Title:
Polymerase chain reaction method for detecting Salmonella in an animal, environmental or food samples, based on specific amplification of part of the invA gene, also provides indication of virulence
Kind Code:
A1


Abstract:
A PCR method for detecting Salmonella, is new. A PCR method for detecting Salmonella comprises: (a) incubating a sample first in peptone broth and then in Rappaport-Vassiliadis medium; (b) extracting DNA; (c) adding oligonucleotide PCR primers, each having a sequence that is specific for Salmonella but unable to cross-react with other organisms; (d) performing PCR; (e) cleaving the amplicon with a restriction enzyme (RE) that has a recognition sequence present at least once in the amplicon; and (f) detecting cleavage products. Independent claims are also included for: (1) the DNA oligonucleotide primers (S1) and (S2); and (2) kit for the process comprising oligonucleotide primers, as specified; PCR reagents, and RE, as specified. tttacggtctattttgatttg (S1) atatgctccacaaggttaatg (S2)



Inventors:
gleich Anmelder
Application Number:
DE10249171A
Publication Date:
05/13/2004
Filing Date:
10/22/2002
Assignee:
Hensel, Andreas (Markkleeberg, 04416, DE)
International Classes:
Domestic Patent References:
DE19819889A1N/A1999-11-11



Foreign References:
EP12330732002-08-21
WO1999057314A11999-11-11
Other References:
WHYTE, P. u.a.: The prevalence and PCR detection of Salmonella contamination in raw poultry. Veterinary Microbiology (02.10.2002) 89 (1) 53-60
atenbank PubMed bei NCBI, Adresse www.ncbi.nlm. nih.gov , Zusammen- fassung zu: Use of polymerase chain reaction and restriction enzyme analysis to directly detect andSalmonella typhimurium in food. COCOLIN, L. u.a., J. Appl. Microbiol. (1998) 85 (4) 673-7 [rech. am 20.06.2003]
CHIU, C.H. & OU, J.T.: Rapid identification of Salmonella serovars in feces by specific detectionof virulence genes, invA and spvC, by an enrich- ment broth culture-multiplex PCR combination assay. J. Clin. Microbiol. (1996) 34 (10) 2619-22
atenbank PubMed bei NCBI, Adresse www.ncbi.nlm. nih.gov , Zusammen- fassung zu: Application of nested polymerase chainreaction to detection of Salmonella in poultry environment. LIU, T. u.a., J. Food Prot.
Attorney, Agent or Firm:
Dehmel & Bettenhausen, Patentanwälte (München)
Claims:
1. Verfahren zum Nachweis von Salmonella, umfassend die aufeinander folgenden Schritte:
a) Inkubieren einer Probe in Pepton-Bouillon und anschließend in Rappaport-Vassiliadis-Medium,
b) Extrahieren der DNA aus der Probe,
c) Zugabe von DNA-Oligonukleotiden als Primer für eine PCR, wobei die DNA-Oligonukleotide jeweils eine Sequenz aufweisen, die spezifisch für Salmonella ist und nicht mit Sequenzen anderer Organismen kreuzreagieren können,
d) Durchführen einer Polymerase-Kettenreaktion (PCR),
e) Durchführen einer DNA-Spaltung mit einem Restriktionsenzym, das eine Erkennungssequenz aufweist, die mindestens einmal in dem durch Schritt d) erzeugten DNA-Amplifikat vorkommt, und
f) Nachweisen der durch die DNA-Spaltung erhaltenen DNA-Fragmente.

2. Verfahren nach Anspruch 1, wobei die DNA-Oligonukleotide Sequenzen des 3'-Endes des invA-Gens von Salmonella aufweisen.

3. Verfahren nach einem der vorhergehenden Ansprüche, wobei die DNA-Oligonukleotide Sequenzen gemäß SEQ ID NO: 1 und 2 aufweisen.

4. Verfahren nach einem der vorhergehenden Ansprüche, wobei das Restriktionsenzym NdeI ist.

5. DNA-Oligonukleotide mit einer Sequenz gemäß SEQ ID NO: 1 oder 2.

6. Kit zum Durchführen des Verfahrens nach einem der vorhergehenden Ansprüche, enthaltend DNA-Oligonukleotide als Primer für eine PCR, wobei die DNA-Oligonukleotide jeweils eine Sequenz aufweisen, die spezifisch für Salmonella ist und nicht mit Sequenzen anderer Organismen kreuzreagieren können, Reagenzien zur Durchführung einer PCR, ein Restriktionsenzym, das eine Erkennungssequenz aufweist, die mindestens einmal in dem durch die PCR erzeugten DNA-Amplifikat vorkommt.

Description:

Die vorliegende Erfindung betrifft ein Verfahren zum spezifischen Nachweis von Salmonella in einer Probe, spezifische DNA-Oligonukleotide als PCR-Primer und ein Kit zum Durchführen des erfindungsgemäßen Verfahrens.

Salmonella-Spezies (Serovare) sind bakterielle Krankheitserreger humaner Gastroenteritiden. Im Jahre 2000 wurden in Deutschland beim Bundesinstitut für gesundheitlichen Verbraucherschutz und Veterinärmedizin 79 535 Fälle einer Salmonellen-Infektion beim Menschen gemeldet. Dabei wird jedoch von einer mindestens 10fach höheren Dunkelziffer nicht gemeldeter Erkrankungen ausgegangen.

Eine wichtige Rolle bei der Übertragung von Salmonella-Spezies vom Tier auf den Menschen spielen kontaminierte Lebensmittel von infizierten, landwirtschaftlichen Nutztieren. So stellt das Geflügel, das Rind und das Schlachtschwein ein bedeutendes Reservoir für diese Zoonose-Erreger dar. Besonders vom persistent infizierten Tier (intermittierender Ausscheider des Erregers) geht eine mögliche Gefahr für den Verbraucher aus, da Infektionen mit nicht wirtsadaptierten Salmonellen beim landwirtschaftlichen Nutztier überwiegend symptomlos verlaufen und deshalb weder im Herkunftsbestand noch auf dem Schlachthof bei der Lebendbeschau erkannt werden. Trotz aller Maßnahmen der Tier- und Fleischhygiene, können die Erreger humaner Enteritiden so über Produkte tierischer Herkunft in die Lebensmittelkette gelangen und Erkrankungsfälle beim Verbraucher verursachen. Die Identifizierung von persistent, aber auch der akut infizierten Tiere stellt heute ein zentrales Probleme des Gesundheitlichen Verbraucherschutzes in der tierischen Produktion dar. Um die betroffenen Tiere im Bestand und am Schlachthof eindeutig identifizieren und selektieren zu können, sind schnelle, sensitive und spezifische Nachweismethoden erforderlich. Diese Forderungen werden in besonderem Maße durch die PCR-Methode erfüllt.

In den vergangenen Jahren wurden eine Vielzahl verschiedener PCR-Methoden zum Nachweis von Salmonellen aus Lebensmitteln, klinischen Materialien und Umweltproben beschrieben. Die Zielsequenzen der Salmonella-PCR-Methoden, insbesondere der in den letzten fünf Jahren publizierten Sequenzen, sind aber auf einige wenige Genabschnitte beschränkt geblieben. Ein in vielen Studien gewählter DNA-Abschnitt ist das invA-Gen von S. Typhimurium. Die Unterschiede in den einzelnen Studien liegen im wesentlichen in der Adaptation der PCR-Methode an die speziellen Anforderungen des sehr heterogenen Probenmaterials, aus dem schließlich der Nachweis von Salmonellen erfolgen soll. Die Anpassung der jeweiligen PCR-Methode erfolgte letztlich durch eine Modifikation der unterschiedlichen Voranreicherungsschritte sowie durch Variation der DNA-Extraktionsmethoden und der PCR-Bedingungen. Die Vielzahl der von verschiedenen Autoren beschriebenen Methoden ist meist sehr speziell an bestimmte Bedingungen bzw. Probenmaterialien adaptiert. Ob sich diese Methoden prinzipiell eignen würden, Salmonella in Umweltproben oder Lebensmitteln wie Schweinefleisch bzw. Schweinefleischprodukte nachzuweisen, ist nur durch eine Überprüfung jeder einzelnen Methode auf falsch positive Signale durch eine Untersuchung, wie sie im Beispielteil angegeben ist, möglich. Dies ist zur Zeit nicht praktikabel. Selbstverständlich geben aber natürlich die unterschiedlichen, oben genannten Autoren an, dass die von ihnen entwickelte Methode grundsätzlich für den Nachweis von Salmonella für das angegebene Probenmaterial geeignet ist.

