Title:
Multianalyt-Reportersystem
Kind Code:
A1
Abstract:

Die Erfindung betrifft eine Mediator-Sonde zur Bindung an ein Zielmolekül und/oder ein Nachweismolekül umfassend eine Sonden-Region und eine Mediator-Region sowie ein Verfahren zum Nachweis von mindestens einem Zielmolekül, sowie ein System umfassend eine Mediator-Sonde und ein Nachweismolekül.



Inventors:
Roth, Günter (79110, Freiburg, DE)
Wadle, Simon (79106, Freiburg, DE)
Faltin, Bernd (79100, Freiburg, DE)
Von Stetten, Felix (79112, Freiburg, DE)
Application Number:
DE102011055247A
Publication Date:
05/16/2013
Filing Date:
11/10/2011
Assignee:
Albert-Ludwigs-Universität Freiburg, 79098 (DE)
International Classes:
Domestic Patent References:
DE10316159A1N/A2004-10-28
Foreign References:
200201108262002-08-15
200400140782004-01-22
200401018352004-05-27
200701228042007-05-31
47511771988-06-14
WO1998003678A11998-01-29
WO2001006012A12001-01-25
56416581997-06-24
63000702001-10-09
56539391997-08-05
60998032000-08-08
62388692001-05-29
200100340252001-10-25
Other References:
BRUNK C.F. u.a.: Analysis of specific bacteria from environmental samples using a quantitative polymerase chain reaction. Curr. Issues Mol. Biol. (2002) 4 (1) 13-18
HUANG Q. u.a.: Multiplex fluorescence melting curve analysis for mutation detection with dual-labeled, self-quenched probes. In: PLoS One. (April 2011) (4): e19206, 1-9
SUN C. u.a.: Electrochemical DNA biosensor based on proximity-dependent DNA ligation assays with DNAzyme amplification of hairpin substrate signal. In: Biosensors and Bioelectronics (2010) 25, 2483–2489
TSOURKAS A. u.a.: Shedding night on health and disease using molecular beacons. Brief. Funct. Genomic. Proteomic. (2003) 1 (4) 372-384
VAN DOORN R. u.a.: Robust Detection and Identification of Multiple Oomycetes and Fungi in Environmental Samples by Using a Novel Cleavable Padlock Probe-Based Ligation Detection Assay. In: Appl. Environ. Microbiol. (2009) 75 (12) 4185-93
Attorney, Agent or Firm:
HERTIN Anwaltssozietät, 10707, Berlin, DE
Claims:
1. Mediator-Sonde zur Bindung an ein Zielmolek?l und/oder ein Nachweismolek?l umfassend eine Sonden-Region und eine Mediator-Region, dadurch gekennzeichnet, dass die Sonde ein Oligonukleotid ist und die Sonden-Region am 3?-Terminus und die Mediator-Region am 5?-Terminus des Oligonukleotides angeordnet ist, wobei zwischen den Regionen eine chemische, biologische und/oder physikalische Spaltstelle vorliegt und die Sonden-Region eine Affinit?t zu dem Zielmolek?l und die Mediator-Region eine weitere Affinit?t zu dem Nachweismolek?l aufweist.

2. Mediator-Sonde zur Bindung an ein Zielmolek?l und/oder ein Nachweismolek?l umfassend eine Sonden-Region und eine Mediator-Region, dadurch gekennzeichnet, dass die Sonde ein Oligonukleotid ist und die Sonden-Region am 3?-Terminus und die Mediator-Region am 5?-Terminus des Oligonukleotides angeordnet ist, wobei zwischen den Regionen eine chemische, biologische und/oder physikalische Spaltstelle vorliegt und die Sonden-Region eine Affinit?t zu dem Zielmolek?l und die Mediator-Region eine weitere Affinit?t zu dem Nachweismolek?l aufweist, wobei die Spaltung der Mediator-Sonde insbesondere durch eine Amplifikation des Zielmolek?ls erfolgt.

3. Mediator-Sonde nach Anspruch 1 oder 2, dadurch gekennzeichnet, dass die Sonde 1 bis 70, bevorzugt 15 bis 60, besonders bevorzugt 35 bis 45 Nukleotide aufweist.

4. Mediator-Sonde nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass das Zielmolek?l ein Biomolek?l ist, ausgew?hlt aus der Gruppe umfassend DNA, RNA, Protein, Aptamer und/oder ein Komplex aus Aptamer und assoziierter DNA, RNA, Protein oder einer Kombination hieraus....

5. Mediator-Sonde nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass die Sonden-Region und die Mediator-Region funktionell und/oder r?umlich ?berlappen.

6. Mediator-Sonde nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass die Mediator-Sonde am 3?-Terminus der Sonden-Region eine chemische Schutzgruppe aufweist.

7. System umfassend eine Mediator-Sonde nach einem oder mehreren der vorherigen Anspr?che und ein Nachweismolek?l, wobei das Nachweismolek?l ein Oligonukleotid ist und mindestens folgende Regionen aufweist:
a. eine Region an einem 5?-Terminus des Nachweismolek?ls, die einen Fluoreszenzakzeptor oder einen -donor und/oder eine chemische Gruppe zur Bindung an eine Festphase und/oder eine chemische Schutzgruppe aufweist,
b. eine weitere Region, die mit der Mediator-Region interagiert,
c. eine dritte Region, die einen Fluoreszenzdonor oder einen -akzeptor aufweist und
d. eine vierte Region an einem 3?-Terminus des Nachweismolek?ls, die eine chemische Gruppe zur Bindung an eine Festphase und/oder eine chemische Schutzgruppe aufweist.

8. System nach Anspruch 7, dadurch gekennzeichnet, dass das Nachweismolek?l an eine Festphase gebunden oder frei in einer L?sung vorliegt.

9. System nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass die Mediator-Sonde und/oder das Nachweismolek?l fluoreszenzmarkierte Nukleotide aufweisen.

10. System nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass das Nachweismolek?l ein einzelstr?ngiges Nukleins?uremolek?l oder Nukleins?urederivat ist.

11. System nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass das Nachweismolek?l eine Haarnadel-Struktur aufweist.

12. System nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass die Haarnadel-Struktur ausgebildet ist, indem der 5?-Terminus des Nachweismolek?ls mit einem internen Sequenzabschnitt komplement?r hybridisiert und der 3?-Terminus des Nachweismolek?ls einen ungepaarten Sequenzabschnitt umfasst.

13. System nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass das Nachweismolek?l mindestens eine Fluoreszenz-Modifikationen am 5?-Terminus und/oder innerhalb der Haarnadelstruktur aufweist.

14. Verfahren zum Nachweis von mindestens einem Zielmolek?l, umfassend ein System nach einem oder mehreren der vorherigen Anspr?che umfassend folgende Schritte:
a. komplement?re Bindung der Sonden-Region der Mediator-Sonde an eine Sequenz des Zielmolek?ls oder eines Aptamers, b. Spaltung der Mediator-Sonde an der Spaltstelle zwischen der Sonden-Region
am 5?-Terminus und der Mediator-Region am 3?-Terminus durch Hilfsmolek?le, und
c. komplement?re Bindung der abgespaltenen Mediator-Region der Mediator-Sonde an die zweite Region des Nachweismolek?ls.

15. Verfahren nach einem oder mehreren der vorherigen Anspr?che,
dadurch gekennzeichnet, dass
die Spaltung der Mediator-Sonde eine Ver?nderung der physikalischen und/oder chemischen Eigenschaften mindestens einer Region der Mediator-Sonde bewirkt, ausgew?hlt aus der Gruppe umfassend:
a. molekulare Masse,
b. enzymatische Aktivit?t,
c. Bindungseigenschaften umfassend Affinit?t oder Avidit?t,
d. chemische Reaktivit?t,
e. Vorhandensein chemischer Gruppen,
f. elektrischer Eigenschaft umfassend Leitf?higkeit, Polarisierbarkeit oder Ladung und/oder
g. optischer Eigenschaft umfassend Absorption und Emission von Licht.

16. Verfahren nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass die, an die zweite Region des Nachweismolek?ls gebundene Mediator-Region durch ein Hilfsmolek?l enzymatisch verl?ngert wird, wobei das Hilfsmolek?l an den 3?-Terminus der gebundenen Mediator-Region bindet.

17. Verfahren nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass die, an das Zielmolek?l gebundene Sonden-Region durch ein Hilfsmolek?l enzymatisch verl?ngert wird.

18. Verfahren nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass die Hilfsmolek?le ausgew?hlt sind aus der Gruppe umfassend Katalysatoren, Proteine, Nukleins?uren, Naturstoffe, Enzyme, Enzym-Systeme, Zell-Lysate, Zell-Bestandteile, aus Zell-Bestandteilen abgeleitete Derivate und/oder synthetische Molek?le.

19. Verfahren nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass Hilfsmolek?le Molek?le aus einem Nukleins?ureamplifikationssystem und/oder einem Restriktionsenzymsystem umfassen.

20. Verfahren nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass durch eine indirekte oder direkte Interaktion der Mediator-Region mit der zweiten Region des Nachweismolek?ls eine physikalisch oder chemisch messbare Ver?nderung des Nachweismolek?ls erfolgt.

21. Verfahren nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass das Nachweismolek?l durch direkte oder indirekte Interaktion mit der Mediator-Region ver?ndert wird, umfassend ?nderung in Fluoreszenz, Phosphoreszenz, Masse, Absorption, Streuung des Lichts, elektrischen Leitf?higkeit, enzymatische Aktivit?t und/oder der Affinit?t.

22. Verfahren nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass sequenzspezifische oder -unspezifische, fluorogene und/oder chromogene Sonden oder Fluoreszenzfarbstoffe mit mindestens einer Region der Mediator-Sonde und/oder dem Nachweismolek?l interagieren.

23. Verfahren nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass das Nachweismolek?l durch eine Interaktion mit der Mediator-Region durch die Hilfsmolek?le ver?ndert wird, umfassend Phosphorylierung, Dephosphorylierung, Amidierung, Anbindung oder Abspaltung einer chemischen Gruppe, Fluoreszenz-, Phosphoreszenz- oder Lumineszenz?nderung.

24. Verfahren nach einem oder mehreren der vorherigen Anspr?che, dadurch gekennzeichnet, dass Nachweismolek?l ?ber mindestens eine Fluoreszenz-Modifikationen am 5?-terminalen Bereich und/oder innerhalb der Haarnadelstruktur verf?gt und nach der Reaktion mit der Mediator-Region mittels eines Hilfsmolek?ls von dem Nachweismolek?l die Fluoreszenz-Modifikationen abgespalten und/oder der 5?-Terminus der Haarnadelstruktur des Nachweismolek?ls entfernt wird und eine ?nderung des Fluoreszenzsignals am Nachweismolek?l detektiert wird.

25. Verwendung des Systems nach den Anspr?chen 7 bis 13 zur Amplifikation von mindestens einem Zielmolek?l.

26. Verwendung des Systems nach den Anspr?chen 7 bis 13 zur Detektion von einem oder mehreren gleichartigen oder verschiedenen Biomolek?len in einem Gemisch.

27. Verwendung des Systems nach Anspruch 26 unter Verwendung der Aktivit?t eines Restriktionsenzyms, wobei das Nachweismolek?l ?ber eine chemische Schutzgruppe am 3?-terminalen Bereich verf?gt, die nach der Reaktion mit der Mediator-Region mittels eines Hilfsmolek?ls von dem Nachweismolek?l abgespalten wird und eine 3?-terminale OH-Gruppe generiert wird.

Description:

Die Erfindung betrifft eine Mediator-Sonde, die aus einer Sonden-Region und einer Mediator-Region besteht. Au?erdem betrifft die Erfindung ein System, umfassend eine Mediator-Sonde und ein Nachweismolek?l, die Verwendung des System und ein Verfahren zum Nachweis von mindestens einem Zielmolek?l.

Im Stand der Technik sind zahlreiche molekularbiologische Untersuchungsmethoden beschrieben, die die Detektion und ggf. Analyse einer Probe erm?glichen. Eine dieser Methoden ist die Detektion und parallele Analyse von mehreren tausend Einzelnachweisen in einer geringen Menge biologischen Probenmaterials mittels einem Microarray. Es gibt verschiedene Formen von Microarrays, die manchmal auch als "Genchips" oder "Biochips" bezeichnet werden, weil sie wie ein Computerchip viele Informationen auf kleinstem Raum enthalten k?nnen.

Mikroarrays erlauben die hoch-parallele Detektion verschiedener Analyte auf einem typischerweise planaren Substrat. Die immobilisierten Sondenmolek?le eines Mikroarrays werden auf einem geeigneten Substrat im Laufe des Herstellungsprozesses an einer definierten Stelle (Spot) eines Rasters (Array) durch ?bertragung geringer Fl?ssigkeitsvolumina immobilisiert bzw. synthetisiert. Diese zweidimensionale, ortsaufgel?ste Immobilisierung von F?ngermolek?len kann so gestaltet sein, dass Nukleins?uren oder Peptide bzw. Proteine detektiert werden k?nnen. In der Regel erlauben in situ-Lithographieverfahren nur die Synthese kurzer Oligonukleotide bzw. Aminos?ureketten. Die hergestellten DNA-Mikroarrays k?nnen unter geeigneten Bedingungen ?ber Monate gelagert werden, Protein-Arrays k?nnen dagegen nur f?r eine kurze Zeit funktionell aufbewahrt werden.

F?r eine Mikroarray-Analyse wird die zu untersuchende Probe mit einem geeigneten Puffer vermischt und in entsprechender Weise mit dem Mikroarray inkubiert, so dass typischerweise bei komplement?ren Sequenzabschnitten ein Hybridisierungsereignis stattfindet. Aufgrund der geringen Sensitivit?t von Mikroarray-Systemen wird die Probe im Falle von nachzuweisender Nukleins?ure in einem vorgelagerten Reaktionsschritt amplifiziert (z.B. mittels Polymerase Chain Reaction (PCR), RT-PCR oder Whole Genome Amplification (WGA)) und f?r eine Detektion zum Beispiel mit einem Fluoreszenzfarbstoff markiert oder auf dem Mikroarray mit einer zus?tzlichen Detektionssonde inkubiert. Peptide und Proteine k?nnen nicht enzymatisch amplifiziert werden und werden durch Aufreinigungen der zu untersuchenden Probe aufkonzentriert. Dem gegen?ber stehen Ans?tze, die eine Signalverst?rkung auf dem Mikroarray nach erfolgter Hybridisierung, z.B. mittels Rolling Circle Amplification (RCA), durchf?hren. Diese Vorgehensweise umfasst mehrere zeitintensive Arbeitsschritte und erh?ht die Gefahr f?r Ungenauigkeiten und Kontaminationen. Typische Anwendungen finden Mirkoarrays bei Expressionsanalysen, sowie dem Nachweis von Pathogenen oder Resistenz-Markern. Ein ?berblick ?ber verschiedene Herstellungstechniken und Anwendungen ist f?r den Fachmann aus dem Stand der Technik bekannt.

Im Stand der Technik ist die Hybridisierung von amplifizierten DNA-Fragmenten an immobilisierte, allelspezifische Oligonukleotide beschrieben, die zu den Routineverfahren eines Fachmanns geh?ren. Ein vorgeschalteter Amplifikationsschritt mit Primermolek?len in unterschiedlichen Konzentrationen erlaubt die Generierung einzelstr?ngiger, markierter DNA, welche bevorzugt mit den F?ngermolek?len des Mikroarrays interagiert. Nach ?berf?hren des Mediums auf einen Mikroarray kann nach erfolgter Hybridisierung die Detektion direkt mittels Fluoreszenz oder durch Verwendung von Biotin-markierten Primer erfolgen, wobei nach dem Hybridisierungsschritt eine Inkubation insbesondere mit einer Streptavidin-modifizierten Meerrettichperoxidase erfolgt, welche ein l?sliches Substrat in ein unl?sliches Reaktionsprodukt umsetzt. Durch die Detektion des chromogenen Niederschlags kann ein Bindeereignis zwischen Ziel- und F?ngermolek?l nachgewiesen werden. Gegebenenfalls kann nach der Hybridisierung der voramplifizierten Zielsequenz(en) eine Verl?ngerungsreaktion eines immobilisierten Primers durchgef?hrt werden, bei der Biotinmarkierte Nukleotide eingebaut werden. Nach Inkubation mit einer Streptavidin-modifizierten Alkalischen Phosphatase und Zugabe eines geeigneten Substrats kann durch Bildung eines chromogenen Reaktionsprodukts die Anwesenheit der Zielsequenz nachgewiesen werden.

In einer weiteren Ausf?hrung (Multiplex quantitative DNA-Array basierte PCR, MQDA-PCR) wird die nachzuweisende Nukleins?ure in einem mehrstufigen Prozess zuerst mit bifunktionellen Primern f?r wenige PCR-Zyklen parallel amplifiziert. Dabei entstehen Amplifikate mit universellem 5?-Ende, welches anschlie?end die kompetitive quasi-monoplex Amplifizierung mit universellen Primern erm?glicht. Anschlie?end wird in einem gesonderten Arbeitsschritt eine Zielsequenz-spezifische Sonde durch Addition eines modifizierten Nukleotids markiert und auf einem Mikroarray hybridisiert. Durch die Verwendung bifunktioneller Primer, kann eine zweistufige PCR-Reaktion mit erh?htem Multiplexing-Grad durchgef?hrt werden, ohne dass die Reaktionseffizienz durch unterschiedliche Sequenzen signifikant beeinflusst wird. Nachteilig wirkt sich das komplexe Durchf?hrungsprotokoll auf die Integration in den Arbeitsablauf aus. Die mehrmalige Zugabe und Entnahme von Reagenzien bzw. Reaktionsprodukten sowie das Transferieren des Reaktionsansatzes zwischen mehreren Gef??en beinhalten hohen Arbeitsaufwand (?hands-on time?), lange Wartezeiten (?time to result?) und die Gefahr von Durchf?hrungsfehlern. Neben dem Ansetzen der einzelnen PCR-Reaktionen beinhaltet die Ausf?hrung mehrere Inkubationsschritte, in denen z.B. die bifunktionellen Primer verdaut, Sonden markiert und auf dem Mikroarray inkubiert werden. Bei dieser Methode besteht eine direkte Korrelation zwischen nachzuweisender Zielsequenz und immobilisierten F?ngermolek?l auf der Chip-Oberfl?che. Dadurch kann das Verfahren nicht an abweichende Zielsequenzen angepasst werden, ohne einen neuen Mikroarray herzustellen. Die genannten Verfahren besitzen zus?tzlich den Nachteil, dass das Probenmaterial nach der Amplifizierung zwischen zwei Reaktionsgef??en transferiert werden muss, wobei Durchf?hrungsfehler und Kontaminationen entstehen k?nnen.

