Title:
Verfahren zum Überwachen der Differenzierung in Herzmuskelzellen
Kind Code:
T5


Abstract:

Ein Verfahren zum Überwachen der Differenzierung in Herzmuskelzellen umfasst das Halten von Zellen in einem lebenden Zustand, in die ein Reporter-Gen aus lumineszentem Protein eingeführt wird, das zum Variieren in der lumineszenten Intensität entsprechend einer Expression des Myokard-Differenzierungsmarkergens ausgebildet ist (S1). Das Verfahren umfasst das Aufnehmen eines Lumineszenzbildes als ein Standbild durch von den Zellen in einem Lichtabschirmungszustand ausgestrahltes Bildgebungslicht (S2). Das Verfahren umfasst das Aufnehmen von Sequenzbildern mit Beleuchten der Zellen (S3). Das Verfahren umfasst das Zuordnen von aus den Sequenzbildern erhaltenen biologischen Informationen zu aus dem Standbild erhaltenen biologischen Informationen (S6).




Inventors:
Hayashi, Taro (Tokyo, JP)
Sakane, Isao (Tokyo, JP)
Ohashi, Yoko (Tokyo, JP)
Application Number:
DE112014006537T
Publication Date:
01/26/2017
Filing Date:
09/30/2014
Assignee:
Olympus Corporation (Tokyo, JP)
International Classes:



Attorney, Agent or Firm:
Wuesthoff & Wuesthoff, Patentanwälte PartG mbB, 81541, München, DE
Claims:
1. Verfahren zum Überwachen der Differenzierung in Herzmuskelzellen, umfassend:
Halten von Zellen in einem lebenden Zustand, in die ein Reporter-Gen aus lumineszentem Protein eingeführt wird, das zum Variieren in der Lumineszenzintensität entsprechend einer Expression des Myokard-Differenzierungsmarkergens ausgebildet ist;
Aufnehmen eines Lumineszenzbildes als ein Standbild durch von den Zellen in einem Lichtabschirmungszustand ausgestrahltes Bildgebungslicht;
Aufnehmen von Sequenzbildern durch Beleuchten der Zellen; und
Zuordnen von aus den Sequenzbildern erhaltenen biologischen Informationen zu aus dem Standbild erhaltenen biologischen Informationen.

2. Verfahren nach Anspruch 1, bei dem das Aufnehmen von Sequenzbildern das Aufnehmen eines Hellfeldbildes der Zellen umfasst.

3. Verfahren nach Anspruch 2, ferner umfassend Durchführen einer Bewegungsanalyse auf Basis des Hellfeldbildes.

4. Verfahren nach Anspruch 3, bei dem die Bewegungsanalyse durch Verwendung eines Bildkorrelationsverfahrens erfolgt.

5. Verfahren nach Anspruch 3, ferner umfassend:
Analysieren des Schlagens der Zellen durch die Bewegungsanalyse;
Analysieren der Expression des Myokard-Differenzierungmarkergens auf Basis des Lumineszenzbildes; und
Bewerten einer Beziehung zwischen dem Schlagen und der Expression.

6. Verfahren nach Anspruch 1, bei dem
das Aufnehmen des Lumineszenzbildes Aufnehmen von mehr als einem Lumineszenzbild durch Bildgebung mit Zeitverlauf umfasst, und
das Verfahren ferner Ermitteln einer Änderung in der Lumineszenzintensität auf Basis der Lumineszenzbilder umfasst, so dass ein Zustand der Differenzierung der Zellen identifizierbar ist.

7. Verfahren nach Anspruch 6, ferner umfassend Umwandeln der Änderung der Lumineszenzintensität in einen numerischen Wert.

8. Verfahren nach Anspruch 1, ferner umfassend Einführen eines Reporter-Gens von lumineszentem Protein, das zum Ausstrahlen von Licht entsprechend einer Expression eines undifferenzierten Markergens ausgebildet ist.

9. Verfahren nach Anspruch 1, bei dem das Reporter-Gen zum Ausstrahlen von Licht entsprechend der Expression der Myokard-Differenzierungsmarkergene von mehr als einer Art ausgebildet ist.

10. Verfahren nach Anspruch 1, bei dem die Zellen Stammzellen oder Herz-Vorläuferzellen sind.

11. Verfahren nach Anspruch 1, bei dem die Zellen die Form eines Embryoid Body oder einer Zellschicht aufweisen.

12. Verfahren nach Anspruch 1, ferner umfassend Bestimmen eines Differenzierungszustands der Zellen.

13. Verfahren nach Anspruch 1, ferner umfassend Analysieren einer Calciumkonzentration in den Zellen.

14. Verfahren nach Anspruch 1, ferner umfassend Messen eines Potentials in den Zellen.

Description:
Technisches Gebiet

Die vorliegende Erfindung betrifft ein Verfahren zum Überwachen der Differenzierung in Herzmuskelzellen.

Bisheriger Stand der Technik

Momentan steht die regenerative Medizin zum Regenerieren betroffener Teile oder durch Erkrankungen verlorener Teile auf dem Gebiet der Medizin im Fokus. Auf dem Gebiet der regenerativen Medizin stehen Versuche im Fokus, Stammzellen wie embryonale Stammzellen (ES-Zellen) oder induzierte pluripotente Stammzellen (iPS) mit dem Potential zur Differenzierung in verschiedene Zellen in Herzmuskelzellen zu differenzieren und die Herzmuskelzellen in der Behandlung von Patienten mit Erkrankungen wie Myokardinfarkten zu verwenden.

Es ist aber in Bezug auf den Mechanismus, in dem sich ES-Zellen und iPS-Zellen in verschiedene Zellen differenzieren, noch vieles unklar. Das Untersuchen, wie Gene im Prozess der Differenzierung ausgedrückt werden, ist für das Klären von Differenzierungsprozessen äußerst wichtig.

Ein Verfahren zum Analysieren der Genexpression besteht in der Messung der Transkriptionsaktivität mit Reporter-Genen. Das Verfahren zum Messen der Transkriptionsaktivität umfasst eine Analyse einer Expressionssteuersequenz wie ein Promoter, ein Enhancer und ein Dämpfer und damit verbundene Transkriptionsfaktoren. Dieses Verfahren umfasst ebenfalls die Verwendung des Expressionswertes der mit einem bestimmten Promoter verbundenen Reporter-Gene als einen Index zum Analysieren verschiedener intrazellulärer molekularer Mechanismen, beispielsweise zum Analysieren des Aktivierungszustands der intrazellulären Signalwege oder Analysieren von Rezeptoren und Liganden. Dieses Werkzeug wird ebenfalls als ein Werkzeug für ein Screening im großen Umfang in der Wirkstoffforschung und als ein Index für die Bewertung der Toxizität von chemischen Stoffen verwendet.

Im Allgemeinen werden Verfahren wie Fluoreszenzbildgebung mit fluoreszierendem Protein wie GFP, Antikörperfärbung, Western-Blotting, Durchflusszytometrie usw. in der Analyse der Genexpression in einem Prozess zum Induzieren der Differenzierung von Stammzellen wie ES-Zellen und iPS-Zellen verwendet.

Das Problem der Fluoreszenzbildgebung besteht aber darin, dass eine quantitative Beobachtung der Genexpression mit Zeitverlauf über einen langen Zeitraum schwierig ist, weil optische Schäden durch das Erregerlicht erzeugt werden, ein Einfluss durch die Autofluoreszenz besteht und gegebenenfalls eine erwünschte Lichtmenge aufgrund der Streuung des Erregerlichts nicht in einen Embryoid Body umfassend Zellgruppen, die sich differenziert haben, gelangt. Das Problem von Antikörperfärbung und Western-Blotting besteht darin, dass die Genexpression des gleichen Ziels nicht mit Zeitverlauf beobachtet werden kann, weil eine Probe fixiert werden muss.

Vor kurzem wurde nicht nur eine Fluoreszenzbildgebung mit fluoreszierendem Protein durchgeführt, sondern auch eine Lumineszenzbildgebung mit der Biolumineszenz von lumineszenten lebenden Organismen in der Form von Glühwürmchen durchgeführt. Biolumineszenz ist ein Phänomen, bei dem sichtbares Licht von lebenden Organismen oder daraus erzeugten Stoffen aufgrund verschiedener Chemilumineszenzreaktionen ohne Abhängigkeit von optischer Energie resultierend aus Beleuchtungslicht ausgestrahlt wird. Biolumineszenzreaktionen erfordert meist drei Komponenten: Luciferin (Substrat), Luciferase (Enzym) und ein molekulares Enzym.

Luciferase dient als Reporter-Gene für die Bewertung des Einflusses von exogenen Faktoren auf Zellen, die intrazelluläre Informationsübertragung, Expressionsanalysen von einzelnen Proteingruppen usw. In einem System, in dem Luciferase verwendet wird, werden beispielsweise Glühwürmchen-Luciferase-Gene zunächst an einer transkriptionell aktivierten Stelle eingesetzt. Anschließend wird ein genetisches Konstrukt in die Zellen eingeführt. Gezüchtete Zellen, in welche die Reporter-Gene eingeführt wurden, werden anschließend beispielsweise mit einem Wirkstoff über eine vorgegebene Zeit behandelt. Die Zellen werden anschließend gesammelt und es wird ein lumineszentes Substrat hinzugefügt. Als ein Ergebnis wird die Menge der in den Zellen synthetisierten Luciferase gemessen und es kann die transkriptionelle Aktivität bewertet werden.

Zum Bewerten der transkriptionellen Aktivität von Reporter-Proben mit Luciferase werden im Allgemeinen Luminometer verwendet. Luminometer sind aber zum Messen der Lumineszenz von allen Zellen in einem Schacht vorgesehen. Zellen müssen entsprechend den Protokollen aufgelöst werden. Daher kann die Änderung der lumineszenten Intensität von jeder Zeile nicht mit Zeitverlauf in der gleichen Zelle in der Probe mit Luminometern gemessen werden.

Bei der Verwendung von Stammzellen wie ES-Zellen und iPS-Zellen in der regenerativen Medizin ist zu beobachten, dass sich Grad und Charakteristik der Genexpression je nach Strang unterscheiden. Die Herausforderung besteht somit darin, Zellen gleichmäßiger Qualität zu erzeugen und zu erhalten. Es muss somit auf der Ebene der einzelnen Zellen geklärt werden, wie Gene im Prozess zum Induzieren der Differenzierung von ES-Zellen und iPS-Zellen ausgedrückt werden. Verfahren zur Bildgebung von Stammzellen wie ES-Zellen und iPS-Zellen sind in derinternationalen Veröffentlichung Nr. 2011/029798 und der internationalen Veröffentlichung Nr. 2007/080622 offenbart. Die in der internationalen Veröffentlichung Nr. 2011/029798 und der internationalen Veröffentlichung Nr. 2007/080622 offenbarten Verfahren sind aber Verfahren zum Messen der gesamten Genexpression von Stammzellen mit Luminometer oder Verfahren zum Transplantieren von Stammzellen in einen Mauskörper und zur anschließenden Bildgebung der Stammzellen im lebenden Körper. Das heißt die in der internationalen Veröffentlichung Nr. 2011/0297 98 und der internationalen Veröffentlichung Nr. 2007/080622 offenbarten Verfahren sind nicht für die Bildgebung der Genexpression auf der Ebene von einzelnen Zellen vorgesehen.

Ein Verfahren zum Überwachen der Differenzierung von Stammzellen wie ES-Zellen und iPS-Zellen und der Expression von an der Differenzierung beteiligten Genen ist in der internationalen Veröffentlichung Nr. 2010/101225 offenbart. Im in der internationalen Veröffentlichung Nr. 2010/101225 offenbarten Verfahren wird das Verfahren der Antikörperfärbung verwendet. In diesem Fall müssen Zellen fixiert werden und es werden ausschließlich Endpunktdaten erhalten. Ferner wird Fluoreszenz als Nachweismittel in der Antikörperfärbung verwendet. Zellen mit integrierten Strukturen wie eine Zellschicht oder ein Embryoid Body weisen eine starke Autofluoreszenz auf. Daher ist eine quantitative Analyse mit Fluoreszenz in einigen Fällen schwierig.

Zusammenfassung der Erfindung

Die vorliegende Erfindung soll ein Verfahren zum Überwachen der Differenzierung in Herzmuskelzellen beispielsweise zum Visualisieren und Analysieren des Induzierens der Differenzierung in Herzmuskelzellen bereitstellen.

Zum Erfüllen der zuvor beschriebenen Aufgabe umfasst gemäß einem Aspekt der Erfindung ein Verfahren zum Überwachen der Differenzierung in Herzmuskelzellen das Halten von Zellen in einem lebenden Zustand, in die ein Reporter-Gen aus lumineszentem Protein eingeführt wird, das zum Variieren in der lumineszenten Intensität entsprechend einer Expression des Myokard-Differenzierungsmarkergens ausgebildet ist; das Aufnehmen eines Lumineszenzbildes als ein Standbild durch von den Zellen in einem Lichtabschirmungszustand ausgestrahltes Bildgebungslicht; das Aufnehmen von Sequenzbildern durch Beleuchten der Zellen; und das Zuordnen von aus den Sequenzbildern erhaltenen biologischen Informationen zu aus dem Standbild erhaltenen biologischen Informationen.

Die vorliegende Erfindung kann ein Verfahren zum überwachen der Differenzierung in Herzmuskelzellen beispielsweise zum Visualisieren und Analysieren des Induzierens der Differenzierung in Herzmuskelzellen bereitstellen.

Kurze Beschreibung der Zeichnungen

1 zeigt ein Fließbild zur Darstellung einer Übersicht eines Verfahrens zum überwachen der Differenzierung in Herzmuskelzellen gemäß einer Ausführungsform.

2 zeigt ein Diagramm zur Darstellung einer Übersicht eines Konfigurationsbeispiels eines Systems, das gleichzeitig eine Analyse der Genexpression auf der Basis eines Lumineszenzbildes und eine Analyse der funktionalen Expression auf der Basis von Hellfeld-Sequenzbildern gemäß einer Ausführungsform durchführen kann.

3 zeigt ein Bild zur Darstellung der Autofluoreszenz, wenn das Erregerlicht für GFP auf einen aus Maus-ES-Zellen erzeugten Embryoid Body angewendet wird, wobei das Bild ein Hellfeldbild ist.

4 zeigt ein Bild zur Darstellung der Autofluoreszenz, wenn das Erregerlicht für GFP auf den aus den Maus-ES-Zellen erzeugten Embryoid Body angewendet wird, wobei das Bild ein Lumineszenzbild ist.

5 zeigt ein Bild zur Darstellung der cTnT-Expression in einem Prozess der Myokard-Differenzierung des aus Maus-ES-Zellen erzeugten Embryoid Body, in den ein Reporter-Vektor, bei dem Luciferase mit einem Promoter von cTnT, das sich spezifisch im Herzmuskel ausdrückt, verbunden ist, eingeführt wird.

6 zeigt ein Bild zur Darstellung der cTnT-Expression in einem Prozess der Myokard-Differenzierung des aus den Maus-ES-Zellen erzeugten Embryoid Body, in den der Reporter-Vektor, bei dem Luciferase mit dem Promoter von cTnT, das sich spezifisch im Herzmuskel ausdrückt, verbunden ist, eingeführt wird, wobei das Bild ein Lumineszenzbild ist.

7 zeigt ein Bild zur Darstellung der cTnT-Expression im Prozess der Myokard-Differenzierung eines aus Maus-iPS-Zellen erzeugten Embryoid Body, in den der Reporter-Vektor, bei dem Luciferase mit dem Promoter von cTnT, das sich spezifisch im Herzmuskel ausdrückt, verbunden ist, eingeführt wird, wobei das Bild ein Hellfeldbild ist.

8 zeigt die cTnT-Expression im Prozess der Myokard-Differenzierung des aus den Maus-iPS-Zellen erzeugten Embryoid Body, in den der Reporter-Vektor, bei dem Luciferase mit dem Promoter von cTnT, das sich spezifisch im Herzmuskel ausdrückt, verbunden ist, eingeführt wird, wobei das Bild ein Lumineszenzbild ist.