So ist die von Widjojoatmodjo und Mitarbeitern (1991) entwickelte PCR mit einer immunomagnetischen Separation kombiniert, was jedoch den Nachteil einer ungenügenden Sensitivität hervorruft. Die von Rahn und Mitarbeiter (1992) für die Salmonellen-spezifische PCR gewählten Oligonukleotide basieren auf dem invA-Gen (GALAN et al., 1992). Das Detektions-Limit dieser Methode liegt bei 3×102 KBE (Kolonie bildende Einheiten). Neuere Untersuchungen zeigen jedoch, dass beim Vorhandensein von bestimmten E. coli Stämmen falsch positive Ergebnisse erzielt werden. Die spezifische Problematik dieser Methode nach Rahn et al. (1992) wird durch ein multiples Alignment des invA-Gens gegen andere bakterielle Gensequenzen deutlich. Es zeigt sich dabei, dass insbesondere im Bereich des 5'-Endes des invA-Gens eine hohe Sequenzidentität mit Teilen des Genoms von E. coli besteht. Es wird zudem eine 90 %ige Sequenzidentität zwischen den Genomen von Salmonella und E. coli beschrieben (SALYERS und WHITT, 1994). Diese Sequenzidentitäten zwischen den beiden Spezies können letztendlich, wie im Fall von invA, zu falsch-positiven Ergebnissen in der PCR-Diagnostik führen. Die entstehenden falsch-positiven Amplifikate können eine identische Baasenpaarlänge wie das spezifische PCR Produkt besitzen, so dass die Spezifität durch eine DNA-Hybridisierung überprüft werden muss (Feder et al., 2001).

Olsen et al. (1991) konnten durch Sequenz-Analysen von 20 verschiedenen Salmonella-Serovaren einen 2.3 kb großen DNA-Bereich ermitteln, der eine komplette Basenhomologie in allen Serovaren aufwies. Darauf ausbauend entwickelten Aabo und Mitarbeiter (1993) ein Oligonukleotidpaar, das anhand von 146 Salmonellen-Stämmen und 86 Nicht-Salmonellen-Spezies auf seine Spezifität geprüft wurde. Zwar wurden alle Salmonella-Spezies mittels dieser PCR-Methode korrekt erkannt. Auch die nicht Salmonellen-Spezies darunter 21 E. coli-Isolate zeigten keinerlei positive Amplifikate. Der Nachteil dieser Methode ist allerdings, dass sie auf einem Abschnitt des Genoms von Salmonellen basiert, dessen Funktion bis heute noch nicht bekannt ist und daher durch den Nachweis dieses Genes keine Aussage über die Virulenz des Isolates getroffen werden kann.

Trotz der Vielzahl bereits publizierter PCR-Methoden fehlen diagnostische PCR-Verfahren, die in Proben einen Nachweis von Salmonella mit hoher Sensitivität und Spezifität ermöglichen und somit zu einer Verbesserung der Salmonellen-Diagnostik beitragen.

Daher liegt der Erfindung die Aufgabe zu Grunde, Oligonukleotide bereitzustellen, die als PCR-Primer spezifisch für Salmonella sind und eine gleichzeitige Bestimmung der Virulenz zulassen.

Die Aufgabe wird durch den in den Patentansprüchen definierten Gegenstand gelöst.

Die nachfolgenden Figuren erläutern die Erfindung.

1 zeigt ein Schrittdiagramm für die Probenaufbereitung und DNA-Extraktion aus Gewebeproben nach vorangegangener kultureller Anreicherung.

2 zeigt ein Schrittdiagramm für die DNA-Extraktion aus Gewebeproben vom persistent infizierten Schwein nach vorangegangener kultureller Anreicherung.

3 zeigt in einem Diagramm die prozentualen Nachweisraten von S. Typhimurium DT104 in Gewebeproben von persistent infizierten Meishan-Schweinen. Die schwarzen Balken stellen die prozentuale Nachweisrate der Kulturverfahren nach ISO 6579 dar. Die grauen Balken zeigen den prozentualen Nachweis mit der invA I-PCR-Methode (RAHN et al., 1992) zum Nachweis von Salmonella nach 24stündiger Anreicherung in Pepton-Bouillon. To, Tonsille; Maly, Mandibularlymphknoten; Lu, Lunge; Le, Leber; Mi, Milz; Je, Jejunum; IL, Ileum; Co, Colon; Ca, Caecum; Luly, Lungenlymphknoten; Icly, lnn. Ileocolici; Jely, Jejunallymphknoten; Coly, Colonlymphknoten; Mus, Muskulatur.

4 zeigt in einem Diagramm die prozentualen Nachweisraten von S. Typhimurium DT104 in Gewebeproben von persistent infizierten Hybridschweinen. Die schwarzen Balken stellen die prozentuale Nachweisrate des Kulturverfahrens nach ISO 6579 dar. Die dunkelgrauen Balken zeigen den prozentualen Nachweis mit der invA I-PCR Methode (RAHN et al., 1992) zum Nachweis von Salmonella nach 24stündiger Anreicherung in Pepton-Bouillon. Die hellgrauen Balken zeigen die prozentuale Nachweisrate mit der invA I-PCR-Methode (RAHN et al. 1992) zum Nachweis von Salmonella nach 48stündiger kombinierter Anreicherung in Pepton-Bouillon und RV-Medium. To, Tonsille; Maly, Mandibularlymphknoten; Lu, Lunge; Le, Leber; Mi, Milz; Je, Jejunum; IL, Ileum; Co, Colon; Ca, Caecum; Luly, Lungenlymphknoten; Icly, lnn. Ileocolici; Jely, Jejunallymphknoten; Coly, Colonlymphknoten; Mus, Muskulatur.

5 zeigt das Ergebnis des Nachweises von S. Typhimurium DT 104 in Gewebeproben von einem persistent infizierten Hybridschwein nach einer Agarosegelelektrophorese. 5A zeigt Amplifikate nach invA I-PCR (Rahn et al., 1992), und 5B die Amplifikate nach invA-II-PCR jeweils nach 48 stündiger kombinierter Pepton-Bouillon-RV-Medium-Anreicherung. Jeweils in Spur eins ist der Längenstandard (LS), in Spur zwei die Positiv-Kontrolle (+) und in Spur drei die Negativ-Kontrolle (-) aufgetragen. To, Tonsille; Maly, Mandibular-lymphknoten; Lu, Lunge; Le, Leber; Mi, Milz; Je, Jejunum; IL, Ileum; Co, Colon; Ca, Caecum; Luly, Lungenlymphknoten; Icly, lnn. Ileocolici; Jely, Jejunallymphknoten; Coly, Colonlymphknoten; Mus, Muskulatur; ♦ kennzeichnet unspezifische Produkte der invA I-PCR-Methode. In 5 sind die Unterschiede hinsichtlich der Spezifität zwischen den beiden PCR-Methoden invA I und invA II dargestellt. Das unspezifische Produkte aus der Probe vom Mandibularlymphknoten, von der Lunge, von der Leber und von der Milz läuft etwas höher im Gel als das spezifische Produkt von 284 bp.