Eine M?glichkeit, die Kontaminationsgefahr zu minimieren besteht darin, Amplifikation und Hybridisierung in einem Reaktionsgef?? durchzuf?hren. Durch r?umliche Trennung zweier Reaktionskompartimente k?nnen verschiedene Reaktionen zeitlich voneinander getrennt in einem Gef?? ablaufen. In dem Stand der Technik ist ein ?Microarray-in-a-tube?-System beschrieben, bei welchem zwei Kompartimente und ein Pufferreservoir in einem Reaktionsgef?? integriert sind (Liu, Q. et al, 2007, Microarray-in-a-tube for detection of multiple viruses. Clin Chem, 53, 188?194). Durch Invertieren des Gef??es wird die Fl?ssigkeit vom unteren Abschnitt in den oberen Abschnitt ?berf?hrt und mit einem vorgelagerten Reaktionspuffer vermischt, wobei das Reaktionsgef?? nicht ge?ffnet werden muss. Damit kann ein Amplifikationsschritt mit einer nachfolgenden Hybridisierung durchgef?hrt werden, ohne dass das Reaktionsmedium zwischen zwei Gef??en transferiert oder mit Hilfe aktiver Elemente aktuiert werden muss. Da die immobilisierten F?ngermolek?le von der Sequenz der nachzuweisenden Zielsequenz abh?ngen, k?nnen mit einem spezifischen Array-Layout nur ausgew?hlte Sequenzen detektiert werden. Das hergestellte Mikroarray kann daher nicht an neu ausgew?hlte Zielsequenzen adaptiert und muss gegebenenfalls in einem neuen Arbeitsablauf hergestellt und in das System integriert werden.

Weiterhin ist im Stand der Technik beschrieben, dass der Nachweis spezifischer Nukleins?uren in einem Reaktionsansatz mittels Strangverl?ngerung einer immobilisierten Sonde erfolgen kann. Dazu wird die Zielsequenz in Gegenwart von dUTP amplifiziert und in einem nachgeschalteten Schritt in ungef?hr 20 bis 50 Basenpaar lange Abschnitte enzymatisch mittels Uracil-N-Glycosylase fragmentiert. Anschlie?end wird der Ansatz auf einem Mikroarray inkubiert, welcher aus Zielsequenz-komplement?ren Sonden besteht, die am 5?-Terminus immobilisiert sind. Nach Hybridisierung entsteht typischerweise ein Duplex, bei dem der 5?-Bereich des Zielmolek?ls den 3?-Bereich der Sonde ?berlappt. Nach Entfernen der ungebundenen Fragmente wird der Array mit einem Reaktionsmix inkubiert, welcher u. a. eine Polymerase und markierte ddNTPs enth?lt. F?r jedes der vier Nukleotide ist die Markierung (Fluoreszenzfarbstoff) verschieden. Die Verwendung von ddNTPs erlaubt die spezifische Addition genau eines Nukleotids an die Festphasen-Sonde in Gegenwart der komplement?ren Zielsequenz, da an ddNTPs kein weiteres Nukleotid gekn?pft werden kann. Mit geeigneten Detektionsverfahren l?sst sich somit ermitteln, welches Nukleotid an welchen Sondenabschnitt angef?gt wurde. Daher eignet sich die Methode zur Detektion der Zielsequenz und Sequenzierung, sofern geeignete Sondenabschnitte verwendet werden. In einer speziellen Ausf?hrung, erlaubt das Verfahren einen hohen Multiplex-Grad und den parallelen SNP-Nachweis von bis 640 Zielsequenzen. Wie bei anderen Verfahren des Standes der Technik, bei denen ein Reaktionsansatz nach durchgef?hrter Amplifikation transferiert werden muss, besteht auch bei diesem Ansatz die Gefahr der Kontamination und Durchf?hrungsfehler. Typischerweise m?ssen Festphasensonden den kompletten nachzuweisenden Lokus abdecken, womit mehrere Sonden pro Sequenzabschnitt ben?tigt werden.

In der US 5,641,658 und US 6,300,070 B1 ist eine PCR-basierte Amplifikationsmethode beschrieben, bei welcher die ben?tigten Primermolek?le an einer Festphase immobilisiert sind. Dies hat zur Folge, dass die amplifizierten Nukleins?uremolek?le ebenfalls ausschlie?lich an der Festphase vorliegen. Bei Vorhandensein der Zielsequenz in der zu untersuchenden Probe kann die Nukleins?ure an ?Primer 1? binden und dieser enzymatisch verl?ngert werden. Im wiederkehrenden Denaturierungsschritt dissoziiert die Nukleins?ure-Vorlage vom neu gebildeten Nukleins?urestrang und steht somit im n?chsten Annealingzyklus zur Verf?gung. Das gebildete Amplifikationsprodukt kann im n?chsten Zyklus mit einem immobilisierten ?Primer 2? hybridisieren, welcher verl?ngert werden kann und ebenfalls einen immobilisierten Nukleins?urestrang bildet. Die durch diesen Vorgang gebildeten Nukleins?urestr?nge k?nnen mit weiteren Primermolek?len interagieren und als Nukleins?ure-Vorlage dienen. Dieses Verfahren zum Nachweis von Nukleins?uren wird als ?BridgeTM-PCR? bezeichnet.

Durch Immobilisierung verschiedener Primerpaare in einem definierten Array k?nnen durch den somit erreichten Multiplexing-Grad mehrere Zielsequenzen parallel nachgewiesen werden. Ein Nachteil dieses Verfahren besteht in der Notwendigkeit, dass die verschiedenen Primermolek?le homogen und mit ausreichender Dichte im jeweiligen Spot verteilt vorliegen m?ssen, damit der durch Primerverl?ngerung entstandene Nukleins?ure-Strang eine ausreichende Anzahl weiterer Interaktionspartner f?r den n?chsten Zyklen besitzt. Die Reaktionseffizienz dieser Festphasen-PCR liegt bei etwa 30 %, wobei der Anteil der linearen interphasischen Amplifikation ungef?hr zehnmal h?her ist als der der Oberfl?chenamplifikation. Zu vergleichbaren Reaktionseffizienzen (~34 %) kommt Pemov et al. (Pemov, A. et al, 2005, DNA analysis with multiplex microarray-enhanced PCR. Nucleic Acids Res., 33, e11.), wobei f?r diese Studien in Hydrogel immobilisierte Primer und zus?tzliche Primer in der Fl?ssigphase verwendet wurden. Die 5?-immobilisierten Primer bestehen aus zwei funktionellen Abschnitten und setzten sich aus einem universellen 5?-Bereich und einem zielsequenzspezifischen 3?-Bereich zusammen. Frei in der Reaktionsl?sung vorliegende universelle Primer besitzen die identische Sequenz wie die universellen Abschnitte der Festphasenprimer. In einer Abfolge von interphasischer und Festphasen-Amplifikation wird eine modifizierte Kopie der Zielsequenz gebildet, die mittels universeller Fl?ssigphasenprimer in einer ?quasi-monoplex? PCR amplifiziert werden kann. Dieses Festphasen-gest?tzte Multiplexing-Verfahren hat den Nachteil, dass post PCR-Schritte (z.B. Inkubation mit modifizierten Detektionsoligonukleotiden bzw. Wasch- und Inkubationsschritte nach Einbau modifizierter Nukleotide durchgef?hrt werden m?ssen.

Ein weiteres im Stand der Technik beschriebene Verfahren, um Amplifikationsprodukte auf einer Festphase w?hrend eines Amplifikationsschrittes zu immobiliiseren ist die verschachtelte Festphasen-PCR (nested on-chip PCR (NOC PCR). Die Methode bedient sich mindestens drei verschiedener Primermolek?le, von denen zwei Primer das ?u?ere Primerpaar (P1 und P2) bilden und das dritte Primermolek?l (P3) innerhalb eines von P1 und P2 begrenzten Abschnitt bindet und P3 an einer Festphase immobilisiert vorliegt. P1 und P2 liegen im Vergleich zu P3 im ?berschuss vor. Die Methode stellt ein kombiniertes Fl?ssigphasen/Festphasenamplifikationssystem dar. Die Vorteile dieses Verfahrens liegen analog zur verschachtelten PCR (nested PCR) in der erh?hten Sensitivit?t und Spezifit?t. Durch geeignete Immobilisierungsverfahren und Wahl des Substrats kann ein hoch-paralleler Nachweis mehrerer Zielsequenzen erfolgen. Die Analyse kann mittels sequenzspezifischer Sonden oder markierten Nukleotiden erfolgen, wobei bei letzterer Variante eine Detektion in Echtzeit m?glich ist. Ein Nachteil dieses Ansatzes ist die Verwendung Zielsequenzsequenspezifischer P3-Primermolek?le, deren Sequenz direkt mit dem Zielmolek?l korreliert.

Die Verwendung immobilisierter Primer-Molek?le zum spezifischen Nachweis von Nukleins?uren ist nicht nur auf PCR-basierte Methoden beschr?nkt. Es ist im Stand der Technik beschrieben, dass mittels Helikase-abh?ngiger Amplifikation (?Helicase Dependent Amplification?, HDA) der isotherme Nachweis von Pathogenen innerhalb von 120 Minuten erfolgreich durchgef?hrt wurde. Die Markierung des Amplifikationsproduktes erfolgt mittels Fluoreszenz-markierter Reverse-Primer. Nach Durchf?hrung der Reaktion wird der Chip gewaschen und das Fluoreszenzsignal ausgewertet. Um eine spezifische und sensitive Reaktion durchzuf?hren, muss der Reaktionsansatz auf 65?C erw?rmt werden. Zus?tzlich muss der Chip an ein Pumpenelement angeschlossen werden, damit das relativ hohe Probenvolumen von 50 ?L ausreichend durchmischt wird. Die Konnektierung von aktiven Aktuatoren an einen Biochip ist generell als nachteilig anzusehen und erh?ht den Arbeitsaufwand. Die erreichte Sensitivit?t ist f?r die klinische Diagnostik zu gering. So wurden beispielsweise 5?10^4 Genom?quivalente von Staphylococcus aureus und 1,3?10^5 Genom?quivalente von Neisseria gonorrhoeae als Detektionslimit beschrieben (Andresen, D., von Nickisch-Rosenegk, M. and Bier, F.F., 2009, Helicase dependent OnChipamplification and its use in multiplex pathogen detection, Clin. Chim. Acta, 403, 244?248). Der durch diese Methode hergestellte Biochip ist ausschlie?lich zur Detektion festgelegter Zielsequenzen zu verwenden, da Analyt-spezifische Oligonukleotide immobilisiert vorliegen.

Weiterhin sind im Stand der Technik Methoden offenbart, bei denen der Nachweis der Zielsequenz in Echtzeit bzw. ohne weitere Prozessierungsschritte erfolgt. Diese Methoden werden durch ein kombiniertes Amplifikations- und Detektionssystem realisiert. So ist beispielsweise beschrieben, dass die parallele Detektion und Quantifizierung drei verschiedener Viren in Spenderplasma-Proben m?glich ist. Es werden ein ?u?eres und inneres Primerpaar ben?tigt, wobei das ?u?ere Paar in einer Reversen Transkription verwendet wird. Das innere Paar, bei dem der Forward-Primer in einem Hydrogel-Pad immobilisiert, liegt w?hrend der Reverse-Primer frei in der Fl?ssigphase vor, wird f?r die onchip PCR eingesetzt. Unter Verwendung eines geeigneten Farbstoffes werden doppelstr?ngige Amplifikationsprodukte in den Spots w?hrend des Annealingschritts markiert und detektiert. Das Verfahren besitzt einen dynamischen Bereich von 6 Log (10^0 bis 10^6 Kopien). Die Verwendung eines sequenz-unspezifischen Farbstoffes erlaubt die universelle Detektion beliebiger, doppelstr?ngiger Amplifikationsprodukte. Nachteilig ist allerdings, dass keine Spezifit?t gew?hrleistet ist, so dass unspezifische Amplifikationsprodukte nicht unterschieden werden k?nnen.

In der DE 103 16 159 A1 wird ein Verfahren beschrieben, bei dem Zielsequenz-spezifische Primermolek?le in einer temperierbaren Flusszelle immobilisiert vorliegen. Die Flusszelle besitzt weiterhin die Eigenschaft, mittels Totaler interner Resonanzfluoreszenz (Total internal resonance fluorescence, TIRF) das Anregungslicht durch eine in der Regel planare Fl?che zu leiten. Nach Zugabe der Zielsequenz und typischer PCR-Reagenzien sowie Fluoreszenzmarkierten Nukleotiden (z.B. Cy5-dUTP) kann die DNA-abh?ngige Festphasenprimerverl?ngerung durch geeignete Verfahren detektiert werden.

Liu et al. entwickelte eine Multiplex-Analyse f?r Nukleins?uren, welche die Amplifiaktion durch PCR und Detektion mittels Mikroarray-Analyse in einer Reaktion kombiniert (Liu, H.P. et al, 2006, TaqMan probe array for quantitative detection of DNA targets, Nucleic Acids Research, 34.). Dies erfolgt mittels Primermolek?len in der Fl?ssigphase und eines Arrays Zielsequenz-spezifischer, 3?-immobilisierter TaqMan-Sonden. In Anwesenheit der komplement?ren Zielsequenz wird eine TaqMan-Sonde durch eine Polymerase gespalten, wodurch ein unterdr?cktes Fluoreszenzsignal wiederhergestellt wird. Das ?rtlich-aufgel?ste Signal kann mittels optischer Vorrichtungen detektiert werden. Unter Verwendung dieser Plattform erfolgte der Nachweis von f?nf verschiedenen Zielsequenzen in einer Probe. Dieser Ansatz ist potentiell auch f?r eine Echtzeit-Auswertung geeignet. Da die Primer frei in der Reaktionsl?sung vorliegen, kann die enzymatische Amplifizierung der Zielsequenz auch ausschlie?lich in der Fl?ssigphase erfolgen. Die Sonde stellt daher keinen notwendigen Interaktionspartner dar, und daher wird ggf. die Amplifikationsreaktion nicht durch ein Fluoreszenz-Signal an der Festphase abgebildet. Weitere Fluorophor-markierte Oligonukleotid-Sonden werden f?r den spezifischen Nachweis von Zielsequenzen eingesetzt. Die Verwendung von Molecular Beacons als Biosensoren f?r sensitive und spezifische Nukleins?uredetektion ist in dem Stand der Technik beschrieben. Die Verwendung von Molecular Beacon- oder TaqMan-Sonden f?r Mikroarray-Analysen hat den Vorteil, dass die Zielsequenz nicht wie bei Oligonukleotid-Mikroarrays in einem gesonderten Reaktionsschritt, welcher vor oder nach dem Hybridisierungsereignisses durchgef?hrt wird, typischerweise mit Fluoreszenzfarbstoffen markiert werden muss. Falls ein Voramplifikationsschritt ausserhalb des Mikroarrays ben?tigt wird, entstehen jedoch eine erh?hter Arbeitsaufwand und Kontaminationsgefahr. Da immobilisierte Molecular Beaconoder TaqMan-Sonden typischerweise mindestens drei Modifikationen (Gruppe zur Immobilisierung, Fluoreszenzdonor und -akzeptor) besitzen, entstehen unmittelbar bei ?nderungen der Zielsequenz oder des Array-Layouts hohe Folgekosten f?r die Herstellung und Immobilisierung neuer Sonden.

Weiterhin ist im Stand der Technik ein sogenannter ?Invader Assay? beschrieben, der von der Firma Hologic (fr?her: Third Wave Technology) entwickelt wurde. Der Assay kann unter isothermen Bedingungen die Anwesenheit einer Zielsequenz nachweisen. Das Verfahren ben?tigt im einfachsten Fall eine Struktur-spezifische Nuklease, zwei Zielsequenzspezifische Oligonukleotide ? ein ?Invader?-Oligonukleotid und eine Sonde, welche ?ber einen Fluoreszenzdonor und -akzeptor verf?gt. W?hrend der Nachweisereaktion hybridisieren die beiden Oligonukleotide an einen Strang der Zielsequenz, wobei sich der 3?-Terminus des ?Invader?-Oligonukleotids und der 5?-Terminus der Sonde ?berlappen und eine Triplex-Struktur (tern?rer Komplex) bilden. Die gebildete Triplex-Struktur stellt das Substrat f?r eine Struktur-spezifische Nuklease dar, die die Sonde spaltet (Prim?rreaktion) und dabei ein zuvor unterdr?cktes Fluoreszenz-Signal wiederherstellt. In einer weiteren Ausf?hrung des ?Invader Assays? besitzt die Sonde keine Fluoreszenz-Modifikationen, die freigesetzte 5?-Region der Sonde kann jedoch eine nachfolgende Detektionsreaktion (Sekund?rreaktion) aktivieren, indem es mit einem FRET-Detektionsmolek?l interagiert und eine lokale Triplex-Struktur bildet. Nach Spaltung dieses Komplexes entsteht ein Fluoreszenzsignal. Bei der beschriebenen Reaktion findet eine Signalamplifizierung aber keine Zielsequenzamplifizierung statt. Der ?Invader-Assay? kann u.a. f?r die Detektion von Einzelnukleotid-Polymorphismen (SNP) verwendet verwendet werden.

Das von dem ?Invader Assay? abgeleitete InPlex?-System kombiniert eine Voramplifikation der Zielsequenzen mit dem Invader? Assay. Dabei werden die Zielsequenzen zuerst mittels PCR amplifiziert und anschlie?end in eine Reaktionskartusche ?berf?hrt und mehrere Stunden inkubiert (Detektionsreaktion). Die InvaderPlus?-Reaktion kombiniert eine PCR mit der ?Invader?-Reaktion in einem Reaktionsgef??, wobei eine Polymerase aus Thermus aquaticus und das Enzym Cleavase? verwendet werden. Dabei wird zun?chst mittels PCR die Zielsequenz amplifiziert und anschlie?end die Polymerase bei 99 ?C inaktiviert. Im n?chsten Schritt wird der Reaktionsmix auf eine Temperatur abgek?hlt, bei der sich ein Invader-Oligonukleotid und eine Sonde an die Zielsequenz anlagern. Diese Struktur wird von der Cleavase? erkannt, worauf eine Spaltungsreaktion mit Signalgenerierung ablaufen kann. Diese Endpunkt-Reaktion dauert typischerweise zwei Stunden.

