Title:
Multianalyt-Reportersystem
Kind Code:
A1
Abstract:

Die Erfindung betrifft eine Mediator-Sonde zur Bindung an ein Zielmolekül und/oder ein Nachweismolekül umfassend eine Sonden-Region und eine Mediator-Region sowie ein Verfahren zum Nachweis von mindestens einem Zielmolekül, sowie ein System umfassend eine Mediator-Sonde und ein Nachweismolekül.



Inventors:
Roth, Günter (79110, Freiburg, DE)
Wadle, Simon (79106, Freiburg, DE)
Faltin, Bernd (79100, Freiburg, DE)
Von Stetten, Felix (79112, Freiburg, DE)
Application Number:
DE102011055247A
Publication Date:
05/16/2013
Filing Date:
11/10/2011
Assignee:
Albert-Ludwigs-Universität Freiburg, 79098 (DE)
International Classes:
Domestic Patent References:
DE10316159A1N/A2004-10-28
Foreign References:
200201108262002-08-15
200400140782004-01-22
200401018352004-05-27
200701228042007-05-31
47511771988-06-14
WO1998003678A11998-01-29
WO2001006012A12001-01-25
56416581997-06-24
63000702001-10-09
56539391997-08-05
60998032000-08-08
62388692001-05-29
200100340252001-10-25
Other References:
BRUNK C.F. u.a.: Analysis of specific bacteria from environmental samples using a quantitative polymerase chain reaction. Curr. Issues Mol. Biol. (2002) 4 (1) 13-18
HUANG Q. u.a.: Multiplex fluorescence melting curve analysis for mutation detection with dual-labeled, self-quenched probes. In: PLoS One. (April 2011) (4): e19206, 1-9
SUN C. u.a.: Electrochemical DNA biosensor based on proximity-dependent DNA ligation assays with DNAzyme amplification of hairpin substrate signal. In: Biosensors and Bioelectronics (2010) 25, 2483–2489
TSOURKAS A. u.a.: Shedding night on health and disease using molecular beacons. Brief. Funct. Genomic. Proteomic. (2003) 1 (4) 372-384
VAN DOORN R. u.a.: Robust Detection and Identification of Multiple Oomycetes and Fungi in Environmental Samples by Using a Novel Cleavable Padlock Probe-Based Ligation Detection Assay. In: Appl. Environ. Microbiol. (2009) 75 (12) 4185-93
Attorney, Agent or Firm:
HERTIN Anwaltssozietät, 10707, Berlin, DE
Claims:
1. Mediator-Sonde zur Bindung an ein Zielmolekül und/oder ein Nachweismolekül umfassend eine Sonden-Region und eine Mediator-Region, dadurch gekennzeichnet, dass die Sonde ein Oligonukleotid ist und die Sonden-Region am 3’-Terminus und die Mediator-Region am 5’-Terminus des Oligonukleotides angeordnet ist, wobei zwischen den Regionen eine chemische, biologische und/oder physikalische Spaltstelle vorliegt und die Sonden-Region eine Affinität zu dem Zielmolekül und die Mediator-Region eine weitere Affinität zu dem Nachweismolekül aufweist.

2. Mediator-Sonde zur Bindung an ein Zielmolekül und/oder ein Nachweismolekül umfassend eine Sonden-Region und eine Mediator-Region, dadurch gekennzeichnet, dass die Sonde ein Oligonukleotid ist und die Sonden-Region am 3’-Terminus und die Mediator-Region am 5’-Terminus des Oligonukleotides angeordnet ist, wobei zwischen den Regionen eine chemische, biologische und/oder physikalische Spaltstelle vorliegt und die Sonden-Region eine Affinität zu dem Zielmolekül und die Mediator-Region eine weitere Affinität zu dem Nachweismolekül aufweist, wobei die Spaltung der Mediator-Sonde insbesondere durch eine Amplifikation des Zielmoleküls erfolgt.

3. Mediator-Sonde nach Anspruch 1 oder 2, dadurch gekennzeichnet, dass die Sonde 1 bis 70, bevorzugt 15 bis 60, besonders bevorzugt 35 bis 45 Nukleotide aufweist.

4. Mediator-Sonde nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass das Zielmolekül ein Biomolekül ist, ausgewählt aus der Gruppe umfassend DNA, RNA, Protein, Aptamer und/oder ein Komplex aus Aptamer und assoziierter DNA, RNA, Protein oder einer Kombination hieraus....

5. Mediator-Sonde nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass die Sonden-Region und die Mediator-Region funktionell und/oder räumlich überlappen.

6. Mediator-Sonde nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass die Mediator-Sonde am 3’-Terminus der Sonden-Region eine chemische Schutzgruppe aufweist.

7. System umfassend eine Mediator-Sonde nach einem oder mehreren der vorherigen Ansprüche und ein Nachweismolekül, wobei das Nachweismolekül ein Oligonukleotid ist und mindestens folgende Regionen aufweist:
a. eine Region an einem 5’-Terminus des Nachweismoleküls, die einen Fluoreszenzakzeptor oder einen -donor und/oder eine chemische Gruppe zur Bindung an eine Festphase und/oder eine chemische Schutzgruppe aufweist,
b. eine weitere Region, die mit der Mediator-Region interagiert,
c. eine dritte Region, die einen Fluoreszenzdonor oder einen -akzeptor aufweist und
d. eine vierte Region an einem 3’-Terminus des Nachweismoleküls, die eine chemische Gruppe zur Bindung an eine Festphase und/oder eine chemische Schutzgruppe aufweist.

8. System nach Anspruch 7, dadurch gekennzeichnet, dass das Nachweismolekül an eine Festphase gebunden oder frei in einer Lösung vorliegt.

9. System nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass die Mediator-Sonde und/oder das Nachweismolekül fluoreszenzmarkierte Nukleotide aufweisen.