6A und B zeigt das Ergebnis der vergleichenden Spezifitätsprüfung der invA I-PCR Methode (Rahn et al., 1992) und der invA II-PCR-Methode anhand von Gewebeproben eines nicht infizierten Kontrolltieres nach einer Agarosegelelektrophorese. Alle Gewebeproben vom Schwein wurden mittels bakteriologischer Methoden (ISO 6579) Salmonella-negativ getestet. Die A zeigt die Amplifikate nach invA I-PCR (Rahn et al., 1992) und die B die Amplifikate nach invA-II-PCR jeweils nach 48stündiger kombinierter Pepton-Bouillon-RV-Medium-Anreicherung. Jeweils in Spur eins ist der Längenstandard (LS), in Spur zwei die Positiv-Kontrolle (+) und in Spur drei die Negativ-Kontrolle (-) aufgetragen. To, Tonsille; Maly, Mandibularlymphknoten; Lu, Lunge; Le, Leber; Mi, Milz; Je, Jejunum; IL, Ileum; Co, Colon; Ca, Caecum; Luly, Lungenlymphknoten; Icly, lnn. Ileocolici; Jely, Jejunallymphknoten; Coly, Colonlymphknoten; Mus, Muskulatur; i kennzeichnet unspezifische Produkte der invA I-PCR-Methode.

7. zeigt das Ergebnis der Spezifitätsprüfung der invA I-PCR-Methode (Rahe et al., 1992) anhand von E. coli-Reinkulturen. Jeweils in Spur eins ist der Längenstandard (LS), in Spur zwei die Positiv-Kontrolle (+) und in Spur drei die Negativ-Kontrolle (-) aufgetragen. 1, E. coli ATCC 11229; 2, E. coli DSMZ 682; 3, E. coli DSMZ 787; 4, E. coli DSMZ 1103; 5 bis 9, E. coli Feldisolate vom Schwein, i kennzeichnet unspezifische Produkte der invA I-PCR-Methode

8A. und B zeigt das Ergebnis des Sensitivitätsvergleich zwischen der invA I-PCR Methode (Rahn et al., 1992) und der invA II-PCR Methode. Die 8A zeigt die Nachweisgrenze der invA I-PCR-Methode, und die B die der invA II-PCR-Methode. Die noch detektierbare Zellzahl pro Reaktionsansatz ist in der Beschriftung der Figuren hervorgehoben. Jeweils in Spur eins ist der Längenstandard (LS), in Spur zwei die Positiv-Kontrolle (+) und in Spur drei die Negativ-Kontrolle (-) aufgetragen.

9 zeigt in einer schematischen Darstellung den Ansatzpunkt der PCR-Methode auf dem invA-Gen von Salmonella.

Amplifikationsbereich der invA PCR-Methode (Oligonukleotide invA-sal-F1 und invA-sal-R1)

10 zeigt in einer schematischen Darstellung die unterschiedlichen Ansatzpunkte der invA I und invA II-PCR-Methoden auf dem invA-Gen von S. Typhimurium DT104.

Amplifikationsbereich der invA I-PCR-Methode (Oligonukleotide ST 139 und ST 141), Bereich höchster Sequenzidentität mit Teilen des E. coli-Genoms, Amplifikationsbereich der invA II-PCR-Methode (Oligonukleotide invA-sal-F1 und invA-sal-R1)

Der Begriff "Salmonella" wie hier verwendet bedeutet, dass er alle Isolate, Stämme und Subspezies, die das invA-Gen tragen.

Die vorliegende Erfindung betrifft ein Verfahren zum Nachweis von Salmonella, umfassend die aufeinander folgenden Schritte:

  • a) Inkubieren einer Probe in Pepton-Bouillon und anschließend in Rappaport-Vassiliadis-Medium,
  • b) Extrahieren der DNA aus der Probe,
  • c) Zugabe von DNA-Oligonukleotiden als Primer für eine PCR, wobei die DNA-Oligonukleotide jeweils eine Sequenz aufweisen, die spezifisch für Salmonella ist und nicht mit Sequenzen anderer Organismen kreuzreagieren können,
  • d) Durchführen einer Polymerase-Kettenreaktion (PCR),
  • e) Durchführen einer DNA-Spaltung mit einem Restriktionsenzym, das eine Erkennungssequenz aufweist, die mindestens einmal in dem durch Schritt d) erzeugten DNA-Amplifikat vorkommt, und Nachweisen der durch die DNA-Spaltung erhaltenen DNA-Fragmente.

Eine wesentliche Vorraussetzung, um pathogene Mikroorganismen aus unterschiedlichen Untersuchungsproben mit hoher Sensitivität nachzuweisen, ist die effiziente Aufarbeitung des Probenmaterials (Inkubation). Im ersten Schritt muss somit gewährleistet werden, dass die potentiell im Probenmaterial vorhandenen Salmonellen optimal angereichert werden, um im nächsten Schritt, der Gewinnung der Nukleinsäuren, ausreichende Konzentrationen an Nukleinsäure zu gewährleisten. Da diese beiden Schritte im Vergleich zur eigentlichen PCR sehr zeitaufwendig sind, ist eine Automatisierung der Anreicherung, sowie der Extraktion der Nukleinsäuren bevorzugt. Eine weitgehende Automatisierung der PCR kann durch die Etablierung einer Real-Time PCR, optimiert für die erfindungsgemäßen DNA-Oligonukleotidprimer, erreicht werden. Eine Automatisierung aller drei Prozessstufen, der Anreicherung, der Nukleinsäureextraktion und der PCR, ermöglicht ein effizientes und hoch standardisiertes Verfahren zum Nachweis von Salmonella.

Die Inkubation kann mit unterschiedlichen Proben, wie Gewebeproben, Umweltproben und Lebensmittelproben erfolgen. Die verwendete Probe ist vorzugsweise Gewebe von Schlachttieren, z.B. Geflügel aller An, Rinder, Schweinen, Schafe, oder Fleischsaft oder Blut dieser Tiere, oder verschiedenste Lebensmittel und Produkte tierischer Herkunft, z.B. Wurst, Hackfleisch. Vorzugsweise wird die Probe für die Inkubation zerkleinert. Als Nährmedium für die Vorinkubation wird Pepton-Bouillon verwendet. Die Inkubation erfolgt vorzugsweise bei 37°C für 24 Stunden unter aeroben Bedingungen. Anschließend wird in einem zweiten Medium, nämlich Rappaport-Vassiliadis (RV)-Medium, die Probe selektiv angereichert. Dazu können Aligouts der Probe aus dem ersten Medium, z.B. 100 μl, überführt und dann im zweiten Medium inkubiert werden, vorzugsweise für 24 Stunden bei 42 °C. Anschließend erfolgt eine übliche DNA-Extraktion.

Die Sequenzen der Oligonukleotidprimer sind für das erfinderische Verfahren wesentlich. Daher ist insbesondere darauf zu achten, dass die Sequenzen nicht bei den zu untersuchenden Schlachttieren oder den Tieren, aus denen die zu untersuchenden Lebensmittel hergestellt wurden, vorkommen. Ferner ist darauf zu achten, dass die Sequenzen nicht mit Sequenzen aus anderen, nicht Salmonella-artigen Mikroorganismen stammen. Nur so kann eine zuverlässige, hoch spezifische PCR-Diagnostik gewährleistet werden. Durch die z.B. 90%ige DNA-Sequenzhomologie zwischen Salmonella spp. und E. coli, muss insbesondere die Spezifität hinsichtlich verschiedener E. coli-Isolate beachtet werden. Da E. coli zur normalen Fäkalflora bei Mensch und Tier gehört, wäre eine Kreuzreaktivität der Oligonukleotidprimer von erheblichem Nachteil. Vorzugsweise stammen die Sequenzen für die erfindungsgemäßen Oligonukleotidprimer von der Sequenz des Salmonella invA-Gens (M90846, European Bioinformatics Institut, http://srs6.ebi.ac.uk/srs6bin/cgi-bin/wgetz) ab. Besonders bevorzugt stammen die Oligonukleotidprimer vom 3'-Ende des invA-Gens, da es Überschneidungen mit dem Genom von E. coli im besonderen Maße im Bereich des 5'-Endes des invA-Gens gibt. Insbesondere bevorzugt weisen die Oligonukleotidprimer eine Sequenz gemäß SEQ ID NO:1 (invA-sal-F1) und SEQ ID NO:2 (invA-sal-R1) oder deren Derivate auf.