9 zeigt ein Hellfeldbild, in dem die Expression von cTnT im Prozess der Myokard-Differenzierung des aus den Maus-iPS-Zellen erzeugten Embryoid Body mit Zeitverlauf beobachtet wird.

10 zeigt ein Lumineszenzbild, in dem die Expression von cTnT im Prozess der Myokard-Differenzierung des aus den Maus-iPS-Zellen erzeugten Embryoid Body mit Zeitverlauf beobachtet wird.

11 zeigt ein Diagramm zur Darstellung von ROI1 bis ROI4.

12 zeigt ein Diagramm zur Darstellung der Änderung der lumineszenten Intensität des in 10 dargestellten Lumineszenzbildes, in dem die Expression von cTnT im Prozess der Myokard-Differenzierung des aus den Maus-ES-Zellen erzeugten Embryoid Body mit Zeitverlauf beobachtet wird, und zeigt Ergebnisse von Analysen in Bezug auf die in 11 dargestellten Bereiche ROI1 bis ROI4.

13 zeigt ein Diagramm zur Darstellung eines Bereichs, in dem das Schlagen von Zellen durch ein Bildkorrelationsverfahren analysiert wird.

14 zeigt ein Diagramm zur Darstellung eines Ergebnisses einer mit dem Bildkorrelationsverfahren durchgeführten Analyse mit Hellfeld-Sequenzbildern 91 Stunden nach Beginn der Beobachtung.

15 zeigt ein Diagramm zur Darstellung von Hellfeld-Sequenzbildern, Bildern, in denen durch das Bildkorrelationsverfahren erhaltene Analyseergebnisse auf Luminesenzbildern überlagert sind, und Bildern zur Darstellung von Schlageintensitäten, wobei die Bilder 66 Stunden, 71 Stunden, 76 Stunden, 81 Stunden, 86 Stunden und 91 Stunden nach Beginn der Beobachtung aufgenommen sind.

16A zeigt ein Diagramm zur Darstellung eines Bildes, in dem ein durch das Bildkorrelationsverfahren erhaltenes Analyseergebnis auf einem Hellfeldbild von Zellen überlagert ist, und eines Bildes zur Darstellung der Schlagstärke 76 Stunden nach Beginn der Beobachtung.

16B zeigt ein Diagramm zur Darstellung, wie sich die Geschwindigkeit bei jedem Analysepunkt mit Zeitverlauf 76 Stunden nach Beginn der Beobachtung ändert.

16C zeigt ein Diagramm zur Darstellung des Geschwindigkeitsverhältnisses zwischen dem ersten Punkt P1 und dem zweiten Punkt P2 76 Stunden nach Beginn der Beobachtung.

16D zeigt ein Diagramm zur Darstellung des Geschwindigkeitsverhältnisses zwischen dem ersten Punkt P1 und dem dritten Punkt P3 76 Stunden nach Beginn der Beobachtung.

16E zeigt ein Diagramm zur Darstellung des Geschwindigkeitsverhältnisses zwischen dem zweiten Punkt P2 und dem dritten Punkt P3 76 Stunden nach Beginn der Beobachtung.

16F zeigt ein Diagramm zur Darstellung der Autokorrelation der Geschwindigkeit 76 Stunden nach Beginn der Beobachtung.

16G zeigt ein Diagramm zur Darstellung der Kreuzkorrelation der Geschwindigkeit 76 Stunden nach Beginn der Beobachtung.

17A zeigt ein Diagramm zur Darstellung eines Bildes, in dem ein durch das Bildkorrelationsverfahren erhaltenes Analyseergebnis auf einem Hellfeldbild von Zellen überlagert ist, und eines Bildes zur Darstellung der Schlagstärke 81 Stunden nach Beginn der Beobachtung.

17B zeigt ein Diagramm zur Darstellung, wie sich die Geschwindigkeit bei jedem Analysepunkt mit Zeitverlauf 81 Stunden nach Beginn der Beobachtung ändert.

17C zeigt ein Diagramm zur Darstellung des Geschwindigkeitsverhältnisses zwischen dem ersten Punkt P1 und dem zweiten Punkt P2 81 Stunden nach Beginn der Beobachtung.

17D zeigt ein Diagramm zur Darstellung des Geschwindigkeitsverhältnisses zwischen dem ersten Punkt P1 und dem dritten Punkt P3 81 Stunden nach Beginn der Beobachtung.

17E zeigt ein Diagramm zur Darstellung des Geschwindigkeitsverhältnisses zwischen dem zweiten Punkt P2 und dem dritten Punkt P3 81 Stunden nach Beginn der Beobachtung.

17F zeigt ein Diagramm zur Darstellung der Autokorrelation der Geschwindigkeit 81 Stunden nach Beginn der Beobachtung.

17G zeigt ein Diagramm zur Darstellung der Kreuzkorrelation der Geschwindigkeit 81 Stunden nach Beginn der Beobachtung.

18A zeigt ein Diagramm zur Darstellung eines Bildes, in dem ein durch das Bildkorrelationsverfahren erhaltenes Analyseergebnis auf einem Hellfeldbild von Zellen überlagert ist, und eines Bildes zur Darstellung der Schlagstärke 86 Stunden nach Beginn der Beobachtung.

18B zeigt ein Diagramm zur Darstellung, wie sich die Geschwindigkeit bei jedem Analysepunkt mit Zeitverlauf 86 Stunden nach Beginn der Beobachtung ändert.

18C zeigt ein Diagramm zur Darstellung des Geschwindigkeitsverhältnisses zwischen dem ersten Punkt P1 und dem zweiten Punkt P2 86 Stunden nach Beginn der Beobachtung.

18D zeigt ein Diagramm zur Darstellung des Geschwindigkeitsverhältnisses zwischen dem ersten Punkt P1 und dem dritten Punkt P3 86 Stunden nach Beginn der Beobachtung.

18E zeigt ein Diagramm zur Darstellung des Geschwindigkeitsverhältnisses zwischen dem zweiten Punkt P2 und dem dritten Punkt P3 86 Stunden nach Beginn der Beobachtung.

18F zeigt ein Diagramm zur Darstellung der Autokorrelation der Geschwindigkeit 86 Stunden nach Beginn der Beobachtung.

18G zeigt ein Diagramm zur Darstellung der Kreuzkorrelation der Geschwindigkeit 86 Stunden nach Beginn der Beobachtung.

19A zeigt ein Diagramm zur Darstellung eines Bildes, in dem ein durch das Bildkorrelationsverfahren erhaltenes Analyseergebnis auf einem Hellfeldbild von Zellen überlagert ist, und eines Bildes zur Darstellung der Schlagstärke 91 Stunden nach Beginn der Beobachtung.

19B zeigt ein Diagramm zur Darstellung, wie sich die Geschwindigkeit bei jedem Analysepunkt mit Zeitverlauf 91 Stunden nach Beginn der Beobachtung ändert.

19C zeigt ein Diagramm zur Darstellung des Geschwindigkeitsverhältnisses zwischen dem ersten Punkt P1 und dem zweiten Punkt P2 91 Stunden nach Beginn der Beobachtung.

19D zeigt ein Diagramm zur Darstellung des Geschwindigkeitsverhältnisses zwischen dem ersten Punkt P1 und dem dritten Punkt P3 91 Stunden nach Beginn der Beobachtung.

19E zeigt ein Diagramm zur Darstellung des Geschwindigkeitsverhältnisses zwischen dem zweiten Punkt P2 und dem dritten Punkt P3 91 Stunden nach Beginn der Beobachtung.

19F zeigt ein Diagramm zur Darstellung der Autokorrelation der Geschwindigkeit 91 Stunden nach Beginn der Beobachtung.

19G zeigt ein Diagramm zur Darstellung der Kreuzkorrelation der Geschwindigkeit 91 Stunden nach Beginn der Beobachtung.

20 zeigt ein Diagramm zur Darstellung des Verhältnisses zwischen verstrichener Zeit seit Beginn der Beobachtung und dem Determinationskoeffizienten.

21 zeigt ein Diagramm zur Darstellung des Verhältnisses zwischen verstrichener Zeit seit Beginn der Beobachtung und der Schlagstärke sowie der lumineszenten Intensität.

Beschreibung der Ausführungsformen

Nachfolgend ist eine Ausführungsform der vorliegenden Erfindung beschrieben. Die vorliegende Ausführungsform betrifft ein Verfahren zum überwachen der Differenzierung in Herzmuskelzellen. Eine Übersicht des Verfahrens gemäß der vorliegenden Ausführungsform ist in 1 dargestellt.

Wie in Schritt S1 dargestellt umfasst das vorliegende Verfahren das Einführen von Reporter-Genen aus lumineszentem Protein, das zum Ausstrahlen von Licht entsprechend der Expression von Myokard-Differenzierungsmarkergenen ausgebildet sind, in Zellen mit Potential zur Differenzierung in Herzmuskelzellen. Der Myokard-Differenzierungsmarker kann beispielsweise Gene bedeuten, die im Prozess der Myokard-Differenzierung ausgedrückt werden. Der Myokard-Differenzierungsmarker kann verschiedene Gene umfassen.

Das Verfahren gemäß der vorliegenden Ausführungsform umfasst das Markieren wenigstens einer Zelle mit Potential zur Differenzierung in Herzmuskelzellen mit luminszentem Protein, das Licht entsprechend der Expression von Myokard-Differenzierungsmarkergenen und/oder undifferenzierten Markergenen ausstrahlt. Das Verfahren gemäß der vorliegenden Ausführungsform kann ebenfalls das Verwenden von fluoreszierenden Protein wie grün fluoreszierendes Protein (GFP) umfassen. Das Verfahren gemäß der vorliegenden Ausführungsform kann zusätzlich die Analyse des Schlagens von Herzmuskelzellen, eine Calciumbildgebung zum Analysieren der Änderung von Calciumionen in den Herzmuskelzellen und das Messen eines Aktionspotentials des Herzmuskels umfassen. Schlagen bedeutet hier die regelmäßige Bewegung von Zellmasse, die erzeugt wird, wenn miteinander verbundene Zellmassen zusammenwirken, um Kontraktion und Entspannung zu wiederholen. Das Phänomen des Schlagens kann festgestellt werden, wenn sich die Position der einzelnen Zelle, die zu einer Zellmasse gehört, regelmäßig in einer vorgegebenen Kreisbahn bewegt. Mikroskopisch ist zu beobachten, dass sich die einzelne Zelle typischerweise auf einer vorgegebenen geraden Linie hin- und herbewegt. Das Phänomen des Schlagens kann klar von der Positionsänderung abweichend vom Schlagen zwischen zwei Punkten unterschieden werden: Die Zellen in der gleichen Zellmasse bewegen sich im gleichen Zeitraum; und einzelne Zellen bewegen sich in einer Richtung und Größe ähnlich denen der Zellen um diese herum.

Das Feststellen des Schlagens mit aufgenommenen Bildern erfordert Sequenzbilder (Videos), die der Reihe nach mit einer Bildfrequenz aufgenommen werden, die im Vergleich mit der für den Prozess der Kontraktion und Entspannung erforderlichen Zeit schnell genug ist. Die einzelne Zellposition in jedem Bild kann manuell oder durch verschiedene Bilderkennungsverfahren mit Bildern zu vorhergehenden und nachfolgenden Zeiten als Anhaltspunkte bestimmt werden. Das Schlagen kann ebenfalls durch Analysieren der Bewegung eines Hell-Dunkel-Musters eines Bildes gemäß einem Verfahren wie ein Lichtfluss- oder Bildkorrelationsverfahren ohne Spezifizieren der einzelnen Zellpositionen erkannt werden. Die Calciumbildgebung umfasst das Einführen von auf Calcium ansprechender Luciferase wie Obelin in Zellen und die Bildgebung der Calciumreaktion in den Zellen. Das Messen des Aktionspotentials des Herzmuskels besteht im Messen der Änderung des Potentials von Zellen während des Schlagens in einem Zustand, in dem eine Elektrode zur Potentialmessung in Kontakt mit den Zellen ist.

Die Zellen können von verschiedenen Organismen gewonnene Zellen sein. Die Zellen können beispielsweise von mehrzelligen Organismen gewonnene Zellen sein. Die Zellen können beispielsweise von Säugetieren wie einem Menschen oder einer Maus gewonnene Zellen sein. Die Zellen können gezüchtete Zellen sein. Die Zellen können eine Art von Zellen umfassen. Die Zellen können verschiedene Arten von Zellen umfassen.

Die Zellen können eine Schichtstruktur wie eine Zellschicht aufweisen. Die Zellen weisen ein Differenzierungspotential auf. Das heißt die Zellen sind undifferenzierte Zellen und weisen wenigstens das Potential zur Differenzierung in einen Herzmuskel auf. Die Zellen können beispielsweise Vorläuferzellen sein, die zu einem gewissen Grad differenziert sind, aber sich weiter in den Herzmuskel differenzieren können. Die Zellen können in der vorliegenden Ausführungsform mit der verstrichenen Zeit mit der Differenzierung fortschreiten. Die Zellen sind Zellen mit dem Potential zur Differenzierung in einen Herzmuskel zur Anfangsphase in der vorliegenden Ausführungsform. Die Zellen umfassen von Stammzellen wie embryonalen Stammzellen oder induzierten pluripotenten Stammzellen differenzierte Zellen. Die Zellen umfassen beispielsweise ES-Zellen oder iPS-Zellen.

Die Myokard-Differenzierungsmarkergene und/oder undifferenzierten Markergene sind beispielsweise Gene, die das Bestimmen des Zustands der Myokard-Differenzierung der Zellen aufgrund der Tatsache, ob diese Gene ausgedrückt sind oder nicht, ermöglichen. Diese Gene sind mit der Myokard-Differenzierung verknüpfte Gene und ihre Expression variiert vor Beginn der Differenzierung, bei Fortschritt der Differenzierung und/oder nach Abschluss der Differenzierung. Diese Markergene sind vorzugsweise in den Zielzellen inhärente Gene. Diese Markergene können homologe Gene eines Organismus sein, der sich vom Organismus unterscheidet, von dem die Zielzellen gewonnen werden. Beispielsweise können die Gene Markergene, die Funktionen entsprechend denen menschlicher Gene in den Mauszellen aufweisen, oder Markergene, die Funktionen entsprechend denen von Mausgenen in den menschlichen Zellen aufweisen, sein.

Die Myokard-Differenzierungsmarkergene sind beispielsweise Gene, die sich spezifisch in Herzmuskelzellen ausdrücken oder spezifisch ausdrücken, wenn die Zellen in Herzmuskelzellen differenzieren. Die Myokard-Differenzierungsmarker umfassen beispielsweise cTnT, GATA4 und NCX1. Die undifferenzierten Markergene sind beispielsweise Gene, die in einem Zustand ausgedrückt werden, in dem Stammzellen undifferenziert sind. Der undifferenzierte Marker umfasst undifferenzierte Markergene wie Nanog und Tcf3.

Die Myokard-Differenzierungsmarkergene und/oder undifferenzierten Markergene sind beispielsweise so beschaffen, dass die Expression von lumineszentem Protein entsprechend der Expression dieser Gene gefördert wird. Beispielsweise können in der Nukleinsäure von Zellen Gene aus lumineszentem Protein nach einer Transkriptionsfaktor-Bindungsstelle für diese Markergene angeordnet sein. In diesem Fall ist der Transkriptionsfaktor zum ursprünglichen Steuern der Expression der Markergene an diese Transkriptionsfaktor-Bindungsstelle gebunden, und die Expression der Gene aus lumineszentem Protein wird dadurch gefördert.

Das lumineszente Protein bedeutet ein Enzym, das eine chemische Reaktion katalysiert, die Licht erzeugt, ohne von optischer Energie resultierend aus Beleuchtungslicht abzuhängen, und das lumineszente Protein dient als Reporter-Gen, wenn es in bestimmten Genen in Zellen eingeführt wird. Ein Beispiel für das lumineszente Protein ist Luciferase. Luciferase katalysiert eine oxidative Reaktion von Luciferin, das ein Substrat darstellt, wenn ein ATP vorhanden ist. Zum Zeitpunkt dieser Reaktion strahlt Luciferin Licht aus.