10. System nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass das Nachweismolekül ein einzelsträngiges Nukleinsäuremolekül oder Nukleinsäurederivat ist.

11. System nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass das Nachweismolekül eine Haarnadel-Struktur aufweist.

12. System nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass die Haarnadel-Struktur ausgebildet ist, indem der 5’-Terminus des Nachweismoleküls mit einem internen Sequenzabschnitt komplementär hybridisiert und der 3’-Terminus des Nachweismoleküls einen ungepaarten Sequenzabschnitt umfasst.

13. System nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass das Nachweismolekül mindestens eine Fluoreszenz-Modifikationen am 5’-Terminus und/oder innerhalb der Haarnadelstruktur aufweist.

14. Verfahren zum Nachweis von mindestens einem Zielmolekül, umfassend ein System nach einem oder mehreren der vorherigen Ansprüche umfassend folgende Schritte:
a. komplementäre Bindung der Sonden-Region der Mediator-Sonde an eine Sequenz des Zielmoleküls oder eines Aptamers, b. Spaltung der Mediator-Sonde an der Spaltstelle zwischen der Sonden-Region
am 5’-Terminus und der Mediator-Region am 3’-Terminus durch Hilfsmoleküle, und
c. komplementäre Bindung der abgespaltenen Mediator-Region der Mediator-Sonde an die zweite Region des Nachweismoleküls.

15. Verfahren nach einem oder mehreren der vorherigen Ansprüche,
dadurch gekennzeichnet, dass
die Spaltung der Mediator-Sonde eine Veränderung der physikalischen und/oder chemischen Eigenschaften mindestens einer Region der Mediator-Sonde bewirkt, ausgewählt aus der Gruppe umfassend:
a. molekulare Masse,
b. enzymatische Aktivität,
c. Bindungseigenschaften umfassend Affinität oder Avidität,
d. chemische Reaktivität,
e. Vorhandensein chemischer Gruppen,
f. elektrischer Eigenschaft umfassend Leitfähigkeit, Polarisierbarkeit oder Ladung und/oder
g. optischer Eigenschaft umfassend Absorption und Emission von Licht.

16. Verfahren nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass die, an die zweite Region des Nachweismoleküls gebundene Mediator-Region durch ein Hilfsmolekül enzymatisch verlängert wird, wobei das Hilfsmolekül an den 3’-Terminus der gebundenen Mediator-Region bindet.

17. Verfahren nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass die, an das Zielmolekül gebundene Sonden-Region durch ein Hilfsmolekül enzymatisch verlängert wird.

18. Verfahren nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass die Hilfsmoleküle ausgewählt sind aus der Gruppe umfassend Katalysatoren, Proteine, Nukleinsäuren, Naturstoffe, Enzyme, Enzym-Systeme, Zell-Lysate, Zell-Bestandteile, aus Zell-Bestandteilen abgeleitete Derivate und/oder synthetische Moleküle.

19. Verfahren nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass Hilfsmoleküle Moleküle aus einem Nukleinsäureamplifikationssystem und/oder einem Restriktionsenzymsystem umfassen.

20. Verfahren nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass durch eine indirekte oder direkte Interaktion der Mediator-Region mit der zweiten Region des Nachweismoleküls eine physikalisch oder chemisch messbare Veränderung des Nachweismoleküls erfolgt.

21. Verfahren nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass das Nachweismolekül durch direkte oder indirekte Interaktion mit der Mediator-Region verändert wird, umfassend Änderung in Fluoreszenz, Phosphoreszenz, Masse, Absorption, Streuung des Lichts, elektrischen Leitfähigkeit, enzymatische Aktivität und/oder der Affinität.

22. Verfahren nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass sequenzspezifische oder -unspezifische, fluorogene und/oder chromogene Sonden oder Fluoreszenzfarbstoffe mit mindestens einer Region der Mediator-Sonde und/oder dem Nachweismolekül interagieren.

23. Verfahren nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass das Nachweismolekül durch eine Interaktion mit der Mediator-Region durch die Hilfsmoleküle verändert wird, umfassend Phosphorylierung, Dephosphorylierung, Amidierung, Anbindung oder Abspaltung einer chemischen Gruppe, Fluoreszenz-, Phosphoreszenz- oder Lumineszenzänderung.

24. Verfahren nach einem oder mehreren der vorherigen Ansprüche, dadurch gekennzeichnet, dass Nachweismolekül über mindestens eine Fluoreszenz-Modifikationen am 5’-terminalen Bereich und/oder innerhalb der Haarnadelstruktur verfügt und nach der Reaktion mit der Mediator-Region mittels eines Hilfsmoleküls von dem Nachweismolekül die Fluoreszenz-Modifikationen abgespalten und/oder der 5’-Terminus der Haarnadelstruktur des Nachweismoleküls entfernt wird und eine Änderung des Fluoreszenzsignals am Nachweismolekül detektiert wird.

25. Verwendung des Systems nach den Ansprüchen 7 bis 13 zur Amplifikation von mindestens einem Zielmolekül.

26. Verwendung des Systems nach den Ansprüchen 7 bis 13 zur Detektion von einem oder mehreren gleichartigen oder verschiedenen Biomolekülen in einem Gemisch.

27. Verwendung des Systems nach Anspruch 26 unter Verwendung der Aktivität eines Restriktionsenzyms, wobei das Nachweismolekül über eine chemische Schutzgruppe am 3‘-terminalen Bereich verfügt, die nach der Reaktion mit der Mediator-Region mittels eines Hilfsmoleküls von dem Nachweismolekül abgespalten wird und eine 3‘-terminale OH-Gruppe generiert wird.