Das erfindungsgemäße spezifische Oligonukleotidprimerpaar (invA-sal-F1 und invA-sal-R1) amplifiziert ein 443 bpgroßes Produkt im Bereich des 3'Endes des invA-Gens. Das Amplifikat enthält eine Erkennungsstelle für die Restriktionsendonuklease Nde I, um die Spezifität des Amplifikates mit Hilfe eines Restriktionsverdaus kontrollieren zu können. Die Restriktionsendonuklease Nde I spaltet das spezifische Amplifikat in zwei DNA-Fragmente mit einer Größe von jeweils 247 bp sowie 196 bp.

Die erfindungsgemäße Verfahren ermöglicht es, Salmonella in verschiedensten Gewebeproben von Schlachttieren mit hoher Spezifität und Sensitivität nachzuweisen. Diese neue, auf dem 3'-Ende des invA-Gens basierende Nachweismethode, ist insbesondere auch im Hinblick auf die neue Salmonellose-Verordnung (Polten, 2002) von besonderem Interesse, wenn es darum geht, serologisch positive Salmonellose-Befunde bei Schlachtschweinen abzusichern. Insbesondere die Ergebnisse von Fleischsaft-ELISA-Systemen, die oft auf sehr unterschiedlichen Antigenen basieren und daher nur eine geringe Korrelation untereinander aufweisen (Van der Heijden, 2001), lassen sich mit dieser Methode verifizieren.

Das erfindungsgemäße Verfahren konnte im Vergleich zur Bakteriologie nach ISO 6579 und im Vergleich zur PCR-Methode nach DIN 10135 an Organen von experimentell infizierten Schlachtschweinen etabliert werden. Es ist demnach besonders geeignet, Schlachtschweine am Schlachthof zu erfassen, die mit Salmonellen kontaminiert sind. Da das erfindungsgemäße Verfahren im Vergleich zu Deutschen und Internationalen Standards etabliert wurde, kann es auch als Referenzmethode für etwaige neu zu etablierende Testsysteme verwendet werden. So eignet sich das Verfahren als Referenzverfahren besonders, wenn es darum geht verschiedene neue serologische Testssysteme zu etablieren bzw. mit ihnen zu vergleichen. So kann das erfindungsgemäße Verfahren im Hinblick auf die neue Salmonellose-Verordnung als Referenzmethode eingesetzt werden, wenn eindeutig und auch auf genomischer Ebene festgestellt werden soll, ob Schlachtkörper als Salmonella-positiv zu bewerten sind oder nicht.

Ein weiterer wesentlicher Vorteil des erfindungsgemäßen Verfahrens liegt darin, dass die Funktion des invA-Gens, das die Grundlage des erfindungsgemäßen Verfahrens darstellt, als wichtiger Virulenzfaktor für die Invasivität von Salmonella bewiesen ist. Daher lässt der Nachweis dieses Gens gleichzeitig auch Rückschlüsse auf die Invasivität und damit die Virulenz des Isolates zu.

Die folgenden Beispiele erläutern die Erfindung und sind nicht als einschränkend aufzufassen. Sofern nicht anders angegeben, wurden molekularbiologische Standardmethoden verwendet, wie z.B. von Sambrook et al., 1989, Molecular cloning: A Laboratory Manual 2. Auflage, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, beschrieben.

Beispiel 1:

Die Infektionsversuche fanden im voll klimatisierten Versuchstierstall des Institutes für Tierhygiene und Öffentliches Veterinärwesen an der Veterinärmedizinischen Fakultät der Universität Leipzig statt. Schweine wurden im Alter von sieben Wochen über eine Magensonde (Fa. Rüsch, Kernen) mit S. Typhimurium DT104 (Stammsammlung des Instituts für Mikrobiologie der Veterinärmedizinischen Fakultät der Universität Leipzig, MARG et al., 2001) infiziert. Für den Infektionsversuch mit S. Typhimurium DT104 wurde die Übernachtkultur in LB-Bouillon auf 1×1011 Kolonie bildende Einheiten (KBE) pro Infektionsdosis eingestellt. Die jeweilige Keimzahl wurde den Probanden in einem Gesamtvolumen von 20 ml PBS verabreicht.

Beispiel 2: Probenmaterial aus Infektionsversuchen mit S. Typhimurium DT 104

Zur kulturellen Untersuchung und zur Evaluierung der für Salmonellen spezifischen PCR-Nachweismethoden standen Gewebeproben aus zwei Infektionsversuchen und aus einer Negativ-Kontrollgruppe zur Verfügung. In einem ersten Versuch wurden 84 Gewebeproben von sechs experimentell mit S. Typhimurium DT104 infizierten chinesischen Meishan-Schweinen (Tierexperimentellen Station „Unterer Lindenhof", Universität Hohenheim, REINER et al. 2002) entnommen. Alle Tiere entwickelten innerhalb von zwei Tagen nach experimenteller Infektion mit S. Typhimurium DT104 klinische Symptome einer akuten Salmonellose mit profusem gelblichen Durchfall, Fieber und Inappetenz. Kulturell waren sämtliche Schweine nach der Infektion in den Faeces-Proben Salmonella positiv, über den Versuchszeitraum schied jedes Tier auch Salmonellen aus. Zwei der sechs Tiere verstarben vor dem festgesetzten Schlachttermin, die Abgänge erfolgten drei und fünf Tage nach der Infektion unter den Symptomen einer akuten Salmonellose. Die restlichen vier Tiere wurden wie geplant 14 Tage nach experimenteller Infektion geschlachtet. Zum Zeitpunkt der Schlachtung zeigten die vier Tiere keine klinischen Symptome einer Erkrankung mehr, schieden aber noch vereinzelt Salmonellen aus. Damit waren sie zu diesem Zeitpunkt persistent infiziert.

Für die zweite Versuchsreihe standen 336 Gewebeproben von 24 experimentell mit S. Typhimurium DT104 infizierten Hybridschweinen (Landschwein × Edelschwein) (Hybridzucht des Bundeshybridzuchtprogramms (BHZP), Züchtungszentrale Lüneburg, REINER et al. 2002) zur Verfügung. Alle Tiere zeigten bis etwa sieben Tage nach experimenteller Infektion mit S. Typhimurium D7104 klinische Symptome einer akuten Salmonellen-Infektion mit erhöhter Körpertemperatur, Durchfall und vermindertem Allgemeinbefinden. Keines der Tiere verstarb im Verlaufe des Versuches, obgleich alle Schweine über den Versuchszeitraum bakteriologisch positiv gewesen waren. Klinische Symptome waren am Tag der Schlachtung nicht mehr feststellbar. Die Tiere waren demnach persistent infiziert.

Als Negativ-Kontrollen dienten 98 Gewebeproben von sieben nicht infizierten Hybridschweinen aus dem gleichen Salmonella-freien Herkunftsbestand, aus dem die Tiere der zweiten Infektionsgruppe stammten. Von sämtlichen Tieren der drei Versuchsgruppen wurden zum Zeitpunkt der Schlachtung jeweils die in Tabelle 2 aufgeführten Gewebeproben entnommen. Eine Übersicht der durchgeführten Infektionsversuche, aus denen Gewebeproben für die Untersuchungen dieser Arbeit entnommen werden konnten, zeigt Tabelle 1.

Tabelle 1. Infektionsversuche
Tabelle 2. Gewebeproben zur S. Typhimurium DT104- Diagnostik von persistent infizierten Schlachtschweinen

Beispiel 3: Oligonukleotide zum Nachweis von Salmonellen

Für die Salmonella-PCR-Diagnostik wurden zwei verschiedene Oligonukleotidpaare, die auf dem invA-Gen basieren, verwendet. Die Oligonukleotide sind in Tabelle 3 aufgeführt. Um beide PCR-Methoden im weiteren Verlauf der Untersuchung unterscheiden zu können, wurde die auf dem Bereich des 5'Endes des invA-Gens basierende Methode nach RAHN et al. (1992) als invA I-PCR (Oligonukleotide ST 139 und ST 141) bezeichnet und die erfindungsgwemäßen Oligonukleotide, die auf dem Bereich des 3'Endes des invA-Genes basieren, als invA II-PCR (Oligonukleotide invA-sal-F1 und invA-sal-R1).