Im Stand der Technik sind mehrere Festphasen-basierte Ans?tze bekannt, bei denen die Zielsequenz-spezifische Sonde ?rtlich-aufgel?st auf einer geeigneten Oberfl?che immobilisiert ist und zur Detektion von SNPs in genomischer DNA verwendet werden kann. Dabei erfolgt die Detektion direkt ?ber eine Fluoreszenz?nderung bzw. indirekt nach erfolgter Ligation eines Spaltungsproduktes mit einem Primer und universeller Rolling Circle Amplifikation sowie Markierung mit einem sequenzunspezifischen Fluoreszenzfarbstoff bzw. Biotin-markierten Oligonukleotid und anschlie?ender Inkubation mit Streptavidin-beschichteter Goldpartikel. Da bei diesem isothermen Verfahren keine Zielsequenz-Amplifizierung erfolgt, liegt die typische Inkubationsdauer einer Analyse bei bis zu 24 Stunden gefolgt von einer Fluoreszenzmessung.

Mikroarray-Analysen umfassen mehrere Arbeitsschritte, typischerweise Auswahl der Sequenz des immobilisierten F?ngermolek?ls, Probenvorbereitung und Amplifikation, Hybridisierung bzw. Inkubation gefolgt von anschlie?enden Waschschritten sowie Signalmessung und Datenverarbeitung. Die im Stand der Technik bisher beschriebenen Mikroarrays basieren auf dem Prinzip der direkten Wechselwirkung zwischen Ziel- und immobilisierten F?ngermolek?l, daher muss ein ge?ndertes F?ngermolek?l verwendet werden, sobald ein abweichendes Zielmolek?l detektiert werden soll. Dies bedingt prinzipiell die Herstellung eines ge?nderten Arrays und ist ein wesentlicher Zeit- und Kostenfaktor. Aufgrund des aufw?ndigen Herstellungsprozesses, werden aus wirtschaftlichen Gr?nden gr??ere St?ckzahlen eines Sequenzlayouts gefertigt. Somit bieten Arbeiten mit Mikroarrays geringe Flexibilit?t in Bezug auf das nachzuweisende Zielmolek?l, da ein ge?ndertes Sequenzlayout hohe Folgekosten und Prozessierungsaufwand nach sich zieht. Ferner sind im Stand der Technik universelle Mikroarrays offenbart. Universelle Nukleins?ure-Mikroarrays, bei denen die Sequenz der immobilisierten F?ngermolek?le unabh?ngig von der Zielsequenz ist, sind z. B. kommerziell erh?ltlich, z.B. Affymetrix ?GeneChip Universal Tag Arrays?. Diese Verfahren basieren auf einem universellen Mikroarray-Sequenzlayout, bei dem die immobilisierten Oligonukleotide (ZIP code bzw. Universal Tag) unabh?ngig von der nachzuweisenden Sequenz sind und nicht mit dieser interferieren. Bei einer typischen Nachweisreaktion wird die Zielsequenz in der Regel in einem gesonderten Reaktionsgef?? amplifiziert und ggf. aufgereinigt. Anschlie?end erfolgt ein Ligationsschritt, bei dem in Anwesenheit der Zielsequenz eine spezifische Detektionssonde und eine Fluoreszenzsonde direkt nebeneinander an der Basenabfolge der Zielsequenz hybridisieren. Die Detektionssonde besitzt einen Zielsequenz-unspezifischen ?berhang (complementary ZIP code, cZIP code), welcher als Adressierungssequenz dient und komplement?r zu einer ZIP code-Sonde des Mikroarrays ist. Durch die Ligation entsteht ein Produkt aus Detektions- und Fluoreszenzsonde, welches f?r eine Hybridisierung auf einem ZIP code-Mikroarray verwendet wird. Ein Fluoreszenzsignal an einem spezifischen ZIP code-Spot ist ein indirekter Hinweis auf die Anwesenheit der Zielsequenz im Reaktionsmix. Als Festphase k?nnen auch kodierte Mikrokugeln (Beads) verwendet werden. Dabei wird jedem F?ngermolek?l ein eindeutig identifizierbares Bead zugewiesen, was durch eine definierte Nukleotidsequenz oder F?rbung bzw. Intensit?t erreicht wird. Durch diese Zuordnung kann in einem sp?teren Arbeitsschritt eine automatisierte Detektion des Beads sowie die parallele Analyse durchgef?hrt werden. Diese Methode besitzt den Vorteil, dass die Beads in der Fl?ssigphase homogenisiert vorliegen und die daraus resultierenden Reaktionskinetiken h?her sind als bei vergleichbaren Fl?ssig-/Festphaseninteraktionen.

Ein als ?cDNA-vermittelte Annealing, Selektion, Extension und Ligation? (DASL) betiteltes Verfahren zur Expressionsanalyse mittels universellen Mikroarrays ist ebenso im Stand der Technik beschrieben. Dabei wird zun?chst RNA mittels Biotin-markierten Oligo-d(T)18 und Primermolek?len zuf?lliger Sequenz in cDNA umgeschrieben. Anschlie?end erfolgt ein Hybridisierungsschritt zweier lokus-spezifscher Oligonukleotide, wobei beide Olignukleotide universelle, lokus-unspezifische Sequenz?berh?nge besitzen. Das 3?-terminale Oligonukleotid verf?gt ?ber eine Adressierungsequenz, welche zwischen dem sequenzspezifischen Bereich und dem unspezifischen Sequenz?berhang integriert ist. Die Adressierungsequenz ist komplement?r zu einer definierten Sequenz auf dem universellen Mikroarray. In einer Verl?ngerungsreaktion wird der Bereich zwischen den Oligonukleotiden komplement?r erg?nzt und im n?chsten Schritt ligiert. Unter Verwendung spezieller Oligonukleotide kann anschlie?end eine Vervielf?ltigung des Ligationsprodukts mittels PCR erfolgen, wobei durch Fluoreszenz-markierte Primer eine Markierung des amplifizierten Ligationsprodukt erfolgt. Im n?chsten Schritt wird eine Hybridisierung an ein universelles Array bzw. Bead durchgef?hrt. Das DASL-Verfahren bietet im Vergleich zu den vorherig beschriebenen universellen Mikroarrays den Vorteil, dass mehr M?glichkeiten zur Sequenzauswahl der zu ligierenden Oligonukleotide besteht, da eine Verl?ngerungsreaktion die fehlenden Nukleotide erg?nzt. Allerdings muss durch diese Reaktion ein weiterer fehleranf?lliger Arbeitsschritt in den Ablauf integriert werden. Durch die zahlreichen Prozessierungs- und Analyseschritte sind diese Methoden sehr zeitintensiv, zus?tzlich besteht Kontaminationsgefahr, da amplifizierte Nukleins?ure-Fragmente zwischen Reaktionsgef??en ?berf?hrt werden m?ssen. Des Weiteren ist die Methode nur f?r Endpunkt-Messungen ausgelegt.

In der US 5,653,939 und US 6,099,803 ist ein Verfahren beschrieben, dass durch lokale Manipulation eines elektrischen Feldes den elektrophoretischen Transport geladener (Bio)Molek?le zu definierten Mikrolokationen (Spots) auf einem Mikroelektronikchip erm?glicht. Dieser ?aktiver Mikroelektronik-Array?, der unter der Bezeichnung NanoChip? kommerzialisiert wurde, besteht aus einem geordneten Aufbau individuell adressierbarer Elektroden. Durch Anlegen einer Spannung an eine oder mehrere Elektroden k?nnen geladene Analyte spezifisch an definierte Spots auf dem Halbleiter-Chip bewegt und konzentriert werden. Werden die Spots mit komplement?ren oder affinen F?ngermolek?l versehen, kann durch elektrophoretischen Transport ein Hybridisierungs- oder Affinit?tsereignis innerhalb kurzer Zeitspannen stattfinden. Da Polarit?t und anliegende Spannung der Elektroden beliebig ge?ndert werden kann, erm?glicht dies die Manipulation von Teilchen mit negativer (z.B. Nukleins?uren, teilweise Proteine) und positiver (z.B. teilweise Proteine) Nettoladung. Durch Belegung mehrerer Spots mit verschiedenen F?ngermolek?len kann eine Multiplex-Analyse mit einer aufgetragenen Probe durchgef?hrt werden. Durch Umpolen der Elektroden erfolgt ein Absto?en der Zielmolek?le vom F?ngermolek?l, wodurch die St?rke der Wechselwirkung ermittelt (Selekltivit?t) und unspezifische Bindungen minimiert werden (?elektrische Stringenz?). Die Immobilisierung der F?ngermolek?le erfolgt typischerweise ?ber Biotin-Modifikationen, die selektiv an das Streptavidin-modifizierte Polymer-Gel der Chipoberfl?che binden. Die NanoChip-Ger?teplattform eignet sich prinzipiell f?r DNA-Hybridisierungen, SNP- oder STR-Analysen sowie Zelltyp-Bestimmungen und on-chip SDA-Reaktionen. Die Detektion kann durch passive Hybridisierung markierter Sonden oder durch g?ngige Antik?rper-Techniken erfolgen. Durch die angelegte Spannung entstehen im Bereich der Elektroden Elektrolyseprodukte (H+, OH-, H2, O2 und freie Radikale), welche das Zielmolek?l sch?digen k?nnen. Um diesen Effekt zu minimieren ist die Applikation einer separierenden Zwischenschicht in Form eines Polymer-Gels notwendig. Da diese Plattform ausschlie?lich Molek?linteraktionen zu detektieren vermag, muss das Probenmaterial in der Regel in einem vorgelagerten Schritt angereichert werden. Dies ist vor allem f?r Nukleins?uren notwendig, die typischerweise mittels asymmetrischer PCR vervielf?ltigt werden. Die Ger?teplattform besteht aus einer System- und Mikrochipkontrolleinheit, welche z.B. die Steuerung der angelegten Spannung und Fluidik regeln.

Ein weiterer universeller Ansatz zur Detektion von Zielmolek?len wurde von High-Throughput Genomics (HTG) vermarktet (z. B. US 2001/0034025 A1 oder US 6,238,869 B1). Grundlage f?r diesen Ansatz bildet ein universelles Array verschiedener Anker-Oligonukleotide, welche am 3?-Terminus an einer Festphase (Mikrotiterplatte) immobilisiert sind. Linker-Molek?le, die einen komplement?ren 5?-Abschnitt zu den beschriebenen Anker-Oligonukleotide und einen Zielmolek?l-spezifischen 3?-Abschnitt aufweisen, ?ndern nach erfolgter Hybridisierung die Bindespezifit?t an dieser Arrayposition. Sollen mit dem neu konfigurierten Array Nukleins?uren detektiert werden, besteht das Linker-Molek?l aus einem Oligonukleotid, f?r den Nachweis von Proteinen besteht das Molek?l typischerweise aus einem Oligonukleotid-Antik?rper-Konjugat. Eine von HTG vorgestellte Ausf?hrung zur Detektion von mRNA f?r Expressionsanalysen erm?glicht den parallelen Nachweis von 16 verschiedenen Loci pro Kavit?t einer handels?blichen Mikrotiterplatte. Dazu werden beispielsweise Zellen in einem gesonderten Gef?? in Anwesenheit von mRNA-komplement?ren DNA-Sonden lysiert und denaturiert. Nach erfolgter Hybridisierung werden durch Zugabe einer S1 Nuklease einzelstr?ngige Nukleins?uren (mRNA und ?berschuss der DNA-Sonden) verdaut. Durch alkalische Hydrolyse wird der RNA-Anteil des Duplex degradiert, so dass nach Neutralisation st?chiometrische Mengen der DNA-Sonden im Ansatz vorhanden sind. Anschlie?end wird der Ansatz auf das Array transferiert, worauf sequentielle Hybridisierungen einer zur DNA-Sonde teilkomplement?ren Detektions-Sonde und ein dazu komplement?res Detektions-Konjugat, welches mit einer Peroxidase-Modifikation versehen ist, durchgef?hrt werden. Nach Zugabe geeigneter Substrate entsteht an der Position des Arrays ein lokales Chemilumeneszenz-Signal, an dem der beschriebene Hybridisierungskomplex erfolgreich gebildet werden konnte. Durch die zahlreichen Prozessierungsschritte ist das Verfahren arbeitsintensiv. Ein weiterer Nachteil besteht in der geringen Sensitivit?t des Assays, da keine Amplifikationsreaktion in das Assay-Protokoll integriert ist. Somit k?nnen beispielsweise sehr geringe Nukleins?urekonzentrationen nicht ausreichend empfindlich nachgewiesen werden. Zus?tzlich k?nnen die zahlreichen Hybridisierungsschritte zu Interferenzen und somit zu unerw?nschten unspezifischen Reaktionen oder falsch-positiven Signalen f?hren.

Verfahren zum Proteinnachweis mittels Nukleins?ure-basierter Methoden sind in dem Stand der Technik offenbart. Dabei interagiert der Analyt mit einem immobilisierten Protein (z.B. ein Antik?rper) und wird anschlie?end mit einem Protein-Nukleins?urekonjugat inkubiert. In einem folgenden Waschschritt werden nicht-gebundenen Molek?le entfernt. Das Konjugat enth?lt eine Nukleotidsequenz, die komplement?r zu einem zirkul?ren DNA-Molek?l ist, welches anschlie?end hinzugegeben wird. Durch Prozessierung mit einer geeigneten Polymerase wird der Primer verl?ngert und mittels RCA Konkatamere des DNA-Molek?ls generiert. Nach Inkubation mit Gold- modifizierten Sonden oder Sequenz-unspezifischen Fluoreszenzfarbstoffen, werden die Bereiche eines Mikroarrays spezifisch markiert, an denen F?ngermolek?l und Detektionskonjugat an den Analyten gebunden haben. Mittels geeigneter Detektionsverfahren lassen sich Bindungsereignisse des Analyten somit ortsaufgel?st nachweisen. Nachteilig ist, dass zwei verschiedene Proteine bzw. Protein-Nukleins?ure-Konjugate verwendet werden, welche direkt mit dem jeweiligen Analyten korrelieren. Die Verwendung von Proteinen und den davon abgeleiteten Verfahren ist aufgrund der Synthese ein gro?er Kostenfaktor. Einen prinzipiell ?hnlichen Ansatz verfolgt die Firma Chimera Biotec mit der entwickelten Imperacer?-Technologie, wobei Antik?rper-DNA-Chim?re, d.h. synthetische DNA-Fragmente, an die ein Antik?rper gekoppelt wurde, verwendet werden. Bindet dieser Antik?rper an das passende Antigen, kann nach anschlie?enden Waschschritten das gekoppelte DNA-Fragment mittels real-time PCR amplifiziert und detektiert werden.

In Zentrallaboratorien wird die labormedizinische Diagnostik mit Hilfe von Analysenautomaten durchgef?hrt und umfasst Bereiche der klinischen Chemie, medizinischen Mikrobiologie und medizinischen Immunbiologie sowie Transfusionsmedizin. Neben diesen Hochdurchsatz- Systemen gibt es deutlich kleinere Ger?te, die eine patientennahe (?point of care?) Multianalyt-Analyse zum Beispiel wichtiger Blutwerte oder Markerproteinen erm?glichen. Diese nutzen verschiedene Prinzipien der Detektion, wie Absorptionsmessung einer chromogenen Reaktion der Probe mit in der Reaktionskartusche vorgelagerten Reagenzien (z. B. Abaxis Piccolo? Xpress), Durchfluss-Immunoassay mittels einer mit Antik?rper-markierten Membran und anschlie?ender Markierung des Analyten mit Gold-modifizierten Detektionsantik?rpern (z. B. Axis-Shield Afinion) oder eines linearen Teststreifens (z. B. Abbott Point-of-Care i-STAT?, Roche Cobas h232, BioSite? Triage?-System). Bei diesen Verfahren wird die Testfl?ssigkeit in eine spezielle Reaktionskartusche appliziert, in welcher ein saugf?higes Material die Probe durch Kapillarkr?fte aufnimmt, transportiert und ggf. separiert. Typischerweise basieren die angebotenen Testkits auf Immunofluoreszenz-Technologie. An definierten Zonen sind auf dem Material Reagenzien vorgelagert (Detektionsantik?rper) bzw. immobilisiert (F?ngerantik?rper). Die Durchf?hrung erfordert typischerweise keine Probenpr?paration, so dass die Tests mit Vollblut, Blutplasma oder Urin durchgef?hrt werden k?nnen (ggf. mit internem Filter f?r Blutzellen und Partikel) und detektieren in den meisten F?llen mehrere Analyte innerhalb einer Reaktion. Die Ergebnisse sind innerhalb von etwa 15 Minuten verf?gbar. Die zur Verf?gung stehenden Testkits umfassen Marker f?r Herzkrankheiten, Pathogene sowie Stoffwechselprodukte von diversen Medikamenten. Die Vorteile der beschriebenen Ausf?hrungen bestehen in der hohen Benutzerfreundlichkeit (einfaches Durchf?hrungsprotokoll, keine Probenvorbereitung) und geringen Prozessierungsdauer. Nachteilig ist, dass diese vor allem in der klinischen Diagnostik eingesetzten Ger?te nur mit propriet?rem Verbrauchsmaterial kompatibel sind und die Verwendung auf klinisch-relevante Marker und Parameter (zum Beispiel kardiovaskul?re Erkrankungen) beschr?nkt ist. Au?erdem ist der Einsatz sehr stark durch den Hersteller beschr?nkt, da nur f?r bestimmte Zielmolek?le Nachweise durchgef?hrt werden k?nnen, f?r die der Hersteller freigegebene Testkits anbietet.