Description:

Die Erfindung betrifft eine Mediator-Sonde, die aus einer Sonden-Region und einer Mediator-Region besteht. Außerdem betrifft die Erfindung ein System, umfassend eine Mediator-Sonde und ein Nachweismolekül, die Verwendung des System und ein Verfahren zum Nachweis von mindestens einem Zielmolekül.

Im Stand der Technik sind zahlreiche molekularbiologische Untersuchungsmethoden beschrieben, die die Detektion und ggf. Analyse einer Probe ermöglichen. Eine dieser Methoden ist die Detektion und parallele Analyse von mehreren tausend Einzelnachweisen in einer geringen Menge biologischen Probenmaterials mittels einem Microarray. Es gibt verschiedene Formen von Microarrays, die manchmal auch als "Genchips" oder "Biochips" bezeichnet werden, weil sie wie ein Computerchip viele Informationen auf kleinstem Raum enthalten können.

Mikroarrays erlauben die hoch-parallele Detektion verschiedener Analyte auf einem typischerweise planaren Substrat. Die immobilisierten Sondenmoleküle eines Mikroarrays werden auf einem geeigneten Substrat im Laufe des Herstellungsprozesses an einer definierten Stelle (Spot) eines Rasters (Array) durch Übertragung geringer Flüssigkeitsvolumina immobilisiert bzw. synthetisiert. Diese zweidimensionale, ortsaufgelöste Immobilisierung von Fängermolekülen kann so gestaltet sein, dass Nukleinsäuren oder Peptide bzw. Proteine detektiert werden können. In der Regel erlauben in situ-Lithographieverfahren nur die Synthese kurzer Oligonukleotide bzw. Aminosäureketten. Die hergestellten DNA-Mikroarrays können unter geeigneten Bedingungen über Monate gelagert werden, Protein-Arrays können dagegen nur für eine kurze Zeit funktionell aufbewahrt werden.

Für eine Mikroarray-Analyse wird die zu untersuchende Probe mit einem geeigneten Puffer vermischt und in entsprechender Weise mit dem Mikroarray inkubiert, so dass typischerweise bei komplementären Sequenzabschnitten ein Hybridisierungsereignis stattfindet. Aufgrund der geringen Sensitivität von Mikroarray-Systemen wird die Probe im Falle von nachzuweisender Nukleinsäure in einem vorgelagerten Reaktionsschritt amplifiziert (z.B. mittels Polymerase Chain Reaction (PCR), RT-PCR oder Whole Genome Amplification (WGA)) und für eine Detektion zum Beispiel mit einem Fluoreszenzfarbstoff markiert oder auf dem Mikroarray mit einer zusätzlichen Detektionssonde inkubiert. Peptide und Proteine können nicht enzymatisch amplifiziert werden und werden durch Aufreinigungen der zu untersuchenden Probe aufkonzentriert. Dem gegenüber stehen Ansätze, die eine Signalverstärkung auf dem Mikroarray nach erfolgter Hybridisierung, z.B. mittels Rolling Circle Amplification (RCA), durchführen. Diese Vorgehensweise umfasst mehrere zeitintensive Arbeitsschritte und erhöht die Gefahr für Ungenauigkeiten und Kontaminationen. Typische Anwendungen finden Mirkoarrays bei Expressionsanalysen, sowie dem Nachweis von Pathogenen oder Resistenz-Markern. Ein Überblick über verschiedene Herstellungstechniken und Anwendungen ist für den Fachmann aus dem Stand der Technik bekannt.

Im Stand der Technik ist die Hybridisierung von amplifizierten DNA-Fragmenten an immobilisierte, allelspezifische Oligonukleotide beschrieben, die zu den Routineverfahren eines Fachmanns gehören. Ein vorgeschalteter Amplifikationsschritt mit Primermolekülen in unterschiedlichen Konzentrationen erlaubt die Generierung einzelsträngiger, markierter DNA, welche bevorzugt mit den Fängermolekülen des Mikroarrays interagiert. Nach Überführen des Mediums auf einen Mikroarray kann nach erfolgter Hybridisierung die Detektion direkt mittels Fluoreszenz oder durch Verwendung von Biotin-markierten Primer erfolgen, wobei nach dem Hybridisierungsschritt eine Inkubation insbesondere mit einer Streptavidin-modifizierten Meerrettichperoxidase erfolgt, welche ein lösliches Substrat in ein unlösliches Reaktionsprodukt umsetzt. Durch die Detektion des chromogenen Niederschlags kann ein Bindeereignis zwischen Ziel- und Fängermolekül nachgewiesen werden. Gegebenenfalls kann nach der Hybridisierung der voramplifizierten Zielsequenz(en) eine Verlängerungsreaktion eines immobilisierten Primers durchgeführt werden, bei der Biotinmarkierte Nukleotide eingebaut werden. Nach Inkubation mit einer Streptavidin-modifizierten Alkalischen Phosphatase und Zugabe eines geeigneten Substrats kann durch Bildung eines chromogenen Reaktionsprodukts die Anwesenheit der Zielsequenz nachgewiesen werden.