Tabelle 3. Ausgewählte Oligonukleotidsequenzen für die Salmonella-Diagnostik in Gewebeproben vom persistent infizierten Schlachtschwein

Beispiel 4: Diagnostik von Salmonella1. Kulturelle Diagnostik

Die bakteriologische Untersuchung der Gewebeproben erfolgte nach der ISO 6579 mit den nachfolgend aufgeführten Änderungen. Dazu wurde das Organmaterial (Tabelle 2) steril entnommen, in Spiritus getaucht, im Labor über einem Bunsenbrenner abgeflammt und jeweils 5 g in 25 ml Pepton-Bouillon (Fa. Merck, Darmstadt, Deutschland) eingewogen. Anschließend wurde das Material bei höchster Stufe für 2 Min im Stomacher 400 (Fa. Seward, London, UK) in einem Stomacherbeutel (Fa. Seward, London, UK) homogenisiert und dann bei 37 °C für 24 Stunden im Beutel aerob bebrütet. Danach wurden aus der Pepton-Bouillon-Voranreicherung zweimal 100 μl entnommen und in jeweils ein neues Reagenzröhrchen mit 9,9 ml Rappaport-Vassiliadis (RV)-Medium (Fa. Merck, Darmstadt) überführt und für 24 Stunden bei 42 °C inkubiert. Beide Ansätze im RV-Medium wurden nach dem Bebrüten jeweils auf XLD- und BPLS-Agarmedium (Fa. Merck, Darmstadt) mittels Glasstab ausgestrichen und bei 37 °C für 24 Stunden inkubiert. Nach 24 Stunden wurden potentiell positive Kolonien mittels Objektträgerschnellagglutination bestätigt (Agglutinationsseren von der Firma Sifin, Berlin).

1. Nachweis mittels PCR-Methode

Für den spezifischen Salmonella Nachweis in Gewebeproben von Schlachtschweinen wurden die in Tabelle 3 aufgeführten Oligonukleotide als Primer verwendet. Das Kontroll-Oligonukleotidpaar (inv-A I-PCR) basiert auf einem Bereich nahe des 5'-Endes des invA-Gens von S. Typhimurium. Die Amplifikation liefert ein 284 bp großes Produkt. Ein wesentlicher Nachteil des Nachweises mit den Kontroll-Oligonukleotiden besteht darin, dass der Bereich am 5'-Ende des invA-Gens von S. Typhimurium hohe Übereinstimmungen mit bestimmten Bereichen des Genoms von E. coli besitzt.

Das erfindungsgemäße Oligonukleotidpaar (invA-sal-F1 und invA-sal-R1, Tabelle 3) amplifiziert ein 443 bp großes Produkt im Bereich des 3'Endes des invA-Gens. Die Lokalisation des Amplifikationsbereiches der beiden PCR-Methoden innerhalb der invA-kodierenden Region ist schematisiert in 10 dargestellt. Bei der Konstruktion erfindungsgemäßen Oligonukleotide für die invA II-PCR-Methode wurde insbesondere auf Schnittstellen für Restriktionsendonukleasen geachtet, um die Spezifität des späteren Amplifikates mit Hilfe eines Restriktionsverdaus auch kontrollieren zu können. Zur Überprüfung der Spezifität des 443 bp großen Produktes wurde deshalb die Restriktionsendonuklease Nde I ausgewählt. Sie spaltet das spezifische Produkt in zwei Amplifikate mit einer Größe von 247 bp sowie 196 bp.

2. Spezifitätsprüfungen und Sensitivitätsprüfungen der PCR-Methoden

Die Spezifitätsprüfung der beiden zum Salmonella-Nachweis eingesetzten PCR-Verfahren erfolgte anhand von Bakterien-Reinkulturen. Für die Spezifitätsprüfung wurden ausgewählte Referenzstämme und Feldisolate eingesetzt (Tabelle 5). Jeweils eine Kolonie wurde mit einer Öse von der Agarmedium-Platte abgehebert und in 500 μl Aqua bidest. in einem 1,5 ml Eppendorf-Reaktionsgefäß (Fa. Eppendorf, Köln) zu einer homogenen Suspension vermischt. Die Suspension wurde dann bei 94 °C für 10 Min im Wasserbad erhitzt, anschließend bei 13.000 x g für 5 min abzentrifugiert und bei 4 °C gelagert. Jeweils 3 μl des Überstandes wurden als Template für jeden 50 μl PCR-Ansatz eingesetzt. Insgesamt wurden 12 Salmonella-Stämme getestet sowie 36 Nicht-Salmonella-Spezies, welche durch ihr Vorkommen beim Schwein tierartspezifisch von diagnostischer Relevanz sind.

Zum Vergleich der Sensititvität der invA I-PCR- und der invA II-PCR-Methode wurde eine logarithmische Verdünnungsreihe von 107 absteigend auf 100 GKZ/ml einpipettiert. Dafür wurde der als Infektionsstamm ausgewählte vom Schwein isolierte S. Typhimurium DT104-Stamm verwendet. Von jeder Verdünnungsstufe wurde jeweils 1 ml in ein 1,5 ml Eppendorf-Reaktionsgefäß überpipettiert und bei 13.000 x g für 5 Min abzentrifugiert, der Überstand dann vorsichtig abpipettiert und verworfen. Das Pellet wurde anschließend in 1 ml Lysis-Puffer, der sich aus 0,2 mg/ml Proteinase K (Fa. AppliChem, Darmstadt) und 0,025 % Tween 20 (Fa. Fluka Chemie, Steinheim) in Aqua bidest. zusammensetzt, bei 56 °C für 1 Stunde im Thermoblock (Fa. Uniequip, München) inkubiert. Zur Inaktivierung der Proteinase K wurden die Eppendorf-Reaktionsgefäße anschließend direkt nach der Inkubation im Wasserbad für 10 min auf 94 °C erhitzt und bei 13.000 x g für 5 min abzentrifugiert. Jeweils 3 μl des Überstandes wurden pro 50 μl PCR-Ansatz (3 μl Template-DNA und 47 μl Mastermix) zugesetzt.

3. PCR-Bedingungen und Agarose-Gelelektrophorese

Bei dem für die PCR verwendeten Thermocycler handelte es sich um das Modell GeneAmp 2400 PCR-System (Fa. Perkin Elmer, Rodgau-Jügesheim). Alle Reaktionen wurden in einem Volumen von 50 μl pro PCR-Ansatz in 200 μl PCR-Reaktionsgefäßen (Fa. Peglab Biotechnologie GmbH, Erlangen) durchgeführt. Jeder PCP-Ansatz setzte sich aus je 5 μl 10 x PCR-Reaktionspuffer (Fa. Roche, Mannheim), 5 μl 2 mM dNTP-Mix (Fa. Hybaid, Franklin), 10 pmol von jedem Primer (Fa. VBC-Genomics, Wien, Österreich) sowie 3 μl bzw. 10 μl Template und dementsprechend 34,8 μl bzw. 27,8 μl Aqua bidest. zusammen. Bei jedem Reaktionsansatz wurde eine Positiv- sowie eine Negativ-Kontrolle mitgeführt. In der Positiv-Kontrolle wurde als Template reine DNA des Infektionsstammes S. Typhimurium DT104 eingesetzt. Als Negativ-Kontrolle diente ein PCR-Ansatz wie oben beschrieben nur ohne Template.