Das beschriebene Teststreifen-Prinzip findet ebenfalls Anwendung in der Nukleins?ureanalytik. Dabei wird die nachzuweisende Nukleins?ure amplifiziert und auf einen Teststreifen appliziert, auf dem sich Zielsequenz-spezifische F?nger- und Nachweismolek?le befinden. Durch Kapillarkr?fte passiert die Zielsequenz verschiedene Zonen auf dem Teststreifen und interagiert mit den verschiedenen komplement?ren bzw. affinen Molek?len. Durch Ermittlung einer Nachweisbande (z.B. mittels Gold-markierter Nachweismolek?le) an einer definierten Stelle des Teststreifens kann das Vorhandensein der Zielsequenz in der zu untersuchenden Probenl?sung ermittelt werden. Ein universeller Ansatz zur Detektion beliebiger Nukleins?urensequenzen ist in dem Stand der Technik beschrieben (z. B. Baeumner, A.J. et al, 2004, A universal nucleic acid sequence biosensor with nanomolar detection limits, Anal. Chem., 76, 888?894.). Dabei wird die Probenl?sung amplifiziert und mit bifunktionalen Reporter-Sonden inkubiert. Ein Abschnitt der Sonde hybridisiert an die Zielsequenz, wohingegen ein anderer Abschnitt an Vesikel mit immobiliserten Oligonukleotiden komplement?rer Sequenz bindet. Ein weiterer Abschnitt der amplifizierten Zielsequenz bindet an ein Biotin-modifiziertes Oligonukleotid. Nach Applizierung des Teststreifens in die L?sung, erfolgt ein gerichteter Transport des Hybridisierungskomplexes, welcher an einer Streptavidin-modifizierten Zone akkumuliert und detektiert werden kann. Die Teststreifen-basierte Nukleins?ureanalytik ben?tigt einen vorgeschalteten Amplifikationsschritt und die damit verbundene Handhabung von post-PCR-Produkten. Zus?tzlich sind die Systeme durch einen geringen Multiparameter-Grad, geringe Sensitivit?t und eingeschr?nkte Quantifizierung limitiert.

In verschiedenen Bereichen der klinischen Analytik und in vitro-Diagnostik besitzen Multianalyt-Nachweise gro?e Bedeutung, wozu im Folgenden einige Beispiele aufgef?hrt werden (ohne jedoch hierauf begrenzt zu sein): Beispielsweise ist f?r die Blutgruppenbestimmung nicht nur die AB0-Genotypisierung relevant, sondern auch die Erstellung des Humanen Neutrophilen Antigen-Profils (HNA), welches f?r Blut- und Gewebetransfusionen ermittelt werden muss. Auch die parallele ?berpr?fung von Blutspenderproben auf HIV-Varianten und Hepatitis-B bzw. -C-Viren wird routinem??ig mit Immunoassays oder Nukleins?ure-basierten Techniken durchgef?hrt. Der spezifische Nachweis von Pathogenen bedingt die Bestimmung mehrerer genomischer Loci, um eine davon abgeleitete Diagnose nach kurzen Analysezeiten zu erm?glichen.

Die Aktivit?tsbestimmung verschiedener Marker- und Kontrollgene erlaubt die Erstellung eines Expressionsprofils. Dies kann beispielsweise verwendet werden, um Onkogene, welche Zellteilung und -differenzierung beeinflussen und daher in enger Korrelation zu Krebserkrankungen stehen, zu identifizieren oder Vorhersagen ?ber die Wirksamkeit bestimmter Medikamente abh?ngig vom Genotyp des Patienten zu treffen (Personalisierte Medizin). Auch h?ufig vertretene Erbkrankheiten lassen sich in der molekularbiologischen (Pr?natal-)Diagnostik nachweisen, dazu z?hlen u. a. Zystische Fibrose (Mukoviszidose), Phenylketonurie (Stoffwechselst?rung) und Thalass?mie (Degradation der Erythrozyten). Des Weiteren erlaubt die gemeinsame Detektion von Entz?ndungsmarkern, wie Procalcitonin oder Cytokine, einen R?ckschluss auf den Schweregrad einer Infektion.

Zahlreiche diagnostische Fragestellung erfordern die Analyse mehrerer Zielmolek?le, genetischer Loci oder anderer Marker sowie interner Kontrollen bzw. Referenzen, so dass Methoden, die nur die Bestimmung eines einzelnen Parameters pro Analyse erlauben, in der Regel wenig aussagekr?ftig sind. Werden zur Erfassung mehrerer Parameter verschiedene Einzelanalysen parallel durchgef?hrt, ist das andererseits un?konomisch: Die Probenl?sung muss in mehrere homogene Reaktionsans?tze aufgeteilt werden, in denen unterschiedliche Zielmolek?le nachgewiesen werden. Ein Nachteil dabei ist, dass durch das Aufteilen der Probenl?sungen in ?n? Aliquote die Stoffmenge in der Einzelreaktion um Faktor 1/n reduziert wird, wobei sich die Sensitivit?t der Nachweisreaktion entsprechend erniedrigt.

Ein weiterer Nachteil st, dass die Analytik von Proben mit niedriger Nukleins?ure- oder Protein-Konzentration ohne einen Analyt-abh?ngigen vorgeschalteten Aufkonzentrationsbzw. Amplifikationsschritt aufgrund der niedrigen Sensitivit?t mancher Detektionsverfahren nicht m?glich ist. Bei der parallelen, Mikroarray-basierten Analyse niedrig konzentrierter Nukleins?uren stellt die Voramplifikation einerseits einen zus?tzlichen Arbeitsschritt dar und bringt ferner das Problem mit sich, dass abh?ngig von der initialen Stoffmenge und Reaktionseffizienz keine homogene Amplifikation stattfindet und quantitative Aussagen nur eingeschr?nkt m?glich sind. Als nachteilig ist au?erdem das Transferieren von amplifizierten Produkten zwischen verschiedenen Reaktionsgef??en und Ger?ten anzusehen, da dies nicht nur mit einem zus?tzlichen Arbeitsschritt verbunden ist, sondern zus?tzlich ein Kontaminationsrisiko darstellt.

Mikroarray-Analysen beruhen auf der direkten Interaktion zwischen einem typischerweise ?rtlich aufgel?sten, immobilisierten F?ngermolek?l (Bindungspartner oder Sonde) auf einem planaren Substrat und einem Zielmolek?l, welches frei diffusiv in der Fl?ssigphase vorliegt. Ein Nachteil dieser Methoden ist, dass sie mehrere Arbeitsschritte umfassen: eine vorgeschaltete Amplifikation bzw. Anreicherung, die Markierung der Zielmolek?le, um die Interaktion der Zielmolek?le mit dem F?ngermolek?l nachzuweisen, sowie mehrmalige Hybridisierungs- und Waschschritte. Des Weiteren tritt bei der beschriebenen direkten Abh?ngigkeit zwischen F?nger- und Zielmolek?l das Problem auf, dass die Immobilisierung einer anderen Sonde erforderlich ist, wenn sich eine neue experimentelle Fragestellung ergibt, z.B. ein abweichender Genotyp eines Virus nachgewiesen werden soll.

Ein weiterer Nachteil ist, dass aufgrund des aufw?ndigen Herstellungsprozesses und den hohen R?stkosten (Konfiguration des Arrays, Reinigung der Prozessierungselemente) die Fertigung eines Sequenzlayouts nur in gr??eren St?ckzahlen wirtschaftlich (Skaleneffekte) ist. Diese eingeschr?nkte Flexibilit?t reduziert den Vorteil der hoch-parallelen und automatisierbaren Prozessierungen. Nachweise mit universellen Nukleins?ure-Mikroarrays, deren Sonden unabh?ngig vom nachzuweisenden Zielmolek?l sind, k?nnen diesen Nachteil umgehen, allerdings ist der Arbeitsaufwand dieser Methoden sehr hoch, wodurch sich diese nicht durchgesetzt haben. Weiterhin ist neben den beschriebenen technischen Nachteilen der universellen Mikroarrays bislang kein biochemisches System aus dem Stand der Technik bekannt, welches kombinierte Multiplex-Analysen in verschiedenen Stoffklassen, wie zum Beispiel Nukleins?uren und Proteine, erlaubt, so dass f?r unterschiedliche Nachweise verschiedene Verfahren oder Ger?te verwendet werden m?ssen.

Aufgabe der Erfindung war es demgem?? ein System, ein Mittel oder ein Verfahren bereitzustellen, dass die Detektion unterschiedlicher Biomolek?le erm?glicht, wobei es universell einsetzbar ist und nicht die Nachteile oder M?ngel des Standes der Technik aufweist.

Gel?st wird die Aufgabe durch die unabh?ngigen Anspr?che. Vorteilhafte Ausf?hrungsformen ergeben sich aus den Unteranspr?chen.

Es war v?llig ?berraschend, dass eine Mediator-Sonde zur Bindung an ein Zielmolek?l und/oder ein Nachweismolek?l bereitgestellt werden kann, die nicht die Nachteile oder M?ngel der im Stand der Technik offenbarten Sonden oder Systeme aufweist, wobei die Mediator-Sonde eine Sonden-Region und eine Mediator-Region umfasst, wobei die Sonde ein Oligonukleotid ist und die Sonden-Region am 3?-Terminus und die Mediator-Region am 5?-Terminus des Oligonukleotides angeordnet ist, wobei zwischen den Regionen eine chemische, biologische und/oder physikalische Spaltstelle vorliegt und die Sonden-Region eine Affinit?t zu dem Zielmolek?l und die Mediator-Region eine weitere Affinit?t zu dem Nachweismolek?l aufweist.

In einem weiteren Aspekt betrifft die Erfindung eine Mediator-Sonde zur Bindung an ein Zielmolek?l und/oder ein Nachweismolek?l umfassend eine Sonden-Region und eine Mediator-Region, wobei die Sonde ein Oligonukleotid ist und die Sonden-Region am 3?-Terminus und die Mediator-Region am 5?-Terminus des Oligonukleotides angeordnet ist, wobei zwischen den Regionen eine chemische, biologische und/oder physikalische Spaltstelle vorliegt und die Sonden-Region eine Affinit?t zu dem Zielmolek?l und die Mediator-Region eine weitere Affinit?t zu dem Nachweismolek?l aufweist, wobei die Spaltung der Mediator-Sonde insbesondere durch eine Amplifikation des Zielmolek?ls erfolgt. Die Mediator-Sonde umfasst mindestens eine Region ? Region 1-, welche komplement?r oder affin zum Zielmolek?l ist, und eine weitere Region ? Region 2-, welche nicht-komplement?r oder nicht-affin zum Zielmolek?l ist. Dabei k?nnen Region 1 und Region 2 vorteilhafterweise sowohl funktionell als auch r?umlich ?berlappend sein. Die Mediator-Sonde kann in Anwesenheit des Zielmolek?ls und eines oder mehrerer Hilfsmolek?le struktur-spezifisch gespalten werden. Eine erfindungsgem??e Signalentwicklung kann nur durch eine gespaltene Mediator-Sonde erfolgen.

Weiterhin ist eine Mediator-Sonde bevorzugt, die eine Region ? Region 1-, welche komplement?r oder affin zum Zielmolek?l ist, und eine weitere Region ? Region 2-, welche nicht-komplement?r oder nicht-affin zum Zielmolek?l ist, und eine weitere Region ? Region 3-, welche komplement?r oder affin zur besagten Region 2 ist, aufweist. Dabei k?nnen Region 1, Region 2 und/oder Region 3 sowohl funktionell als auch r?umlich ?berlappend sein. Eine direkte oder indirekte Interaktion von Region 1 mit dem Zielmolek?l erzeugt eine Ver?nderung von Region 2 oder Region 3 und ver?ndert damit die Affinit?t oder Interaktion zwischen Region 2 und Region 3 bzw. der kompletten Mediator-Sonde.

Es war v?llig ?berraschend, dass ein Mittel zur Verf?gung gestellt wird, das universell einsetzbar ist und insbesondere zur Minimierung der Kontaminationsf?lle bei molekularbiologischen Nachweismethoden beitr?gt. Es wird mittels einer biochemischen Reaktion eine Detektion verschiedener Molek?le, bevorzugt auf einem universellen Detektions-Chip mit standardisierten F?ngermolek?len erzielt. Dies wird insbesondere dadurch erm?glicht, dass die direkte, physikalische Wechselwirkung zwischen Zielmolek?l und immobilisierten Nachweismolek?l aufgehoben wird. Eine Detektionssonde, die im Sinne der Erfindung insbesondere als Mediator-Sonde bezeichnet wird, fungiert als ?bermittler (Informationstr?ger) zwischen Ziel- und Nachweismolek?l. Durch Interaktion mit dem Zielmolek?l wird die Mediator-Sonde (in Anwesenheit von weiteren Hilfsmolek?len) bevorzugt gespalten und setzt ein aktiviertes Mediator-Molek?l frei, welches eine Nachweisreaktion initiiert.

Im Sinne der Erfindung beschreibt ein abasisches Nukleotid insbesondere einen DNA-Baustein, dessen Desoxyribose nicht an eine Base verkn?pft ist und somit nur ein Phosphat-Zucker-R?ckgrat darstellt. In DNA-Duplexen erfolgt an dieser Position keine Wasserstoffbr?ckenbildung. Diese Modifikation kann unter Verwendung von Tetrahydrofuran (THF) synthetisiert werden.

Der Begriff Amplifikation bezeichnet insbesondere eine Vervielf?ltigung (eines Nukleins?uremolek?ls).

Aptamer beschreibt im Sinne der Erfindung insbesondere ein Oligonukleotid, das mit Molek?len aus anderen Stoffklassen (z.B. Proteinen) aufgrund ihrer strukturellen Eigenschaften interagieren bzw. an diese binden kann.

Ein Bead kennzeichnet bevorzugt Mikrokugeln mit einem Durchmesser von insbesondere 5?100 ?m. Diese k?nnen ggf. auf der Oberfl?che bzw. im Inneren modifiziert bzw. funktionalisiert vorliegen. Die Verwendung von Beads erlaubt die Bereitstellung gro?er Oberfl?chen in einem definierten Reaktionsvolumen.

F?ngermolek?l bezeichnen im Sinne der Erfindung insbesondere ein Molek?l, welches mit einem anderen Molek?l (typischerweise mit dem nachzuweisenden Zielmolek?l) interagiert.

FRET kennzeichnet bevorzugt einen Fluoreszenz-Resonanz-Energie-Transfer, insbesondere die Energie-?bertragung von einem Donor- zu einem Akzeptor-Molek?l.

Der Begriff HDA kennzeichnet vorteilhafterweise eine Helikase-abh?ngige Amplifikation (Helicase Dependent Amplification, HDA), insbesondere ein isothermers Nukleins?ure-Amplifikationsverfahren, welches typischerweise aus zwei enzymatischen Komponenten besteht. Eine Helikase dient zur Trennung der DNA-Doppelstr?nge, wobei die DNA-Polymerase zur Synthese der DNA verwendet wird.

Ein Hilfsmolek?l bezeichnet insbesondere ein Molek?l, welches in Anwesenheit des Zielmolek?ls zur Zustands?nderung der Mediator-Sonde beitr?gt. Es k?nnen verschiedene Hilfsmolek?le aus einer oder verschiedenen Stoffklassen verwendet werden. Beispiele: Enzyme (Polymerasen), Nukleins?uren (Oligonukleotide). Es ist bevorzugt, dass die, an das Zielmolek?l gebundene Sonden-Region durch ein Hilfsmolek?l enzymatisch verl?ngert wird.

Der Begriff LDR steht bevorzugt f?r eine Ligationsdetektionsreaktion (Ligase Detection Reaction). Nukleins?ureamplifikationsverfahren, bei dem zwei oder mehr an einem Nukleins?urestrang nebeneinander hybridisierte Oligonukleotide durch Ligation miteinander verkn?pft werden. Bei dieser Methode dient das Produkt als Substrat f?r den n?chsten Zyklus.

Die Mediator-Sonde kennzeichnet insbesondere ein Molek?l, welches mindestens zwei funktionelle Regionen besitzt, die mit dem Zielmolek?l bzw. dem Nachweismolek?l interagieren k?nnen. Die Mediator-Sonde l?st vorteilhafterweise bei Vorhandensein eines Zielmolek?ls ? ggf. unter Interaktion mit Hilfsmolek?len ? eine Nachweisreaktion aus.

Ein Mikroarray bezeichnet bevorzugt eine ortsaufgel?ste, mindestens 1-dimensionale Anordnung von immobilisierten F?ngermolek?len auf einer geeigneten (typischerweise planaren) Festphase. Alternative Methoden erm?glichen einen Festphasen-gest?tzten Ansatz unter Verwendung von Beads, die z.B. durch unterschiedliche F?rbungen eine eindeutige Diskriminierung erlauben. An eine definierte Bead-Klasse kann ein bestimmtes F?ngermolek?l immobilisiert werden.

Eine Multiplex-Analyse beschreibt insbesondere einen parallelen Nachweis mehrere Zielmolek?le in einem Reaktionsansatz.

Der Begriff Nachweismolek?l kennzeichnet im Sinne der Erfindung insbesondere ein Molek?l, mit dem das Zielmolek?l direkt oder indirekt interagieren kann und ggf. durch Prozessierung eine Nachweisreaktion (z.B. ?nderung eines Fluoreszenzsignals) hervorrufen kann.

Ein Nachweishilfsmolek?l beschreibt insbesondere ein Molek?l, welches vorteilhafterweise mit Mediator und Nachweismolek?l interagiert, wobei bevorzugt eine Nachweisreaktion ausgel?st wird. Es k?nnen verschiedene Hilfsmolek?le aus einer oder verschiedenen Stoffklassen verwendet werden.

Nested PCR bezeichnet bevorzugt eine verschachtelte PCR (Nukleins?ureamplifikations-Variante), wobei zwei Primer-Paare verwendet werden. Das ?u?ere Primer-Paar dient zur Voramplifikation der Zielsequenz, das innere Primer-Paar zur Hauptamplifikation. Das Verfahren erh?ht die Spezifit?t des Nachweises.

Der Begriff NOC-PCR beschreibt insbesondere eine spezielle Ausf?hrung der PCR, n?mlich die nested on-chip PCR, wobei neben den Primern in Fl?ssigphase auch mindestens ein Primer auf einer geeigneten Oberfl?che immobilisiert ist, der innerhalb des amplifizierten Bereichs bindet.

PCR kennzeichnet insbesondere die Polymerase Kettenreaktion (Polymerase Chain Reaction). Verfahren, bei welchem ein von Primermolek?len begrenzter Nukleins?ureabschnitt exponentiell amplifiziert wird. Dabei wird der Reaktionsansatz zyklisch erhitzt und abgek?hlt.