Luciferase kann aus verschiedenen Organismen wie Glühwürmchen und Bakterien gewonnen werden. Luciferase kann beispielsweise Emerald-Luc-Luciferase, die grünes Licht erzeugt, CBR-Luciferase, die rotes Licht erzeugt, und Renilla-Luciferase, die blaues Licht erzeugt, sein. Die Gene dieser Luciferasen können handelsübliche Gene sein. Beispiele für handelsübliche Vektoren, die Luciferasegene enthalten, umfassen Emerald-Luc-Vektor (Toyobo), CBR-Vektor (Promega), Renilla-Vektor (Promega) und NanoLuc-Vektor (Promega).

Das Einführen der Reporter-Gene aus lumineszentem Protein, das zum Ausstrahlen von Licht entsprechend der Expression von Myokard-Differenzierungsmarkergenen ausgebildet ist, umfasst beispielsweise das Einführen von Nukleinsäure umfassend die Transkriptionsfaktor-Bindungsstelle der Markergene und ebenfalls umfassend die Gene des lumineszentem Protein, die nach dieser Stelle wie zuvor beschrieben angeordnet sind. Es kann mehr als ein Satz der Transkriptionsfaktor-Bindungsstelle der Markergene und des lumineszentem Protein verwendet werden. Wenn mehrere Sätze verwendet werden, können sich diese Sätze voneinander unterscheiden.

Wie in Schritt S2 dargestellt umfasst das Verfahren gemäß der vorliegenden Ausführungsform das Erhalten von Zellen am Leben und von den Zellen in einem Lichtabschirmungszustand, in dem Beleuchtungslicht und externes Licht abgeschirmt sind, ausgestrahltes Bildgebungslicht, wodurch ein Lumineszenzbild aufgenommen wird. Das heißt die Zellen werden nach dem Markieren am Leben erhalten. In diesem Zustand wird das Lumineszenzbild aufgenommen. Dass die Zellen am Leben erhalten werden, bedeutet beispielsweise, dass die Zellen nicht fixiert werden. Vorzugsweise werden die Zellen differenzierbar gehalten. Die Zellen werden ebenfalls zum undifferenzierten Zustand wiederherstellbar gemacht. Insbesondere werden Zellen in Kulturmedium gezüchtet, dem beispielsweise LIF, Dorsomorphin C oder Ciclosporin A hinzugefügt wird. Alternativ werden Zellen unter einer Bedingung gezüchtet, unter der die Differenzierung verhindert wird; beispielsweise werden sie in Kulturmedium gezüchtet, dem ein Differenzierungsinhibitor hinzugefügt wird. Die Aufnahmebedingungen des Lumineszenzbildes sind: Betrachten des unteren Grenzwerts der Variation der Expression von zu analysierenden Genen, Bildgebungsempfindlichkeit, bei der die Menge der durch eine Enzymreaktion von beispielsweise Luciferase als luminiszentes Protein erzeugten Bioluminszenz festgestellt werden kann; und eine relativ lange Belichtungszeit, die ein signifikantes Unterscheiden von Hintergrund entsprechend der Bildgebungsempfindlichkeit ermöglicht. Ferner wird zum Durchführen einer hochgradig quantitativen Analyse vorzugsweise ein Lumineszenzbildgebungs-System verwendet, um ein klares Lumineszenzbild in möglichst kurzer Zeit zu erhalten, so dass die Bildanalyse vereinfacht wird. Die Belichtungszeit zum Aufnehmen eines Lumineszenzbildes wird beispielsweise von 1 Minute bis 60 Minuten gewählt und ein Lumineszenzbild kann in einer Belichtungszeit von mehreren Sekunden bis einer Minute in einer genetischen Analyse mit einem hohen Expressionswert aufgenommen werden. Bei einer genetischen Analyse mit einem niedrigen Expressionswert und/oder einer geringen Variation des Expressionswerts kann ein Lumineszenzbild in einer Belichtungszeit von 30 bis 90 Minuten aufgenommen werden. Die Variation des Genexpressionswerts wird im Allgemeinen mit der Zeit über einen langen Zeitraum von mehreren Stunden bis mehreren Wochen verglichen, so dass beispielsweise auch in einer Belichtungszeit von 10 Minuten oder mehr aufgenommenes Standbild ein vergleichbares und zufriedenstellendes Analysebild liefert. Beim Binning ist 1×l (ohne Pixel-Shifting) vorzuziehen; die Pixel können aber in einem Pseudoverfahren beispielsweise um 2×2 oder 4×4 vergrößert werden.

Von der Biolumineszenz erfolgt eine Bildgebung mit Zeitverlauf und es kann mehr als ein Standbild aufgenommen werden. In der vorliegenden Ausführungsform wird ein durch Bildgebung von Biolumineszenz von wenigstens einer Zelle erzeugtes Bild als ein Lumineszenzbild bezeichnet. Das Lumineszenzbild umfassend einen von lumineszenten Zellen gewonnenen Bereich, in dem Lumineszenzsignale erkannt wurden, und einen von nicht-leuchtenden Zellen und Teilen ohne Zellen gewonnenen Bereich, in dem keine Lumineszenzsignale erkannt wurden. Daher kann Lumineszenz aus geschätzten Einheiten von einer Zelle oder einer Kolonie bestehen. Das Aufnehmen von mehr als einem Lumineszenzbild mit Zeitverlauf ermöglicht die Analyse einer Anomalität, bei der die Bewegung des Herzmuskels als Reaktion auf einen Stimulus beispielsweise eines Wirkstoffs oder einer Herzerkrankung variiert. Ein Multiwell-Behälter wie eine Mikrotiterplatte oder mehrere Schalen können zusammen verwendet werden, um Lumineszenzbilder für eine große Zahl von Proben aufzunehmen. Durch paralleles Durchführen von mehr als einer Beobachtung kann ein Einfluss von Zusatzstoffen wie einer chemischen Verbindung, einem Wachstumsfaktor oder siRNA sowie die Konzentrationsabhängigkeit des Zusatzstoffs verglichen und bewertet werden. Es kann ebenfalls die experimentelle Reproduzierbarkeit durch die Verwendung von mehr als einem Reaktionsbehälter berücksichtigt werden.

Die Bildgebung kann durch Verwendung einer Vorrichtung umfassend ein Filter, das hauptsächlich Licht mit einer bestimmten Wellenlänge entsprechend der Lumineszenz, eine Bildaufnahmevorrichtung, die das Licht in ein elektrisches Signal umwandelt, und Verarbeitungsmittel zum Erzeugen eines Lumineszenzbildes aus dem elektrischen Signal durchgeführt werden. Ein Beispiel für die Vorrichtung zum Aufnehmen eines Lumineszenzbildes ist ein Lumineszenzbildgebungs-System. Das Lumineszenzbildgebungs-System umfasst beispielsweise ein Biolumineszenzbildgebungs-System LV200 (hergestellt von der Olympus Corporation).

Wie in Schritt S3 dargestellt kann das Verfahren gemäß der vorliegenden Ausführungsform ferner das Aufnehmen eines Hellfeldbildes von Zellen umfassen. Das Hellfeldbild ist beispielsweise ein durch Bildgebungslicht erzeugtes Bild, wenn auf Stammzellen einstrahlendes Beleuchtungslicht von den Stammzellen reflektiert wird und/oder in die Stammzellen eindringt. Das heißt die Positionen und Formen von Stammzellen können ohne Berücksichtigung von Lumineszenz beobachtet werden. Das Hellfeldbild umfasst ein Phasenkontrastbild und ein Differentialinterferenz-Beobachtungsbild (DIC-Beobachtungsbild). Das Hellfeldbild kann im Wesentlichen mit der gleichen Zeitsteuerung wie bei der Aufnahme des Lumineszenzbildes aufgenommen werden. Alternativ kann das Hellfeldbild mit einer beliebigen Zeitsteuerung unabhängig von der Aufnahme des Lumineszenzbildes aufgenommen werden. Die Hellfeldbilder können Sequenzbilder in Form von Videos sein.

Wie in Schritt S4 dargestellt wird bestimmt, ob die Bildgebung wiederholt wird, und die Bildgebung kann mit Zeitverlauf durchgeführt werden. Das heißt die Bildgebung kann der Reihe nach in beliebigen Intervallen durchgeführt werden. Beispielsweise kann die Bildgebung in Abständen von 1 Minute bis zu 1 Stunde durchgeführt werden. Die Zeit von einer Bildgebung kann auf eine beliebige Zeit eingestellt werden. Die Zeit von einer Bildgebung kann so angepasst werden, dass ein zufriedenstellendes Lumineszenzsignal erkannt werden kann. Das Erhalten von Standbildern in vorgegebenen Zeitintervallen kann ebenfalls als Intervallbildgebung bezeichnet werden.

Wie in Schritt S5 dargestellt kann das Verfahren gemäß der vorliegenden Ausführungsform ebenfalls das Analysieren der Änderung in der Lumineszenzintensität nach Aufnehmen des Lumineszenzbildes umfassen, so dass der Zustand der Differenzierung von Zellen ermittelt werden kann. Das heißt die Änderung in der Lumineszenzintensität kann von mehr als einem Lumineszenzbild gelesen und in eine Darstellungsform gebracht werden, so dass der Differenzierungszustand identifiziert werden kann. Beispielsweise kann die Änderung in der Lumineszenzintensität optisch erkennbar dargestellt werden. Beispielsweise kann die Lumineszenzintensität an einem Messpunkt zusammen mit der Messzeit aufgezeichnet und als eine Tabelle angeordnet werden. Alternativ kann die Lumineszenzintensität an einem Messpunkt auf einer Ebene mit der verstrichenen Zeit und der Lumineszenzintensität geplottet werden und die Änderung der Lumineszenzintensität kann dadurch als ein Graph dargestellt werden.

Wenn die Änderung in der Lumineszenzintensität von mehr als einem Lumineszenzbild gelesen wird, kann diese Änderung Zelle für Zelle gelesen werden. Beispielsweise wird eine zu lesende Zelle in einem Lumineszenzbild gewählt und die gleiche Zelle wird anschließend ebenfalls von anderen Lumineszenzbildern gewählt, so dass die Änderung in der Lumineszenzintensität gelesen werden kann. Solch eine Wahl kann beispielsweise durch Verwendung eines Programms erfolgen, das auf einem Computer ausgeführt wird. In diesem Fall ist in einem Lumineszenzbild ein Bereich enthaltend die Zelle von einem Quadrat umgeben oder wird freihändig umrahmt, so dass ein interessierender Bereich festgelegt ist. Dieser interessierende Bereich wird ebenfalls in den anderen Bildern verfolgt. In Bezug auf den festgelegten Bereich wird die Lumineszenzintensität in einen numerischen Wert durch Verwendung des Programms auf dem Computer umgewandelt und aufgezeichnet. Es können in einem Lumineszenzbild mehrere interessierende Bereiche ausgewählt werden.

Wie in Schritt S6 dargestellt kann das Verfahren gemäß der vorliegenden Ausführungsform ebenfalls das Bestimmen des Zustands der Differenzierung von Zellen umfassen. Die Expression der Gene in einem oder mehreren ausgewählten Bereichen kann als Änderung in der Lumineszenzintensität analysiert werden. Die Lumineszenzintensitäten in den ausgewählten Bereichen können verglichen werden, um die Änderungen der Lumineszenzintensitäten Zelle für Zelle oder Bereich für Bereich zu vergleichen. Wenn die Expression von verschiedenen Genen analysiert wird, können die Lumineszenzintensitäten der entsprechenden Luciferasen durch Verwendung von beispielsweise sich in der Farbe unterscheidenden roten und grünen Luciferasen als Marker der entsprechenden Gene zum Erkennen des Unterschieds von Expressionswerten der entsprechenden Gene verglichen werden. Die Lumineszenzintensitäten von verschiedenen Luciferasen können mit Zeitverlauf beobachtet werden, um die Variation des Verhältnisses der entsprechenden Genexpressionen zu analysieren.

Das Verfahren gemäß der vorliegenden Ausführungsform kann das Bestimmen der Beziehung zwischen dem Zustand der Myokard-Differenzierung und dem Expressionswert der Myokard-Differenzierungsmarkergene und/oder der undifferenzierten Markergene aus Informationen in Bezug auf das Induzieren von Differenzierung in visualisierte Herzmuskelzellen umfassen. Bei diesem Verfahren kann ein Vergleichsausdruck zwischen dem Zustand der Differenzierung und dem Expressionswert der Markergene auf Basis der erhaltenen Informationen ermittelt werden. Ferner kann der Zustand der Differenzierung, in der ein bestimmter Expressionswert angezeigt wird, durch solch einen Vergleichsausdruck spezifiziert werden. Ein Hellfeldbild von Zellen kann zum Bestimmen des Zustands der Differenzierung von Zellen verwendet werden.

Gemäß der vorliegenden Ausführungsform können beispielsweise die folgenden vorteilhaften Wirkungen erzielt werden. Gemäß diesem Verfahren kann in lebenden Zellen die Genexpression in Stammzellen wie ES-Zellen und iPS-Zellen beobachtet werden. Die Zellen werden lebend beobachtet, so dass der Prozess der Genexpression zum Zeitpunkt der Differenzierung in Herzmuskelzellen beobachtet werden kann.

In diesem Fall kann eine hohe Quantitativität erzielt werden, da eine Beobachtung durch Verwendung einer Lumineszenzbildgebung durchgeführt wird. Es kann ebenfalls die Genexpression im Prozess der Differenzierung von Stammzellen in Herzmuskelzellen mit Zeitverlauf über einen langen Zeitraum beobachtet werden. Bei diesem Verfahren kann ein Zustand Zelle für Zelle ungeachtet der Variation des Zustands in der Zellgruppe durch Durchführen einer Beobachtung Zelle für Zelle visualisiert werden. Da eine Lumineszenzbeobachtung durchgeführt wird, kann eine quantitative Analyse auch in einer Probe mit starker Autofluoreszenz wie etwa einem Embryoid Body durchgeführt werden. Zellen können mit dem vorliegenden Verfahren längere Zeit mit weniger Schäden an Zellen genauer beobachtet werden als bei einer Beobachtung mit Fluoreszenz, die eine Phototoxizität aufgrund der Anwendung von Erregerlicht aufweist.

Mit dem vorliegenden Verfahren können mehr Informationen ermittelt werden, wenn die Genexpression beobachtet wird, als bei einer Analyse der Differenzierung in Herzmuskelzellen beispielsweise ausschließlich durch Beobachten des Schlagens.

Da bei diesem Verfahren ein Hellfeldbild zum Prüfen der Positionen von Zellen, die Licht ausstrahlen, aufgenommen wird, kann der Zustand von Zellen geprüft werden, der nicht ausschließlich mit einem Lumineszenzbild bestimmt werden kann. Beispielsweise kann geprüft werden, ob in einem zu beobachtenden Bereich Zellen vorhanden sind oder nicht. Es kann ebenfalls geprüft werden, ob die beobachteten Zellen beispielsweise am Leben oder tot sind.

Es kann ebenfalls geprüft werden, ob die Zellen im Stadium der Teilung sind. Zellen bewegen sich gegebenenfalls aufgrund der Differenzierung. Wenn sich eine Zelle in zwei Zellen teilt, kann die Menge von in einer Zelle enthaltenem lumineszentem Protein vorübergehend abnehmen; oder Zellen können, wenn sich eine Zelle in Höhenrichtung teilt, von einer Fokusposition verschoben werden und ein Lumineszenzsignal kann abgeschwächt werden. Das Bestimmen des Zustands von solchen Zellen nur mit dem Lumineszenzbild ist schwierig. Somit ist das Analysieren des Zustands der Differenzierung auf Basis des Hellfeldbildes wesentlich. Das Aufnehmen des Hellfeldbildes auf diese Weise verstärkt die Wirksamkeit des Lumineszenzbildes.