Die von RAHN et al. (1992) für ihre PCR-Methode angegebenen Zyklusbedingungen mit einem vorangestellten Inkubations-Schritt von 72 °C für 7 min, gefolgt von 35 Zyklen mit jeweils 1 min Denaturierung bei 94 °C, 2 min Annealing bei 53 °C und 3 min Extension bei 72 °C, sowie abschließendem Inkubationsschritt für 7 min bei 72 °C wurden anhand von 17 Bakterien-Reinkulturen (9x Salmonella-Spezies., Y. enterocolitica, Y. pseudotuberculosis, Enterococcus faecalis, 3 x Escherichia coli, Pseudomonas aeruginosa, Proteus mirabilis) optimiert. Die in Tabelle 5 aufgeführten PCR-Bedingungen begannen jeweils mit einem Denaturierungsschritt von 5 min und endeten in einem finalen Extensionschritt von 7 min. Die elektrophoretische Auftrennung der PCR-Produkte wurde in einem 2 %igen (v/v) Agarose-Gel durchgeführt. Dazu wurden 4 g Agarose (Fa. Life Technologies, Paisley, Schottland) mit 200 ml TBE-Puffer gemischt, im Mikrowellenherd verflüssigt und davon 30 ml in die Gelkammer (Fa. Biorad, München) gegossen. Für die Elektrophorese wurde die Gelkammer mit jeweils 350 ml TBE-Puffer befüllt.

Tabelle 4. Zyklusbedingungen der zum Nachweis von Salmonellen eingesetzten PCR-Methoden invA I und invA II.

Beispiel 5:1. Untersuchung von Gewebeproben auf Salmonella mittels PCR

Die Untersuchung der Gewebeproben auf Salmonella mit der PCR erfolgte nach DIN 10135 mit den nachfolgend beschriebenen Abänderungen. Wie vorstehend beschrieben, standen 84 Gewebeproben für einen ersten Versuch zur Verfügung. Bei diesen Proben wurde nach 24 stündiger Anreicherung in Pepton-Bouillon 1 ml in ein 1,5 ml Eppendorf-Reaktionsgefäß abpipettiert, und wie beschrieben, aufbereitet. Die Entnahme der Probe für die PCR-Diagnostik erfolgte immer aus dem Anreicherungsmedium für den Kulturversuch. Jeweils 10 μl des Überstandes nach der DNA-Extraktion aus der Voranreicherung wurden als Template im 50 μl PCR-Ansatz eingesetzt. Der PCR-Ansatz setzte sich wie vorstehend beschrieben zusammen. In der ersten Untersuchung von 84 Gewebeproben nach Pepton-Anreicherung wurde nur die invA I-PCR-Methode eingesetzt.

Der Untersuchungsgang bei den 336 Gewebeproben aus dem zweiten Infektionsversuch unterschied sich von dem in der ersten Versuchsreihe, da Erkenntnisse aus dem ersten Infektionsversuch genutzt wurden, um eine der beiden PCR-Verfahren (invA I und invA II) zum Nachweis von S. Typhimurium hinsichtlich Sensitivität und Spezifität zu optimieren. Es konnte im Vorversuch gezeigt werden, dass nach alleiniger Anreicherung in Pepton-Bouillon nur in einigen Organen die gleiche Sensitivität wie mit dem Kulturversuch erreicht werden konnte. Aus diesem Grund wurden die Organe nicht nur nach 24 stündiger Anreicherung in Pepton-Bouillon mittels PCR untersucht, sondern auch nach kombinierter Anreicherung in Pepton-Bouillon und RV-Medium für weitere 48 Stunden, um dadurch die Sensitivität des Verfahrens zu erhöhen.

Von den Gewebeproben des zweiten Versuches wurde deshalb 1 ml aus der Pepton-Anreicherung in ein steriles 1,5 ml Eppendorf-Reaktionsgefäß überführt. Zusätzlich wurden aus den parallelen Ansätzen des RV-Mediums für den Kulturversuch jeweils 500 μl abgenommen und die Aliquots in einem sterilen 1,5 ml Eppendorf-Reaktionsgefäß zusammengeführt. Die Entnahme der Probe für die PCR-Diagnostik erfolgte aus den Anreicherungen für die Bakteriologie. Die Aufbereitung der Probe nach Pepton-Anreicherung erfolgte wie in 2 beschrieben. Bei der Probe aus der RV-Anreicherung wurde allerdings der erste Zentrifugationsschritt weggelassen. Dieser Zentrifugationsschritt erwies sich nur für diejenigen Fälle erforderlich, bei denen grobe Schwebstoffe aus der Anreicherung zu entfernen sind. Da dies aber in der RV-Anreicherung nicht der Fall war, konnte auf diesen Zentrifugationsschritt verzichtet werden.

Da die invA I-PCR national (DIN 10135) und auch international (EU-Projekt :"FOOD-PCR" unter folgender Internet-Adresse: http://www.pcr.dk) als eine Standardmethode anerkannt ist, wurden die Gewebeproben zuerst mittels dieser PCR-Methode nach 24stündiger Anreicherung in Pepton-Bouillon und nach 48stündiger kombinierter Anreicherung in Pepton-Bouillon und RV-Medium untersucht. Es wurden also insgesamt 672 PCRs mit der invA I-PCR durchgeführt. Die Untersuchung der Proben nach Pepton-Anreicherung wurde mit dem Oligonukleotidpaar invA I durchgeführt. Bei bestimmten Proben nach kombinierter Pepton-RV-Anreicherung wurde zusätzlich mit der invA II-PCR-Methode untersucht, da vermeintlich falsch-positive Produkte bei der invA I-PCR amplifiziert wurden. Der Nachweis des jeweiligen Amplifikates erfolgte durch Elektrophorese in einem 2 %igen (v/v) Agarose-Gel und anschließender Färbung im Ethidiumbromid-Bad.

Ein regelmäßig in der invA I-PCR-Methode auftretendes unspezifisches PCR-Produkt wurde mittels PCR-Purification-Kit® (Fa. Qiagen, Hilden) gereinigt, um daraufhin dessen DNA-Sequenz zu bestimmen. Die Ermittlung der Nukleotid-Sequenz erfolgte nach der Dideoxy-Kettenabbruch-Methode und wurde mit einem LI-COR DNA-Sequenzierer, Model 4000® im Auftrag durchgeführt (Fa. VBC-Genomics, Wien, Österreich). Die Sequenz wurde schließlich mit der Computersoftware Wisconsin (Version 8.1, UNIX®) analysiert. Die Amplifikate der invA II-PCR-Methode wurden mit der Restrtktionsendonuklease Nde I hinsichtlich ihrer Spezifität überprüft. Der 20 μl-Ansatz für den Restriktionsverdau setzte sich jeweils aus 3,5 μl Puffer R+ (Fa. Fermentas, St. Leon Rot), 1,7 u1 Enzym Nde I (10 units/u1), 3,5 u1 PCR-Produkt und 11,3 Aqua bidest. zusammen. Der Ansatz wurde bei 37 °C für 1,5 Stunden in einem 200 μl PCR-Reaktionsgefäß im Thermocycler inkubiert. Nach der Elektrophorese im 2 %igen (v/v) Agarose-Gel und anschließender Färbung im Ethidiumbromidbad, konnten die Fragmente ebenfalls in ihrer Größe mit dem Längenstandard verglichen werden.

ErgebnisseDiagnostik von S. Typhimurium DT104 in infizierten Meishan-Schweinen

In einem ersten Versuch wurden 84 Gewebeproben von sechs infizierten Meishan-Schweinen gewonnen. Die Gewebeproben wurden zum Zeitpunkt der Schlachtung steril entnommen und mittels bakteriologischer Methode nach ISO 6579 und vergleichend mittels invA I-PCR-Methode nach 24stündiger Pepton-Anreicherung untersucht. Die bakteriologische Untersuchung der Proben ergab, dass es Gewebe gibt, in denen bei sämtlichen Tieren S. Typhimurium nachgewiesen werden konnte. Bei diesen Organen handelte es sich um Mandibularlymphknoten, Ileum, Colon, Caecum, Lnn. ileocolici und Colonlymphknoten. Bei denjenigen Schweinen, die mit dem klinischen Bild einer akuten Salmonellose verstarben, konnte S. Typhimurium DT104 sogar in sämtlichen entnommenen Organen kulturell nachgewiesen werden. Dies galt insbesondere auch für die Gewebe, bei denen in den persistent infizierten Tieren kein Nachweis möglich war, dazu gehörten Lunge, Lungenlymphknoten, Leber, Milz und Muskulatur. Die Nachweisraten der beiden Methoden unterschieden sich in den verschiedenen Organen, wie 3 zeigt, erheblich.

