität eluiert im Bereich von pH 8,5 bis pH 8,8 (9).

Teil III: Physikalisch-chemische und biologische Charakterisierung von NAFBeispiel 11Physikalisch-chemische Eigenschaften von NAF

Teilweise gereinigter NAF, der durch Chromatographie mit Phosphocellulose (Beispiel 4) erhalten worden ist, wird bei diesen Versuchen verwendet. Nach der Chromatographie mit Phosphocellulose werden die Fraktionen mit der höchsten NAF-Aktivität über Nacht bei 4°C gegen PBS unter Verwendung einer Membrane mit einer Molekulargewichtsausschlußgrenze von 1000 Dalton dialysiert. Die erhaltene Zubereitung wird dann den folgenden Behandlungen unterzogen: a) Bebrütung bei 37°C mit und ohne Trypsin, Chymotrypsin oder Proteinase K (100 μg/ml) unter anschließendem Zusatz eines Überschusses an BSA (2 mg/ml) zum Stoppen der Proteolyse von NAF, b) Erhitzung auf 56°C, 80°C oder 95°C (im Vergleich zu der auf 22°C erhitzten Kontrolle), c) Behandlung bei pH 2 oder pH 10 (bei 22°C) unter anschließender Einstellung auf pH 7,4 (im Vergleich zu pH 7,4 bei der Kontrolle), d) Behandlung mit 2 molarem Lithiumchlorid, 6 molarem Guanidiniumchlorid, 1-prozentigem 2-Mercaptoethanol oder 0,5-prozentigem Natriumdodecylsulfat (SDS) während 3 h bei 22°C und anschließende Dialyse während 24 h bei 4°C gegen PBS. Nach erfolgter Zugabe werden die Proben ohne NAF genauso gehandhabt und hinsichtlich des möglichen Einflusses auf den NAF-Versuch geprüft.

Die folgende Tabelle 2 zeigt, dass NAF beachtlich resistent gegen eine Inaktivierung ist. Seine Aktivität wird nach Bebrütung mit unterschiedlichen Proteasen zerstört, was zeigt, dass NAF ein Polypeptid ist. Im Gegensatz dazu lässt sich NAF nicht leicht durch Hitze, Säure oder alkalische pH-Bedingungen oder durch Einwirkung von SDS inaktivieren. Eine gewisse Inaktivierung ergibt sich mit 2-Mercaptoethanol, Lithiumchlorid und Guanidiniumchlorid. Tabelle 2Physikalisch-chemische Eigenschaften von NAF

BehandlungBedingungenRelative AktivitätTemperatur22°, 3 h
56°, 1 h
80°, 15 min
95°, 5 min
100
82
80
66
pH 2,022°, 3 h76pH 10,022°, 3 h90SDS 0,5 Prozent22°, 3 h1002-Mercaptoethanol 1,0-prozentig22°, 3 h30Lithiumchlorid
2 molar
22°, 3 h52
Guadiniumchlorid 6 molar22°, 3 h68Trypsin 100 μg/ml37°, 4 h
37°, 12 h
100
8
α-Chymotrypsin
100 μg/ml
37°, 4 h
37°, 12 h
80
1
Proteinase K 100 μg/ml37°, 12 h0

Beispiel 12Durch NAF eingeleitete Exozytose (Einleitung einer Freisetzung von Granulum durch NAF in Humanneutrophilen)

Neutrophile (5 × 106/ml), die in PBS/BSA suspendiert sind, werden mit oder ohne Cytochalasin B (5 μg/ml) bei 37°C während 5 min vorbebrütet. Hierauf wird die Freisetzung von Granulum durch Zugabe des Stimulans, wie von NAF oder einem Standardstimulans, eingeleitet. Die Reaktion wird 15 min später durch rasche Abkühlung in Eis und anschließende Zentrifugierung zum Absetzen der Zellen gestoppt. In den zellfreien Medien und in den Zellpellets bestimmt man die Menge an Bindungsprotein für Vitamin B12, β-Glucuronidase und Lactatdehydrogenase, und die Freisetzung dieser Bestandteile wird in Prozent auf den gesamten Zellgehalt bezogen berechnet (B. Dewalt und M. Baggiolini, Methods Enzymol. 132 [1986], Seite 267).

Die Wirkung von NAF auf die Freisetzung des Bindungsproteins für Vitamin B12 und der β-Glucuronidase, bei denen es sich um Bestandteile der spezifischen und azurophilen Granula handelt, geht aus der folgenden Tabelle 3 hervor. Tabelle 3Vom Stimulans abhängige Exozytose des Granulumgehalts bei Humanneutrophilen