Bei diesem Verfahren werden von Stammzellen umfassend wenigstens embryonale Stammzellen (ES-Zellen) oder induzierte pluripotente Stammzellen (iPS-Zellen) differenzierte Zellen für die Beobachtung ins Visier genommen, so dass Informationen in Bezug auf die Differenzierung ermittelt werden können, die beispielsweise für die Anwendung beispielsweise in der regenerativen Medizin relevant sind.

Es kann beispielsweise jeder Differenzierungsprozess durch das Verwenden von mehreren Markern unterschieden werden. In diesem Fall ist der Freiheitsgrad für die Gestaltung eines experimentellen Systems größer, wenn Lumineszenz statt Fluoreszenz verwendet wird.

Gemäß der Analyse, die das vorliegende Verfahren umfasst, kann der Zustand der Differenzierung von Zellen genau bestimmt werden. Solche Informationen können die Erforschung des Mechanismus der Myokard-Differenzierung von Stammzellen und die Anwendung in der regenerativen Myokard-Medizin beschleunigen.

Beim vorliegenden Verfahren nimmt, wenn ferner die Analyse des Schlagens von Zellen, die Analyse der Calciumkonzentration und die Analyse des zellularen elektrischen Potentials enthalten sind, die zu ermittelnde Informationsmenge zu und es können mehr Informationen in Bezug auf die Differenzierung der Zellen in Herzmuskelzellen ermittelt werden.

Das vorliegende Verfahren umfasst das Aufnehmen von Hellfeld-Sequenzbildern als Videos und kann ferner das Analysieren von Bewegungen wie das Schlagen von Zellen auf Basis der Videos umfassen. Verfahren zum Analysieren der Bewegung eines Objekts auf der Basis eines Bildes sind allgemein bekannt. Verschiedene Verfahren für solche Bewegungsanalyse gehören zum Stand der Technik. Beispielsweise gehören ein Lichtfluss, der häufig auf dem Gebiet des maschinellen Sehens verwendet wird, und eine Korrelationsanalyse, die häufig bei der Analyse in der Hydrodynamik verwendet wird, zum Stand der Technik. Bei der Korrelationsanalyse wird eine Strömungsgeschwindigkeit eines Stoffs mit der Berechnung der Korrelationsfunktion eines Bildes ermittelt. Solch ein Verfahren wird als Bildkorrelationsverfahren bezeichnet.

Das Bildkorrelationsverfahren umfasst ein Verfahren zum Berechnen einer Autokorrelationsfunktion eines Doppelbelichtungsbildes in der gleichen Bildaufnahmevorrichtung und ein Verfahren zum Berechnen einer Kreuzkorrelationsfunktion von zwei zu verschiedenen Zeiten aufgenommenen Bildern. Da es durch die Verbesserung von Bildaufnahmevorrichtungen einfacher geworden ist, Bilder mit hoher Geschwindigkeit aufzunehmen, ist das Verfahren mit der Kreuzkorrelationsfunktion üblich.

Beispielsweise haben Weisman et al. die räumlich-zeitliche Bildkorrelation-Spektroskopie (Spatio-temporal Image Correlation Spectroscopy, STICS) zum Analysieren das Wandern von Gerüstprotein in Verbindung mit der Zellmigration entwickelt (B. Hebert et al. (2005), „Spatiotemporal image correlation spectroscopy (STICS) theory, verification, and application to protein velocity mapping in living CHO cells”, Biophys. 3. 88, 3601–3614.). Beispielsweise erfasst ein Bildkorrelationsverfahren wie STICS das Wandern von Schatten in einem Bild, so dass auch ein Bild von Zellen mit unscharfen Rändern für die Analyse in den Fokus genommen werden kann. Dies ist besonders beim Fokussieren auf Zellen oder anderem zur Analyse im Vergleich zu einer Analyse wie der Lichtfluss, der Merkmalspunkte verwendet, vorteilhaft.

Nachfolgend ist STICS kurz beschrieben. Das hier beschriebene STICS-Verfahren ist ein Beispiel für ein Bildkorrelationsverfahren und kann entsprechend abgeändert werden; es kann aber auch ein anderes Verfahren umfassend eine Verarbeitung zum Ermitteln der Korrelation zwischen Bildern verwendet werden. Für den Zweck der Erläuterung werden die Raumkoordinaten x und y und die Zeitkoordinate t von Sequenzbildern als Ganzzahlen behandelt. Die tatsächliche Position der Probe und die tatsächliche Belichtungszeit können einfach durch Multiplizieren der Raumkoordinaten x und y und der Zeitkoordinate t mit Proportionalitätskoeffizienten, die mit der optischen Verstärkung und den Belichtungsintervallen bestimmt werden, ermittelt werden. Das hier beschriebene Analyseobjekt ist zwar ein zweidimensionales Bild; als Analyseobjekt kann aber problemlos ein dreidimensionales Bild mit volumetrischen Informationen verwendet werden.

Es erfolgt eine Bildgebung der Probe in vorgegebenen Zeitintervallen mit einer Bildgröße von M×M Pixel, um N Sequenzbilder als Videos aufzunehmen. Es wird eine Bildkorrelationsberechnung in Bezug auf ein Paar von Bildern mit den Zeitintervallen τ, ausgewählt aus den N Sequenzbildern, durchgeführt. Es werden Bildkorrelationsberechnungen in Bezug auf (N–τ) Paare von Bildern, ausgewählt aus den N Sequenzbildern, durchgeführt. Ein gemitteltes Korrelationsbild, das ein Mittel von (N–τ) Korrelationsbildern ist, die durch die Bildkorrelationsberechnungen ermittelt werden, wird anschließend ermittelt. Das gemittelte Korrelationsbild kann durch Hinzufügen von Bilddaten an einer entsprechenden Pixelposition in jedem Korrelationsbild und Ermitteln eines Mittelwerts ermittelt werden.

Die zuvor beschriebene Verarbeitung ist durch einen numerischen Ausdruck wie folgt dargestellt. Eine Mittelbildkorrelation ist durch den Ausdruck (1) dargestellt:

Dabei ist I(x, y; t) die Signalintensität eines Bildes an den Koordinaten (x, y) mit einer Aufnahme zur Zeit t.

Hier ist δI(x, y; t) ein Fluktuationswert der Signalintensität, der durch den Ausdruck (2) dargestellt ist: δI(x, y; t) = I(x, y; t) – 〈I(x, y; t)〉.(2)

<I(x, y; t)> in Ausdruck (1) und Ausdruck (2) weist auf die Mittlung von Bilddaten über x und y des Bildes mit einer Größe von M×M Pixel hin. Das heißt <F(x, y; t)> ist als eine Funktion F von x, y; t definiert, wie durch den Ausdruck (3) dargestellt:

Wenn die periodische Grenzbedingung in Bezug auf x und y erfüllt ist, das heißt wenn F(x + nM, y + mM; t) = F(x, y; t) in Bezug auf die Ganzzahlen n und m erfüllt ist, kann die Kreuzkorrelationsfunktion, die im Zähler von Ausdruck (1) beschrieben ist, schnell durch Verwenden einer Fourier-Transformation berechnet werden.

Um das Wandern einer Genexpressionsverteilung in der Probe mit Zeitverlauf genau erfassen zu können, können unbewegliche Komponenten in einem zu analysierenden Zeitabschnitt oder langsame Komponenten vorab entfernt werden. Wie in einem von B. Hebert et al. (2005) beschriebenen Entfernungsverfahren können niederfrequente Komponenten von Signalintensitätsänderungen an jeder Koordinate entfernt werden. Es können ortsfeste Komponenten entfernt werden. Das heißt es kann eine Migrationskomponente Imov durch Ausdruck (4) berechnet werden und Imov kann statt I(x, y; t) in Ausdruck (1) verwendet werden.

Nachfolgend ist ein Analyseverfahren mit dem gemittelten Korrelationsbild beschrieben. Wenn sich ein Verteilungsbild in den Sequenzbildern in einer bestimmten Richtung mit Zeitverlauf bewegt, stellt ein durch das zuvor beschriebene Verfahren gemitteltes Korrelationsbild R(ξ, η, τ) ein Verteilungsbild dar, dessen Maximumwert an einer Position nicht in der Mitte des Bildes angeordnet ist. Ein Verfahren zum Bestimmen der Position dieses Maximumwerts ist die Annahme einer gaußschen Verteilung, das heißt der Maximumwert wird durch gaußsches Anpassen an ein Kreuzkorrelationsbild bestimmt.

Das heißt eine durch Ausdruck (5) dargestellte gaußsche Funktion wird auf das gemittelte Korrelationsbild durch eine Methode der kleinsten Quadrate mit A, β, ρ, q und C als variable Parameter angewendet. F(x, y) = Aexp⌊–β{(x – p)2 + (y – q)2}⌋ + C.(5)

Die durch die Anwendung ermittelten Parameter ρ and q sind Maximumpositionen (pτ, qτ) des gemittelten Korrelationsbildes in den Zeitintervallen τ. Somit werden die Maximumpositionen (pτ, qτ) des gemittelten Korrelationsbildes für jede Verzögerungszeit τ (= 1 bis N – 1) bestimmt.

Eine Wanderungsgeschwindigkeit (vx, vy) der Verteilung im Bild wird als ein Proportionalitätskoeffizient vx, vy der durch den Ausdruck (6) dargestellten Maximumpositionen und der Verzögerungszeit dargestellt.

Zum statistischen Ableiten genauer Werte für vx und vy können die Proportionalitätskoeffizienten vx und vy durch eine Regressionsanalyse mit der Methode der kleinsten Quadrate o. Ä. berechnet werden.

Wenn die zuvor beschriebene Analyse am Bild in einem Teilbereich von m×m Pixel durchgeführt wird, der im Gesamtbild von M×M Pixel enthalten ist, kann eine lokale Wanderungsgeschwindigkeit in diesem Teilbereich abgeleitet werden. Das heißt es wird eine Bildkorrelation für einen Teilbereich Ai berechnet, in dem x sich im Bereich von xi bis xi + m – 1 befindet und in dem sich y im Bereich von yi bis yi + m – 1 befindet, und es kann eine Wanderungsgeschwindigkeit für diesen Teilbereich bestimmt werden. Eine Verteilung von Wanderungsgeschwindigkeiten kann durch Erfassen von lokalen Wanderungsgeschwindigkeiten für eine große Zahl von Teilbildern ermittelt werden.

Eine Wanderungsgeschwindigkeit zum Zeitpunkt t kann durch Verwenden eines Zeitabschnitts umfassend die neuesten n Bilder in Bezug auf die Zeit t von Bildern, die zu verschiedenen Belichtungszeiten aufgenommen wurden, und Durchführen der zuvor beschriebenen Analyse abgeleitet werden. Das heißt die Bildkreuzkorrelation wird für Bilder berechnet, in denen t im Bereich von ti bis ti + n – 1 liegt, und kann beispielsweise als eine Wanderungsgeschwindigkeit zu einer medianen Zeit dieses Zeitabschnitts t = ti + (n – 1)/2 bestimmt werden. Durch Bestimmen einer Wanderungsgeschwindigkeit unter Verwendung dieses Zeitabschnitts, der kontinuierlich oder diskontinuierlich verschoben wird, können Änderungen der Wanderungsgeschwindigkeit festgestellt werden und es kann die zeitabhängige Änderung der Wanderungsgeschwindigkeit analysiert werden.

Durch Anzeigen der durch das zuvor beschriebene Analyseverfahren ermittelten Wanderungsgeschwindigkeit auf einem Bildschirm kann das Ergebnis visualisiert werden und ein Benutzer kann optisch das Ergebnis nachvollziehen. Ein mögliches Anzeigeverfahren ist beispielsweise das Anzeigen eines Werts zur Darstellung eines Geschwindigkeitsvektors über die Sequenzbilder. Der Wert zur Darstellung des Geschwindigkeitsvektors umfasst einen Pfeil, der eine Länge proportional zur Höhe der Wanderungsgeschwindigkeit und eine Spitze zum Anzeigen der Richtung des Vektors aufweist. Die Farbe des Pfeils kann entsprechend der Höhe der Geschwindigkeit angezeigt werden.

Wenn eine Analyse im Teilbereich im Bild durchgeführt und die Wanderungsgeschwindigkeit einer lokalen Genexpressionsverteilung analysiert wird, kann eine Geschwindigkeitsverteilung durch Anzeigen eines Vektors in der Mitte von jedem Teilbereich visualisiert werden. Wenn eine Analyse mit Zeitverlauf durchgeführt wird, wie sich die Wanderungsgeschwindigkeit im Laufe der Zeit ändert, kann eine Visualisierung durch Anzeigen des Geschwindigkeitsvektors zur Zeit t über einem Bild zur Zeit t erfolgen.

Durch Durchführen der zuvor beschriebenen Bewegungsanalyse kann das Schlagen von Zellen, die sich in einen Herzmuskel differenziert haben, analysiert werden. Das heißt es kann entsprechend dieser Bewegungsanalyse die funktionale Expression von Zellen analysiert werden. Im vorliegenden Verfahren können ein Lumineszenzbild und Hellfeldsequenzbilder (die Videos sind) für die gleiche Probe zum gleichen Zeitpunkt aufgenommen werden. Hier bedeutet die gleiche Zeit nicht genau die gleiche Zeit in physikalischer Hinsicht, sondern die gleiche Zeit in biologischer Hinsicht, das heißt der gleiche Zeitraum, der als die gleiche Zeit betrachtet werden kann, wenn ein Unterschied von mehreren Minuten besteht.

Da das Lumineszenzbild und die Hellfeld-Sequenzbilder (die Videos sind) für die gleiche Probe zur gleichen Zeit aufgenommen werden können, kann die Differenzierung von Stammzellen in Herzmuskelzellen detailliert in Bezug auf Genexpression und funktionaler Expression analysiert werden.

Hier ist zwar STICS beschrieben; aber es können neben STICS verschiedene Bildkorrelationsverfahren verwendet werden, und es können verschiedene Bewegungsanalyseverfahren wie der Lichtfluss ebenfalls verwendet werden.

Ein Verfahren zum Analysieren der Funktion des Herzmuskels besteht beispielsweise im Messen des zellularen elektrischen Potentials durch die Verwendung von Mehrfachelektrodenanordnungen. Solch ein Verfahren zum Messen des Potentials umfasst aber lediglich eine lokale Messung in Teilen, an denen Elektroden vorhanden sind, und ermöglicht kein Ermitteln von Informationen in Bezug auf den schlagenden Teil der Zellgruppe. Jedoch können gemäß dem Analyseverfahren mit dem Hellfeldbild biologische Informationen wie die Wanderungsmengen der Positionen von Zellen und die Geschwindigkeit des Schlagens in Bezug auf alle Zellen in einem Beobachtungssichtfeld ermittelt werden. Um das Bild eines schlagenden Herzens der Reihe nach analysieren zu können, müssen ein Sequenzbild-Analyseprozess umfassend einen Sequenzbild-Aufnahmeprozess zur Bildgebung mit einer Belichtungszeit, die schneller ist als die obere Grenze der Bewegungsgeschwindigkeit des Herzmuskels, als ein Ziel, und ein Bildberechnungsprozess zum Vergleichen der erhaltenen Sequenzbilder mit Zeitverlauf zum Berechnen der Wanderungsgeschwindigkeit von jedem Bild durchgeführt werden. Eine Bildaufnahmevorrichtung und Bildverarbeitungssoftware zum Durchführen dieses Sequenzbild-Analyseprozesses sind allgemein erhältlich. Beispielsweise kann AQUACOSMOS von Hamamatsu Photonics als Bildverarbeitungssoftware verwendet werden. Die Arten von aufzunehmenden Bildern zum Durchführen des Sequenzbild-Aufnahmeprozesses umfassen ein Übertragungsbild als ein Hellfeldbild resultierend aus Beleuchtungslicht wie einem Laser, ein Reflexionsbild, ein Phasenkontrastbild und ein Differentialinterferenzbild. Statt dem Hellfeldbild kann ein durch die Anwendung von Erregerlicht erhaltenes Fluoreszenzbild einer Sequenzbildanalyse unterzogen werden oder das Hellfeldbild und das Fluoreszenzbild können zusammen verwendet werden, um die schnellen biologischen Analysegegenstände zu vermehren. Vorzugsweise werden die Bildgebungszeit und die Bildgebungsintervalle als Belichtungsbedingungen von Videos im Sequenzbild-Aufnahmeprozess beispielsweise aus einem Bereich von 10 bis 800 ms ausgewählt und wird das Schlagen des Herzmuskels beispielsweise auf einen Bereich von 100 bis 200 ms eingestellt. Die vorliegende Erfindung ist nicht auf die mit der Reproduktion des Herzmuskels verbundene genetische Analyse beschränkt, sondern ist ebenfalls auf die genetische Analyse von Erkrankungen (beispielsweise Myokard-Infarkt), die mit Störungen des Herzschlags verbunden sind, anwendbar.