In einer weiteren Ausführung (Multiplex quantitative DNA-Array basierte PCR, MQDA-PCR) wird die nachzuweisende Nukleinsäure in einem mehrstufigen Prozess zuerst mit bifunktionellen Primern für wenige PCR-Zyklen parallel amplifiziert. Dabei entstehen Amplifikate mit universellem 5’-Ende, welches anschließend die kompetitive quasi-monoplex Amplifizierung mit universellen Primern ermöglicht. Anschließend wird in einem gesonderten Arbeitsschritt eine Zielsequenz-spezifische Sonde durch Addition eines modifizierten Nukleotids markiert und auf einem Mikroarray hybridisiert. Durch die Verwendung bifunktioneller Primer, kann eine zweistufige PCR-Reaktion mit erhöhtem Multiplexing-Grad durchgeführt werden, ohne dass die Reaktionseffizienz durch unterschiedliche Sequenzen signifikant beeinflusst wird. Nachteilig wirkt sich das komplexe Durchführungsprotokoll auf die Integration in den Arbeitsablauf aus. Die mehrmalige Zugabe und Entnahme von Reagenzien bzw. Reaktionsprodukten sowie das Transferieren des Reaktionsansatzes zwischen mehreren Gefäßen beinhalten hohen Arbeitsaufwand („hands-on time“), lange Wartezeiten („time to result“) und die Gefahr von Durchführungsfehlern. Neben dem Ansetzen der einzelnen PCR-Reaktionen beinhaltet die Ausführung mehrere Inkubationsschritte, in denen z.B. die bifunktionellen Primer verdaut, Sonden markiert und auf dem Mikroarray inkubiert werden. Bei dieser Methode besteht eine direkte Korrelation zwischen nachzuweisender Zielsequenz und immobilisierten Fängermolekül auf der Chip-Oberfläche. Dadurch kann das Verfahren nicht an abweichende Zielsequenzen angepasst werden, ohne einen neuen Mikroarray herzustellen. Die genannten Verfahren besitzen zusätzlich den Nachteil, dass das Probenmaterial nach der Amplifizierung zwischen zwei Reaktionsgefäßen transferiert werden muss, wobei Durchführungsfehler und Kontaminationen entstehen können.

Eine Möglichkeit, die Kontaminationsgefahr zu minimieren besteht darin, Amplifikation und Hybridisierung in einem Reaktionsgefäß durchzuführen. Durch räumliche Trennung zweier Reaktionskompartimente können verschiedene Reaktionen zeitlich voneinander getrennt in einem Gefäß ablaufen. In dem Stand der Technik ist ein „Microarray-in-a-tube“-System beschrieben, bei welchem zwei Kompartimente und ein Pufferreservoir in einem Reaktionsgefäß integriert sind (Liu, Q. et al, 2007, Microarray-in-a-tube for detection of multiple viruses. Clin Chem, 53, 188–194). Durch Invertieren des Gefäßes wird die Flüssigkeit vom unteren Abschnitt in den oberen Abschnitt überführt und mit einem vorgelagerten Reaktionspuffer vermischt, wobei das Reaktionsgefäß nicht geöffnet werden muss. Damit kann ein Amplifikationsschritt mit einer nachfolgenden Hybridisierung durchgeführt werden, ohne dass das Reaktionsmedium zwischen zwei Gefäßen transferiert oder mit Hilfe aktiver Elemente aktuiert werden muss. Da die immobilisierten Fängermoleküle von der Sequenz der nachzuweisenden Zielsequenz abhängen, können mit einem spezifischen Array-Layout nur ausgewählte Sequenzen detektiert werden. Das hergestellte Mikroarray kann daher nicht an neu ausgewählte Zielsequenzen adaptiert und muss gegebenenfalls in einem neuen Arbeitsablauf hergestellt und in das System integriert werden.

Weiterhin ist im Stand der Technik beschrieben, dass der Nachweis spezifischer Nukleinsäuren in einem Reaktionsansatz mittels Strangverlängerung einer immobilisierten Sonde erfolgen kann. Dazu wird die Zielsequenz in Gegenwart von dUTP amplifiziert und in einem nachgeschalteten Schritt in ungefähr 20 bis 50 Basenpaar lange Abschnitte enzymatisch mittels Uracil-N-Glycosylase fragmentiert. Anschließend wird der Ansatz auf einem Mikroarray inkubiert, welcher aus Zielsequenz-komplementären Sonden besteht, die am 5’-Terminus immobilisiert sind. Nach Hybridisierung entsteht typischerweise ein Duplex, bei dem der 5’-Bereich des Zielmoleküls den 3’-Bereich der Sonde überlappt. Nach Entfernen der ungebundenen Fragmente wird der Array mit einem Reaktionsmix inkubiert, welcher u. a. eine Polymerase und markierte ddNTPs enthält. Für jedes der vier Nukleotide ist die Markierung (Fluoreszenzfarbstoff) verschieden. Die Verwendung von ddNTPs erlaubt die spezifische Addition genau eines Nukleotids an die Festphasen-Sonde in Gegenwart der komplementären Zielsequenz, da an ddNTPs kein weiteres Nukleotid geknüpft werden kann. Mit geeigneten Detektionsverfahren lässt sich somit ermitteln, welches Nukleotid an welchen Sondenabschnitt angefügt wurde. Daher eignet sich die Methode zur Detektion der Zielsequenz und Sequenzierung, sofern geeignete Sondenabschnitte verwendet werden. In einer speziellen Ausführung, erlaubt das Verfahren einen hohen Multiplex-Grad und den parallelen SNP-Nachweis von bis 640 Zielsequenzen. Wie bei anderen Verfahren des Standes der Technik, bei denen ein Reaktionsansatz nach durchgeführter Amplifikation transferiert werden muss, besteht auch bei diesem Ansatz die Gefahr der Kontamination und Durchführungsfehler. Typischerweise müssen Festphasensonden den kompletten nachzuweisenden Lokus abdecken, womit mehrere Sonden pro Sequenzabschnitt benötigt werden.