Ein Primer beschreibt bevorzugt ein Oligonukleotid, welches typischerweise komplement?r zu einem Abschnitt der zu amplifizierenden Nukleins?ure ist und diesen Abschnitt begrenzt. Typischerweise werden zwei Primer, die ein Amplikon definieren, als Forward Primer und Reverse Primer bezeichnet. Da die Polymerisation vom 5?-Terminus in Richtung 3?-Terminus durchgef?hrt wird, ben?tigt ein Primer einen 3?-OH-Terminus, an die Polymerase die weiteren Nuklepotide kovalent verkn?pft.

Der Begriff PTO steht bevorzugt f?r Phosphothioat, n?mlich einer Verkn?pfung zweier Nukleotide, in deren Phosphodiesterbindung ein Sauerstoffatom durch ein Schwefelatom ausgetauscht wurde. Durch diese Modifikation werden Nukleotidverbindung weniger anf?llig f?r enzymatische Nuklease-Aktivit?t.

RCA kennzeichnet vorteilhafterweise ein isothermes Nukleins?ureamplifikationsverfahren, welches lineare Konkatamere eines zirkul?ren DNA-Molek?ls generiert (Rolling Circle Amplification).

Reaktionseffizienz beschreibt bevorzugt die Effizienz, mit der eine Amplifikationsreaktion durchgef?hrt wurde. Unter idealen Bedingungen wird in jedem Zyklus das Substrat verdoppelt, wobei die Reaktionseffizienz 100% betr?gt.

Der Begriff Reportersystem beschreibt insbesondere eine Kombination von mindestens zwei Molek?len, welche die Detektion eines spezifischen Zielmolek?ls erm?glichen. Die Detektion erfolgt typischerweise ?ber Fluoreszenz, Lumineszenz, Phosphoreszenz und Chemilumineszenz, ist aber nicht darauf beschr?nkt.

SDA beschreibt vorteilhafterweise eine Einzelstrangverdr?ngungs-Reaktion, n?mlich ein isothermes Verfahren zur Amplifikation von Nukleins?uren (Strand Displacement Amplification).

Der Begriff SNP kennzeichnet bevorzugt eine Punktmutation (Single Nucleotide Polymorphism), n?mlich einen Nukleotidaustausch innerhalb einer Nukleotidabfolge.

Sonde Molek?l, welches typischerweise mit dem Zielmolek?l interagiert. Die Sonde kann immobilisiert an einer Festphase oder in der fl?ssigen Phase vorliegen.

Der Begriff STR steht bevorzugt f?r repetitive Abschnitte (typischerweise 3 bis 5 Basenpaare) im Genom (short tandem repeats).

Im Sinne der Erfindung bezeichnet TIRF bevorzugt totale innere Reflexionsfluoreszenz (Total Internal Reflection Fluorescence).

Universelle Arrays In der Regel Nukleins?ure-Mikroarray, dessen Sondensequenzen unabh?ngig vom Zielmolek?l w?hlbar sind.

WGA steht vorzugsweise f?r die Amplifzierung eines Genoms (Whole Genome Amplification) mit Hilfe Primer zuf?lliger Sequenz typischerweise unter isothermern Bedingungen.

Das Zielmolek?l umfasst im Sinne der Erfindung insbesondere ein Biomolek?l, ausgew?hlt aus der Gruppe umfassend DNA, RNA, Protein, Aptamer und/oder ein Komplex aus Aptamer und assoziierter DNA, RNA, Protein oder einer Kombination hieraus, welches in einer Probenl?sung nachgewiesen werden soll und auch Teile des Molek?ls (Erkennungssequenzen, Epitope). Eine Kombination der Zielmolek?le kann im Sinne der Erfindung insbesondere auch als Gemisch bezeichnet werden. ?berraschenderweise k?nnen Molek?le verschiedener Stoffklassen (z.B. Protein und DNA) einzeln oder parallel in einem Ansatz detektier werden, so dass ein universell einsetzbares Mittel zur Verf?gung steht.

Das Zielmolek?l kann auch cDNA umfassen, welche mittels Reverse-Transkription unter Verwendung von ggf. mit 5?-Sequenz?berhang modifizierten Primern generiert werden kann. Auch ein Komplex aus Aptamer und assoziiertem Zielmolek?l oder ein Interaktionsprodukt aus zwei oder mehreren Stoffklassen, wie zum Beispiel Nukleins?uren und Proteine k?nnen als Zielmolek?l verwendet werden. Dabei lassen sich verschiedene Zielmolek?le in einem Reaktionsansatz einzeln oder parallel nachweisen. Es ist bevorzugt, dass die Mediator-Sonde aus einem Oligonukleotid oder einem entsprechenden Derivat besteht, das Zielmolek?l eine Nukleins?ure, ein entsprechendes Derivat oder ein Molek?l umfassend DNA, RNA, Protein, Aptamer und/oder ein Komplex aus Aptamer und assoziierter DNA, RNA oder Protein darstellt und das Nachweismolek?l ein Oligonukleotid oder davon abgeleitetes Derivat ist.

Die Mediator-Sonde ist bevorzugt ein lineares Oligonukleotid und weist 1 bis 70, bevorzugt 15 bis 60, besonders bevorzugt 35 bis 45 Nukleotide auf. Die Sonde ist in mindestens zwei funktionell verschiedene Regionen untergliedert (siehe hierzu 2). Der 3?-terminale Bereich ? Region 1 ? ist affin bzw. komplement?r zu einem Bereich des Zielmolek?ls. Die Region 1 kann im Sinne der Erfindung insbesondere als Sonden-Region oder Hybridisierungssequenz bezeichnet werden. Der 5?-Terminus ? Region 2 ? ist nicht komplement?r bzw. affin zum Zielmolek?l, aber komplement?r bzw. affin zu einem spezifischen Nachweismolek?l, welches bevorzugt immobilisiert an einer Festphase vorliegt. Die Region 2 kann im Sinne der Erfindung bevorzugt als Mediator-Region bezeichnet werden. Die Spezifit?t der Reaktion wird durch Region 1 der Mediator-Sonde erreicht, welche mit dem Zielmolek?l interagiert. Die Mediator-Sonde weist eine potentielle Spaltstelle zwischen Region 1 und Region 2 auf.

Die Interaktion des Zielmolek?ls mit der Mediator-Sonde f?hrt bevorzugt zu einer direkten oder indirekten Spaltung der Mediator-Sonde, wobei bevorzugt folgende Spaltfragmente erzeugt werden:

  • ? ein Fragment aus Region 2 und ein Fragment aus Region 1 oder
  • ? Region 2 und ein Fragment aus Region 1 oder
  • ? Region 2 und einen Bereich von Region 1 als ein zusammenh?ngendes Fragment und ein Fragment aus Region 1 oder
  • ? ein Fragment aus Region 2, Region 3 bzw. ein Fragment aus Region 3 und ein Fragment aus Region 1 oder
  • ? Region 2 sowie Region 3 bzw. ein Fragment aus Region 3 und ein Fragment aus Region 1 oder
  • ? Region 2 und einen Bereich von Region 1 als ein zusammenh?ngendes Fragment sowie Region 3 bzw. ein Fragment aus Region 3 und ein Fragment aus Region 1.

Es war ?berraschend, dass Zielmolek?le (Analyten), insbesondere Biomolek?len wie Nukleins?uren oder Proteinen, durch direkte oder indirekte Interaktion mit einem speziellen, signal?bertragenden Molek?l (Mediator-Sonde) nachgewiesen werden k?nnen. Bei der Interaktion des Zielmolek?ls mit der Mediator-Sonde wird in einer direkten oder indirekten Aktivierungsreaktion die Mediator-Sonde in Sonden-Fragment und Mediator gespalten. Der aktivierte Mediator l?st eine direkte oder indirekte Nachweisreaktion aus, in der ein oder mehrere Nachweismolek?le ver?ndert werden. Die Anwesenheit des Zielmolek?ls l?st vorteilhafterweise eine Aktivierungsreaktion der Mediator-Sonde aus. Die Aktivierungsreaktion, welche die Mediator-Sonde in den Mediator ?berf?hrt, kann bevorzugt enzymatischer, katalytischer oder physikalischer Natur sein, ferner kann sie bevorzugt parallel zur Amplifikation des Zielmolek?ls erfolgen. Bei direkten Interaktionen zwischen Zielmolek?l und Mediator-Sonde erzeugt die Anwesenheit des Zielmolek?ls aus der Mediator-Sonde den Mediator. Bei indirekten Interaktionen induziert das Zielmolek?l, insbesondere eine Nukleins?ure, eine Wechselwirkung mit der Mediator-Sonde und einem Hilfsmolek?l, insbesondere einem Oligonukleotid, welches strukturell nicht mit der Mediator-Sonde interagiert. Das beschriebene Hilfsmolek?l fungiert als Primer und wird dabei durch ein andersartiges Hilfsmolek?l, insbesondere eine geeignete Polymerase, verl?ngert, worauf die Mediator-Sonde nach struktureller Interaktion mit der Polymerase in Mediator und Sonden-Fragment gespaltet wird. Der Mediator entsteht aus der Mediator-Sonde somit in Anwesenheit des Zielmolek?ls. Die Hilfsmolek?le sind vorzugsweise ausgew?hlt aus der Gruppe umfassen Katalysatoren, Proteine, Nukleins?uren, Naturstoffe, Enzyme, Enzym-Systeme, Zell-Lysate, Zell-Bestandteile, daraus abgeleitete Derivate oder synthetische Molek?le oder eine Mischung hieraus. Die Nachweishilfsmolek?le sind bevorzugt aus verschiedenen Stoffklassen, wie Katalysatoren, Proteinen, Nukleins?uren, Naturstoffen, Enzymen, Enzym-Systemen, Zell-Lysaten, Zell-Bestandteilen, daraus abgeleitete Derivaten oder synthetischen Molek?len oder einer Mischung aus verschiedenen Molek?len dieser Stoffklassen ausgew?hlt. Es ist bevorzugt, dass die Hilfsmolek?le, Molek?le aus einem Nukleins?ureamplifikationssystem und/oder einem Restriktionsenzymsystem umfassen. Ferner ist bevorzugt, dass das Nachweishilfsmolek?l strukturspezifisch spaltet. Die Region 1 der Mediator-Sonde kann bevorzugt mit dem Zielmolek?l durch Basenpaarung interagieren und ein Hilfsmolek?l Region 2 von Region 1 bzw. Fragmente von Region 1 oder Region 2 abspalten, wobei Region 2 mit einem Nachweismolek?l durch Basenpaarung interagiert und ein Nachweishilfsmolek?l Bestandteile des Nachweismolek?ls abspaltet, wobei diese Abspaltungsreaktion als indirekter Nachweis f?r das Zielmolek?l dient. Der abgespaltene Bestandteil des Nachweismolek?ls kann vorzugsweise einen Fluoreszenzdonor oder einen Fluoreszenzakzeptor darstellen.

Es kann jedoch auch bevorzugt sein, dass das Nachweishilfsmolek?l sequenzspezifisch spaltet. Hierbei sind die Hilfsmolek?le ein Nukleins?ureamplifikationssystem und das Nachweishilfsmolek?l ein Restriktionsenzymsystem oder eine Mischung aus einem Nukleins?ureamplifikationssystem und einem Restriktionsenzymsystem. Das Nachweismolek?l ist ein Oligonukleotid oder ein Derivat und enth?lt die entsprechende Erkennungssequenz f?r das Restriktionsenzymsystem. Hierbei bindet der Mediator an das Nachweismolek?l an den komplement?ren Abschnitt und wird durch das Nukleins?ureamplifikationssystem verl?ngert. Der generierte Sequenzduplex enth?lt somit mindestens ein Erkennungssequenzmotiv des Restriktionsenzymsystems, welches diesen in mindestens zwei Teile spaltet. Nach der Spaltung des Sequenzduplex kann bevorzugt ein Signal, zum Beispiel die ?nderung der Fluoreszenz oder der Masse, detektiert werden. Es kann jedoch auch vorteilhaft sein, wenn nach Spaltung des Sequenzduplex mindestens ein Spaltfragment eine Amplifikationsreaktion mit vorliegenden komplement?ren oder teilkomplement?ren Nukleins?uresequenzen initiieren kann, wobei besagte Nukleins?uresequenzen frei in L?sung oder an einer Festphase immobilisiert vorliegen k?nnen.

In einer bevorzugten Ausf?hrungsform kann die Amplifikation durch Inkorporation von Fluoreszenz- oder anderweitig markierter Nukleotide oder durch Anlagerung sequenzspezifischer, fluorogener oder chromogener Sonden oder durch Anlagerung eines sequenzunspezifischen Fluoreszenzfarbstoffes detektiert werden. Die Amplifikationsprodukte k?nnen vorteilhafterweise direkt oder indirekt nachgewiesen werden, wobei die Detektion als indirekter Nachweis f?r das Zielmolek?l dient.

Der freigesetzte Mediator kann bevorzugt in Anwesenheit einer geeigneten Nukleins?ure durch eines oder mehrerer verschiedener Enzyme, wie zum Beispiel Polymerasen, eine enzymatisch-katalysierte Amplifikations- oder Polymerisationsreaktion initiieren. Dabei kann die geeignete Nukleins?ure einzel- oder doppelstr?ngig vorliegen und in der Nachweisreaktion zus?tzlich ein gegenl?ufiger Primer (Reverse Primer) verwendet werden.

Die Anwesenheit des Mediators l?st bevorzugt eine Nachweisreaktion aus. Die Kopplung zwischen Zielmolek?l und Nachweisreaktion h?ngt dabei nur von den Eigenschaften des Mediators bzw. der Mediator-Sonde ab und erlaubt somit eine freie Kopplung zwischen einem beliebigen Zielmolek?l und einer beliebigen Nachweisreaktion bzw. Nachweismolek?l. Bei einer direkten Nachweisreaktion des Mediators ver?ndert der Mediator direkt das Nachweismolek?l. Bei einer indirekten Nachweisreaktion induziert der Mediator durch Interaktion mit Nachweishilfsmolek?len, insbesondere einer Polymerase, welche den Mediator verl?ngert, die Ver?nderung des Nachweismolek?ls. Vorteilhafterweise verursacht der Mediator w?hrend der Nachweisreaktion eine Ver?nderung des Nachweismolek?ls und erf?hrt durch geeignete Nachweishilfsmolek?le selbst eine ?nderung, womit ein Mediator, der in der Nachweisreaktion ver?ndert wurde, von einem Mediator, der unmittelbar aus einer Mediator-Sonden-Spaltung hervorgegangen ist, eindeutig unterschieden werden kann. Die genannten Nachweismolek?le wechselwirken nicht physikalisch mit den genannten Zielmolek?len. Eine Kopplung zwischen Zielmolek?l und Nachweismolek?l erfolgt indirekt ?ber die entsprechenden Mediator-Sonden. Durch die Verwendung der Mediator-Sonde erfolgt eine freie Zuordenbarkeit eines Zielmolek?ls zu einem beliebigen Nachweismolek?l. Die Nachweismolek?le k?nnen an einer Festphase immobilisiert vorliegen und einen universellen Detektionsmikroarray darstellen, welcher f?r verschiedenartige Nachweise verwendet werden kann.

Findet eine Interaktion zwischen Zielmolek?l und Mediator-Sonde statt, erfolgt in Anwesenheit von weiteren Molek?len und Hilfsmolek?len eine enzymatisch-prozessierte Spaltung der Mediator-Sonde, wobei ein Mediator-Molek?l freigesetzt und die Hybridisierungssequenz fragmentiert wird (3). Der Mediator weist durch dieses Spaltungsereignis einen 3?-OH-Teminus auf, welcher f?r die anschlie?ende Nachweisreaktion erforderlich ist. Daher dient der abgespaltene Mediator als Informationstr?ger f?r die Anwesenheit des Zielmolek?ls im Reaktionsmedium. In Gegenwart von Nachweishilfsmolek?len kann der Mediator in einem weiteren Schritt an einem spezifischen Nachweismolek?l eine Signal-generierende Reaktion ausl?sen, deren Detektion als indirekter Nachweis f?r das Zielmolek?l dient. Um die Sensitivit?t des Nachweises zu erh?hen, kann die Spaltung der Mediator- Sonde bevorzugt an eine parallel erfolgende Amplifizierung des Zielmolek?ls gekoppelt werden. Die unerw?nschte, enzymatischkatalysierte Sequenzverl?ngerung der ungespaltenen Mediator-Sonde wird bevorzugt dadurch verhindert, dass die Mediator-Sonde am 3?-Terminus der Sonden-Region eine chemische Schutzgruppe aufweist. Die chemische Schutzgruppe kann ausgew?hlt sein aus der Gruppe umfassend Phosphatgruppe, Biotin, invertiertes Nukleotid, Nukleotide, die nicht komplement?r zur Zielsequenz sind. Dem Fachmann sind weitere chemische Schutzgruppen bekannt, die eine Verl?ngerung einen Oligonukleotides, insbesondere des 3?-Terminus verhindern k?nnen. Eine Detektion des Mediators erfolgt mit Hilfe einer Nachweisreaktion. Der Reaktionsmechanismus (siehe 4) kann parallel zu der beschriebenen Amplifikation des Zielmolek?ls erfolgen.

In einer bevorzugten Ausf?hrungsform betrifft die Erfindung ein System umfassend eine Mediator-Sonde und ein Nachweismolek?l, wobei das Nachweismolek?l ein Oligonukleotid ist und mindestens folgende Regionen aufweist:

  • a. eine Region an einem 5?-Terminus des Nachweismolek?ls, die einen Fluoreszenzakzeptor oder einen -donor und/oder eine chemische Gruppe zur Bindung an eine Festphase und/oder eine chemische Schutzgruppe aufweist,
  • b. eine weitere Region, die mit der Mediator-Region interagiert,
  • c. eine dritte Region, die einen Fluoreszenzdonor oder einen -akzeptor aufweist und
  • d. eine vierte Region an einem 3?-Terminus des Nachweismolek?ls, die eine chemische Gruppe zur Bindung an eine Festphase und/oder eine chemische Schutzgruppe aufweist.

Beispielhaft sind m?gliche chemische Gruppen zur Immobilisierung eines Oligonukleotids aufgelistet. Die chemische Gruppe ist abh?ngig von der verwendenden Oberfl?chenchemie und evtl. ben?tigten Kopplungsmolek?len: -OH (Hydroxyl), -NH2 (Amino), -Ph (Phosphat), -Acrydite oder -Silan. Dem Fachmann sind Methoden bekannt, um Oligonukleotide an einer Oberfl?che zu immobilisieren. Um insbesondere eine putative Immobilisierung des 5?-Terminus zu erm?glichen, weist das Nachweismolek?l eine chemische Gruppe und/oder eine chemische Schutzgruppe auf.