Somit ist die vorliegende Erfindung gegebenenfalls das erste Verfahren, das Sequenzbilder und ein Standbild von der gleichen Zelle oder einem Objekt umfassend das Bild dieser Zelle aufnimmt, Teile von Informationen, die aus beiden Bildern ermittelt werden, verknüpft und dadurch die Beziehung zwischen einer funktionalen Analyse des sich schnell bewegenden Herzmuskels und des langsam variierenden Genexpressionswerts deutlich macht.

Eine Übersicht eines Systems, das gleichzeitig eine Analyse der Genexpression auf der Basis eines Lumineszenzbildes und eine Analyse der funktionalen Expression auf der Basis von Videos, die Hellfeldbilder wie zuvor beschrieben sind, ist in 2 dargestellt. Wie in 2 dargestellt umfasst dieses Analysesystem 1 ein in einem Gehäuse (nicht dargestellt) angeordnetes Mikroskop 10 in einem Lichtabschirmungszustand, eine Rechnereinheit 20 wie ein Personalcomputer, die verschiedene Berechnungen durchführen kann, und eine Eingabeeinheit 29 wie eine Tastatur oder eine Maus zum Eingeben eines Befehls durch den Benutzer an der Rechnereinheit 20.

Ein optisches System 12, eine Lichtquelle 14 und eine Bildgebungsvorrichtung 16 sind im Mikroskop 10 angeordnet. Das optische System 12 umfasst mehrere Linsen und Spiegel. Die Lichtquelle 14 strahlt ein vorgegebenes Beleuchtungslicht (beispielsweise weißes Licht) aus, das zum Aufnehmen von Hellfeldbildern erforderlich ist, und das von dieser Lichtquelle 14 ausgestrahlte Licht wird auf eine Probe 50 wie Stammzellen über das optische System 12 angewendet. Diese Probe 50 befindet sich in einer Zuchtkammer, so dass die Zellen vorzugsweise in einer vorgegebenen Zuchtumgebung leben können. Die Bildgebungsvorrichtung 16 umfasst eine Bildaufnahmevorrichtung wie einen CCD-Bildsensor und erzeugt ein Bildsignal in Bezug auf ein mikroskopisches Bild der Probe 50 über das optische System 12.

Die Rechnereinheit 20 umfasst eine Belichtungssteuereinheit 21, eine Bildaufnahmeeinheit 22, eine Lichtquellen-Steuereinheit 23, eine Steuereinheit des optischen Systems 24, eine Standbild-Analyseeinheit 25, eine Videoanalyseeinheit 26 und eine Aufzeichnungseinheit 27. Die Belichtungssteuereinheit 21 steuert den Betrieb der Bildgebungsvorrichtung 16. Die Bildaufnahmeeinheit 22 nimmt das Bild von der Bildgebungsvorrichtung 16 auf und führt unter anderem die erforderliche Bildkonvertierung durch.

Die Lichtquellen-Steuereinheit 23 steuert den Betrieb der Lichtquelle 14. Die Steuereinheit des optischen Systems 24 steuert das optische System 12. Wenn beispielsweise ein Hellfeldbild aufgenommen wird, wird das von der Lichtquelle 14 ausgestrahlte Beleuchtungslicht über das optische System 12 auf die Probe 50 angewendet. Zusätzlich wird die Belichtungszeit entsprechend verkürzt, wenn ein Hellfeldbild aufgenommen wird. Wenn hingegen ein Lumineszenzbild aufgenommen werden soll, wird das von der Lichtquelle 14 ausgestrahlte Beleuchtungslicht abgeschirmt und die Probe 50 wird nicht beleuchtet. Zusätzlich wird eine relativ lange Belichtungszeit eingestellt, wenn ein Lumineszenzbild aufgenommen werden soll.

Die Standbild-Analyseeinheit 25 analysiert ein Standbild wie etwa ein Lumineszenzbild. Die Videoanalyseeinheit 26 führt eine Analyse wie die zuvor genannte Bewegungsanalyse durch. Die Aufzeichnungseinheit 27 zeichnet beispielsweise Analyseergebnisse des Lumineszenzbildes, der Videos und des Standbildes sowie Ergebnisse der Bewegungsanalyse auf.

Gemäß dem zuvor beschrieben Analysesystem 1 können das Lumineszenzbild und die Hellfeldsequenzbilder, die Videos für die gleiche Probe zum gleichen Zeitpunkt wie zuvor beschrieben sind, aufgenommen werden. Ferner kann die Differenzierung von Stammzellen in Herzmuskelzellen detailliert in Bezug auf die Genexpression und die Funktionsexpression auf Basis der aufgenommenen Bilder analysiert werden.

Diese analytische System kann vorteilhafterweise im zuvor genannten Biolumineszenz-Bildgebungssystem LV200 erzielt werden.

Beispiele[Beispiel 1: Untersuchen des Einflusses der Autofluoreszenz in einem von Stammzellen gewonnenen Embryoid Body]

Maus-ES-Zellen wurden verwendet, um den Grad des Einflusses der Autofluoreszenz zu untersuchen, wenn Erregerlicht für die Erregung des fluoreszierenden Proteins auf einen von Stammzellen gewonnenen Embryoid Body angewendet wurde.

(1) Züchten von Maus-ES-Zellen

Für das Züchten der Maus-ES-Zellen (BRC6, Riken BRC) wurde ein KO-DMEM-Kulturmedium (enthaltend 15% FBS, Penicillin-Streptomycin (100-fach SIGMA-verdünnt), NEAA (100-fach SIGMA-verdünnt), L-Glutamin (Endkonzentration: 2 mM) und 2-Mercaptoethanol (Endkonzentration: 0,1 mM)) verwendet. Die Maus-ES-Zellen wurden auf einem Maus-Embryon-Fibroblast (MEF-Zellen) gezüchtet, dessen Teilung durch eine Mitomycin-C-Behandlung unterbrochen wurde.

(2) Bilden des Embryoid Body von Maus-ES-Zellen

Die gezüchteten Maus-ES-Zellen wurden mit PBS gewaschen, durch 0,25% Trypsin-EDTA abgelöst und anschließend 4 Stunden lang in einem Brutapparat bei 37°C mit dem KO-DMEM-Kulturmedium gebrütet. Fütterzellen (MEF) wurden angehaftet, so dass nur die Maus-ES-Zellen schwammen. Das die Maus-ES-Zellen enthaltende Kulturmedium wurde zentrifugiert, um die Zellen zu sammeln, und die Zellen wurden erneut in 1 ml KO-DMEM-Kulturmedium oder IMDM-Kulturmedium (enthaltend 15 FBS, Penicillin-Streptomycin (100-fach SIGMA-verdünnt), NEAA (100-fach SIGMA-verdünnt) und 2-Mercaptoethanol (Endkonzentration: 0,1 mM)) suspendiert. Die Zahl der Zellen in der Lösung wurde mit einem Zellzählgerät gezählt und es wurde eine Zellsuspension hinzugefügt, so dass die Zahl der Zellen in jedem Schacht mit Lipidure-Coat-Kulturmedium (96-Schacht-Rundboden; NOF Cooperation), dem das IMDM-Kulturmedium hinzugefügt wurde, 2500 oder 5000 betrug. Die Zellen wurden 3 bis 7 Tage lang bei 37°C angezüchtet, um einen Embryoid Body zu bilden.

(3) Untersuchen des Einflusses der Autofluoreszenz von Maus-ES-Zellen

Der gebildete Embryoid Body wurde in eine mit Gelatine beschichtete 35-mm-Schale verbracht und über Nacht bei 37°C gebrütet, so dass der Embryoid Body auf der Schalenoberfläche haftete. Anschließend wurde Erregerlicht unter Verwendung eines EGFP-Filters (460–80 nm, 495–540 nm) angewendet, um den Grad des Einflusses von Autofluoreszenz durch die Verwendung eines umgekehrten Fluoreszenzmikroskops 1X70 und einer Mikroskop-Digitalkamera DP70 (hergestellt von der Olympus Corporation) zu beobachten.

3 und 4 zeigen ein Hellfeldbild und ein Fluoresenzbild, wenn EGFP-Erregerlicht auf die Maus-ES-Zellen angewendet wird. Aus 3 und 4 ging hervor, dass der aus Stammzellen erzeugte Embryoid Body eine starke Autofluoreszenz aufwies. Dies zeigte in einer Fluoreszenzbeobachtung, dass Autofluoreszenz einen großen Einfluss hatte und eine quantitative Analyse schwierig war.

[Beispiel 2: Expressionsanalyse des herzmuskelspezifischen Markers im herzmuskelinduzierenden Prozess von ES-Zellen und iPS-Zellen]

Herztroponin T (cTnT) ist ein Protein, das sich spezifisch im Herzmuskel ausdrückt. cTnT wird als Markergen für die Myokard-Differenzierung verwendet. Die Expression dieser cTnT-Gene wurde als ein Index zum Untersuchen verwendet, ob der die Myokard-Differenzierung von ES-Zellen und iPS-Zellen induzierende Prozess visualisiert werden kann.

[Beispiel 2-1: Analyse der cTnT-Expression im Myokard-Differenzierungsprozess von Maus-ES-Zellen](1) Herstellen von Maus-ES-Zellen, in die Nukleinsäure einschließlich der Promoterregion von cTnT-Genen und Luciferase-Genen eingeführt wurde

Eine Promoterregion für cTnT-Gene wurde gemäß der Nicht-Patentliteratur „Jin et al., Biochemical and Biophysical Research Communications 1995 Vol. 214, Nr. 3, S. 1168 bis 1174” geklont und die Promoterregion wurde erfasst. In diesem Fall wurde Maus-Genom-DNA als eine Schablone verwendet. Es wurden die folgenden zwei Primer verwendet.
Forward Primer 1: GCCTCGAGTCTAGACTGAGATACAATGCAAAAGCTGG
(Folgenummer 1)

Reverse Primer 1: GCAGATCTGGTTGAGGGCAGGGCATGGGGAGAGC
(Folgenummer 2).

Die erfasste Promoter-Sequenz für cTnT-Gene wurde in einen neomyzin-resistenten pGL4.17-Luciferase-Reporter-Vektor (Promega) eingeführt, um einen „für die cTnT-Genexpression spezifischen lumineszenten Vektor pcTnT-GL4” zu erzeugen.

Zum Züchten von Maus-ES-Zellen wurde KO-DMEM-Kulturmedium verwendet (BRC6, Riken BRC), in das der Vektor eingeführt wurde. Diese ES-Zellen wurden auf MEF-Zellen gezüchtet, deren Teilung durch eine Mitomycin-C-Behandlung unterbrochen wurde.

Ein Nukleofektionsverfahren durch den Amaxa Nucleofector (Wako Pure Chemical Industries) wurde verwendet, um den pcTnT-GL4-Genexpressions-Vektor in die Maus-ES-Zellen zu transfizieren. Die transfizierten Zellen wurden über Nacht im KO-DMEM-Kulturmedium zusammen mit gegen Neomycin resistenten Fütterzellen gezüchtet und das Kulturmedium wurde durch ein KO-DMEM-Kulturmedium ausgetauscht, dem ein antibiotisches G418 (Invitrogen) bis zu einer Endkonzentration von 250 μg/ml hinzugefügt wurde, wodurch eine selektive Züchtung erfolgte. Auf diese Weise wurde eine sich stabil ausdrückende Zelllinie erfasst. Diese Zellen sind nachfolgend als cTnT-GL4-Expressions-Maus-ES-Zellen bezeichnet.

(2) Bilden des Embryoid Body von cTnT-GL4-Expressions-Maus-ES-Zellen

Die gezüchteten cTnT-GL4-Expressions-Maus-ES-Zellen wurden mit PBS gewaschen, durch 0,25% Trypsin-EDTA abgelöst und anschließend 4 Stunden lang in einem Brutapparat bei 37°C mit dem KO-DMEM-Kulturmedium gebrütet. Fütterzellen (MEF) wurden angehaftet, so dass nur die Maus-ES-Zellen schwammen. Das Kulturmedium enthaltend die Maus-ES-Zellen wurde zentrifugiert, um die Zellen zu sammeln, und die Zellen wurden erneut in 1 ml KO-DMEM-Kulturmedium oder IMDM-Kulturmedium suspendiert. Die Zahl der Zellen in der Lösung wurde mit einem Zellzählgerät gemessen und es wurde eine Zellsuspension hinzugefügt, so dass die Zahl der Zellen in jedem Schacht mit Lipidure-Coat-Kulturmedium (96-Schacht-Rundboden; NOF Cooperation), dem das IMDM-Kulturmedium hinzugefügt wurde, 2500 oder 5000 betrug. Die Zellen wurden 3 bis 7 Tage lang bei 37°C angezüchtet, um Embryoid Bodies zu bilden.

(3) Induzieren der Myokard-Differenzierung von cTnT-GL4-Expressions-Maus-ES-Zellen

Der gebildete Embryoid Body wurde in eine mit Gelatine beschichtete 35-mm-Schale verbracht und über Nacht bei 37°C gebrütet, so dass der Embryoid Body auf der Schalenoberfläche haftete. Der Embryoid Body wurde 5 bis 14 Tage lang bei 37°C gezüchtet, um seine Differenzierung in schlagende Herzmuskelzellen zu induzieren.

(4) Beobachtung und Analyse der cTnT-GL4-Expressions-Maus-ES-Zellen

D-Luciferin (hergestellt von Wako Pure Chemical Industries) wurde zu einer Endkonzentration von 1 mM zum Embryoid Body der cTnT-GL4-Expressions-Maus-ES-Zellen hinzugefügt, die bei 37°C gezüchtet wurden und teilweise einen schlagenden Herzmuskel zeigten. Die Zellen wurden in einem Lichtabschirmungszustand unter Verwendung des Biolumineszenzmikroskops LV200 (hergestellt von der Olympus Corporation), ausgestattet mit AQUACOSMOS (Hamamatsu Photonics Corporation), einer Analysesoftware zum Analysieren von schlagenden Zellen, beobachtet und es wurde ein Lumineszenzbild aufgenommen.

Die Expression von cTnT-Genen wurde unter den folgenden Belichtungsbedingungen beobachtet. Eine CCD-Kamera des Typs ImagEM (hergestellt von der Hamamatsu Photonics Corporation) wurde unter einer Bedingung eines 1×1-Binning verwendet. Die cTnT-GL4-Expressions-Maus-ES-Zellen wurden für eine Belichtungszeit von 15 Minuten einer Bildgebung unterzogen.

Ein Hellfeldbild der in schlagende Herzmuskelzellen differenzierten cTnT-GL4-Expressions-Maus-ES-Zellen ist in 5 dargestellt, und ein Lumineszenz-Beobachtungsbild der gleichen Zellen ist in 6 dargestellt. Wie in 5 und 6 dargestellt wurde in den schlagenden Herzmuskelzellen Lumineszenz nachgewiesen. Das heißt die Expression von cTnT konnte durch Lumineszenz beobachtet werden.