In der US 5,641,658 und US 6,300,070 B1 ist eine PCR-basierte Amplifikationsmethode beschrieben, bei welcher die benötigten Primermoleküle an einer Festphase immobilisiert sind. Dies hat zur Folge, dass die amplifizierten Nukleinsäuremoleküle ebenfalls ausschließlich an der Festphase vorliegen. Bei Vorhandensein der Zielsequenz in der zu untersuchenden Probe kann die Nukleinsäure an ‚Primer 1’ binden und dieser enzymatisch verlängert werden. Im wiederkehrenden Denaturierungsschritt dissoziiert die Nukleinsäure-Vorlage vom neu gebildeten Nukleinsäurestrang und steht somit im nächsten Annealingzyklus zur Verfügung. Das gebildete Amplifikationsprodukt kann im nächsten Zyklus mit einem immobilisierten ‚Primer 2’ hybridisieren, welcher verlängert werden kann und ebenfalls einen immobilisierten Nukleinsäurestrang bildet. Die durch diesen Vorgang gebildeten Nukleinsäurestränge können mit weiteren Primermolekülen interagieren und als Nukleinsäure-Vorlage dienen. Dieses Verfahren zum Nachweis von Nukleinsäuren wird als „BridgeTM-PCR“ bezeichnet.

Durch Immobilisierung verschiedener Primerpaare in einem definierten Array können durch den somit erreichten Multiplexing-Grad mehrere Zielsequenzen parallel nachgewiesen werden. Ein Nachteil dieses Verfahren besteht in der Notwendigkeit, dass die verschiedenen Primermoleküle homogen und mit ausreichender Dichte im jeweiligen Spot verteilt vorliegen müssen, damit der durch Primerverlängerung entstandene Nukleinsäure-Strang eine ausreichende Anzahl weiterer Interaktionspartner für den nächsten Zyklen besitzt. Die Reaktionseffizienz dieser Festphasen-PCR liegt bei etwa 30 %, wobei der Anteil der linearen interphasischen Amplifikation ungefähr zehnmal höher ist als der der Oberflächenamplifikation. Zu vergleichbaren Reaktionseffizienzen (~34 %) kommt Pemov et al. (Pemov, A. et al, 2005, DNA analysis with multiplex microarray-enhanced PCR. Nucleic Acids Res., 33, e11.), wobei für diese Studien in Hydrogel immobilisierte Primer und zusätzliche Primer in der Flüssigphase verwendet wurden. Die 5’-immobilisierten Primer bestehen aus zwei funktionellen Abschnitten und setzten sich aus einem universellen 5’-Bereich und einem zielsequenzspezifischen 3’-Bereich zusammen. Frei in der Reaktionslösung vorliegende universelle Primer besitzen die identische Sequenz wie die universellen Abschnitte der Festphasenprimer. In einer Abfolge von interphasischer und Festphasen-Amplifikation wird eine modifizierte Kopie der Zielsequenz gebildet, die mittels universeller Flüssigphasenprimer in einer „quasi-monoplex“ PCR amplifiziert werden kann. Dieses Festphasen-gestützte Multiplexing-Verfahren hat den Nachteil, dass post PCR-Schritte (z.B. Inkubation mit modifizierten Detektionsoligonukleotiden bzw. Wasch- und Inkubationsschritte nach Einbau modifizierter Nukleotide durchgeführt werden müssen.

Ein weiteres im Stand der Technik beschriebene Verfahren, um Amplifikationsprodukte auf einer Festphase während eines Amplifikationsschrittes zu immobiliiseren ist die verschachtelte Festphasen-PCR (nested on-chip PCR (NOC PCR). Die Methode bedient sich mindestens drei verschiedener Primermoleküle, von denen zwei Primer das äußere Primerpaar (P1 und P2) bilden und das dritte Primermolekül (P3) innerhalb eines von P1 und P2 begrenzten Abschnitt bindet und P3 an einer Festphase immobilisiert vorliegt. P1 und P2 liegen im Vergleich zu P3 im Überschuss vor. Die Methode stellt ein kombiniertes Flüssigphasen/Festphasenamplifikationssystem dar. Die Vorteile dieses Verfahrens liegen analog zur verschachtelten PCR (nested PCR) in der erhöhten Sensitivität und Spezifität. Durch geeignete Immobilisierungsverfahren und Wahl des Substrats kann ein hoch-paralleler Nachweis mehrerer Zielsequenzen erfolgen. Die Analyse kann mittels sequenzspezifischer Sonden oder markierten Nukleotiden erfolgen, wobei bei letzterer Variante eine Detektion in Echtzeit möglich ist. Ein Nachteil dieses Ansatzes ist die Verwendung Zielsequenzsequenspezifischer P3-Primermoleküle, deren Sequenz direkt mit dem Zielmolekül korreliert.

Die Verwendung immobilisierter Primer-Moleküle zum spezifischen Nachweis von Nukleinsäuren ist nicht nur auf PCR-basierte Methoden beschränkt. Es ist im Stand der Technik beschrieben, dass mittels Helikase-abhängiger Amplifikation („Helicase Dependent Amplification“, HDA) der isotherme Nachweis von Pathogenen innerhalb von 120 Minuten erfolgreich durchgeführt wurde. Die Markierung des Amplifikationsproduktes erfolgt mittels Fluoreszenz-markierter Reverse-Primer. Nach Durchführung der Reaktion wird der Chip gewaschen und das Fluoreszenzsignal ausgewertet. Um eine spezifische und sensitive Reaktion durchzuführen, muss der Reaktionsansatz auf 65°C erwärmt werden. Zusätzlich muss der Chip an ein Pumpenelement angeschlossen werden, damit das relativ hohe Probenvolumen von 50 µL ausreichend durchmischt wird. Die Konnektierung von aktiven Aktuatoren an einen Biochip ist generell als nachteilig anzusehen und erhöht den Arbeitsaufwand. Die erreichte Sensitivität ist für die klinische Diagnostik zu gering. So wurden beispielsweise 5·10^4 Genomäquivalente von Staphylococcus aureus und 1,3·10^5 Genomäquivalente von Neisseria gonorrhoeae als Detektionslimit beschrieben (Andresen, D., von Nickisch-Rosenegk, M. and Bier, F.F., 2009, Helicase dependent OnChipamplification and its use in multiplex pathogen detection, Clin. Chim. Acta, 403, 244–248). Der durch diese Methode hergestellte Biochip ist ausschließlich zur Detektion festgelegter Zielsequenzen zu verwenden, da Analyt-spezifische Oligonukleotide immobilisiert vorliegen.