Stimulans CBProzentuale Freisetzung vonBindungs- protein von Vita- min B12β-Glucu- ronidaseLactatdehydrogenaseKeines6,0 ± 0,42,1 ± 0,46,2 ± 2,5NAF 50 μl12,9 ± 1,62,7 ± 1,35,8 ± 0,7NAF 100 μl13,9 ± 2,13,0 ± 1,36,8 ± 2,2fMLP 0,1 molar14,0 ± 0,92,3 ± 0,815,7 ± 1,1Keines+10,0 ± 1,12,4 ± 0,27,0 ± 3,2NAF 50 μl+25,6 ± 3,47,9 ± 2,016,7 ± 1,6NAF 100 μl+26,8 ± 4,98,5 ± 1,77,3 ± 2,1fMLP 0,1 μmolar +35,6 ± 5,512,1 ± 4,45,3 ± 1,6Mittelwerte + SF

Bei normalen Neutrophilen induziert NAF eine Exozytose von lediglich spezifischen Granula. Sind die Zellen jedoch mit Cytochalasin B vorbehandelt, dann ergibt sich eine extensive Freisetzung aus beiden Arten an Granula. Unter diesen letztgenannten Bedingungen verläuft die Freisetzung von β-Glucuronidase parallel zur Freisetzung von Elastase, nämlich dem zur Prüfung der Aktivität von NAF (Beispiel 1) verwendeten Markierungsmittel. Quantitativ ausgedrückt ähneln die Exozytose induzierenden Eigenschaften von NAF den Eigenschaften des chemotaktischen Peptids fMLP. Keines dieser Stimulanzien induziert die Freisetzung des cytosolischen Enzyms Lactatdehydrogenase, was zeigt, dass eine Zellschädigung vernachlässigbar ist.

Beispiel 13Durch NAF eingeleiteter respiratorischer Knall (Einleitung der Bildung von Superoxid durch NAF bei Humanneutrophilen)

Die Bildung von Superoxid wird bei 37°C als die SOD sensitive Reduktion von Ferricytochrom C gemessen (M. Markert et al., Methods Enzymol. 132 [1984], Seite 267). Das Versuchsgemisch (800 μl) besteht aus 0,75 × 106 Zellen/ml von PBS-BSA und enthält 85 μMol Cytochrom C. Die Absorptionsveränderungen werden mit einem Hewlett-Packard 8451A Diodenanordnungsspektrophotometer aufgezeichnet, das mit einem thermostatisierten Cuvettenwechsler mit sieben Plätzen ausgerüstet ist. Die Tabelle 4 zeigt die Fähigkeit von NAF zur Auslösung des respiratorischen Knalls bei Humanneutrophilen. Tabelle 4Von NAF abhängige Bildung von Superoxid durch Humanneutrophile Reduktion von Cytochrom C*

NAF (μl)Maximale Geschwindigkeit
(nMol/min)
Gesamtmenge in
3 min (nMol)
50,810,89101,45 ± 0,631,45 ± 0,50202,32 ± 0,562,16 ± 0,39302,51 ± 0,502,30 ± 0,55503,51 ± 0,693,10 ± 0,551003,693,39* Alle Werte sind auf 106 Zellen bezogen
Mittelwerte ± SF

Eine allmähliche Zunahme der Maximalgeschwindigkeit und der Gesamtmenge der Bildung an Superoxid ergibt sich mit zunehmenden Mengen an NAF. Durch Vergleichsversuche lässt sich zeigen, dass die Mengen an NAF, welche ein Maximum der Bildung an Superoxid ergeben, den Mengen entsprechen, die eine maximale Exozytose einleiten.

Beispiel 14Bildung von H2O2 (Vergleich von NAF mit fMLP und C5a als Stimulans für den respiratorischen Knall bei Humanneutrophilen)

Die Eigenschaften von NAF, fMLP und C5a als Stimulanzien für den respiratorischen Knall werden verglichen, indem die Bildung an Superoxid oder Wasserstoffperoxid durch die stimulierten Zellen ermittelt wird. Die Bildung an Superoxid wird wie im Beispiel 13 beschrieben bestimmt. Die Bildung an Wasserstoffperoxid wird durch Chemilumineszenz bestimmt (M.P. Wymann et al., Anal. Biochem. 165 [1987], Seiten 371 bis 378). Das Versuchsgemisch, welches aus PBS-BSA besteht und 0,1 Mol Natriumazid, 0,01 mMol Luminol, 9 E/ml Meerrettichperoxidase und 106 Neutrophile enthält, wird 10 min bei 37°C vorbebrütet, worauf die Reaktion durch Zugabe des Stimulans mittels einer Mikrospritze gestartet wird.

Die 10 zeigt die Bildung von Superoxid, welche durch zunehmende Mengen an NAF induziert wird. Aufgrund des raschen Beginns, der hohen Geschwindigkeit und des frühen Nachlassens ähnelt das Wirkungsmuster von NAF weitgehend dem, welches von fMLP oder C5a hervorgerufen wird. Die Wirkung von NAF wird durch Vorbehandlung der Zellen mit PAF stark verbessert (10), wodurch sich ebenfalls eine Verbesserung der durch fMLP oder C5a eingeleiteten Bildung an Superoxid ergibt. Ein direkter Vergleich zwischen den Wirkungen von NAF, fMLP und C5a geht aus der 9 hervor. Die Werte für die Chemilumineszenz über das Ausmaß der Bildung von H2O2 gegen die Zeit unterstreichen die Ähnlichkeit der Wirkungen.