Das Nachweismolek?l ist bevorzugt ein einzelstr?ngiges Nukleins?uremolek?l oder ein Nukleins?urederivat. Das Nachweismolek?l ist vorzugsweise eine Nukleins?ure und verf?gt ?ber eine oder mehrere gleichartige oder verschiedene Modifikationen (beispielsweise abasische Nukleotide und/oder Phosphothioate und/oder funktionelle Gruppen wie Fluoreszenzfarbstoffe). Vorteilhafterweise erfolgt eine ?nderung des Nachweismolek?ls durch direkte oder indirekte Interaktion mit dem Mediator und kann eine oder mehrere ?nderungen der Fluoreszenz, Phosphoreszenz, Masse, Absorption, Streuung des Lichts, elektrischen Leitf?higkeit, enzymatischen Aktivit?t oder der Affinit?t betreffen und dadurch physikalisch erfassbar werden. In Anwesenheit des Mediators kann das Nachweismolek?l bevorzugt eine chemische Modifizierung, wie z.B. Phosphorylierung, Dephosphorylierung, Amidierung, Anbindung oder Abspaltung einer chemischen Gruppe, Fluoreszenz-, Phosphoreszenz- oder Lumineszenz?nderung erfahren.

Ein Nachweismolek?l besteht in einer bevorzugten Ausf?hrungsform aus einem Oligonukleotid, welches in sechs Regionen unterteilt ist (siehe 4). Region 1 umfasst den 5?-Terminus des Nachweismolek?ls, welcher in einer bevorzugten Ausf?hrungsform aus einem Sequenzabschnitt und einem Fluoreszenzakzeptor Q besteht. Region 3 ist eine revers-komplement?re Sequenzabfolge von Region 1 und wird durch Region 2 davon abgetrennt. Region 4 trennt Region 3 und Region 5, welche spezifisch mit einem Mediator-Molek?l interagieren kann. Region 6 umfasst den 3?-terminalen Sequenzbereich, welcher bevorzugt ?ber eine chemische Modifikation verf?gt und somit eine gerichtete Immobilisierung des Oligonukleotids erm?glicht. Ein Fluoreszenzdonor F ist in dem Fachmann bekannter Weise an einen Bereich der Region 2 bis Region 6, beispielsweise Region 4, assoziiert. Es ist bevorzugt, dass das Nachweismolek?l eine Haarnadel-Struktur aufweist. Region 1 und Region 3 des Nachweismolek?ls bilden unter Reaktionsbedingungen eine definierte Sekund?rstruktur (im Sinne der Erfindung als Haarnadel-Struktur bezeichnet), bei welcher der 5?-Terminus mit einem internen Sequenzabschnitt hybridisiert. Bevorzugt ist, dass die Haarnadel-Struktur ausgebildet ist, indem der 5?-Terminus des Nachweismolek?ls mit einem internen Sequenzabschnitt komplement?r hybridisiert und der 3?-Terminus des Nachweismolek?ls einen ungepaarten Sequenzabschnitt umfasst. Nach Anlagerung des Mediators an einen Sequenzbereich des ungepaarten 3?-Sequenzabschnitt wird der Mediator durch eine Polymerase verl?ngert, wobei Nukleotide des 5?-Terminus der Haarnadelstruktur des Nachweismolek?ls aufgrund der Nuklease-Aktivit?t der Polymerase entfernt werden. Nach Ausbildung dieser Struktur interagieren Fluoreszenzdonor F und Fluoreszenzakzeptor Q miteinander, wobei das Fluoreszenzsignal von F unterdr?ckt wird (Fluoreszenz-Resonanz-Energietransfer, FRET). Es ist bevorzugt, dass die Mediator-Sonde und/oder das Nachweismolek?l fluoreszenzmarkierte Nukleotide aufweisen. Insbesondere ist es bevorzugt, dass das Nachweismolek?l mindestens eine Fluoreszenz-Modifikationen am 5?-Terminus und/oder innerhalb der Haarnadelstruktur aufweist. Das Nachweismolek?l weist eine oder mehrere Fluoreszenz-Modifikationen auf, die zu einem Fluoreszenz-Resonanz-Energie-Transfer bef?higt sind und die nach der Abspaltung r?umlich voneinander getrennt werden k?nnen, woraus eine ?nderung des Fluoreszenzsignals detektiert werden kann.

Es k?nnen vorteilhafterweise sequenzspezifische oder -unspezifische, fluorogene und/oder chromogene Sonden oder Fluoreszenzfarbstoffe mit mindestens einer Region der Mediator-Sonde und/oder dem Nachweismolek?l interagieren. Weiterhin kann vorteilhaft sein, wenn das Nachweismolek?l ?ber mindestens eine Fluoreszenz-Modifikationen am 5?-terminalen Bereich und/oder innerhalb der Haarnadelstruktur verf?gt und nach der Reaktion mit der Mediator-Region mittels eines Hilfsmolek?ls von dem Nachweismolek?l die Fluoreszenz-Modifikationen abgespalten und/oder der 5?-Terminus der Haarnadelstruktur des Nachweismolek?ls entfernt wird und eine ?nderung des Fluoreszenzsignals am Nachweismolek?l detektiert wird.

Das Nachweismolek?l kann au?erdem in einer bevorzugten Ausf?hrungsform ?ber eine oder mehrere Fluoreszenz-Modifikationen am 5?-terminalen Bereich und/oder innerhalb der Haarnadelstruktur verf?gen, wobei nach der Prozessierung des hybridisierten Mediators mithilfe eines geeigneten Enzyms von diesem Nachweismolek?l die 5?-terminalen Nukleotide abgespalten und eine ?nderung des Fluoreszenzsignals am Nachweismolek?l detektiert werden kann. Der freigesetzte Mediator interagiert vorzugsweise mit mindestens einem frei in der L?sung vorliegenden oder an einer Festphase immobilisierten Nachweismolek?lkomplex, wobei aus zwei oder mehreren gleichartigen oder verschiedenen Molek?len wie z.B. Peptid, Nukleins?ure, ein von den genannten Gruppen abgeleitetes Derivat oder anderes Molek?l, erfolgen kann. Der Nachweismolek?lkomplex kann ?ber eine bis mehrere verschiedene oder gleichartige chemische Modifizierungen verf?gen und nach der Interaktion mit dem Mediator ein detektierbares Signal generieren. Es ist bevorzugt, dass durch eine indirekte oder direkte Interaktion der Mediator-Region mit der zweiten Region des Nachweismolek?ls eine physikalisch oder chemisch messbare Ver?nderung des Nachweismolek?ls erfolgt. Diese Region kann erst nach der Spaltung der Mediator-Sonde ein Signal ausl?sen. Die Region 2 der Mediator-Sonde l?st bevorzugt -soweit sie noch assoziiert an die Mediator-Sonde vorliegt- kein Signal aus, weder direkt (z.B. Hybridisierung) noch indirekt (z.B. Prozessierung durch Polymerase), da sonst eine Zielmolek?lunabh?ngige Signalentstehung erfolgt. Diese messbare Ver?nderung kann auch durch die Hilfsmolek?le (z. B. Polymerase) hervorgehen.

In einem weiteren Aspekt betrifft die Erfindung ein Verfahren zum Nachweis von mindestens einem Zielmolek?l, umfassend ein System, umfassend folgende Schritte:

  • a. komplement?re Bindung der Sonden-Region der Mediator-Sonde an eine Sequenz des Zielmolek?ls oder eines Aptamers. Ein Aptamer ist im Sinne der Erfindung eine einzelstr?ngige Nukleins?ure, welche eine erh?hte Bindungsaffinit?t f?r andere Molek?le, z.B. Proteine, zeigt. Ein bevorzugtes Aptamer besitzt zus?tzlich terminale Regionen ?Region 1? und ?Region 2?, die miteinander interagieren k?nnen (im Sinne der Erfindung als geschlossene Form bezeichnet). Davon begrenzt sind zwei Regionen, wobei ?Region 3? die Affinit?t f?r das Zielmolek?l besitzt und die ?Region 4? eine Bindesequenz f?r ein Primermolek?l und eine Mediator-Sonde darstellt. ?Region 4? erlaubt nur eine Bindung des Primers und der Mediator-Sonde, sofern ?Region 3? mit dem Zielmolek?l interagiert bzw. assoziiert ist.
  • b. Spaltung der Mediator-Sonde an der Spaltstelle zwischen der Sonden-Region am 5?-Terminus und der Mediator-Region am 3?-Terminus durch Hilfsmolek?le, und
  • c. komplement?re Bindung der abgespaltenen Mediator-Region der Mediator-Sonde an die zweite Region des Nachweismolek?ls.

Es war ?berraschend, dass die Spaltung der Mediator-Sonde eine Ver?nderung der physikalischen und/oder chemischen Eigenschaften mindestens einer Region der Mediator-Sonde bewirkt, ausgew?hlt aus der Gruppe umfassend:

  • a. molekulare Masse (nach Spaltung der Sonde unterscheiden sich die Spaltfragmente von der Mediator-Sonde),
  • b. enzymatische Aktivit?t (Die Sonde ?ndert vorteilhafterweise ihre Eigenschaft eine Nachweisreaktion initiieren zu k?nnen ? Vorhandensein eines freien 3? Endes),
  • c. Bindungseigenschaften umfassend Affinit?t oder Avidit?t,
  • d. chemische Reaktivit?t (Nach Spaltung der Mediator-Sonde besitzt das Spaltfragment, welches die Region 2 der Mediator-Sonde enth?lt, eine Hydroxyl-Gruppe am 3?-Ende, welches durch ein Hilfsmolek?l (z. B. Polymerase) verl?ngert werden kann. Dies ist f?r die ungespaltene Sonde nicht m?glich),
  • e. Vorhandensein chemischer Gruppen,
  • f. elektrischer Eigenschaft umfassend Leitf?higkeit, Polarisierbarkeit oder Ladung und/oder
  • g. optischer Eigenschaft umfassend Absorption und Emission von Licht (Sofern die Mediator-Sonde mit mindestens einem Fluoreszenzfarbstoff markiert ist, kann bevorzugt nach der Spaltung ein ver?ndertes Fluoreszenzsignal detektiert werden).

Die Mediator-Region, die im Sinne der Erfindung insbesondere als Mediator bezeichnet werden kann, liegt nach der Spaltung vorteilhafterweise diffusiv in der Reaktionsl?sung vor und kann mit der Mediator-Hybridisierungssequenz (Region 5) des Nachweismolek?ls interagieren (siehe 5i) + ii)). Das Nachweismolek?l kann bevorzugt an eine Festphase gebunden oder frei in einer L?sung vorliegen. Hierdurch kann ein universeller Detektionsarray bereitgestellt werden. Durch ein geeignetes Hilfsmolek?l (z.B. ein Enzym, insbesondere eine Polymerase) erfolgt eine Elongation des Mediators, wobei Region 1 des Nachweismolek?ls sequentiell abgebaut wird. Dabei wird das Nachweismolek?l bevorzugt durch Abspaltung des 5?-Terminus und den damit assoziierten Fluoreszenzakzeptors Q, ver?ndert und das zuvor unterdr?ckte Fluoreszenzsignal des Fluoreszenzdonors F wiederhergestellt (siehe 5iii) + iv)). Wird durch die Abspaltung die Interaktion von Region 1 und Region 3 unterbunden, wird die Ausbildung der Sekund?rstruktur aufgehoben. In diesem Fall kann der Mediator durch das beschriebene Hilfsmolek?l unter bestimmten Bedingungen bis zum neu entstehenden 5?-Terminus des Nachweismolek?ls komplement?r verl?ngert werden (siehe 5v) + vi)). Durch diese vollst?ndige Elongation besitzt der verl?ngerte Mediator einen Sequenzabschnitt, der komplement?r zu Region 1 und Region 2 des Nachweismolek?ls ist.

In einer bevorzugten Ausf?hrung erfolgt die serielle Interaktion des Mediators mit mehreren gleichartigen Nachweismolek?len, womit eine Signalverst?rkung erfolgt. Dies erh?ht die Sensitivit?t der Nachweisreaktion. Bei dieser Ausf?hrung werden vorteilhafterweise modifizierte Nukleotide f?r die Synthese des Nachweismolek?ls verwendet, die nur einen begrenzten 5?-Terminusabbau w?hrend der Nachweisreaktion erlauben. Dies kann durch den Einbau einer oder mehrerer Phosphothioat-Modifikationen (PTO) beispielsweise am vorletzten Nukleotid des 5?-Terminus w?hrend der Synthese des Molek?ls erfolgen. Die Position der PTO-Modifikation befindet sich bevorzugt in Region 1, besonders bevorzugt zwischen Fluoreszenzdonor F und Fluoreszenzakzeptor Q. Eine Darstellung bevorzugter Positionen modifizierter Nukleotide ist in 6 dargestellt. Bevorzugte Nachweishilfsmolek?le k?nnen PTO-Verbindungen nicht oder nur mit geringer Effizienz spalten, worauf der 5?-Terminus (Region 1) nicht ?ber dieses Nukleotid hinaus abgebaut wird. Folglich wird auch der Mediator nicht weiter verl?ngert. Durch geeignetes Einstellen der Reaktionsbedingung k?nnen das Nachweishilfsmolek?l und der Mediator vom Nachweismolek?l dissoziieren und f?r die Aktivierung eines weiteren Nachweismolek?ls wieder zur Verf?gung stehen.

In einer weiteren bevorzugten Ausf?hrung, die mit der oben beschriebenen PTO-Modifikation kompatibel, aber nicht auf eine kombinierte Anwendung beschr?nkt ist, wird in Region 3 ein abasisches Nukleotid (Tetrahydrofuran-Modifkation, THF) eingebaut, welches keine Wasserstoffbr?cken mit einem komplement?ren Nukleotid ausbilden kann. Dadurch wird die Verl?ngerungsreaktion des Mediators an der gegen?berliegenden Position des abasischen Nukleotids unterbunden, worauf das Nachweishilfsmolek?l und der verl?ngerte Mediator vom Nachweismolek?l dissoziieren (siehe 7). Die Verwendung einer der bevorzugten Modifikationen erm?glicht die serielle Interaktion eines Mediator-Molek?ls mit mehreren Nachweismolek?len, was im Sinne der Erfindung insbesondere als Mediator-Wiederverwendung bezeichnet werden kann. Der Mediator wird bei der ersten Interaktion mit einem Nachweismolek?l und erfolgter Prozessierung mittels eines Nachweishilfsmolek?ls verl?ngert und kann auch in diesem verl?ngerten Zustand mit weiteren Nachweismolek?len interagieren und eine Degradation des 5?-Terminus ? und somit auch des Fluoreszenzakzeptors Q ? mit Hilfe eines geeigneten Nachweishilfsmolek?ls (z.B. Polymerase mit 5?-Nukleaseaktivit?t) erm?glichen. Dieser Reaktionsmechanismus erlaubt eine Signalamplifikation, da unabh?ngig von einer Zielmolek?lamplifikation ein Signal generiert und verst?rkt wird. Wird das Zielmolek?l mithilfe geeigneter Hilfsmolek?le amplifiziert und dieser Vorgang an eine Mediator-Sonden-Spaltung gekoppelt, tritt eine Mediator-Akkumulation auf, die eine Zielmolek?l-Amplifikation mit einer Signalverst?rkung kombiniert und die Nachweisgrenze der Detektionsreaktion um mehrere Gr??enordnungen verringert. Dies war v?llig ?berraschend und ist nicht im Stand der Technik beschrieben. Au?erdem stellt es eine Abkehr vom technisch ?blichen dar. Die Reaktionsbedingungen k?nnen vorteilhafterweise nach Ablauf dieses Prozesses, z.B. durch Erh?hen der Reaktionstemperatur, ge?ndert werden, so dass das Enzym, z. B. die Polymerase und der verl?ngerte Mediator vom Nachweismolek?l dissoziiert. Dem Fachmann ist bekannt, dass die Reaktionsbedingungen zyklisch ver?ndert werden k?nnen, so dass ein Mediator-Molek?l in einer besonders bevorzugten Ausgestaltung der Erfindung mit mehreren gleichartigen Nachweismolek?len interagieren kann. Dadurch entsteht ?berraschenderweise eine Signalamplifizierung, welche die Sensitivit?t der Reaktion deutlich erh?ht.

Die Nachweisreaktion ist bevorzugt derartig ausgelegt, dass im Gegensatz zum Mediator die ungespaltene Mediator-Sonde keine Signal-generierende Reaktion ausl?st und somit keine falsch-positiven Ergebnisse erzeugt werden. Der Mediator, welcher aus der Mediator-Sonden-Spaltung hervorgeht, besitzt einen 3?-OH-Terminus, der f?r eine Polymerasevermittelte Verl?ngerungsreaktion besonders vorteilhaft ist. Tritt diese Spaltung nicht auf, ist eine Mediator-Elongation nicht m?glich, da die Mediator-Sequenz kovalent mit der Hybridisierungssequenz der Mediator-Sonde verkn?pft ist (siehe 8). Zus?tzlich kann eine unspezifische Verl?ngerung des 3?-Terminus der Mediator-Sonde beispielsweise mit einer Phosphatgruppe oder anderen chemischen Gruppen verhindert werden.

Durch das Interaktionsereignis des Mediators mit dem Nachweismolek?l entsteht bevorzugt ein lokales, detektierbares (Fluoreszenz-)Signal. Werden ausreichend viele Nachweismolek?le durch die bevorzugte Mediatorverl?ngerung mit resultierender Abspaltung des 5?-Terminus aktiviert, wird das Signal verst?rkt und kann mittels geeigneter (insbesondere optischer) Detektionsvorrichtungen nachgewiesen werden. Dies erm?glicht die Detektion in Anwesenheit des Reaktionsgemisches und bedarf keiner Prozessierungsschritte. Damit besitzt die bevorzugte Ausf?hrungsform die vorteilhafte Eigenschaft, innerhalb eines geeigneten Reaktionsraumes eine Detektion zu erlauben, ohne dieses nach durchgef?hrter Reaktion ?ffnen zu m?ssen. Dies vermeidet die im Stand der Technik beschriebenen Probleme von Mikroarray-Analysen durch Hybridisierungs-, F?rbe-, und/oder Waschschritten, welche zus?tzlichen Arbeitsaufwand und hohes Kontaminationsrisiko darstellen. Demnach kann die bevorzugte Ausf?hrungsform als Abkehr vom technischen ?blichen bezeichnet werden, da sie ein neues technisches Feld er?ffnet und ein im Stand der Technik lang bestehendes Problem l?st.