Weiterhin sind im Stand der Technik Methoden offenbart, bei denen der Nachweis der Zielsequenz in Echtzeit bzw. ohne weitere Prozessierungsschritte erfolgt. Diese Methoden werden durch ein kombiniertes Amplifikations- und Detektionssystem realisiert. So ist beispielsweise beschrieben, dass die parallele Detektion und Quantifizierung drei verschiedener Viren in Spenderplasma-Proben möglich ist. Es werden ein äußeres und inneres Primerpaar benötigt, wobei das äußere Paar in einer Reversen Transkription verwendet wird. Das innere Paar, bei dem der Forward-Primer in einem Hydrogel-Pad immobilisiert, liegt während der Reverse-Primer frei in der Flüssigphase vor, wird für die onchip PCR eingesetzt. Unter Verwendung eines geeigneten Farbstoffes werden doppelsträngige Amplifikationsprodukte in den Spots während des Annealingschritts markiert und detektiert. Das Verfahren besitzt einen dynamischen Bereich von 6 Log (10^0 bis 10^6 Kopien). Die Verwendung eines sequenz-unspezifischen Farbstoffes erlaubt die universelle Detektion beliebiger, doppelsträngiger Amplifikationsprodukte. Nachteilig ist allerdings, dass keine Spezifität gewährleistet ist, so dass unspezifische Amplifikationsprodukte nicht unterschieden werden können.

In der DE 103 16 159 A1 wird ein Verfahren beschrieben, bei dem Zielsequenz-spezifische Primermoleküle in einer temperierbaren Flusszelle immobilisiert vorliegen. Die Flusszelle besitzt weiterhin die Eigenschaft, mittels Totaler interner Resonanzfluoreszenz (Total internal resonance fluorescence, TIRF) das Anregungslicht durch eine in der Regel planare Fläche zu leiten. Nach Zugabe der Zielsequenz und typischer PCR-Reagenzien sowie Fluoreszenzmarkierten Nukleotiden (z.B. Cy5-dUTP) kann die DNA-abhängige Festphasenprimerverlängerung durch geeignete Verfahren detektiert werden.

Liu et al. entwickelte eine Multiplex-Analyse für Nukleinsäuren, welche die Amplifiaktion durch PCR und Detektion mittels Mikroarray-Analyse in einer Reaktion kombiniert (Liu, H.P. et al, 2006, TaqMan probe array for quantitative detection of DNA targets, Nucleic Acids Research, 34.). Dies erfolgt mittels Primermolekülen in der Flüssigphase und eines Arrays Zielsequenz-spezifischer, 3’-immobilisierter TaqMan-Sonden. In Anwesenheit der komplementären Zielsequenz wird eine TaqMan-Sonde durch eine Polymerase gespalten, wodurch ein unterdrücktes Fluoreszenzsignal wiederhergestellt wird. Das örtlich-aufgelöste Signal kann mittels optischer Vorrichtungen detektiert werden. Unter Verwendung dieser Plattform erfolgte der Nachweis von fünf verschiedenen Zielsequenzen in einer Probe. Dieser Ansatz ist potentiell auch für eine Echtzeit-Auswertung geeignet. Da die Primer frei in der Reaktionslösung vorliegen, kann die enzymatische Amplifizierung der Zielsequenz auch ausschließlich in der Flüssigphase erfolgen. Die Sonde stellt daher keinen notwendigen Interaktionspartner dar, und daher wird ggf. die Amplifikationsreaktion nicht durch ein Fluoreszenz-Signal an der Festphase abgebildet. Weitere Fluorophor-markierte Oligonukleotid-Sonden werden für den spezifischen Nachweis von Zielsequenzen eingesetzt. Die Verwendung von Molecular Beacons als Biosensoren für sensitive und spezifische Nukleinsäuredetektion ist in dem Stand der Technik beschrieben. Die Verwendung von Molecular Beacon- oder TaqMan-Sonden für Mikroarray-Analysen hat den Vorteil, dass die Zielsequenz nicht wie bei Oligonukleotid-Mikroarrays in einem gesonderten Reaktionsschritt, welcher vor oder nach dem Hybridisierungsereignisses durchgeführt wird, typischerweise mit Fluoreszenzfarbstoffen markiert werden muss. Falls ein Voramplifikationsschritt ausserhalb des Mikroarrays benötigt wird, entstehen jedoch eine erhöhter Arbeitsaufwand und Kontaminationsgefahr. Da immobilisierte Molecular Beaconoder TaqMan-Sonden typischerweise mindestens drei Modifikationen (Gruppe zur Immobilisierung, Fluoreszenzdonor und -akzeptor) besitzen, entstehen unmittelbar bei Änderungen der Zielsequenz oder des Array-Layouts hohe Folgekosten für die Herstellung und Immobilisierung neuer Sonden.