Diese und andere Messergebnisse zeigen ferner, dass die Zeit zwischen der Zugabe des Stimulans und dem Beginn der Bildung von H2O2, welche durch NAF, fMLP und C5a induziert wird, identisch ist und etwa 2 sek beträgt, wie dies bereits für fMLP, C5a, PAF und Leukotrien B4 berichtet worden ist (M.P. Wymann et al., J. Biol. Chem. 262 [1987], Seite 12048). Die qualitative und quantitative Ähnlichkeit der Neutrophilenantwort auf NAF, fMLP und C5a zeigt, dass NAF die Neutrophilen durch Bindung an einen Oberflächenrezeptor aktiviert und sich somit wie ein Rezeptoragonist verhält.

Beispiel 15Unterschiede zwischen NAF und C5a

Wie im Beispiel 14 angegeben, ist das Wirkungsprofil von NAF gegenüber Humanneutrophilen ähnlich wie das Wirkungsprofil von C5a. Die Ähnlichkeiten zwischen diesen beiden Peptiden erstrecken sich auf die unterscheidbaren physikalisch-chemischen Eigenschaften, wie die Beständigkeit gegen Wärme und Säure. Da C5a und NAF ähnliche Wirkungen bei Neutrophilen haben, müssen zur vollständigen Unterscheidbarkeit dieser beiden Substanzen weitere Versuche durchgeführt werden. Hierzu werden Proben von NAF und C5a frischem Humanserum ausgesetzt. Von einer solchen Behandlung weiß man, dass hierbei durch Spaltung mit einer Carboxypeptidase C5a in sein relativ inaktives Desarginylderivat umgewandelt wird. Der 11 ist zu entnehmen, dass eine derartige Behandlung mit Serum zu einem vollständigen Verlust der Aktivität von C5a führt, hierdurch die Aktivität von NAF jedoch nicht beeinträchtigt wird. Daraus ergibt sich, dass diese beiden Mittel strukturell verschieden sind.

Beispiel 16Beweis dafür, dass NAF über einen eigenen spezifischen Rezeptor an Neutrophilen verfügt

Werden Neutrophile zweimal mit der gleichen Menge des gleichen Rezeptoragonisten (wie fMLP) stimuliert, dann lässt sich die Bildung an Superoxid als Maßzahl für die Wirkung der Neutrophilenantwort aufzeichnen, wobei die zweite Stimulierung praktisch inaktiv ist. Werden dagegen Agonisten, die auf unterschiedliche Rezeptoren einwirken, aufeinanderfolgend angewandt (wie fMLP und dann C5a), dann ergibt sich durch diese Stimulierungen eine normale Antwort, Versuche dieser Art werden daher herangezogen, um herauszufinden, ob NAF durch seinen eignen Rezeptor oder über einen Rezeptor wirkt, der auch von anderen Agonisten verwendet wird.

Die 12a zeigt, dass die Neutrophilen nach einem ersten Kontakt mit NAF oder C5a auf fMLP normal antworten. Aus der 12b gehen die Ergebnisse einer wiederholten Stimulierung mit NAF und C5a hervor. Die Zellen werden zuerst mit NAF und C5a in einer Konzentration stimuliert, welche etwa die gleiche Menge der Bildung an Superoxid hervorruft, worauf dann eine zweite Stimulierung mit entweder dem gleichen Stimulans oder dem anderen Stimulans durchgeführt wird. Wird der gleiche Agonist zweimal angewandt, dann antworten die Zellen nicht mehr auf die zweite Stimulierung. Im Gegensatz dazu ergibt sich eine normale Antwort gegenüber C5a bei Zellen, welche zuerst mit NAF behandelt worden sind, und gegenüber NAF bei Zellen, die zuerst einer Einwirkung von C5a unterzogen worden sind. Die Neutrophilen zeigen eine vollständige Desensitivisierung gegenüber beiden Stimulanzien, jedoch keine Kreuzdesensitivierung, sodass NAF und C5a ihre stimulierenden Effekte über nicht verwandte Rezeptoren auszuüben scheinen, was belegt, dass sie strukturell unterschiedlich sind. Kombinationen von NAF mit PAF, fMLP und Leukotrien B4 zeigen ebenfalls keine Kreuzdesensitivierung. NAF wirkt somit durch einen selektiven und bisher unbekannten Rezeptor.