Erg?nzend zu den beschriebenen Vorteilen erm?glicht die bevorzugte Ausf?hrungsform das Auslesen der entstehenden Signale zu beliebigen Zeitpunkten der Reaktion. Somit kann eine Echtzeit?berwachung der Reaktion erfolgen, welche z.B. f?r die Quantifizierung von Nukleins?ureamplifikationen oder Ermittlung der Bindekinetik von Protein-Interaktionen ben?tigt wird. Damit hebt sich die bevorzugte Ausf?hrungsform vom Stand der Technik ab, in dem typischerweise nur Endpunkt-Bestimmungen erfolgen und daher eine Signaldetektion zu beliebigen Zeitpunkten nicht durchf?hrbar ist.

Multiplex-Analysen bedingen die Detektion mehrerer verschiedener Analyte in einem Reaktionsgemisch. F?r die Erh?hung des Multiplexgrads der bevorzugten Reaktion ist die Verwendung von ?n? verschiedenartiger Mediator-Sonden f?r ?n? unterschiedliche Zielmolek?le bevorzugt. Jedem zu detektierenden Zielmolek?l kann in einer bevorzugten Ausf?hrungsform eine Mediator-Sonde zugeordnet werden, deren Region 1 spezifisch mit dem Zielmolek?l interagiert. Die Region 2 der jeweiligen Mediator-Sonde, welche nach erfolgter Spaltung den Mediator darstellt, ist nicht affin bzw. komplement?r zum Zielmolek?l, stellt aber einen spezifischen Interaktionspartner f?r ein definiertes Nachweismolek?l dar. Dadurch ist jedem Zielmolek?l indirekt ein Nachweismolek?l zugewiesen, dessen Zuordnung durch die Mediator-Sonde erfolgt. Die Detektion verschiedener Zielmolek?le bedingt verschiedenartige Nachweismolek?le. Aufgrund des bevorzugten Aufbaus ist es ausreichend, wenn sich diese Molek?le ausschlie?lich in Region 5 unterscheiden. Aufgrund beliebiger Sequenzabfolgen innerhalb dieser Region ist der Parallelit?tsgrad nahezu beliebig hoch und somit ein Detektionsverfahren f?r eine Multiparameter-Analyse gegeben. Es ist somit bevorzugt, das System als Detektionsverfahren f?r eine Multiparameter-Analyse zu verwenden. Das System kann bevorzugt zur Detektion von einem oder mehreren gleichartigen oder verschiedenen Biomolek?len in einem Gemisch verwendet werden. Au?erdem kann das System vorteilhafterweise zur Amplifikation von mindestens einem oder insbesondere mehreren Zielmolek?len verwendet werden, wobei es sich vorteilhafterweise um nicht identische Zielmolek?le handelt. Es kann weiterhin bevorzugt sein, das System unter Verwendung der Aktivit?t eines Restriktionsenzyms zu verwenden, wobei das Nachweismolek?l ?ber eine chemische Schutzgruppe am 3?-terminalen Bereich verf?gt, die nach der Reaktion mit der Mediator-Region mittels eines Hilfsmolek?ls von dem Nachweismolek?l abgespalten wird und eine 3?-terminale OH-Gruppe generiert wird.

Da Region 1 und Region 2 der Mediator-Sonde bevorzugt unabh?ngig voneinander frei kombiniert werden k?nnen, kann ein Nachweismolek?l auch mit einem anderen Zielmolek?l korreliert werden, indem die passende Region 2 (Mediator) mit einer beliebigen Region 1 der Mediator-Sonde verkn?pft und synthetisiert wird. Das erfindungsgem??e Verfahren erlaubt daher die Zielmolek?l-unabh?ngige Gestaltung des Nachweismolek?ls. Somit k?nnen mit einem standardisierten Satz von Nachweismolek?len unterschiedliche Zielmolek?le in einer Probe nachgewiesen werden, wodurch die Reaktion kosteng?nstig durch Anpassen der Mediator-Sonde und Verwendung geeigneter Hilfsmolek?le (z.B. Primer oder Aptamere) an das jeweilige Zielmolek?l adaptiert werden kann. Durch diese vorteilhafte Eigenschaft wird das im Stand der Technik beschriebene Problem der typischerweise direkten Korrelation zwischen Zielmolek?l und immobilisierten F?ngermolek?l gel?st.

In einer erfindungsgem??en Probleml?sung wird die Mediator-Sonde mit der zu untersuchenden Probe zu den in einer Einweg-Reaktionskartusche immobilisierten Nachweismolek?len appliziert, in geeigneter Weise prozessiert und detektiert. Die Reaktionskartusche kann anschlie?end kontaminationsfrei entsorgt werden. Des Weiteren kann ein Amplifikationsschritt im Reaktionsgef?? vorgeschaltet bzw. parallel zur Detektion durchgef?hrt werden, womit ggf. eine spezifische Anreicherung des Zielmolek?ls erfolgen kann. Dadurch wird das Transferieren von Reaktionsans?tzen mit hoher Zielmolek?l-Konzentration (z.B. post PCR-Ans?tze) aus einem Amplifikations- in einen Detektionsbereich und den damit entstehenden Arbeitsschritten und Kontaminationsrisiken ?berfl?ssig.

Die Erfindung betrifft ferner ein Prozessierungsger?t und ein mikrofluidische Reaktionskartusche zur Verwendung des Verfahrens oder des Systems. Die Kartusche weist mindestens eine Reaktionskammer auf, in der insbesondere ein universelles Detektionsarray vorliegt, welches vorzugsweise aus einer ?rtlich aufgel?sten Anordnung eines oder mehreren Nachweismolek?len besteht.

Das Prozessierungsger?t unterzieht bevorzugt die Kartusche und Reaktionsfl?ssigkeit bei einer konstanten Temperatur bzw. einem definierten Temperaturverlauf (Heizen und/oder K?hlen). Das Prozessierungsger?t kann die ?nderung des Nachweismolek?ls durch ein bevorzugtes System oder Verfahren detektieren. Hierf?r kann beispielsweise ein Fluoreszenzsignal verwendet werden. Zus?tzlich kann das Ger?t mittels aktiver oder passiver Elemente einen Fl?ssigkeitstransport innerhalb der Reaktionskartusche erm?glichen. Die oben dargelegten Ausf?hrungen sind auf die Mediator-Sonde, das System und das Verfahren zu beziehen.

Vorteile der Erfindung umfassen:

  • ? Entwicklung einer neuartigen Fl?ssigphasenreaktion, die die Abh?ngigkeit von Ziel- und Nachweismolek?l entkoppelt und in Verbindung mit einem standardisierten Mikroarrays nahezu jedes beliebige Zielmolek?l detektiert.
  • ? Kombination aus neuartiger Fl?ssigphasenreaktion und universellem Mikroarray erlaubt den parallelen Nachweis verschiedener Zielmolek?le.
  • ? Ein vom Zielmolek?l unabh?ngiger, standardisierter Mikroarray kann f?r verschiedenste Multianalyt-Analysen verwendet werden, da die spezifische Fl?ssigphasenreaktion schnell und kosteng?nstig an das Zielmolek?l anpasst werden kann.
  • ? Durch die Herstellung eines standardisierten Mikroarrays k?nnen verschiedene Experimente mit einer Reaktionskartusche ohne Vor- bzw. Nachprozessierungsschritte durchgef?hrt werden, wodurch Kosten eingespart und hohe St?ckzahlen produziert werden k?nnen (Skaleneffekte). Somit lassen sich mit einer Charge der standardisierten Reaktionskartusche verschiedene Nachweisreaktionen (z.B. im Bereich der Routineuntersuchungen) durchf?hren.
  • ? Abh?ngig von den Reaktionsbedingungen erm?glicht eine Multianalyt-Analyse die parallele Detektion verschiedener Molek?le und Molek?lklassen, wie zum Beispiel Proteine und Nukleins?uren in einem Arbeitsschritt, womit ein kombiniertes DNA-RNA-Protein-Profil einer Probe erstellt werden kann.
  • ? Mit einem standardisierten Array-Layout und Adaptierung der Mediator-Sonden kann kosteng?nstig eine Vielzahl an verschiedenen Zielmolek?len detektiert werden, die den Multiplexing-Grad einer im Stand der Technik beschriebenen PCR-Reaktion potentiell um Gr??enordnungen ?bersteigt. Der Multiplex-Grad dieses Verfahrens wird in der Praxis nicht ausgesch?pft werden. Ein Mediator, beispielsweise bestehend aus einem Nukleins?uremolek?l mit einer L?nge von 20 Nukleotiden kann rechnerisch 4^20 (~ 1?10^12) m?gliche verschiedene Nukleotidabfolgen annehmen.
  • ? Die Erfindung erlaubt den Nachweis verschiedener Zielmolek?le in einem geschlossenen Reaktionsgef??, welches nach Prozessierung ohne Kontaminationsrisiko entsorgt werden kann.
  • ? Die Mediator-Sonde besteht aus einem Oligonukleotid, welches ohne technisch komplexe Modifikationen wie zum Beispiel Fluoreszenzdonoren und/oder -akzeptoren kosteng?nstig synthetisiert werden kann.
  • ? Durch Spaltung der Mediator-Sonde wird ein Mediator freigesetzt, welcher au?er dem immobilisierten Nachweismolek?l keinen Interaktionspartner besitzt. Im Vergleich zu konventionellen Nukleins?ure-basierten Ans?tzen besteht somit kein Bedarf, wie im Falle von asymmetrischer PCR oder LATE-PCR, durch zus?tzliche Optimierung der Primerverh?ltnise ein Wiederanlagern (Re-annealing) des nachzuweisenden Stranges zu verhindern. Durch eine L?nge von typischerweise 20 bis 25 Nukleotiden besitzt der Mediator eine h?here Diffusionskonstante als durch Amplifikationsmechanismen generierte Nukleins?urefragmente, welche z.B. f?r eine Hybridisierungsreaktion generiert werden.
  • ? In einer besonders vorteilhaften Ausf?hrung kann eine Nukleins?ure-basierte Amplifikation das Zielmolek?l direkt bzw. ein Nachweishilfsmolek?l (z.B. Aptamer) indirekt amplifizieren, womit die Sensitivit?t erh?ht wird. Dabei lassen sich Amplifikations- und Nachweisreaktion kombinieren und parallel durchf?hren. Damit hebt sich die Erfindung deutlich von der im Stand der Technik beschriebenen Invader?-Reaktion ab, bei welcher die Detektion mit linearer Signalamplifikation bzw. eine konsekutive Amplifikation und Detektion durchgef?hrt wird.
  • ? Die Kosten f?r die Durchf?hrung eines Experiments k?nnen reduziert werden, da in einer m?glichen Ausf?hrungsform die Applizierung der zu untersuchenden Probe und der ben?tigten Reagenzien in eine Einweg-Kartusche automatisiert durchgef?hrt werden kann. Somit entf?llt die Notwendigkeit geschultes Personal f?r diese Arbeiten einzusetzen.
  • ? Die Detektion der Nachweismolek?le kann unter Verwendung geeigneter Vorrichtungen in Echtzeit- bzw. Endpunkt-Messung ermittelt werden. In beiden F?llen ben?tigt die erfindungsgem??e Ausf?hrung keine Nachprozessierung, wie z.B. Wasch- oder Inkubationsschritte.
  • ? In einer besonders bevorzugten Ausf?hrung kann ein Mediator in jedem Reaktionszyklus bzw. zeitlichen Abschnitt der Reaktion mit mehreren identischen spezifischen Nachweismolek?len interagieren und eine Signalgenerierende Nachweisreaktion ausl?sen. Da ein akkumulativer Effekt durch Amplifizierung des Zielmolek?ls erfolgt, wird die Sensitivit?t der Reaktion deutlich.
  • ? Die hergestellten universellen Mikroarrays k?nnen unter definierten Lagerbedingungen ?ber l?ngere Zeit aufbewahrt werden, was v.a. gegen?ber Protein-Arrays ein deutlicher Vorteil ist. Dadurch ist eine Bevorratung unabh?ngig von geplanten Experimenten unkritisch.

Im Folgenden soll die Erfindung sowie der Stand der Technik anhand von Figuren und Ausf?hrungsbeispielen erl?utert werden, ohne jedoch hierauf beschr?nkt zu sein. Es zeigen:

1(A?D) Verschiedene Festphasen-basierte Detektionsverfahren nach invasiver Spaltung einer immobilisierten Sonde

2 Bevorzugten Aufbau einer Mediator-Sonde

3A, B Bevorzugte Interaktion der Mediator-Sonde mit dem Zielmolek?l und Mediator-Sonden-Spaltung

4A, B Darstellung eines bevorzugten Nachweismolek?ls

5i).vi) Schematische Darstellung einer bevorzugten enzymatischen Mediatorverl?ngerung

6 Schematische Darstellung bevorzugter Position chemischer Modifikation innerhalb des Nachweismolek?ls

7 Bevorzugte Detektion des Mediators mit Hilfe eines immobilisierten Nachweismolek?ls

8 Bevorzugte Interaktion von Mediator-Sonde und Nachweismolek?l

9 Schematische Darstellung der bevorzugten Anwendungsbereiche der Mediator-Sonden-Technologie

10 Normalisierter Fluoreszenz-Plot einer PCR unter Verwendung einer bevorzugten Mediator-Sonden und im Reaktionsgef?? immobilisierter Nachweismolek?le

1(A?D) zeigt verschiedene Festphasen-basierte Detektionsverfahren nach invasiver Spaltung einer immobilisierten Sonde. (A) Direkte, Fluoreszenz-basierte invasive Spaltungsdetektion. M?glichkeit 1: Die Sonde liegt immobilisiert an der Substratoberfl?che vor. Das Invader-Oligonukleotid (upstream oligonucleotide) und die Zielsequenz (target) werden zu der Reaktionsl?sung hinzugegeben (siehe ). M?glichkeit 2: Die Sonde und das Invader-Oligonukleotid sind auf der Oberfl?che immobilisiert. Die Zielsequenz wird zu dem Reaktionsmix hinzugegeben (siehe ). In beiden F?llen erfolgt eine Spaltung des Sondenmolek?ls, woraus die ?nderung eines Fluoreszenzsignals resultiert. Quelle: (Lu, M.C. et al, 2002, A surface invasive cleavage assay for highly parallel SNP analysis, Hum. Mutat., 19, 416?422.).

(B) Indirekte Spaltungsdetektion. Eine Dabcyl-modifizierte Sonde liegt immobilisiert an einer Festphase vor. Nach erfolgter invasiver Spaltung erfolgt die Ligation eines Biotin-markierten Linkers, an welchen Streptavidin-beschichtete Goldpartikel gebunden werden. Quelle: (Nie, B. et al, 2006, Quantitative detection of individual cleaved DNA molecules on surfaces using gold nanoparticles and scanning electron microscope imaging, Anal. Chem., 78, 1528?1534.).

(C) Indirekte Spaltungsdetektion durch anschlie?ende Rolling Circle Amplification. Nach invasiver Spaltung einer immobilisierten, 5?-markierten Sonde erfolgt ein Ligationsschritt mit anschlie?ender Rolling Ciricle Amplification. Es werden zwei unterschiedliche Strategien dargestellt, bei welchen nur die Sonde (a) bzw. die Sonde und das Invader-Oligonukleotid (b) immobilisiert vorliegen. Quelle: (Chen, Y. et al, 2004, Surface amplification of invasive cleavage products, J. Amer. Chem. Soc., 126, 3016?3017.).

(D) Indirekte, Fluoreszenz-basierte Spaltungsdetektion. An eine Fluoreszenz-markierte Sonde wird eine markierte Detektionssonde hybridisiert und das Fluoreszenzsignal detektiert. Nach erfolgten Waschschritten und durchgef?hrter invasiven Spaltung erfolgt ein weiterer Hybridisierungsschritt mit der beschriebenen Detektionssonde. Die anschlie?ende Fluoreszenzmessung erlaubt einen R?ckschluss auf die Anwesenheit der Zielsequenz im Reaktionsansatz. Quelle: (Lockett, M.R. et al, 2007, Molecular beacon-style hybridization assay for quantitative analysis of surface invasive cleavage reactions, Anal. Chem., 79, 6031?6036.).

2 zeigt einen bevorzugten Aufbau einer Mediator-Sonde. Die Mediator-Sonde besteht insbesondere aus einem Oligonukleotid und ist in zwei funktionelle Regionen unterteilt. Region 1 ist affin bzw. komplement?r zum Zielmolek?l, Region 2 interagiert ausschlie?lich mit einem spezifischen Nachweismolek?l. Zwischen den Regionen befindet sich eine potentielle Spaltstelle.

3 zeigt eine bevorzugte Interaktion der Mediator-Sonde mit dem Zielmolek?l und Mediator-Sonden-Spaltung. Die Mediator-Sonde, Hilfsmolek?l 1 (hier: Primer) und Hilfsmolek?l 2 (hier: Enzym mit Polymerisations- und Nuklease-Aktivit?t (Polymerase)) interagieren mit dem Zielmolek?l (hier: Nukleins?uresequenz) (A). Unter geeigneten Reaktionsbedingungen wird der Primer durch die Polymerase verl?ngert und die Mediator-Sonde gespalten, wobei ein Mediator-Molek?l freigesetzt wird. (B).

4A, B zeigt eine Darstellung eines bevorzugten Nachweismolek?ls. Lineare Darstellung (A). Darstellung eines 3?-immobilisierten Nachweismolek?ls unter Ausbildung der Sekund?rstruktur (B). Die revers-komplement?ren Sequenzabschnitte, durch deren Interaktion die Sekund?rstruktur des Nachweismolek?ls entsteht, sind als schwarze Bereiche, die Mediator-Hybridisierungssequenz als diagonal-gestreifter Bereich dargestellt.