Weiterhin ist im Stand der Technik ein sogenannter „Invader Assay“ beschrieben, der von der Firma Hologic (früher: Third Wave Technology) entwickelt wurde. Der Assay kann unter isothermen Bedingungen die Anwesenheit einer Zielsequenz nachweisen. Das Verfahren benötigt im einfachsten Fall eine Struktur-spezifische Nuklease, zwei Zielsequenzspezifische Oligonukleotide – ein „Invader“-Oligonukleotid und eine Sonde, welche über einen Fluoreszenzdonor und -akzeptor verfügt. Während der Nachweisereaktion hybridisieren die beiden Oligonukleotide an einen Strang der Zielsequenz, wobei sich der 3’-Terminus des „Invader“-Oligonukleotids und der 5’-Terminus der Sonde überlappen und eine Triplex-Struktur (ternärer Komplex) bilden. Die gebildete Triplex-Struktur stellt das Substrat für eine Struktur-spezifische Nuklease dar, die die Sonde spaltet (Primärreaktion) und dabei ein zuvor unterdrücktes Fluoreszenz-Signal wiederherstellt. In einer weiteren Ausführung des „Invader Assays“ besitzt die Sonde keine Fluoreszenz-Modifikationen, die freigesetzte 5’-Region der Sonde kann jedoch eine nachfolgende Detektionsreaktion (Sekundärreaktion) aktivieren, indem es mit einem FRET-Detektionsmolekül interagiert und eine lokale Triplex-Struktur bildet. Nach Spaltung dieses Komplexes entsteht ein Fluoreszenzsignal. Bei der beschriebenen Reaktion findet eine Signalamplifizierung aber keine Zielsequenzamplifizierung statt. Der „Invader-Assay“ kann u.a. für die Detektion von Einzelnukleotid-Polymorphismen (SNP) verwendet verwendet werden.

Das von dem „Invader Assay“ abgeleitete InPlex®-System kombiniert eine Voramplifikation der Zielsequenzen mit dem Invader® Assay. Dabei werden die Zielsequenzen zuerst mittels PCR amplifiziert und anschließend in eine Reaktionskartusche überführt und mehrere Stunden inkubiert (Detektionsreaktion). Die InvaderPlus®-Reaktion kombiniert eine PCR mit der „Invader“-Reaktion in einem Reaktionsgefäß, wobei eine Polymerase aus Thermus aquaticus und das Enzym Cleavase® verwendet werden. Dabei wird zunächst mittels PCR die Zielsequenz amplifiziert und anschließend die Polymerase bei 99 °C inaktiviert. Im nächsten Schritt wird der Reaktionsmix auf eine Temperatur abgekühlt, bei der sich ein Invader-Oligonukleotid und eine Sonde an die Zielsequenz anlagern. Diese Struktur wird von der Cleavase® erkannt, worauf eine Spaltungsreaktion mit Signalgenerierung ablaufen kann. Diese Endpunkt-Reaktion dauert typischerweise zwei Stunden.

Im Stand der Technik sind mehrere Festphasen-basierte Ansätze bekannt, bei denen die Zielsequenz-spezifische Sonde örtlich-aufgelöst auf einer geeigneten Oberfläche immobilisiert ist und zur Detektion von SNPs in genomischer DNA verwendet werden kann. Dabei erfolgt die Detektion direkt über eine Fluoreszenzänderung bzw. indirekt nach erfolgter Ligation eines Spaltungsproduktes mit einem Primer und universeller Rolling Circle Amplifikation sowie Markierung mit einem sequenzunspezifischen Fluoreszenzfarbstoff bzw. Biotin-markierten Oligonukleotid und anschließender Inkubation mit Streptavidin-beschichteter Goldpartikel. Da bei diesem isothermen Verfahren keine Zielsequenz-Amplifizierung erfolgt, liegt die typische Inkubationsdauer einer Analyse bei bis zu 24 Stunden gefolgt von einer Fluoreszenzmessung.

Mikroarray-Analysen umfassen mehrere Arbeitsschritte, typischerweise Auswahl der Sequenz des immobilisierten Fängermoleküls, Probenvorbereitung und Amplifikation, Hybridisierung bzw. Inkubation gefolgt von anschließenden Waschschritten sowie Signalmessung und Datenverarbeitung. Die im Stand der Technik bisher beschriebenen Mikroarrays basieren auf dem Prinzip der direkten Wechselwirkung zwischen Ziel- und immobilisierten Fängermolekül, daher muss ein geändertes Fängermolekül verwendet werden, sobald ein abweichendes Zielmolekül detektiert werden soll. Dies bedingt prinzipiell die Herstellung eines geänderten Arrays und ist ein wesentlicher Zeit- und Kostenfaktor. Aufgrund des aufwändigen Herstellungsprozesses, werden aus wirtschaftlichen Gründen größere Stückzahlen eines Sequenzlayouts gefertigt. Somit bieten Arbeiten mit Mikroarrays geringe Flexibilität in Bezug auf das nachzuweisende Zielmolekül, da ein geändertes Sequenzlayout hohe Folgekosten und Prozessierungsaufwand nach sich zieht. Ferner sind im Stand der Technik universelle Mikroarrays offenbart. Universelle Nukleinsäure-Mikroarrays, bei denen die Sequenz der immobilisierten Fängermoleküle unabhängig von der Zielsequenz ist, sind z. B. kommerziell erhältlich, z.B. Affymetrix „GeneChip Universal Tag Arrays“. Diese Verfahren basieren auf einem universellen Mikroarray-Sequenzlayout, bei dem die immobilisierten Oligonukleotide (ZIP code bzw. Universal Tag) unabhängig von der nachzuweisenden Sequenz sind und nicht mit dieser interferieren. Bei einer typischen Nachweisreaktion wird die Zielsequenz in der Regel in einem gesonderten Reaktionsgefäß amplifiziert und ggf. aufgereinigt. Anschließend erfolgt ein Ligationsschritt, bei dem in Anwesenheit der Zielsequenz eine spezifische Detektionssonde und eine Fluoreszenzsonde direkt nebeneinander an der Basenabfolge der Zielsequenz hybridisieren. Die Detektionssonde besitzt einen Zielsequenz-unspezifischen Überhang (complementary ZIP code, cZIP code), welcher als Adressierungssequenz dient und komplementär zu einer ZIP code-Sonde des Mikroarrays ist. Durch die Ligation entsteht ein Produkt aus Detektions- und Fluoreszenzsonde, welches für eine Hybridisierung auf einem ZIP code-Mikroarray verwendet wird. Ein Fluoreszenzsignal an einem spezifischen ZIP code-Spot ist ein indirekter Hinweis auf die Anwesenheit der Zielsequenz im Reaktionsmix. Als Festphase können auch kodierte Mikrokugeln (Beads) verwendet werden. Dabei wird jedem Fängermolekül ein eindeutig identifizierbares Bead zugewiesen, was durch eine definierte Nukleotidsequenz oder Färbung bzw. Intensität erreicht wird. Durch diese Zuordnung kann in einem späteren Arbeitsschritt eine automatisierte Detektion des Beads sowie die parallele Analyse durchgeführt werden. Diese Methode besitzt den Vorteil, dass die Beads in der Flüssigphase homogenisiert vorliegen und die daraus resultierenden Reaktionskinetiken höher sind als bei vergleichbaren Flüssig-/Festphaseninteraktionen.