Beispiel 17Neutrophilenakkumulierung und Plasmaexudation infolge einer Induktion durch NAF beim Hasen

Es werden die entzündlichen Reaktionen in der Haut von bei Bewußtsein befindlichen weißen Neuseelandhasen mit einem Gewicht von 2,0 bis 2,5 kg geprüft. Erythrozyten im Blut von Donorhasen werden mit Hydroxyethylcellulose (Polysciences, Warrington, Pa., V.St.A.) sedimentiert, und die im erhaltenen leukozytenreichen Plasma vorhandenen Neutrophilen werden gereinigt, (> 94% Neutrophile) durch Dichtegradientenzentrifugation mit Percoll (Pharmacia, Uppsala, Schweden). Die Zellen werden in an Ca2+ und Mg2+ freier Tyrode-Lösung, die 10 Prozent blättchenarmes Plasma enthält, in einer Konzentration von 106 Leukozyten pro ml suspendiert und während 15 min bei Raumtemperatur mit 40 μCi 111Indiumoxin (Amersham) pro 106 Zellen markiert. Die markierten Zellen werden mittels Zentrifugation durch 10-prozentiges blättchenarmes Plasma gewaschen, und etwa 106 Zellen pro Rezipient werden mit humanem Serumalbumin, das mit 10 μCi 125Iod markiert worden ist (Amersham), vermischt und intravenös in die laterale Ohrvene von Hasen gespritzt, welche die jeweils zu prüfenden entzündlichen Verletzungen aufweisen. Hierauf werden den Hasen intradermal inflammatorische Mittel gespritzt, worauf nach 2 h zuerst die mit Actinomycin D und Polymyxin B behandelten Tiere und nach 4 h dann die unter den Dosis-Wirkungsversuchen stehenden Tiere getötet werden. In der Mitte der Zeitdauer, während der sich die radiomarkierten Zellen in Zirkulation befinden, entnimmt man eine Blutprobe und bestimmt die spezifischen Aktivitäten der Neutrophilen und des Plasmas im Blut. Am Ende eines jeden Versuchs wird die Radioaktivität der inflammatorischen Verletzungen in einem Mehrfachkanal-Gamma-Zähler bestimmt, wobei die Aktivität an den Stellen der Kontrollhaut abgezogen wird und wobei die in den inflammatorischen Verletzungen vorhandene absolute Anzahl an Neutrophilen und das Volumen an Plasma aus den spezifischen Aktivitäten berechnet wird. Die Anzahl an Neutrophilen in den inflammatorischen Verletzungen wird zwischen den Tieren standardisiert, indem die Ergebnisse als Zellauszählung pro 106 Neutrophilen, welche pro ml an peripherem Blut zirkulieren, ausgedrückt werden, was nach dem von Cybulsky et al. in Am. J. Pathol. 124 [1986], Seite 367, beschriebenen Verfahren erfolgt.

Rekombinanter NAF, der wie im Beispiel 19 beschrieben hergestellt worden ist, wird in einer Menge von 400 μg/ml in minimalem essentiellen Medium (50 millimolar) plus 0,45 molarem NaCl (pH = 6,5) gelöst. Endotoxin (Escherichia coli Serotyp 055:B5, Sigma, St. Louis, Mo., V.St.A.) wird in pyrogenfreier 1-normaler Kochsalzlösung gelöst. fMLP wird in Dimethylsulfoxid in einer 10–2 molaren Konzentration gelöst, und die Lösung wird in PFS auf Arbeitskonzentrationen verdünnt. Polymyxin B und Actinomycin D werden in 1 ml Ethanol gelöst, und die Lösung wird durch Vermischen mit NAF, Endotoxin oder fMLP in PFS auf das zwanzigfache verdünnt. Bei Studien zur Hemmung der inflammatorischen Antworten werden 40 μg Polymyxin B und 10–7 Mol Actinomycin D pro Hautstelle mit 10–6 Mol Endotoxin injiziert. Bei allen Versuchen werden 0,2 ml an inflammatorischen Mitteln intradermal pro Stelle mit 0,65 mm (26 gauge) Nadeln injiziert, wobei jede Behandlung bei jedem Tier fünffach vorgenommen wird.

NAF induziert eine dosisabhängige Zunahme der Plasmaexudation (16) und der Akkumulierung an Neutrophilen (17) über den geprüften Dosierungsbereich (10–11 bis 10–9 Mol pro Stelle). Im Vergleich dazu ergibt Endotoxin eine Plasmaexudation (16) und eine Akkumulierung an Neutrophilen (17) mit einer vergleichbaren Intensität von 10–13 Mol pro Stelle. Bei fünf Hasen ist NAF drei- bis zehnmal stärker als fMLP als Stimulans für eine Plasmaexudation und eine Akkumulierung von Neutrophilen. Die Akkumulierung von Neutrophilen, welche durch Verdünnung des zum Lösen von NAF verwendeten Puffers auf die Konzentration eingeleitet wird, welche in Lösungen vorhanden ist, die 10–9 Mol pro Stelle liefern, unterscheidet sich nicht von der Antwort an Stellen, welche lediglich PFS allein erhalten. Die Möglichkeit, dass die Aktivität der NAF-Präparation die Folge einer Verunreinigung durch Endotoxin sein kann, wird durch Injektion von Polymyxin B (40 μg/Stelle) zusammen mit NAF, fMLP oder Endotoxin geprüft. Hierbei ergibt Polymyxin B eine 84-prozentige Hemmung der Antwort von Endotoxin (10–13 Mol), hat jedoch keinen Einfluss auf die Akkumulierung von Neutrophilen, welche durch NAF (10–9 Mol) oder fMLP (10–9 Mol) eingeleitet wird (18).