5i)?vi) stellt eine schematische Darstellung einer bevorzugten enzymatischen Mediatorverl?ngerung dar. i) Ein Nachweismolek?l liegt immobilisiert an einer Festphase vor und nimmt unter Reaktionsbedingungen eine definierte Sekund?rstruktur an. Zwei geeignete Fluoreszenz-Modifikationen F und Q interagieren miteinander, wobei das Fluoreszenzsignal von F unterdr?ckt wird. ii) Der Mediator kann mit dem Nachweismolek?l an definierter Position (Mediator-Hybridisierungssequenz, Region 5) interagieren iii)?iv) und wird dabei von einem Nachweishilfsmolek?l (hier: Polymerase) enzymatisch verl?ngert. Dabei wird das Fluoreszenzakzeptormolek?l Q vom Nachweismolek?l abgespalten, womit die Fluoreszenzintensit?t des Fluoreszenzfarbstoffes F wiederhergestellt wird. vi) Nach Abspaltung von Region 1 nimmt das Nachweismolek?l eine lineare Konformation an, wodurch eine weitere Verl?ngerung des Mediators erfolgen kann.

6 zeigt eine schematische Darstellung bevorzugter Position chemischer Modifikation innerhalb des Nachweismolek?ls. An geeigneten Sequenzpositionen innerhalb der Region 1 und/oder Region 2 sind modifizierte Nukleotide eingebaut, welche eine potentielle Mediator-Elongation an definierter Position terminieren.

7 stellt eine bevorzugte Detektion des Mediators mit Hilfe eines immobilisierten Nachweismolek?ls dar. i) Ein Nachweismolek?l liegt immobilisiert an einer Festphase vor und nimmt unter Reaktionsbedingungen eine definierte Sekund?rstruktur an. Zwei geeignete Fluoreszenz-Modifikationen F und Q interagieren miteinander, wobei das Fluoreszenzsignal von F unterdr?ckt wird. Der 3?-terminale Sequenzbereich liegt ungepaart vor und dient als potentielle Mediator-Hybridisierungssequenz (diagonal gestreifter Bereich). ii) An dieser definierten Position kann der Mediator mit dem Nachweismolek?l interagieren iii, iv) und wird dabei von einem Nachweishilfsmolek?l (hier: Polymerase) enzymatisch verl?ngert. v) Dabei wird das Fluoreszenzakzeptormolek?l Q vom Nachweismolek?l abgespalten, womit die Fluoreszenzintensit?t des Fluoreszenzfarbstoffes F wiederhergestellt wird. Nach einer geeigneter Dauer werden die Reaktionsbedingungen durch Erhitzen der Reaktionsl?sung ge?ndert, so dass die Polymerase und der verl?ngerte Mediator vom Nachweismolek?l abdissoziiert.

8 zeigt eine bevorzugte Interaktion von Mediator-Sonde und Nachweismolek?l. Falls die ungespaltene Mediator-Sonde mit dem Nachweismolek?l interagiert, erfolgt selbst in Anwesenheit geeigneter Nachweishilfsmolek?le keine enzymatische Verl?ngerungsreaktion, da diese einen 3?-OH-Terminus der Mediator-Sequenz ben?tigt. Somit wird die Generierung falsch-positiver Signale verhindert. Zus?tzlich kann eine 3?-terminale Modifizierung vorhanden sein, um eine unspezifische Elongation zu unterbinden.

9 stellt eine schematische Darstellung der bevorzugten Anwendungsbereiche der Mediator-Sonden-Technologie dar. Die Mediator-Sonden-Technologie kann DNA, in cDNA umgeschriebene RNA oder an Protein-assoziierte Aptamere detektieren. Die Prozessierung der Medaitor-Sonde kann ggf. an einen Amplifikationsschritt (A) des Zielmolek?ls integriert werden. Dargestellt ist die Detektion mittels eines immobilisierten, Mediator-spezifischen Nachweismolek?ls. Durch Interaktion mit einem Hilfsmolek?l (hier: Polymerase) wird durch eine Mediator-vermittelte Reaktion eine Zustands?nderung des Nachweismolek?ls generiert (hier: Fluoreszenz?nderung).

10 zeigt einen normalisierten Fluoreszenz-Plot einer PCR unter Verwendung einer bevorzugten Mediator-Sonden und im Reaktionsgef?? immobilisierter Nachweismolek?le. Die Reagenzien, welche u.a. Zielsequenz-spezifische Primer sowie die Mediator-Sonde und verschiedene Staphylococcus aureus-Genom?quivalente beinhalten, werden in ein geeignetes Reaktionsgef?? mit immobilisierten Nachweismolek?len pipettiert und mit einer geeigneten Versiegelungsfolie verschlossen. Die Reaktion wurde in einem Thermocycler durchgef?hrt, wobei die Messung der Fluoreszenz zu den angegebenen Zyklen in einem gesonderten Ger?t vorgenommen wurde. In jedem PCR-Zyklus wird der zu amplifizierende Sequenzabschnitt verdoppelt, wobei bei jeder Duplikation ein Mediator aus der Spaltung einer Mediator-Sonde hervorgeht. Der freigesetzte Mediator interagiert mit dem Nachweismolek?l in geeigneter Weise, wobei ein detektierbares Fluoreszenzsignal entsteht. Der Plot zeigt eine Korrelation der DNA-Menge und dem Fluoreszenzverlauf. Die Fluoreszenzintensit?ten wurden auf den Wert von Zyklus 1 normiert (Der Messwert von Zyklus 37 wurde durch Kondensat an der Deckelfolie verf?lscht und daher nicht ber?cksichtigt).

Ausf?hrungsbeispiel i)

Die Ausf?hrungsbeispiele sind au?erdem schematisch in 9 dargestellt. Eine einfache Demonstration eines bevorzugten Nukleins?urenachweises kann wie folgt durchgef?hrt werden: Zum Nachweis bakterieller DNA in einer zu untersuchenden Probe wird ein Nachweismolek?l in einem geeignetem Reaktionsgef?? immobilisiert. Anschlie?end werden die Probe und die ben?tigten Reagenzien dem Reaktionsgef?? zugegeben und das Gemisch nach einer initialen Temperaturhalteschritt bei 95 ?C zyklisch erhitzt und abgek?hlt. W?hrend diesem Prozess wird an definierten Zeitpunkten des Zyklus? die Fluoreszenz im Reaktionsgef?? detektiert. Im Folgenden wird das Ausf?hrungsbeispiel im Detail beschrieben:

In ?NucleoLink-Strips? (NUNC, Langenselbold, Deutschland, Cat.-No. 248650) werden 25 ?L einer 100 nM L?sung eines Nachweismolek?ls der Sequenz 5?-DABCYL-CCGCAG*A*A*GATGAGATC(dT-FAM)GCGGTGTTGGTCGTAGAGCCCAGAACGATTTTTTTTTTTTTTTTTTTTT-[C6NH2]-3? (* = Phosphothioat) (IBA, G?ttingen, Deutschland) in Kopplungspuffer (10 mM 1-Methyl-Imidazole (1-MeIm) (pH 7,0) (Sigma-Aldrich, Steinheim, Deutschland) und 10 mM 1-Ethyl-3-(3-Dimethylaminopropyl)-Carbodiimide (EDC) (Sigma-Aldrich, Steinheim, Deutschland)) pipettiert, mit ViewSEALTM-Deckelfolie (Greiner-BioOne, Frickenhausen, Germany, Cat.-No.676070) verschlossen und ?ber Nacht bei 50?C inkubiert. Der ?berstand wird verworfen und die Mikroreaktionsgef??e werden anschlie?end mit 100 ?L Waschpuffer (100 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.1% Tween 20 (Carl Roth, Karlsruhe, Deutschland)) gewaschen und mit 25 ?L einer 1 M Glycin-L?sung (Carl Roth, Karlsruhe, Deutschland) in Kopplungspuffer 1 Stunde bei 50 ?C inkubiert und erneut gewaschen.

Die Reaktionsgef??e werden mit 25 ?L PCR-Reaktionsmix (1x Finnzymes DyNamo Flash Probe (Finnzymes, Cat.-No. F-455), Primer-Molek?le der Sequenzen 5?-GAGGTAGGAAACTCTGGATCAGGTAT-3? (300 nM) (biomers.net, Ulm, Deutschland), 5?-TCTATTGAAAAACACTCCTATTGGAAGA-3? (300 nM) (biomers.net, Ulm, Deutschland), eine Mediator-Sonde der Sequenz 5?-TCTGGGCTCTACGACCAACAGGTATTCACAGTGGTAAAGGCGGACAACAAGAGCCCAG

A-[Phosphat]-3? (200 nM) (biomers.net, Ulm, Deutschland)) sowie unterschiedlichen Konzentrationen einer Staphylococcus aureus DNA, die den Lokus Exfoliatin-Toxin B (NCBI Accession-Number M17348) enth?lt, bef?llt. Je DNA-Konzentration werden vier Mikroreaktionsgef??e verwendet. Die Reaktionsgef??e werden mit ViewSEALTM-Deckelfolie verschlossen und in einen GeneAmp? 9700 Thermocycler (Perkin-Elmer, Massachusetts) ?berf?hrt. Nach einer Inkubationsphase (7 min bei 95 ?C) wird das zyklische Temperaturprotokoll (30 s bei 95 ?C, 3 min bei 58 ?C) durchgef?hrt und die Reaktionsgef??e nach definierten Zyklen aus dem Thermocycler entnommen und mit Hilfe des Mikrotiterplatten-Lesege?ts Victor2 1420 Multilabel Counter (Perkin-Elmer, Massachusetts) das Fluorescein-Signal gemessen. Anschlie?end werden die Reaktionsgef??e wieder in den Thermocycler ?berf?hrt. Die Fluoreszenzwerte der einzelnen Mikroreaktionsgef??e werden auf den jeweiligen Wert des ersten Zyklus normalisiert, so dass f?r jedes Reaktionsgef?? ein Amplifikationsfaktor in Abh?ngigkeit des Prozessierungszyklus erstellt werden kann (siehe 10).

Ausf?hrungsbeispiel ii)

Eine Ausf?hrung wie in Ausf?hrungsbeispiel i) beschrieben, wobei als Nukleins?urevorlage RNA verwendet wird, welche mittels Reverse-Transkription oder durch ein anderes geeignetes enzymatisches System in cDNA umgeschrieben wird. Dabei wird dieser Schritt in einem gesonderten Reaktionsgef?? durchgef?hrt und ein Aliquot zu einer Nachweisreaktion gem?? Ausf?hrungsbeispiel i) hinzugegeben. Alternativ kann die Reverse Transkription und anschlie?ende Amplifikation gem?? Ausf?hrungsbeispiel i) findet im selben Reaktionsgef?? stattfinden. Als Versuchsziel steht die Expressionsanalyse eines oder mehrerer Gene im Vordergrund.

Ausf?hrungsbeispiel iii)

Der parallele Nachweis von DNA und RNA in einer Probe kann durch Kombination geeigneter Enzymsysteme durchgef?hrt werden. Dabei wird die nachzuweisende RNA mit Hilfe von Primern mit definiertem 5?-Sequenz?berhang amplifiziert (Siehe 9). Die f?r diesen Nachweis verwendete Mediator-Sonde ist derartig ausgelegt, dass sie teilweise an den Sequenz?berhang, den Primer sowie einen Abschnitt des verl?ngerten Primers bindet. Durch diesen definierten Lokus ist sichergestellt, dass nur aus RNA generierte cDNA durch eine spezifische Mediator-Sonde detektiert wird, jedoch nicht der genomische Lokus, von dem die RNA transkribiert wurde. Zur Detektion von genomischer DNA im Reaktionsansatz werden Mediator-Sonden verwendet, die ausschlie?lich komplement?r zu dieser Sequenz sind. In der ggf. durchgef?hrten Amplifikationsreaktion wird die generierte cDNA und spezifische Abschnitte der genomischen DNA amplifiziert, wobei lokus-spezifische Mediator-Sonden gespalten und der Mediator durch geeignete Nachweisverfahren an einem ?rtlich aufgel?sten immobilisierten Nachweismolek?l detektiert werden kann.

Ausf?hrungsbeispiel iv)

In ein geeignetes Reaktionsgef?? werden Reagenzien, welche Zielmolek?l-spezifische Aptamere umfassen und die zu untersuchende Probe gegeben, wobei die Nachweismolek?le ?rtlich aufgel?st immobilisiert vorliegen (siehe 9). Das nachzuweisende Zielmolek?l kann beispielsweise ein Protein oder Peptid sein ist aber nicht darauf beschr?nkt. Ein Aptamer bindet an das Zielmolek?l und ver?ndert seine Struktur, so dass sich nach erfolgter Interaktion eine Aptamer-spezifische Mediator-Sonde und Primer anlagern k?nnen. Durch Prozessierung mit einem geeigneten Enzymsystem kann der angelagerte Primer verl?ngert werden, wobei eine Spaltung der Mediator-Sonde erfolgt. Der freigesetzte Mediator kann mit Hilfe eines spezifischen Nachweismolek?ls detektiert werden. Der enzymatische Amplifikationsprozess kann isotherme Verfahren beinhalten, ist aber nicht darauf beschr?nkt.

Ausf?hrungsbeispiel v)

In einer besonderen Ausf?hrungsvariante werden DNA, RNA und Peptide bzw. Proteine oder eine andere Kombination der genannten Stoffklassen durch die beschriebenen Verfahren i)-iv) in einem Ansatz parallel detektiert. Das Verfahren beinhaltet isotherme Amplifiaktionsverfahren, ist aber nicht auf diese beschr?nkt. Diese Ausf?hrung wird in 9 illustriert.

Ausf?hrungsbeispiel vi)

Unabh?ngig von der Art des Nachweises kann das Reaktionsgef?? beispielsweise das etablierte und weit verbreitete Mikrotiterplattenformat (96-well plate) besitzen, womit handels?bliche Temperierungs- und Ausleseger?te, bzw. Ger?te, die beide Funktionen kombinieren, verwendet werden k?nnen. In allen F?llen sind die Nachweismolek?le ?rtlich aufgel?st immobilisiert (Array). Als m?gliches Reaktionsgef?? kann auch eine Flusszelle betrachtet werden, die nach durchgef?hrter Analyse ggf. gereinigt und wiederverwendet werden kann. In einer besonderen Ausf?hrungsform kann das Reaktionsgef?? eine Kartusche darstellen, in welcher die Nachweismolek?le immobilsiert vorliegen. Der Reaktionsraum kann auch durch die Verwendung eines modifizierten Mikroskop-Objekttr?ger und eines geeigneten Rahmens definiert werden. Diese Ausf?hrung hat die vorteilhafte Eigenschaft, dass die Immobilisierung der Nachweismolek?le auf geeigneten Materialien im Stand der Technik beschrieben ist und passende Kleberahmen (Peqlab in-situ Kleberahmen, Peqlab Biotechnologie, Erlangen, Deutschland) sowie temperierbare Prozessierungsger?te (Peqlab PeqStar in-situ, Peqlab Biotechnologie, Erlangen, Deutschland) und Ausleseger?te (BioAnalyzer, LaVision BioTec GmbH, Bielefeld, Deutschland) kommerziell erh?ltlich sind. Das Format der Kartusche ist nicht festgelegt und kann ggf. nach den W?nschen des Benutzers erstellt sein. Die Kartusche kann mit Hilfe von integrierten Prismen einen eingekoppelten Lichtstrahl zur Anregung oberfl?chennaher Fluorophore mittels TIRF durch einen Auslesebereich leiten. Ferner kann diese Kartusche in Kombination mit einem Ger?t verwendet werden, welches ?ber eine Temperierungsvorrichtung und optischen Komponenten zur Anregung und Detektion von Fluoreszenzsignalen verf?gt. Die Kartusche kann ggf. ?ber mikrofluidische Strukturen, zum Beispiel Einf?ll- und Bel?ftungs?ffnungen, Konnektierungen f?r aktive Elemente, Misch-, Mess- und Aliquotierungskammern, -kan?le oder -strukturen, oder Strukturen, die f?r andersweiteige Zwecke verwendet werden k?nnen, verf?gen. Das System kann ?ber Pumpen oder andere Aktoren verf?gen, mit deren Hilfe die Fl?ssigkeit prozessiert werden kann. Zus?tzlich k?nnen weitere Reagenzien vorgelagert sein.

ZITATE ENTHALTEN IN DER BESCHREIBUNG

Diese Liste der vom Anmelder aufgef?hrten Dokumente wurde automatisiert erzeugt und ist ausschlie?lich zur besseren Information des Lesers aufgenommen. Die Liste ist nicht Bestandteil der deutschen Patent- bzw. Gebrauchsmusteranmeldung. Das DPMA ?bernimmt keinerlei Haftung f?r etwaige Fehler oder Auslassungen.

Zitierte Patentliteratur

  • US 5641658 [0009]
  • US 6300070 B1 [0009]
  • DE 10316159 A1 [0014]
  • US 5653939 [0021]
  • US 6099803 [0021]
  • US 2001/0034025 A1 [0022]
  • US 6238869 B1 [0022]

Zitierte Nicht-Patentliteratur

  • Liu, Q. et al, 2007, Microarray-in-a-tube for detection of multiple viruses. Clin Chem, 53, 188?194 [0007]
  • Pemov, A. et al, 2005, DNA analysis with multiplex microarray-enhanced PCR. Nucleic Acids Res., 33, e11. [0010]
  • Andresen, D., von Nickisch-Rosenegk, M. and Bier, F.F., 2009, Helicase dependent OnChipamplification and its use in multiplex pathogen detection, Clin. Chim. Acta, 403, 244?248 [0012]
  • Liu, H.P. et al, 2006, TaqMan probe array for quantitative detection of DNA targets, Nucleic Acids Research, 34. [0015]
  • Baeumner, A.J. et al, 2004, A universal nucleic acid sequence biosensor with nanomolar detection limits, Anal. Chem., 76, 888?894. [0025]
  • Lu, M.C. et al, 2002, A surface invasive cleavage assay for highly parallel SNP analysis, Hum. Mutat., 19, 416?422. [0108]
  • Nie, B. et al, 2006, Quantitative detection of individual cleaved DNA molecules on surfaces using gold nanoparticles and scanning electron microscope imaging, Anal. Chem., 78, 1528?1534. [0109]
  • Chen, Y. et al, 2004, Surface amplification of invasive cleavage products, J. Amer. Chem. Soc., 126, 3016?3017. [0110]
  • Lockett, M.R. et al, 2007, Molecular beacon-style hybridization assay for quantitative analysis of surface invasive cleavage reactions, Anal. Chem., 79, 6031?6036. [0111]