Obwohl die sich stabil ausdrückende Zelllinie, in der Wirkstoffresistenzgene für eine Wirkstoffselektion eingeführt wurden, in Beispiel 2-1 verwendet wird, können ebenfalls Übergangsexpressionszellen verwendet werden. Dies kann ebenfalls auf die folgenden Beispiele angewendet werden:

[Beispiel 2-2: Analyse der cTnT-Expression im Myokard-Differenzierungsprozess von Maus-iPS-Zellen](1) Herstellen von Maus-iPS-Zellen, in die Nukleinsäure enthaltend die Promoterregion von cTnT-Genen und Luciferase-Genen eingeführt wurde

Eine Promoterregion für cTnT-Gene wurde gemäß der Nicht-Patentliteratur „Jin et al., Biochemical and Biophysical Research Communications 1995 Vol. 214, Nr. 3, S. 1163 bis 1174” geklont und die Promoterregion wurde erfasst. In diesem Fall wurde Maus-Genom-DNA als eine Schablone verwendet. Als Primer wurden wie zuvor erwähnt Forward Primer 1 und Reverse Primer 1 verwendet.

Die erfasste Promoter-Sequenz für cTnT-Gene wurde in einen neomyzin-resistenten pGL4.17-Luciferase-Reporter-Vektor (Promega) eingeführt, um einen „für die cTnT-Genexpression spezifischen lumineszenten Vektor pcTnT-GL4” zu erzeugen.

Zum Züchten von Maus-iPS-Zellen wurde KO-DMEM-Kulturmedium verwendet (iPS-MEF-Ng-20D-17, Universität Kyoto), in das der Vektor eingeführt wurde. Diese iPS-Zellen wurden auf MEF-Zellen gezüchtet, deren Teilung durch eine Mitomycin-C-Behandlung unterbrochen wurde.

Ein Nukleofektionsverfahren durch den Amaxa Nucleofector (Wako Pure Chemical Industries) wurde verwendet, um den pcTnT-GL4-Genexpressions-Vektor die die Maus-iPS-Zellen zu transfizieren. Die transfizierten Zellen wurden über Nacht im KO-DMEM-Kulturmedium zusammen mit gegen Neomycin resistenten Fütterzellen gezüchtet und das Kulturmedium wurde durch ein KO-DMEM-Kulturmedium ausgetauscht, dem das antibiotische G418 (Invitrogen) bis zu einer Endkonzentration von 250 μg/ml hinzugefügt wurde, wodurch eine selektive Züchtung erfolgte. Auf diese Weise wurde eine sich stabil ausdrückende Zelllinie erfasst. Diese Zellen sind nachfolgend als cTnT-GL4-Expressions-Maus-iPS-Zellen bezeichnet.

(2) Bilden des Embryoid Body von cTnT-GL4-Expressions-Maus-iPS-Zellen

Die gezüchteten cTnT-GL4-Expressions-Maus-iPS-Zellen wurden mit PBS gewaschen, durch 0,25% Trypsin-EDTA abgelöst und anschließend 4 Stunden lang in einem Brutapparat bei 37°C mit dem KO-DMEM-Kulturmedium gebrütet. Fütterzellen (MEF) wurden angehaftet, so dass nur die Maus-iPS-Zellen schwammen. Das Kulturmedium enthaltend die Maus-iPS-Zellen wurde zentrifugiert, um die Zellen zu sammeln, und die Zellen wurden erneut in 1 ml KO-DMEM-Kulturmedium oder IMDM-Kulturmedium suspendiert. Die Zahl der Zellen in der Lösung wurde mit einem Zellzählgerät gemessen und es wurde eine Zellsuspension hinzugefügt, so dass die Zahl der Zellen in jedem Schacht mit Lipidure-Coat-Kulturmedium (96-Schacht-Rundboden; NOF Cooperation), dem das IMDM-Kulturmedium hinzugefügt wurde, 2500 oder 5000 betrug. Die Zellen wurden 3 bis 7 Tage lang bei 37°C angezüchtet, um einen Embryoid Body zu bilden.

(3) Induzieren der Myokard-Differenzierung von cTnT-GL4-Expressions-Maus-iPS-Zellen

Der gebildete Embryoid Body wurde in eine mit Gelatine beschichtete 35-mm-Schale verbracht und über Nacht bei 37°C gebrütet, so dass der Embryoid Body auf der Schalenoberfläche haftete. Der Embryoid Body wurde 5 bis 14 Tage lang bei 37°C gezüchtet, um seine Differenzierung in schlagende Herzmuskelzellen zu induzieren.

(4) Beobachtung und Analyse der cTnT-GL4-Expressions-Maus-iPS-Zellen

D-Luciferin (hergestellt von Wako Pure Chemical Industries) wurde zu einer Endkonzentration von 1 mM zum Embryoid Body der cTnT-GL4-Expressions-Maus-iPS-Zellen hinzugefügt, die bei 37°C gezüchtet wurden und teilweise einen schlagenden Herzmuskel zeigten. Die schlagenden Zellen wurden unter Verwendung des Biolumineszenz-Mikroskops LV200 (hergestellt von der Olympus Corporation), ausgestattet mit AQUACOSMOS (Hamamatsu Photonics Corporation), beobachtet. Die Expression von cTnT-Genen wurde unter den folgenden Belichtungsbedingungen beobachtet. Die CCD-Kamera des Typs ImagEM (hergestellt von der Hamamatsu Photonics Corporation) wurde unter einer Bedingung eines 1×1-Binning verwendet. Die cTnT-GL4-Expressions-Maus-iPS-Zellen wurden für eine Belichtungszeit von 15 Minuten einer Bildgebung unterzogen.

7 zeigt ein Hellfeldbild von aus einem Embryoid Body erzeugten Zellen umfassend die in schlagende Herzmuskelzellen differenzierten cTnT-GL4-Expressions-Maus-iPS-Zellen. 8 zeigt ein Lumineszenz-Beobachtungsbild der gleichen Zellen. Wie in 7 und 8 dargestellt wurde in den aus den schlagenden iPS-Zellen erzeugten Herzmuskelzellen Lumineszenz nachgewiesen. Das heißt die Expression von cTnT konnte durch Lumineszenz beobachtet werden.

[Beispiel 2-3: Analyse der Änderung der cTnT-Expression mit Zeitverlauf im Myokard-Differenzierungsprozess von Maus-iPS-Zellen]

Der Prozess der Myokard-Differenzierung der in Beispiel 2-2 erzeugten cTnT-GL4-Expressions-Maus-iPS-Zellen wurde mit Zeitverlauf über einen langen Zeitraum beobachtet und die Änderung der Expression von cTnT wurde analysiert.

  • (1) Die Kultur des cTnT-GL4-Expressions-Maus-iPS-Zellen-KO-DMEM-Kulturmediums enthaltend G418 (mit einer Endkonzentration von 250 μg/ml) wurde zum Züchten der cTnT-GL4-Expressions-Maus-iPS-Zellen auf gegen Neomycin resistenten MEF-Zellen, deren Teilung durch eine Mitomycin-C-Behandlung unterbrochen wurde, verwendet.
  • (2) Bilden des Embryoid Body von cTnT-GL4-Expressions-Maus-iPS-Zellen und Induzieren der Myokard-Differenzierung

Die cTnT-GL4-Expressions-Maus-iPS-Zellen wurden mit PBS gewaschen, durch 0,25% Trypsin-EDTA abgelöst und anschließend 4 Stunden lang in einem Brutapparat bei 37°C mit dem KO-DMEM-Kulturmedium gebrütet. Fütterzellen (MEF) wurden angehaftet, so dass nur die cTnT-Expressions-Maus-iPS-Zellen schwammen. Das Kulturmedium enthalten die cTnT-GL4-Expressions-Maus-iPS-Zellen wurde zentrifugiert, um die Zellen zu sammeln, und die Zellen wurden erneut in 1 ml IMDM-Kulturmedium suspendiert. Die Zahl der Zellen in der Lösung wurde mit einem Zellzählgerät gemessen und es wurde eine Zellsuspension hinzugefügt, so dass die Zahl der Zellen in jedem Schacht mit Lipidure-Coat-Kulturmedium (96-Schacht-Rundboden; NOF Cooperation), dem das IMDM-Kulturmedium hinzugefügt wurde, 2500 oder 5000 betrug. Die Zellen wurden 3 bis 7 Tage lang bei 37°C angezüchtet, um einen Embryoid Body zu bilden.

  • (3) Induzieren der Myokard-Differenzierung von cTnT-GL4-Expressions-Maus-iPS-Zellen und Analyse der cTnT-Expression mit Zeitverlauf

Der gebildete Embryoid Body wurde in eine mit Gelatine beschichtete 35-mm-Schale (enthaltend das IMDM-Kulturmedium und Luciferin mit einer Endkonzentration von 1 mM) verbracht und 24 Stunden lang bei 37°C gebrütet, so dass der Embryoid Body auf der Schalenoberfläche haftete. Das Kulturmedium wurde durch ein neues IMDM-Kulturmedium (Luciferin mit einer Endkonzentration von 1 mM) ersetzt und das Biolumineszenzmikroskop LV200 (hergestellt von der Olympus Corporation), ausgestattet mit AQUACOSMOS (Hamamatsu Photonics Corporation), wurde zum Durchführen einer Langzeitbeobachtung über etwa 5 Tage verwendet. Die Expression von cTnT-Genen wurde unter den folgenden Belichtungsbedingungen beobachtet. Die CCD-Kamera des Typs ImagEM (hergestellt von der Hamamatsu Photonics Corporation) wurde unter einer Bedingung eines 1×1-Binning verwendet.

Die cTnT-GL4-Expressions-Maus-ES-Zellen wurden für eine Belichtungszeit von 10 Minuten und in Belichtungsintervallen von 15 Minuten einer Bildgebung unterzogen. In diesem Fall wurde eine Videoaufnahme mit einer HD-Aufzeichnungsfunktion von AQUACOSMOS gleichzeitig mit der Hellfeldbelichtung durchgeführt, um zu beobachten, wie die in Herzmuskelzellen differenzierten Zellen schlugen. Die Belichtungsbedingungen von Videos beinhalteten eine Belichtungszeit von 124 ms und Belichtungsintervalle von 124 ms und es wurden nacheinander 50 bis 100 Bilder aufgenommen, um Videos aufzuzeichnen. Die erhaltenen Daten wurden mit AQUACOSMOS (Hamamatsu Photonics Corporation) analysiert. Zur Erkennung mit den aufgenommenen Bildern sind der Reihe nach mit einer Bildfrequenz, die höher ist als die für den Prozess der Kontraktion und Entspannung erforderliche Zeit, aufgenommene Sequenzbilder (Videos) erforderlich. Die einzelne Zellposition in jedem Bild kann manuell oder durch verschiedene Bilderkennungsverfahren mit Bildern zu vorhergehenden und nachfolgenden Zeiten als Anhaltspunkte bestimmt werden. Das Schlagen kann ebenfalls durch Analysieren der Bewegung eines Hell-Dunkel-Musters eines Bildes gemäß einem Verfahren wie ein Lichtfluss- oder Bildkorrelationsverfahren ohne Spezifizieren der einzelnen Zellposition erkannt werden.

9 zeigt ein Hellfeldbild eines cTnT-Expressionszustands des von den cTnT-GL4-Expressions-Maus-iPS-Zellen gewonnenen Embryoid Body alle 24 Stunden seit Beginn der Beobachtung. 10 zeigt ein Lumineszenzbild des gleichen Embryoid Body. 12 zeigt einen Graphen, in dem die Änderung der lumineszenten Intensität eines interessierenden Bereichs im Bild von 11 mit AQUACOSMOS (Hamamatsu Photonics Corporation) analysiert wird. Wie in 9 und 10 dargestellt wurde die sich mit der verstrichenen Zeit schrittweise ausbreitende Expressionsfläche beobachtet. Das Schlagen von Zellen in einem Teil, in dem cTnT ausgedrückt wurde, wurde von der HD-Aufzeichnungsfunktion beobachtet, nachdem etwa 72 Stunden verstrichen waren. Wie in 12 dargestellt wurden die Zunahme der Lumineszenzintensität des vom interessierenden Bereich umgebenen Teils mit der verstrichenen Zeit und die Zunahme der cTnT-Expression mit der verstrichenen Zeit beobachtet.

[Beispiel 2-4: Analyse de Schlagens im Myokard-Differenzierungsprozess von Maus-iPS-Zellen]

In den vorliegenden Beispielen wurde das Schlagen im Myokard-Differenzierungsprozess von Maus-iPS-Zellen auf der Basis von STICS, eine der durch das Bildkorrelationsverfahren durchgeführten Bewegungsanalysen, analysiert.

(1) Analyseverfahren

Hellfeld-Sequenzbilder und Lumineszenzbilder wurden im Myokard-Differenzierungsprozess der cTnT-GL4-Expressions-Maus-iPS-Zellen ähnlich denen in Beispiel 2-3 erfasst. Bezüglich der Hellfeld-Sequenzbilder wurden Sequenzbilder von 61 Sekunden oder 74 Sekunden alle 15 Minuten während eines Beobachtungszeitraums aufgenommen. Die Belichtungszeiten der in den Sequenzbildern enthaltenen Bilder betrugen 0,61 Sekunden oder 0,37 Sekunden. Eine Analyseregion von horizontalen 264 Pixeln × vertikalen 256 Pixeln wurde von einem rechten Mittelteil des aufgenommenen Bildes von 512×512 Pixel extrahiert. Der extrahierte Analysebereich ist als Bereich R10 in 13 bezeichnet. Teilbereiche von 32×32 Pixel wurden im extrahierten Analysebereich gefüllt, so dass die Teilbereiche vertikal und horizontal um 8 Pixel zueinander verschoben waren, und es wurde die folgende Bewegungsanalyse in jedem Teilbereich durchgeführt, um um quantitativ eine lokale Bewegung im Teilbereich zu bewerten.

In jedem Teilbereich wurde ein Kreuzkorrelationsbild in Bezug auf zwei Bilder bei tn und tn+1 berechnet, wobei tn die Zeit war, zu der das n-te Bild der Sequenzbilder aufgenommen wurde, und es wurde dessen Peaklage durch gaußsches Anpassen bestimmt. Wenn die Peaklage (p, q) war, war die Geschwindigkeit des Objekts zur Zeit tn in diesem Teilbereich (p/Δt, q/Δt). Hier ist Δt ein Intervall tn+1–tn der Belichtungszeiten der zwei Bilder. Eine Istgeschwindigkeit in der Probe kann durch Multiplizieren des Geschwindigkeitswerts mit dem Umrechnungsfaktor berechnet werden, der den Pixelwert in den Istabstand umrechnet und durch die Vergrößerung eines optischen Systems zur Bildgebung und den Abstand zwischen den Pixeln der Bildaufnahmevorrichtung bestimmt wird.

In jedem Teilbereich wurde die Standardabweichung der Verschiebung der zeitbezogenen Geschwindigkeiten (vx(t), vy(t)) pro Minute wie zuvor berechnet als Schlagstärke an diesem Punkt und in diesem Zeitbereich definiert. Als Definition der Schlagstärke kann die Varianz der Geschwindigkeitsverschiebungen in einem Zeitbereich oder der maximale Höhenwert statt der diesmal verwendeten Definition verwendet werden. Der im Teilbereich in 8-Pixel-Intervallen im Teilbereich wie zuvor berechnete Wert der Schlagstärke wurde im gesamten Analysebereich von 264 Pixel×256 Pixel in der Länge durch Interpolation durch natürliche Nachbarn zum Erzeugen eines Verteilungsbildes des Schlagens interpoliert.