Eine Injektion eines nichtreversiblen Inhibitors für eine RNA-Transkription, nämlich von Actinomycin D (10–7 Mol/Stelle) zusammen mit 10–13 Mol Endotoxin, führt zu einer 90-prozentigen Hemmung der Akkumulierung von Neutrophilen (19). Im Gegensatz dazu zeigt Actinomycin D keinen Effekt auf die Akkumulierung von Neutrophilen, welche durch NAF (10–9 Mol) oder fMLP (10–9 Mol) eingeleitet wird (19).

Die Ergebnisse zeigen, dass NAF in vivo aktiv ist und eine dosisabhängige Akkumulierung von Neutrophilen und eine Exudation von Plasma in inflammatorische Verletzungen einleitet.

Die molare Stärke von NAF ist vergleichbar zum klassischen Chemotactin C5a und LTB und drei- bis fünfmal höher als von fMLP. Die durch NAF eingeleitete Akkumulierung von Neutrophilen wird durch die gleichzeitige intradermale Injektion eines Hemmstoffes für die Proteinsynthese (Actinomycin D) nicht gehemmt. NAF wirkt somit direkt wie ein chemotaktischer Agonist, wie fMLP, und nicht wie Endotoxin.

Beispiel 18Durch NAF eingeleitete Exozytose (Effekt auf Hasenneutrophile)

Hasenneutrophile werden aus peripherem Blut (aus der Ohrvene oder Arterie erhalten) durch Dextransedimentation und anschließende Hypaque-Ficoll-Dichtegradientenzentrifugierung isoliert. Es wird gereinigter natürlicher NAF verwendet.

Die Bedingungen der Exozytose sind: 0,6 × 106 Zellen (in einem Gesamtvolumen von 0,15 ml), welche mit Cytochalasin B während 5 min bei 37°C vorbehandelt worden sind, werden mit NAF (0,1 bis 100 nMol) oder fMLP (100 nMol) während 15 min stimuliert, und im zellfreien Medium wird N-Acetyl-β-glucosaminidase, nämlich ein azurophiler Granulamarker, bestimmt. Die Ergebnisse gehen aus der folgenden Tabelle 5 hervor. Tabelle 5Durch NAF eingeleitete Exozytose

StimulansKonzentration
(nMol)
N-Acetyl-β-glucosaminidase (pMol/min)
Keines41NAF0,1531,09910,0139100,0157fMLP100,0181

Teil IV: Remkombinanter NAFBeispiel 19Synthese und Expression von NAF in Escherichia colia) Synthese und Reinigung von Oligonukleotiden

Die Oligonukleotide ON-1 bis ON-6 (siehe 13) werden auf einem automatischen DNA-Synthesegerät unter Anwendung üblicher chemischer Maßnahmen mit 3'-β-Cyanoethyl-N,N-diisopropylphosphoamiditnukleotiden als Monomeren auf einem festen Träger, wie Fractosilsiliciumdioxidgel oder Glas mit eingestellter Porosität (CPG) synthetisiert (S.L. Beaucage und M.H. Caruthers, Tetr. Letters 22 [1981], Seite 1959, und N.D. Sinha et al., Nucleic Acids Res. 12 [1984], Seite 4539).

Die detritylierten Materialien werden vom Träger durch zweistündige Behandlung mit 25-prozentigem Ammoniak bei Raumtemperatur getrennt, worauf alle Schutzgruppen durch Erhitzung der ammoniakalischen Lösung während 20 h auf 55°C abgespalten und die Produkte lyophilisiert werden. Die Auftrennung der Rohmaterialien erfolgt durch Polyacrylamidgelelektrophorese (PAGE) mit 12 Prozent Acrylamid, 0,3 Prozent Bisacrylamid, 7 molarem Harnstoff, 0,089 molarem Trisborat, 0,089 molarer Borsäure und 0,002 molarem EDTA bei 20 V/cm. Die Oligonukleotide mit voller Länge werden durch UV-Beschattung auf fluoreszierenden Siliciumdioxidgelplatten lokalisiert, wobei die Gelteile herausgeschnitten und in einer Elutionskammer elektroeluiert werden. Die konzentrierten Lösungen werden auf einer mit Biogel P2 gefüllten Säule (30 × 0,9 cm) durch Elution mit 10-prozentigem Ethanol entsalzt und lyophilisiert. Die Proben von ON-1 bis ON-6 werden mit 32P-γ-ATP und Polynukleotidkinase radioaktiv markiert. Durch Analyse mittels PAG und Autoradiographie wird bestätigt, dass sie homogen sind.