Die Nachweisraten der beiden Verfahren waren in Lunge, Jejunum, Ileum, Colon und Caecum nicht gleich. Es konnte bei dieser Untersuchung gezeigt werden, dass sich insbesondere die lymphatischen Organe wie Mandibularlymphknoten, Lnn. ileocolici und Colonlymphknoten (3) zum Nachweis einer S. Typhimurium-Infektion beim Meishan-Schwein eignen, wenn man die invA I-PCR-Methode nach 24stündiger Anreicherung in Pepton-Bouillon anwendet. In diesen Geweben war mittels der PCR-Methode und auch dem Kulturversuch ein Nachweis von S. Typhimurium bei allen Tieren möglich. Hier berechnet sich für die PCR-Methode nach 24stündiger Pepton-Anreicherung für die 36 untersuchten lymphatischen Organe (Tonsille, Mandibularlymphknoten, Lungenlymphknoten, Lnn. ileocolici, Jejunallymphknoten und Colonlymphknoten) eine 100 %ige Sensitivität, bei 100 %iger Spezifität.

Bei den jeweiligen Schweinen, die unter den Symptomen einer akuten Salmonellose verstorben waren, gelang der Nachweis mittels invA I-PCR-Methode in allen Gewebeproben. So konnten die Ergebnisse der bakteriologischen Untersuchung durch die invA I-PCR-Methode bestätigt werden. Der Nachweis von S. Typhimurium in anderen Geweben war allerdings über eine 24stündige Anreicherung in Pepton-Bouillon und anschließender invA I-PCR-Methode nicht mit befriedigender Sensitivität möglich. Dies betrifft insbesondere den Nachweis in Lunge, Jejunum, Ileum, Colon und Caecum (3). In diesen Geweben war die kulturelle Diagnostik der invA I-PCR-Methode hinsichtlich ihrer Sensitivität überlegen, da die PCR-Methode bei 24 untersuchten Proben lediglich eine Sensitivität von 36 % bei 100 % Spezifität aufwies. Bei einigen Gewebeproben waren auch unspezifische PCR-Produkte erkennbar, die aber nicht zu einer Verwechslung mit dem spezifischen PCR-Produkt von 284 bp führten, da sie deutlich größer waren als das erwartete PCR-Produkt. Die invA I-PCR-Methode nach 24stündiger Anreicherung in Pepton-Bouillon erbrachte bei 84 untersuchten Proben eine Sensitivität von 79 % bei einer Spezifität von 100 % für den Nachweis von S. Typhimurium in den Geweben vom Meishan-Schwein. Das bedeutet, dass der Kulturversuch der PCR-Methode nach Anreicherung in Pepton-Bouillon hinsichtlich der Sensitivität überlegen ist, wenn man alle Gewebe der persistent infizierten Schweine in eine Bewertung einbezieht.

Diagnostik von S. Typhimurium DT104 in persistent infizierten Schweinen Für die Untersuchung der 336 Gewebeproben von 24 experimentell infizierten Hybridschweinen wurden neben der bakteriologische Methode (ISO 6579) auch die PCR-Verfahren invA I und invA II vergleichend geprüft. Der Vergleich der Ergebnisse der PCR-Methode nach 24stündiger Anreicherung in Pepton-Bouillon, sowie nach 48stündiger kombinierter Anreicherung in Pepton-Bouillon und RV-Medium mit der kulturellen Untersuchungsmethode zeigte, dass nach Anreicherung in Pepton-Bouillon in keinem Gewebe die Sensitivität der bakteriologischen Verfahrensweise erreicht werden konnte. Erst nach kombinierter Anreicherung in Pepton-Bouillon und RV-Medium für 48 Stunden kann die Sensitivität des Kulturversuches erreicht und in Ileum und Jejunum sogar übertroffen werden (4). Für die PCR-Analyse nach Anreicherung in Pepton-Bouillon errechnete sich eine Sensitivität von 58 % bei 100 %iger Spezifität, bei insgesamt 336 untersuchten Proben. Entnimmt man dagegen die Proben für die PCR nach kombinierter Pepton Bouillon-RV-Medium-Anreicherung, errechnete sich für dieses Verfahren eine 100 %ige Sensitivität für die PCR und eine Spezifität von 96 %.

Die in der PCR-Diagnostik positiven, aber in der Bakteriologie negativen Proben wurden zur Abklärung auch mit der invA II-PCR-Methode untersucht. Auch mit dieser Methode konnte das für das verwendete Oligonukleotidprimerpaar spezifische Produkt von 443 bp amplifiziert werden. Die 443 bp großen Amplifikate aus Ileum und Jejunum-Proben wurden zusätzlich erfolgreich mit der Restriktionsendonuklease Nde I geschnitten. So konnte das Testergebnis nochmals verifiziert werden. Die Auswertung der bakteriologischen Diagnostik und der PCR-Ergebnisse im Hinblick auf einen Erregertropismus ergab zwei Gewebeproben, bei denen 96 % (23 von 24 Tiere) der Tiere als Salmonella-positiv identifiziert werden konnten. So erwies sich das Caecum und die Lnn. ileocolici als geeignete Probenahmelokalisation für die S. Typhimurium DT104-Diagnostik im persistent infizierten Tier. Berücksichtigte man nur die PCR-Diagnostik-Ergebnisse aus einer 48stündigen kombinierten Anreicherung in Pepton-Bouillon und RV -Medium, dann eignete sich auch eine Kombination aus Caecum und Ileum, um 96 % aller Tiere als Salmonella-positiv zu identifizieren. Das eine Schwein, welches nicht durch eine der genannten Organkombinationen erfasst werden konnte, war kulturell und mittels PCR-Methode lediglich im Jejunallymphknoten Salmonella-positiv.

Bei acht der insgesamt 24 untersuchten Tiere wurden nach 48 Stunden kombinierter Anreicherung in Pepton-Boillon und RV-Medium in den unterschiedlichsten Gewebeproben auch unspezifische Produkte amplifiziert. Diese acht Tiere sowie vier weitere Schweine, die eindeutig positiv in der invA I-PCR waren, wurden zur Abklärung und zum Vergleich der Spezifität der beiden Oligonukleotidpaare mit dem invA II-Oligonukleotidprimerpaar nach kombinierter Pepton-Bouillon-RV-Medium-Anreicherung untersucht. Bei allen Geweben der acht untersuchten Tiere, die ein unspezifisches aber vermeintlich positives Produkt aufwiesen, konnte mit der invA II-PCR-Methode kein positives und auch kein unspezifisches Amplifikat nachgewiesen werden. Ein Beispiel für die unspezifischen Amplifikate und den Vergleich der Spezifität zwischen der invA I- und invA II-PCR-Methode aus den Geweben eines experimentell mit S. Typhimurium DT104 infizierten Tieres zeigt 5. Die Spezifität des 448 bp großen Produktes der invA II-PCR wurde mit der Restriktionsendonuklease Nde I überprüft.

Prüfung der Kontrollgruppe auf Salmonella

Die 98 Gewebeproben der Negativ-Kontrollgruppe wurden mittels kultureller Methoden (ISO 6579) und durch die invA-I- und invA-II-PCR-Methode nach kombinierter Anreicherung in Pepton-Bouillon und RV-Medium vergleichend untersucht. Sämtliche 98 untersuchten Gewebeproben wurden in der kulturellen Untersuchung Salmonella-negativ getestet. Die Untersuchung der Gewebe der Salmonella-negativ getesteten Tiere mit den PCR-Verfahren konnte die bereits für die Gewebeproben von experimentell infizierten Tieren gezeigte ungenügende Spezifität der invA-I-PCR-Methode bestätigen. Bei allen kulturell-negativ getesteten Tieren gab es einige Gewebestrukturen, bei denen wieder ein unspezifisches PCR-Produkt amplifiziert wurde. Dies war nur geringfügig größer als das spezifische Amplifikat von 284 bp. Untersuchte man die Gewebeproben dieser Tiere jedoch mit der invA-II-PCR-Methode wurde weder ein spezifisches Amplifikat noch ein unspezifisches Produkt amplifiziert. Ein Beispiel für die PCR-Ergebnisse aus den Gewebeproben eines Salmonella-negativen Schweines zeigt 6.