An der Position entsprechend jeder Zeit von jedem Teilbereich kann die Verteilung von Geschwindigkeiten und zeitlichen Änderungen von dieser optisch erkannt werden, wenn die Geschwindigkeitsvektoren als Pfeile dargestellt werden oder wenn die Geschwindigkeitsvektoren in verschiedenen Farben je nach Höhe der Geschwindigkeiten dargestellt werden. Wenn diese Darstellung über das entsprechende Hellfeldbild oder Lumineszenzbild gelegt wird, kann die Beziehung zwischen dem Zustand an der relevanten Position und der Geschwindigkeit optisch erkannt werden. Im Falle des Hellfeldbildes sind die Größe und Dicke einer Zelle, die Lagebeziehung im Embryoid Body oder Gewebe usw. als Zustand an der relevanten Position zu nennen. Im Falle des Lumineszenzbildes sind ein Genexpressionswert in einer Zelle im relevanten Teil, der Grad der Differenzierung u. Ä. als Zustand an der relevanten Position zu nennen.

Wenn eine Analyse unter Verwendung wechselseitiger Geschwindigkeitskomponenten zwischen zwei Teilbereichen durchgeführt wird, kann die Bewegungsbeziehung zwischen diesen Bereichen bewertet werden. Die Geschwindigkeitskomponenten umfassen beispielsweise Komponenten mit großer Verschiebung zwischen horizontalen und vertikalen Komponenten für ein bestimmtes Bild und Komponenten in Richtungen mit großer Verschiebung im gesamten Zeitbereich. Wenn eine Geschwindigkeitskomponente v1(tn) in einem ersten Bereich und eine Geschwindigkeitskomponente v2(tn) in einem zweiten Bereich zur Zeit tn als ein Korrelationsdiagramm dargestellt werden, kann der Grad der Synchronisation der Bewegungen zwischen zwei Punkten bewertet werden. Wenn die Bewegungen an zwei Punkten synchron sind, sind Punkte von (v1, v2) zu jeder Zeit auf einer ansteigenden oder absteigenden geraden Linie angeordnet, und der Grad der Synchronisation kann quantitativ durch einen aus einer Regressionsanalyse beispielsweise durch den Determinationskoeffizienten R2 ermittelten Parameter geschätzt werden. Als Grad der Synchronisation kann ein absoluter Wert |r| eines Korrelationskoeffizienten oder ein quadratischer Mittelwert der Verschiebung von einem geraden Linienmodell, bestimmt durch eine Regressionsanalyse, stattdessen verwendet werden.

Zusätzlich kann eine Dauerzeit der Synchronisation durch Berechnen einer Kreuzkorrelation C12(τ) = Σt[v1(tn)·v2(tn + τ)] von v1(tn) und v2(tn) geschätzt werden. Eine Synchronisationsdauerzeit zwischen Bereichen kann in Beziehung zur Fortsetzungszeit der Bewegung in jedem Bereich durch Vergleichen einer Autokorrelation C11(τ) = Σt[v1(tn)·v1(tn + τ)] im ersten Bereich und einer ähnlich definierten Autokorrelation C22 im zweiten Bereich mit einer Kreuzkorrelation C12 durch Berechnung von beispielsweise C122/(C11 × C22) oder dessen Quadratwurzel bewertet werden.

(2) Analyseergebnisse

Nachfolgend sind die Analyseergebnisse in den vorliegenden Beispielen beschrieben. Wie zuvor beschrieben zeigt der im Bild in 13 enthaltene quadratische Bereich R10 den Bereich eines in der in 14 bis 21 im vorliegenden Beispiel 2-4 verwendeten Analyse verwendeten Bildes. Drei durch kreisförmige Markierungen in 13 markierte Positionen sind Bereiche, in denen für die Analyse vorgesehene Daten im vorliegenden Beispiel 2-4 ermittelt werden. Diese Bereiche werden als erster Punkt P1, zweiter Punkt P2 und dritter Punkt P3 bezeichnet.

Ergebnisse der STICS-Analyse unter Verwendung von Hellfeld-Sequenzbildern, die in einem Video 91 Stunden nach Beginn der Beobachtung enthalten sind, sind in 14 dargestellt. Das Ziel der Analyse ist der in 13 dargestellte Bereich R10. 14 zeigt die Geschwindigkeit von jedem Teil durch die Länge eines Pfeils, wobei jedes Diagramm in 14 ein Ergebnis der Analyse in jedem Zeitabschnitt innerhalb von 4,03 Sekunden darstellt. Die verstrichene Zeit ist in jedem Diagramm oben links angegeben und der Maßstab der Länge des Pfeils ist in 14 oben rechts angegeben. Wie in 14 dargestellt ist es ersichtlich, dass sich die Geschwindigkeit und Richtung von jedem Punkt mit der verstrichenen Zeit am ersten Punkt P1, zweiten Punkt P2 und dritten Punkt P3 wie in 13 dargestellt ändern, das heißt an diesen Positionen tritt ein Schlagen auf.

Die 66 Stunden, 71 Stunden, 76 Stunden, 81 Stunden, 86 Stunden und 91 Stunden nach Beginn der Beobachtung ermittelten Analyseergebnisse sind in 15 dargestellt. In 15 ist die verstrichene Zeit seit Beginn der Beobachtung in der ersten Spalte dargestellt, in der „Zeit nach Beginn der Beobachtung” angegeben ist. Jedes Diagramm in der zweiten Spalte, in der „Hellfeld” in 15 angegeben ist, zeigt ein Hellfeldbild in jeder Zeit.

Diagramme in der dritten Spalte, in der „STICS/Genexpression” in 15 angegeben ist, zeigt Bilder, in denen Analyseergebnisse von STICS auf die Lumineszenzbilder zur Darstellung der durch das im Beispiel 2-3 wie in den in 10 dargestellten Bildern dargestellte Verfahren ermittelten cTnT-Expression gelegt sind. Helle Teile in den Lumineszenzbildern sind Teile, in denen der Expressionswert von cTnT hoch ist. Teile, in denen Teile zur Angabe der Ergebnisse von STICS lang sind, sind Teile, in denen die Geschwindigkeit hoch ist.

Bilder in der vierten Spalte von 15, die mit „Schlagen” bezeichnet sind, stellen die als Intensität von Pixelwerten dargestellte Schlagstärke dar. Die Schlagstärke ist die Standardabweichung der durch Durchführen der STICS-Analyse auf Basis von 100 bis 200 der Reihe nach in 61 Sekunden bis 74 Sekunden aufgenommenen Bilder ermittelten Geschwindigkeit an jedem Punkt. Eine höhere Intensität ist dargestellt, wenn die Standardabweichung größer ist. Das heißt es ist eine höhere Intensität dargestellt, wenn die Geschwindigkeitsänderung an jedem Punkt größer ist, das heißt wenn das Schlagen stärker ist. Aus dem Vergleich zwischen den Bildern in der dritten Spalte und vierten Spalte in 15 geht hervor, dass das Schlagen in Bereichen stärker ist, in denen die Expression von cTnT-Genen größer ist.

Die Analyseergebnisse 76 Stunden, 81 Stunden, 86 Stunden und 91 Stunden nach Beginn der Beobachtung sind nachfolgend ausführlich beschrieben. 16A bis 16G zeigen die 76 Stunden nach Beginn der Beobachtung ermittelten Analyseergebnisse. 17A bis 17G zeigen die 81 Stunden nach Beginn der Beobachtung ermittelten Analyseergebnisse. 18A bis 18G zeigen die 86 Stunden nach Beginn der Beobachtung ermittelten Analyseergebnisse. 19A bis 19G zeigen die 91 Stunden nach Beginn der Beobachtung ermittelten Analyseergebnisse.

Die entsprechenden linken Diagramme in 16A, 17A, 18A und 19A zeigen Bilder zur Darstellung der Analyseergebnisse durch STICS mit Pfeilen, die auf Hellfeldbildern von Zellen dargestellt sind. Die entsprechenden rechten Diagramme in 16A, 17A, 18A und 19A zeigen die Standardabweichung der durch STICS ermittelten Geschwindigkeit wie in der vierten Spalte in 15 und stellen die Schlagstärke durch Intensität dar. Die STICS-Ergebnisse wurden in Bezug auf den ersten Punkt PI, den zweiten Punkt P2 und den dritten Punkt P3 dargestellt durch kreisförmige Markierungen in 16A, 17A, 18A und 19A analysiert.

16B, 17B, 18B und 19B stellen dar, wie sich die Geschwindigkeiten am ersten Punkt P1 (Punkt 1), zweiten Punkt P2 (Punkt 2) und dritten Punkt P3 (Punkt 3) in jedem Zeitbereich im Laufe der Zeit ab Beginn der Beobachtung ändern. In jedem Diagramm gibt die horizontale Achse die verstrichene Zeit (s) an, und die vertikale Achse gibt die Geschwindigkeit (μm/s) an. In jedem Diagramm gibt eine unterbrochene Linie die Geschwindigkeit am ersten Punkt P1 an, eine graue durchgezogene Linie gibt die Geschwindigkeit am zweiten Punkt P2 an und eine gestrichelte Linie gibt die Geschwindigkeit am dritten Punkt P3 an. Hier geben die Geschwindigkeiten am ersten Punkt P1 und zweiten Punkt P2 Geschwindigkeitskomponenten in der vertikalen Richtung (y-Achsen-Richtung) des beispielsweise in 16A dargestellten Bildes dar, und die Geschwindigkeit am dritten Punkt P3 gibt eine Geschwindigkeitskomponente in der horizontalen Richtung (x-Achsen-Richtung) des beispielsweise in 16A dargestellten Bildes dar. Da die Verschiebung in der vertikalen Richtung größer ist als die in der horizontalen Richtung sowohl am ersten Punkt P1 als auch am zweiten Punkt P2, und weil die Verschiebung in der horizontalen Richtung größer ist als die in vertikaler Richtung am dritten Punkt P3 91 Stunden nach Beginn der Beobachtung, sind die Geschwindigkeitskomponenten in der vertikalen Richtung am ersten Punkt P1 und zweiten Punkt P2 fokussiert und ist die Geschwindigkeitskomponente in der horizontalen Richtung am dritten Punkt P3 fokussiert.

Aus 16B, 17B, 18B und 19B geht hervor, dass der Maximumwert der Geschwindigkeit schrittweise mit der seit Beginn der Beobachtung verstrichenen Zeit angestiegen ist. Das heißt, dass das Schlagen mit der seit Beginn der Beobachtung verstrichenen Zeit stärker geworden ist. Aus diesen Zeichnungen geht ebenfalls hervor, dass die Richtung der Geschwindigkeit am ersten Punkt P1 entgegengesetzt (180 Grad Phasenverschiebung) zur Richtung der Geschwindigkeit am zweiten Punkt P2 und dritten Punkt P3 ist, aber dass der Zeitablauf der Geschwindigkeitsänderung am ersten Punkt P1, zweiten Punkt P2 und dritten Punkt P3 gleich ist. Das heißt das Schlagen ist an allen Punkten synchron.

Die Korrelation der Geschwindigkeiten an den entsprechenden Positionen wurde in Bezug auf 76 Stunden nach Beginn der in 16B dargestellten Beobachtung ermittelten Daten analysiert. Das heißt in 16C sind die gleichzeitig gemessenen Geschwindigkeiten am ersten Punkt P1 als die Komponente der horizontalen Achse geplottet und die Geschwindigkeiten am zweiten Punkt P2 sind als die Komponente der vertikalen Achse geplottet. Jeder Punkt stellt einen von etwa 200 Datenpunkten in den in 16B dargestellten Geschwindigkeitsdaten dar. In 16C sind die Werte normalisiert, so dass der maximale Wert der Geschwindigkeit 1 ist. Ferner sind in 16C eine gerade Linie zur Darstellung des linearen Modells in Bezug auf die geplotteten Daten und der Determinationskoeffizient R2, der das Quadrat des Korrelationskoeffizienten R ist, dargestellt. Der Determinationskoeffizient R2, der näher an 1 ist, stellt dar, dass das Schlagen am ersten Punkt P1 und das Schlagen am zweiten Punkt P2 synchroner sind.

Auf ähnliche Weise zeigt in Bezug auf die 76 Stunden nach Beginn der Beobachtung ermittelten Daten, die in 16B dargestellt sind, 16D ein Diagramm, in dem die Geschwindigkeit am ersten Punkt P1 als die Komponente der horizontalen Achse geplottet ist und die Geschwindigkeit am dritten Punkt P2 als die Komponente der vertikalen Achse geplottet ist, und 16E zeigt ein Diagramm, in dem die Geschwindigkeit am zweiten Punkt P2 als die Komponente der horizontalen Achse geplottet ist und die Geschwindigkeit am dritten Punkt P2 als die Komponente der vertikalen Achse geplottet ist.

Auf ähnliche Weise zeigt in Bezug auf die Daten 81 Stunden nach Beginn der Beobachtung, die in 17B dargestellt sind, 17C ein Diagramm, in dem die Geschwindigkeit am ersten Punkt P1 als die Komponente der horizontalen Achse geplottet ist und die Geschwindigkeit am zweiten Punkt P2 als die Komponente der vertikalen Achse geplottet ist, 17D zeigt ein Diagramm, in dem die Geschwindigkeit am ersten Punkt P2 als die Komponente der horizontalen Achse geplottet ist und die Geschwindigkeit am dritten Punkt P2 als die Komponente der vertikalen Achse geplottet ist, und 17E zeigt ein Diagramm, in dem die Geschwindigkeit am zweiten Punkt P2 als die Komponente der horizontalen Achse geplottet ist und die Geschwindigkeit am dritten Punkt P3 als die Komponente der vertikalen Achse geplottet ist.

Auf ähnliche Weise zeigt in Bezug auf die 86 Stunden nach Beginn der Beobachtung ermittelten Daten, die in 18B dargestellt sind, 18C ein Diagramm, in dem die Geschwindigkeit am ersten Punkt P1 als die Komponente der horizontalen Achse geplottet ist und die Geschwindigkeit am zweiten Punkt P2 als die Komponente der vertikalen Achse geplottet ist, 18D zeigt ein Diagramm, in dem die Geschwindigkeit am ersten Punkt P2 als die Komponente der horizontalen Achse geplottet ist und die Geschwindigkeit am dritten Punkt P2 als die Komponente der vertikalen Achse geplottet ist, und 18E zeigt ein Diagramm, in dem die Geschwindigkeit am zweiten Punkt P2 als die Komponente der horizontalen Achse geplottet ist und die Geschwindigkeit am dritten Punkt P3 als die Komponente der vertikalen Achse geplottet ist.

Auf ähnliche Weise zeigt in Bezug auf die 91 Stunden nach Beginn der Beobachtung ermittelten Daten, die in 19B dargestellt sind, 19C ein Diagramm, in dem die Geschwindigkeit am ersten Punkt P1 als die Komponente der horizontalen Achse geplottet ist und die Geschwindigkeit am zweiten Punkt P2 als die Komponente der vertikalen Achse geplottet ist, 19D zeigt ein Diagramm, in dem die Geschwindigkeit am ersten Punkt point. P2 als die Komponente der horizontalen Achse geplottet ist und die Geschwindigkeit am dritten Punkt P2 als die Komponente der vertikalen Achse geplottet ist, und 19E zeigt ein Diagramm, in dem die Geschwindigkeit am zweiten Punkt P2 als die Komponente der horizontalen Achse geplottet ist und die Geschwindigkeit am dritten Punkt P3 als die Komponente der vertikalen Achse geplottet ist.

Wie in diesen Zeichnungen dargestellt ist der Determinationskoeffizient R2 an allen Positionen von erstem Punkt P1, zweitem Punkt P2 und drittem Punkt P3 mit der seit Beginn der Beobachtung verstrichenen Zeit größer geworden. Das heißt, es hat sich erwiesen, dass das an jeder Position mit der seit Beginn der Beobachtung verstrichenen Zeit festgestellte Schlagen eine höhere Synchronisation zeigte.

Bezüglich der 76 Stunden nach Beginn der Beobachtung ermittelten Daten, die in 16B dargestellt sind, sind die Ergebnisse von Autokorrelationen in 16F dargestellt. In 16F gibt eine durchgezogene Linie eine Autokorrelation in Bezug auf die Geschwindigkeit am ersten Punkt P1 (Punkt 1) an, eine unterbrochene Linie gibt eine Autokorrelation in Bezug auf die Geschwindigkeit am zweiten Punkt P2 (Punkt 2) an und eine gepunktete Linie gibt eine Autokorrelation in Bezug auf die Geschwindigkeit am dritten Punkt P3 (Punkt 3) an. Hier sind die Werte normalisiert, so dass der maximale Wert 1 ist.