Die genauen Sequenzen werden durch Maxam-Gilbert-Sequenzierung der auf einem modifizierten Filterpapier immobilisierten Oligonukleotide bestätigt (A. Rosenthal et al., Nucleic Acids Res. 13 [1985], Seiten 1173 bis 1184).

b) Anlassung und Ligation

Zur Anlassung und Ligation werden Mengen von jeweils 250 pMol der Oligonukleotide mit 4 μCi 32P-ATP (5000 μCi/mMol) und 9 Einheiten Polynukleotidkinase in 20 μl Kinasepuffer während 40 min bei 37°C unter anschließender 20-minütiger Behandlung mit 5 mMol nicht markiertem ATP phosphoryliert (T. Maniatis et al., Molecular Cloning, A Laboratory Manual [1982], Cold Spring Harbor Laboratory, N.Y., V.St.A.). Hierauf wird die Reaktion mit 1 μl 0,5 molarem EDTA bei 70°C gestoppt. Die phosphorylierten Oligonukleotide werden durch Adsorption an NENSORB 20 Patronen (DuPont) und Elution mit 20-prozentigem Ethanol gereinigt, wodurch sich eine Ausbeute von etwa 90 Prozent ergibt. Hierauf wird eine Anlassung und Ligation gleicher Mengen von 30 bis 100 pMol von 5'-phosphoryliertem ON-2 bis ON-4 und unphosphoryliertem ON-1 und ON-6 in 25 μl Puffer (125 millimolares Tris-HCl, pH = 7,6), der 25 millimolar an MgCl2 ist, durchgeführt. Das Gemisch wird 4 min auf 90°C erhitzt, innerhalb von 3 h auf 14°C abgekühlt und weitere 14 h bei 14°C bebrütet. Im Anschluss daran erfolgt eine Volumeneinstellung auf 60 μl mit 50 millimolarem Tris-HCl vom pH = 7,6, 10 millimolarem MgCl2, 10 millimolarem Dithiothreit, 1 millimolarem ATP und 0,1 mg pro ml Rinderserumalbumin, das 1600 bis 2000 Einheiten an T4-Ligase enthält. Die Ligation wird 14 h bei 14°C durchgeführt und dann durch Zusatz von 1 μl an 0,5 molarem EDTA und Erhitzen auf 70°C gestoppt. Die nach Extraktion mit Phenol erhaltene wässrige Lösung wird 0,3 molar an Natriumacetat und 0,01 molar an Magnesiumacetat gemacht, worauf die DNA mit Ethanol ausgefällt und die Produkte durch PAGE (8 Prozent Acrylamid, 7 molar an Harnstoff) unter einer maximalen Beladung von 10 pMol an DNA pro 1,5 cm Nut eines 0,5 mm starken Gels gereinigt werden. Das die korrekte Länge aufweisende Produkt wird durch Autoradiographie identifiziert und das entsprechende Gelsegment herausgeschnitten, worauf die DNA während 6 h bei 200 V in Biotrap BT100 elektroeluiert und mit Ethanol ausgefällt wird, wodurch sich eine Gesamtausbeute von 5 bis 8 pMol an gereinigter doppelsträngiger DNA auf 100 pMol Oligonukleotid ergibt.

c) Klonierung des synthetischen Gens

Eine Probe von 110 ng des isolierten synthetischen NAF-Gens wird mit 260 ng durch Agarosegel gereinigter SphI/BamHI-Schnitt-pBS M13-Plasmid-DNA (Stratagene) ligiert. Ein Zehntel dieses Ligationsgemisches wird zur Transformation von 20 μl 5K-Zellen von Escherichia coli verwendet, die nach der Methode von D. Hanahan, J. Mol. Biol. 166 [1983], Seiten 557 bis 580, kompetent gemacht worden sind, wodurch etwa 320 ampicillinresistente Kolonien pro ng an eingesetzter DNA gebildet werden. Man entnimmt sechs Klone und lässt sie über Nacht in L-Brühe/Ampicillin wachsen. Man stellt Plasmid-DNA her (H.C. Birnbolm und J. Doly, Nucleic Acids Res. 7 [1979], Seiten 1513 bis 1523) und lässt sie auf 1-prozentigem Agarosegel laufen. Durch Elektrophorese der Bande in 3 MM-Papier (Whatman) und Zentrifugieren in Eppendorf-Röhrchen wird reine supergewickelte DNA isoliert. Nach Extraktion mit Phenol und Fällung mit Ethanol wird die DNA durch die alkalidenaturierte Plasmidkettenterminationsmethode unter Verwendung von T3- und T7-Primern (Stratagene) und dem Sequenaseenzym (E.J. Chen et al., DNA 4 [1985], Seiten 165 bis 170) sequenziert.

Von den sechs Klonen enthalten drei Klone, nämlich die Klone 1, 2 und 6, die korrekte NAF-Sequenz. Die anderen drei Klone haben folgende Fehler: Beim Klon 3 ist nach dem ATG-Startkodon ein zusätzlicher G-Rest inseriert, wodurch sich die vollständige Kodierungssequenz außer Phase befindet. Beim Klon 5 ist C durch T in Stellung 34 ersetzt, wodurch nach der Aminosäure mit der Nummer 6 ein Stoppkodon gebildet ist. Beim Klon 4 fehlt schließlich ein G in der Stellung 13. Diese Stellung befindet sich nicht in der Kodierungssequenz, sondern im Bereich zwischen dem Startkodon und der ribosomalen Bindestelle.