Um sicher zu gehen, dass es sich bei den in 6 (Mit einer Raute gekennzeichnete Amplifikate) markierten Amplifikaten wirklich um unspezifische Produkte handelte, wurde das vermeintlich unspezifische PCR-Produkt aus dem Mandibularlymphknoten gereinigt und im Auftrag bei der Firma Genomics in Wien ansequenziert. Das Resultat der Sequenzierung wurde mit der Gendatenbank des EMBL (European Bioinformatics Institute) verglichen. Als Ergebnis war eine 91 %ige Übereinstimmung mit dem membrangebundenen Transglycosylase-Gen von Escherichia coli mit der Accession-Nummer EC18785 feststellbar. Zur Verifizierung der Ergebnisse der Sequenzierung, die mit nur 91 % keine optimale Übereinstimmung mit dem Transglykosylase-Gen erbrachte, wurde DNA von neun verschiedenen E. coli-Stämmen als Template in einem 50 μl PCR-Ansatz mit den Oligonukleotiden der invA I-PCR-Methode eingesetzt. Bei der Untersuchung der E. coli- Reinkulturen traten die unspezifischen Amplifikate des für Salmonellen spezifischen invA I-Oligonukleotidpaares wieder auf, allerdings nicht bei allen E. coli-Stämmen (7).

Spezifitätsprüfung der invA II-PCR-Methode

Die Spezifitätsprüfung der in dieser Arbeit neu entwickelten invA II PCR-Methode erfolgte anhand von Bakterien-Reinkulturen. Die invA I- PCR nach Rahn et al. (1992) wurde von dieser Arbeitsgruppe an einer Vielzahl von Reinkulturen getestet, die sowohl Salmonella als auch diverse andere Enterobacteriaceae beinhalteten. Aus diesem Grund wurde dieses Oligonukleotidpaar in dieser Arbeit nicht erneut auf seine Spezifität hin überprüft. Lediglich eine Optimierung der PCR-Bedingungen an 17 Reinkulturen war erforderlich, da bei Anwendung der PCR-Bedingungen nach RAHM et al. (1992) bei 9 Salmonella-Spezies das spezifische PCR-Produkt von 284 bp optimal amplifiziert wurde, jedoch bei Y. pseudotuberculosis, Enterococcus faecalis und E. coli ATCC 11229 auch unspezifische Produkte amplifiziert worden waren. Durch Optimierung der PCR-Bedingungen gelang es, die Amplifikation unspezifischer Produkte bei Y. pseudotuberculosis, Enterococcus faecalis und E. coli (ATCC 11229) zu verhindern und die Spezifität für Salmonella zu erhalten. Daraufhin wurden die optimierten PCR-Bedingungen von 35 Zyklen zu 30 sec Denaturierung bei 94 °C, 30 sec Annealing bei 64 °C und 30 sec Extension bei 72 °C eingesetzt.

Die Spezifitätsprüfung der invA II-PCR-Methode wurde anhand von 48 verschiedenen Isolaten (überwiegend Referenzstämme) durchgeführt. In Tabelle 6 sind alle geprüften Stämme aufgeführt. Bei allen 12 getesteten Salmonella-Serovaren konnte das spezifische Amplifikat von 443 bp amplifiziert werden. Unspezifische Produkte traten bei den neun getesteten E. coli-Stämmen nicht auf. Nur bei Y. intermedia und Y. aldovae waren PCR-Produkte erkennbar. Bei Y. intermedia waren es zwei unspezifische Produkte mit einer Größe von ungefähr 500 bp und 100 bp und bei Y. aldovae ein Produkt mit einer Größe von etwa 300 bp. Diese unspezifischen Produkte unterschieden sich im Agarose-Gel deutlich von dem spezifischen Amplifikat von 443 bp.

Tabelle 6. Spezifitätsprüfung der invA II-PCR-Methode anhand von Bakterien-Reinkulturen. Ein Amplifikation des spezifischen 443 bp großen Produktes der invA II-PCR ist als + gekennzeichnet, keine Amplifikation als – und die Amplifikation unspezifischer Produkte als (-)

Sensitivität der PCR-Methoden zur Salmonellen-Diagnostik Die Überprüfung und insbesondere der Vergleich der Sensitivität der PCR-Verfahren invA I und invA II erfolgte anhand einer logarithmisch absteigenden Verdünnungsreihe von S. Typhimurium DT 104. Für beide Oligonukleotidpaare konnte die gleiche Nachweisgrenze bei einer Keimzahl von 103 Zellen pro Reaktionsansatz festgestellt werden.

Literatur
  • 1. Aabo, S., Rasmussen, O. F., Rossen, L., Sorensen, P. D., Olsen, J. E. (1993): Salmonella identification by the polymerase chain reaction. Mol. Cell. Probes 7, 171-178.
  • 2. Feder, I., Nietfeld, J. C., Galland, J., Yeary, T., Sargeant, J. M., Oberst, R., Tamplin, M. L., Luchansky, J. B. (2001): Comparison of cultivation and PCR-hybridisation for detection of Salmonella in porcine fecal and water samples. J. Clin. Microbiol. 39, 2477-2484.
  • 3. Galan, J. E., und Curtiss, R. 3rd (1991): Distribution of the invA, -B, -C, and -D genes of Salmonella typhimurium among other Salmonella serovars: invA mutants of Salmonella typhi are deficient for entry into mammalian cells. Infect. Immun. 59, 2901-2908.
  • 4. Marg, H., Scholz, H. C., Arnold, Th., Rösler, U., Hensel, A. (2001). Influence of long-time transportation stress on re-activation of Salmonella Typhimurium DT104 in experimentally infected pigs. Berl. Münch. Tierärztl. Wchschr. 114:385-388.
  • 5. Olsen, J. E., Aabo, S., Nielsen, E. O., Nielsen, B. B. (1991): Isolation of a Salmonella-specific DNA hybridization probe. Acta Path. Microbiol. Immun. Scand. 99, 114-120.
  • 6. Polten, B. (2002): Entwurf einer Verordnung zur Verringerung des Salmonelleneintrags durch Schlachttiere bei der Fleischgewinnung. In: Gropp, J., Ribbeck, R. (Hrsg.): Kongressband des zweiten Leipziger Tierärztekongresses, Leipzig, 127-128.
  • 7. Rahn, K., De Grandis, S. A., Clarke, R. C., McEwen, S. A., Galan, J. E., Ginocchio, C., Curtiss, R. 3rd, Gyles, C. L. (1992): Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol. Cell. Probes. 6, 271-279.
  • 8. Reiner, G., Melchinger, E., Büttner, M., Saalmüller, A., Pfaff E., Hensel, A., Geldermann, H. (2002). Untersuchungen zur Analyse genetischer Krankheitsresistenzen beim Schwein. Berl. Münch. Tierärztl. Wchschr. 115:336.
  • 9. Salyers, A. A. und Whitt, D. D. (1994): Bacterial pathogenesis: a molecular approach, American Society for Microbiology, Washington, D.C., 229-243.
  • 10. Van der Heijden, H. M. J. F. (2001): First international ring trail of ELISAs for Salmonella-antibody detection in swine. Berl. Münch. Tierärztl. Wochenschr. 114, 389-392.
  • 11. Widjojoatmodjo, M. N., Fluit, A. C., Torensma, R., Keller, B. H., Verhoef J. (1991): Evaluation of the magnetic immuno PCR assay for rapid detection of Salmonella. Eur. J. Clin. Microbiol. Infect. Dis. 10, 935-938.
Sequenzprotokoll