In Bezug auf die 76 Stunden nach Beginn der Beobachtung ermittelten Daten, die in 16B dargestellt sind, sind die Ergebnisse von Kreuzkorrelationen in 16G dargestellt. In 16G gibt eine durchgezogene Linie eine Kreuzkorrelation zwischen der Geschwindigkeit am ersten Punkt P1 und der Geschwindigkeit am zweiten Punkt P2 an, eine unterbrochene Linie gibt eine Kreukorrelation zwischen der Geschwindigkeit am zweiten Punkt P2 und der Geschwindigkeit am dritten Punkt P3 an, und eine gepunktete Linie gibt eine Kreuzkorrelation zwischen der Geschwindigkeit am ersten Punkt P1 und der Geschwindigkeit am dritten Punkt P3 an. Auch in dieser Zeichnung sind die Werte normalisiert, so dass der maximale Wert 1 ist.

Auf ähnliche Weise sind in Bezug auf die 81 Stunden nach Beginn der Beobachtung ermittelten Daten, die in 17B dargestellt sind, die Ergebnisse von Autokorrelationen in 17F dargestellt, und die Ergebnisse von Kreuzkorrelationen sind in 17G dargestellt. Auf ähnliche Weise sind in Bezug auf die 86 Stunden nach Beginn der Beobachtung ermittelten Daten, die in 18B dargestellt sind, die Ergebnisse von Autokorrelationen in 18F dargestellt, und die Ergebnisse von Kreuzkorrelationen sind in 18G dargestellt. Auf ähnliche Weise sind in Bezug auf die 91 Stunden nach Beginn der Beobachtung ermittelten Daten, die in 19B dargestellt sind, die Ergebnisse von Autokorrelationen in 19F dargestellt, und die Ergebnisse von Kreuzkorrelationen sind in 19G dargestellt.

Beispielsweise ergibt sich aus 19F und 19G, welche die 91 Stunden nach Beginn der Beobachtung ermittelten Analyseergebnisse darstellen, in der Tendenzen am deutlichsten zu erkennen sind, dass der erste Punkt P1, der zweite Punkt P2 und der dritte Punkt P3 ohne periodische Verschiebung immer synchronisiert sind. Es ergibt sich ebenfalls, dass die Schlagstärke mit einer Periode von etwa 7 Sekunden zu- und abnimmt. Es ist somit erwiesen, dass die Periodizität und die Dauerhaftigkeit durch die Analyse von Autokorrelationen und Kreuzkorrelationen bewertet werden können.

Die Beziehung des in 16C bis 16E, 17C bis 17E, 18C bis 18E und 19C bis 19E dargestellten Determinationskoeffizienten mit der seit Beginn der Beobachtung verstrichenen Zeit ist in 20 dargestellt. Wie in 20 dargestellt ist offensichtlich, dass der Determinationskoeffizient mit der seit Beginn der Beobachtung verstrichenen Zeit größer wird. Das heißt, es ist erwiesen, dass die Synchronität des Schlagens mit der verstrichenen Zeit zunimmt.

Es ergibt sich ebenfalls, dass die Korrelation zwischen dem zweiten Punkt P2 und dem dritten Punkt P3 geringer ist als die Korrelation zwischen dem ersten Punkt P1 und dem zweiten Punkt P2 und die Korrelation zwischen dem ersten Punkt P1 und dem dritten Punkt P3. Daher wird angenommen, dass in diesem Beispiele eine Informationsübertragung zwischen den Zellen am ersten Punkt P1 und den Zellen am zweiten Punkt P2 und zwischen den Zellen am ersten Punkt P1 und den Zellen am dritten P3 erfolgt ist. Zellen mit einer Schrittmacherfunktion können durch Untersuchen der Korrelation an jedem Punkt identifiziert werden.

Die Beziehung zwischen der seit Beginn der Beobachtung verstrichenen Zeit, dem Schlagen (rechte vertikale Achse) und der Genexpression (linke vertikale Achse) am ersten Punkt P1, zweiten Punkt P2 und dritten Punkt P3 ist in 21 dargestellt. Hier entspricht das durch eine dicke Linie mit Markierungen in 21 dargestellte Schlagen der als „Schlagen” in den Bildern in der vierten Spalte von 15 dargestellten Standardgeschwindigkeitsabweichung. Die durch eine dünne Linie dargestellte Genexpression ist durch die lumineszente Intensität im Lumineszenzbild dargestellt. Im Schlagen und in der Genexpression zeigen durchgezogene Linien die Ergebnisse für den ersten Punkt P1 an, unterbrochene Linien zeigen die Ergebnisse für den zweiten Punkt P2 an und gepunktete Linien zeigen die Ergebnisse für den dritten Punkt P3 an. In 21 zeigt eine gerade Linie parallel zur horizontalen Achse die Maximumwerte des Schlagens und der Genexpression an, und eine unterbrochene Linie parallel zur horizontalen Achse zeigt einen Wert mit der Hälfte des Maximumwerts (Halbwert), angezeigt durch die durchgezogene Linie, an. In 21 wird der Unterschied zwischen der Zeit, zu welcher der Genexpressionswert den Halbwert erreicht hat, und der Zeit, zu der die Schlagstärke den Halbwert erreicht hat, durch einen Pfeil und einen numerischen Wert angezeigt.

Wie in 21 dargestellt ist erwiesen, dass die Zeiten der Genexpression und der funktionalen Expression nicht übereinstimmen. Es ist erwiesen, dass Funktionen später als Gene insbesondere am ersten Punkt P1 und zweiten Punkt P2 ausgedrückt werden. Am dritten Punkt P3 erfolgt die funktionale Expression früher als die Genexpression.

In den vorliegenden Beispielen wurde der Expressionswert der Gene von lebenden Zellen auf Basis des Lumineszenzbildes analysiert, und das Phänomen des Schlagens der gleichen Zellen im gleichen Zeitraum wurde durch das Bildkorrelationsverfahren auf der Basis von Hellfeld-Sequenzbildern der gleichen Zellen, die im gleichen Zeitraum aufgenommen wurden, ermittelt. Das Lumineszenzbild und die Hellfeldbilder konnten im gleichen Zeitraum in den gleichen Zellen aufgenommen werden, und es wurde daher nachgewiesen, dass die Beziehung zwischen der Genexpression und der funktionalen Expression wie in den vorliegenden Beispielen bewertet werden konnte. Gemäß den vorliegenden Beispielen können Informationen wie Richtungsbündelung, Stärke und Periodizität in Bezug auf die Genexpression und das Schlag als optisch erkennbare Informationen bereitgestellt werden.

Ein Verfahren zum Analysieren der Funktion des Herzmuskels besteht beispielsweise im Messen des zellularen elektrischen Potentials durch die Verwendung von Mehrfachelektrodenanordnungen. Solch ein Verfahren zum Messen des Potentials umfasst aber lediglich eine lokale Messung an Positionen, an denen Elektroden vorhanden sind, und ermöglicht kein Ermitteln von Informationen in Bezug auf den schlagenden Teil der Zellgruppe. Jedoch können gemäß dem Analyseverfahren mit dem Hellfeldbild wie in den vorliegenden Beispielen Informationen wie die Positionen von Zellen und die Geschwindigkeit des Schlagens in Bezug auf alle Zeilen in einem Beobachtungssichtfeld ermittelt werden.

Obgleich Geschwindigkeiten mit Belichtungsintervallen von 0,61 Sekunden oder 0,37 Sekunden in der hier beschriebenen Analyse des Schlagens berechnet werden, kann die Geschwindigkeit mit Videos berechnet und analysiert werden, die mit anderen Belichtungsintervallen als die Belichtungsintervalle in diesem Beispiel aufgenommen werden, beispielsweise Videos, die jedes Dreißigstel einer Sekunde aufgenommen werden.

[Beispiel 2-5: Analyse der verstrichenen Zeit der cTnT-Expression im Myokard-Differenzierungsprozess von Maus-ES-Zellen]

Wie im Beispiel 2-3 kann der Prozess der Myokard-Differenzierung der in Beispiel 2-1 erzeugten cTnT-GL4-Expressions-Maus-iPS-Zellen mit Zeitverlauf über einen langen Zeitraum beobachtet und die Änderung der Expression von cTnT analysiert werden.

[Beispiel 3: Analyse der Änderung einer von cTnT abweichenden herzmuskelspezifischen Markergenexpression mit Zeitverlauf im Myokard-Differenzierungsprozess von Maus-ES-Zellen oder Maus-iPS-Zellen]

Der Myokard-Differenzierungsprozess von Maus-ES-Zellen oder Maus-iPS-Zellen kann mit Zeitverlauf wie im Beispiel 2 auch durch Verwendung eines anderen herzmuskelspezifischen Markers als cTnT, etwa GATA4 oder NCXI, analysiert werden. Beispielsweise kann der Myokard-Differenzierungsprozess von Maus-ES-Zellen oder Maus-iPS-Zellen auch durch die Verwendung von mehr als einen der zuvor genannten herzmuskelspezifischen Marker analysiert werden.

[Beispiel 4: Analyse der Änderung von herzmuskelspezifischen Markergenen mit Zeitverlauf durch einen Myokard-Differenzierungs-Verbesserungsfaktor]

In den zuvor beschriebenen Beispielen 2 und 3 kann der Myokard-Differenzierungsprozess von Maus-ES-Zellen oder Maus-iPS-Zellen, zu denen ein Myokard-Differenzierungs-Verbesserungsfaktor hinzugefügt wird, mit Zeitverlauf analysiert werden.

[Beispiel 5: Analyse der Expression von mehr als einem Gen im Myokard-Differenzierungsprozess unter Verwendung von undifferenzierten Markern/Myokard-Differenzierungsmarkern als Indizes]

Die Expression von mehr als einem Gen kann durch die Kombination des Myokard-Differenzierungsmarkers in Beispiel 2 und Beispiel 3 wie zuvor beschrieben und eines undifferenzierten Markers wie Nanog und Tcf3 analysiert werden.

[Beispiel 6: Analyse der herzmuskelspezifischen Markerexpression im Zellschicht-Myokard-Differenzierungsprozess]

Auch wenn die Zellschicht im Fokus der Analyse steht, können die zuvor in Beispiel 2 bis Beispiel 5 beschriebenen Analysen durchgeführt werden.

[Beispiel 7: Bildgebung unter Verwendung der Lumineszenz der Herzmuskelmarkerexpression und der Fluoreszenz im Myokard-Differenzierungsprozess von ES-Zellen und iPS-Zellen]

Es kann eine Fluoreszenzbildgebung zusammen in der zuvor beschriebenen Analyse der Myokard-Differenzierung verwendet werden.

[Beispiel 8: Ca-Bildgebung im Myokard-Differenzierungsprozess von ES-Zellen und iPS-Zellen]

Calcium in Zellen, die sich in Herzmuskelzellen differenzierte haben und zu schlagen angefangen haben, kann unter Verwendung von auf Calcium ansprechender Luciferase einer Bildgebung unterzogen werden.

(1) Erzeugung von Maus-ES-Zellen und iPS-Zellen, in die auf Calcium ansprechende Luciferase eingeführt wurde

Maus-ES-Zellen und iPS-Zellen, in die auf Calcium ansprechende Luciferase eingeführt wurde, wurde unter Verwendung von KO-DMEM-Kulturmedium auf MEF-Zellen, deren Teilung durch eine Mitomycin-C-Behandlung unterbrochen wurde, gezüchtet.

Ein Nukleofektionsverfahren durch den Amaxa Nucleofector (Wako Pure Chemical Industries) wird verwendet, um einen Vektor mit der auf Calcium ansprechenden Luciferase in die Maus-ES-Zellen oder iPS-Zellen zu transfizieren. Die transfizierten Zellen werden über Nacht im KO-DMEM-Kulturmedium zusammen mit gegen Neomycin resistenten Fütterzellen gezüchtet und das Kulturmedium wird durch ein KO-DMEM-Kulturmedium ausgetauscht, dem das antibiotische G418 (Invitrogen) bis zu einer Endkonzentration von 250 μg/ml hinzugefügt wird, wodurch eine selektive Züchtung erfolgt. Auf diese Weise wird eine sich stabil ausdrückende Zelllinie erfasst. Diese Zellen werden nachfolgend als auf Calcium ansprechende ES-Zellen oder auf Calcium ansprechende iPS-Zellen bezeichnet.

(2) Bilden eines Embryoid Body von auf Calcium ansprechenden ES-Zellen und auf Calcium ansprechenden iPS-Zellen

Die gezüchteten auf Calcium ansprechenden ES-Zellen oder auf Calcium ansprechenden iPS-Zellen werden mit PBS gewaschen, durch 0,25% Trypsin-EDTA abgelöst und anschließend 4 Stunden lang in einem Brutapparat bei 37°C gebrütet, nachdem das KO-DMEM-Kulturmedium hinzugegeben wurde. Fütterzellen (MEF) werden angehaftet, so dass nur die Maus-iPS-Zellen schwammen. Das Kulturmedium enthaltend die Zellen wird zentrifugiert, um die Zellen zu sammeln, und die Zellen werden erneut in 1 ml KO-DMEM-Kulturmedium oder IMDM-Kulturmedium suspendiert. Die Zahl der Zellen in der Lösung wird mit einem Zellzählgerät gemessen und es wird eine Zellsuspension hinzugefügt, so dass die Zahl der Zellen in jedem Schacht mit Lipidure-Coat-Kulturmedium (96-Schacht-Rundboden; NOF Cooperation), dem das IMDM-Kulturmedium hinzugefügt wird, 2500 oder 5000 beträgt. Die Zellen werden 3 bis 7 Tage lang bei 37°C angezüchtet, um einen Embryoid Body zu bilden.

(3) Induzieren der Myokard-Differenzierung von auf Calcium ansprechenden ES-Zellen oder auf Calcium ansprechenden iPS-Zellen

Der gebildete Embryoid Body wird in eine mit Gelatine beschichtete 35-mm-Schale verbracht und über Nacht bei 37°C gebrütet, so dass der Embryoid Body auf der Schalenoberfläche haftet. Der Embryoid Body wird anschließend 5 bis 14 Tage lang bei 37°C gezüchtet, um seine Differenzierung in schlagende Herzmuskelzellen zu induzieren.

(4) Beobachtung und Analyse der auf Calcium ansprechenden ES-Zellen oder auf Calcium ansprechenden iPS-Zellen

Coelenterazin (hergestellt von Wako Pure Chemical Industries) wird zu einer Endkonzentration von 1 mM zum Embryoid Body der auf Calcium ansprechenden ES-Zellen oder der auf Calcium ansprechenden iPS-Zellen hinzugefügt, die bei 37°C gezüchtet wurden und teilweise einen schlagenden Herzmuskel zeigten. Die schlagenden Zellen werden unter Verwendung des Biolumineszenz-Mikroskops LV200 (hergestellt von der Olympus Corporation), ausgestattet mit AQUACOSMOS (Hamamatsu Photonics Corporation), beobachtet. Die Belichtungsbedingungen sind wie folgt. Die CCD-Kamera des Typs ImagEM (hergestellt von der Hamamatsu Photonics Corporation) wird unter einer Bedingung eines 1×1-Binning verwendet. Die Belichtungszeit wird auf 15 Minuten eingestellt und es wird eine Calcium-Bildgebung bezüglich der auf Calcium ansprechenden ES-Zellen oder der auf Calcium ansprechenden iPS-Zellen durchgeführt.

[Beispiel 9: Messen des Schlagpotentials in aus ES-Zellen oder iPS-Zellen gewonnen Zellschichten]

Das Schlagpotential in einer aus ES-Zellen oder iPS-Zellen gewonnenen Zellschicht kann gemessen werden.

Das Schlagpotential von Zellen durch Züchten der Zellen auf beispielsweise Mehrfachelektrodenanordnungen kann gemessen werden.