Das Plasmid, das die korrekte Sequenz (Klon 6) enthält, wird mit den Restriktionsenzymen ClaI und BamHI geschnitten, und das 237 bp Fragment wird aus einem Agarosegel durch Elution in 3 MM-Papier wie oben beschrieben isoliert. Dieses Fragment wird dann an ein lineares DNA-Fragment ligiert, das von links nach rechts betrachtet folgende Bauelemente enthält:

  • – eine BamHI-Restriktionsendonukleasestelle
  • – einen synthetischen Transkriptionsterminator
    (CCCGGGCGATGAATCGCCCGGG oder CCCGGGCGATTCATCGCCCGGG)
  • – einen Abschnitt an Plasmid pAT153, von der SalI-Stelle am Nukleotid mit der Nummer 651 über den Replikationsursprung und das Gen für die Ampicillinresistenz bis zur EcoRI-Stelle am Nukleotid mit der Nummer 0
  • – den Tryptophanpromotor von Escherichia coli
  • – eine ClaI-Stelle, die sich etwa 5 Basenpaare stromabwärts von der ribosomalen Bindestelle im Promotor befindet

Das erhaltene ampicillinresistente Expressionsplasmid, das als p(NAF)-6T3 bezeichnet wird (14), wird in Zellen von Escherichia coli des Stammes HB101 transformiert.

Der Transkriptionsterminator ist für die Expression von NAF in Escherichia coli nicht wesentlich. Er erlaubt jedoch eine effiziente Termination der durch die Polymerase von Escherichia coli gebildeten NAF-mRNA und ergibt somit eine Ausbeuteerhöhung bei der Expression. NAF kann jedoch auch im gleichen Vektor ohne den Transkriptionsterminator exprimiert werden, wobei die Ausbeute dann jedoch um 30 bis 50 Prozent niedriger ist.

Dieses synthetische Gen, welches für NAF kodiert, und auch andere Gene, die für die gleiche Grundpeptidsequenz kodieren, welche jedoch eine andere Nukleotidsequenz haben, oder die für Peptide unterschiedlicher Länge kodieren, lassen sich in Escherichia coli auch unter Verwendung anderer Promotoren exprimieren, wie des Promotors lambda PL oder der Promotoren Lac oder Tac von Escherichia coli. Die Gene können auch mit anderen Vektoren eingeführt und in anderen Organismen exprimiert werden, wie in Hefen, Pilzen, tierischen Zellen, bakteriellen Zellinien, Pflanzen und transgenen höheren Organismen.

d) Expression

Die Expression von p(NAF)-6T3 in Escherichia coli HB 101 wird wie folgt durchgeführt:

  • Vorkultur 1: 50 μl einer auf –20°C gehaltenen Glycerinkultur der Zellinie gibt man zu 10 ml sterilem Medium LB (10 g/l Trypton, 5 g/l Hefeextrakt, 10 g/l NaCl), welches 100 μg/ml Ampicillin enthält. Die Kultur wird 8 h bei 37°C und 200 Upm in einem Inkubator geschüttelt.
  • Vorkultur 2: Man inokuliert 8 ml des Mediums der Vorkultur 1 in 1 l Medium M9 (J.H. Miller Experiments in Molecular Genetics [1972], Cold Spring Harbor Laboratory, N.Y., V.St.A., Seiten 431 bis 433), das 0,2 Prozent Glucose, 0,5 Prozent Casaminosäuren (Difco), 25 mg/l Tryptophan und 100 μg/ml Ampicillin enthält. Diese Kultur wird 15 bis 16 h bei 37°C und 200 Upm in einem Inkubator geschüttelt.
  • Fermentation: Die Hauptfermentation wird in einem 70 l fassenden Fermenter bei einem Arbeitsvolumen von 35 l durchgeführt. Hierzu wird das gleiche Medium wie bei der Vorkultur 2 mit der Ausnahme verwendet, dass lediglich 5 mg/l Tryptophan zugesetzt werden. Die Vorkultur 2 wird in dieses Medium inokuliert, und die Fermentation wird bei 37°C bis zu einer optischen Dichte von 2,8 bei 600 nm (OD600) fortgeführt. Nach Erreichen eines OD600-Wertes von 2,8 wird Indolacrylsäure in Ethanol bis zu einer Endkonzentration von 20 mg/l zugesetzt. Nach 4 h hat sich der OD600-Wert auf 13,5 erhöht, und zu diesem Zeitpunkt wird das Ganze zentrifugiert, wodurch man ein Pellet von 516 g erhält.

e) Reinigung des rekombinanten NAF

Zellen von Escherichia coli, die den rekombinanten NAF enthalten, werden bei –20°C aufbewahrt. Mengen von jeweils 100 g werden mit 100 ml 20 millimolarer Tris-HCl vom pH = 8,0, welche 50 millimolar an NaCl ist, gewaschen, in 250 ml des gleichen Puffers resuspendiert und bei 172 bar (2500 psi) in einer französischen Presse (Aminco) aufgebrochen. Das nach Zentrifugieren bei 47000 g während 40 min erhaltene Pellet wird im gleichen Puffer suspendiert, worauf man erneut zentrifugiert und das erhaltene Pellet bei –20°C aufbewahrt. Mengen von jeweils 10 g hiervon werden in 100 ml eines Puffers aus 50 millimolarem MES-NaOH vom pH = 6,5 und 6 molarer Guanidin-HCl suspendiert, und die erhaltene Suspension wird 1 h gerührt und dann gegen 0,5-prozentige Essigsäure dialysiert. Das Dialysat wird durch Zentrifugieren geklärt und in Anteilen auf eine Mono-S-Säule (HR 5/5, Pharmacia) gegeben. Die Säule wird mit einem Puffer aus 50 millimolarem MES-NaOH vom pH = 6,5, der 0,2 millimolar an NaCl ist, gewaschen und bei einer Geschwindigkeit von 0,5 ml/min mit einem linearen Gradienten im gleichen Puffer (0,2 bis 0,5 molar an NaCl) eluiert. Die Fraktionen mit dem höchsten NAF-Gehalt werden zusammengefasst und über eine großporige Umkehrphasen-HPLC-Säule (0,46 × 125 mm, Vydac C4TP) in 0,1-prozentiger Trifluoressigsäure und unter einem Gradienten von 20 bis 60 Prozent Acetonitril bei einer Fließgeschwindigkeit von 1 ml/min chromatographiert.

Teil V: Identität von natürlichem und rekombinantem NAFBeispiel 20Physikalisch-chemische Identität

Der durch HPLC gewonnene NAF (siehe Beispiel 19) wird auf Basis der folgenden zwei Kriterien als rein angesehen: Mit Silber angefärbte SDS-Polyacrylamidgele zeigen eine einzige Bande, die mit natürlichem NAF zusammenfällt (1 μg rekombinanter NAF aus der Peakfraktion des HPLC in der Spur 2 gegenüber 1 μg an natürlichem NAF in der Spur 3 mit Molekulargewichtsstandards an Cytochrom C [12,5 kd] und an Aprotinin [6,5 kd] in der Spur 1), und der Edman-Abbau des mit Ameisensäure gespaltenen Peptids ergibt aminoendständige und carboxyendständige Sequenzen, die den Sequenzen der 72 Aminosäuren des natürlichen NAF entsprechen. Die Aminosäureanalyse stimmt mit der aus der Sequenz erwarteten Zusammensetzung überein. Es wird kein Methionin gefunden, was darauf hindeutet, dass dieser Rest wahrscheinlich durch die Bakterien entfernt wird.

Beispiel 21Biochemische Identität

Natürlicher und rekombinanter NAF werden parallel an Humanneutrophilen geprüft. Sie rufen praktisch identische Veränderungen in cytosolfreiem Ca2+ hervor, wobei sich ein maximaler Anstieg bei einer Konzentration von nur 3 nMol ergibt (15). Mit beiden Präparationen erhält man einen nahezu identischen konzentrationsabhängigen respiratorischen Knall im Bereich von 1 bis 30 nMol, wie sich durch Messung der Chemilumineszenz ergibt. Die Äquivalenz zwischen natürlichem und rekombinantem NAF wird auch durch Messung der Chemotaxis und der Exozytose sichtbar. Eine chemotaktische Migration läßt sich zwischen 0,1 und 10 nMol mit einem maximalen Effekt bei 1 nMol beobachten (Tabelle 6). Beide Peptide ergeben eine signifikante Freisetzung des Bindungsproteins von Vitamin B12 aus den spezifischen Granula bei 0,3 nMol und der β-Glucuronidase aus den azurophilen Granula bei 1 nMol. Dieser Effekt erhöht sich mit der Konzentration des Stimulans (Tabelle 7). Tabelle 6Durch NAF induzierte Neutrophilenchemotaxis

NAF (nMol)natrec0,198 ± 688 ± 61,0123 ± 6124 ± 310,0127 ± 3126 ± 4Die Zahlen stellen Mittelwerte ± SF der Wanderung der Führungsfront in μm (n = 3) dar. Die willkürliche Wanderung in Abwesenheit eines chemotaktischen Stimulans beträgt 61 ± 5 μm.
nat = natürlicher NAF rec = rekombinanter NAF
Tabelle 7Durch NAF induzierte ExozytoseBindungsprotein für Vitamin B12β-Glucuronidase NAF (nMol)natrecnatrec0,37,8 ± 3,65,4 ± 2,01,1 ± 0,80,8 ± 0,63,021,9 ± 4,220,2 ± 3,78,2 ± 1,97,1 ± 1,730,028,4 ± 3,728,1 ± 3,814,2 ± 2,112,9 ± 2,9Prozentuale Freisetzung aus mit Cytochalasin B vorbehandelten Neutrophilen (4 × 106 Zellen/ml), welche während 10 min mit natürlichem (nat) oder rekombinantem (rec) NAF stimuliert worden sind. Die Freisetzung aus den entsprechenden nichtstimulierten Kontrollen wird abgezogen. Mittelwerte ± SF (n = 3).