Ein als „cDNA-vermittelte Annealing, Selektion, Extension und Ligation“ (DASL) betiteltes Verfahren zur Expressionsanalyse mittels universellen Mikroarrays ist ebenso im Stand der Technik beschrieben. Dabei wird zunächst RNA mittels Biotin-markierten Oligo-d(T)18 und Primermolekülen zufälliger Sequenz in cDNA umgeschrieben. Anschließend erfolgt ein Hybridisierungsschritt zweier lokus-spezifscher Oligonukleotide, wobei beide Olignukleotide universelle, lokus-unspezifische Sequenzüberhänge besitzen. Das 3’-terminale Oligonukleotid verfügt über eine Adressierungsequenz, welche zwischen dem sequenzspezifischen Bereich und dem unspezifischen Sequenzüberhang integriert ist. Die Adressierungsequenz ist komplementär zu einer definierten Sequenz auf dem universellen Mikroarray. In einer Verlängerungsreaktion wird der Bereich zwischen den Oligonukleotiden komplementär ergänzt und im nächsten Schritt ligiert. Unter Verwendung spezieller Oligonukleotide kann anschließend eine Vervielfältigung des Ligationsprodukts mittels PCR erfolgen, wobei durch Fluoreszenz-markierte Primer eine Markierung des amplifizierten Ligationsprodukt erfolgt. Im nächsten Schritt wird eine Hybridisierung an ein universelles Array bzw. Bead durchgeführt. Das DASL-Verfahren bietet im Vergleich zu den vorherig beschriebenen universellen Mikroarrays den Vorteil, dass mehr Möglichkeiten zur Sequenzauswahl der zu ligierenden Oligonukleotide besteht, da eine Verlängerungsreaktion die fehlenden Nukleotide ergänzt. Allerdings muss durch diese Reaktion ein weiterer fehleranfälliger Arbeitsschritt in den Ablauf integriert werden. Durch die zahlreichen Prozessierungs- und Analyseschritte sind diese Methoden sehr zeitintensiv, zusätzlich besteht Kontaminationsgefahr, da amplifizierte Nukleinsäure-Fragmente zwischen Reaktionsgefäßen überführt werden müssen. Des Weiteren ist die Methode nur für Endpunkt-Messungen ausgelegt.

In der US 5,653,939 und US 6,099,803 ist ein Verfahren beschrieben, dass durch lokale Manipulation eines elektrischen Feldes den elektrophoretischen Transport geladener (Bio)Moleküle zu definierten Mikrolokationen (Spots) auf einem Mikroelektronikchip ermöglicht. Dieser „aktiver Mikroelektronik-Array“, der unter der Bezeichnung NanoChip® kommerzialisiert wurde, besteht aus einem geordneten Aufbau individuell adressierbarer Elektroden. Durch Anlegen einer Spannung an eine oder mehrere Elektroden können geladene Analyte spezifisch an definierte Spots auf dem Halbleiter-Chip bewegt und konzentriert werden. Werden die Spots mit komplementären oder affinen Fängermolekül versehen, kann durch elektrophoretischen Transport ein Hybridisierungs- oder Affinitätsereignis innerhalb kurzer Zeitspannen stattfinden. Da Polarität und anliegende Spannung der Elektroden beliebig geändert werden kann, ermöglicht dies die Manipulation von Teilchen mit negativer (z.B. Nukleinsäuren, teilweise Proteine) und positiver (z.B. teilweise Proteine) Nettoladung. Durch Belegung mehrerer Spots mit verschiedenen Fängermolekülen kann eine Multiplex-Analyse mit einer aufgetragenen Probe durchgeführt werden. Durch Umpolen der Elektroden erfolgt ein Abstoßen der Zielmoleküle vom Fängermolekül, wodurch die Stärke der Wechselwirkung ermittelt (Selekltivität) und unspezifische Bindungen minimiert werden („elektrische Stringenz“). Die Immobilisierung der Fängermoleküle erfolgt typischerweise über Biotin-Modifikationen, die selektiv an das Streptavidin-modifizierte Polymer-Gel der Chipoberfläche binden. Die NanoChip-Geräteplattform eignet sich prinzipiell für DNA-Hybridisierungen, SNP- oder STR-Analysen sowie Zelltyp-Bestimmungen und on-chip SDA-Reaktionen. Die Detektion kann durch passive Hybridisierung markierter Sonden oder durch gängige Antikörper-Techniken erfolgen. Durch die angelegte Spannung entstehen im Bereich der Elektroden Elektrolyseprodukte (H+, OH-, H2, O2 und freie Radikale), welche das Zielmolekül schädigen können. Um diesen Effekt zu minimieren ist die Applikation einer separierenden Zwischenschicht in Form eines Polymer-Gels notwendig. Da diese Plattform ausschließlich Molekülinteraktionen zu detektieren vermag, muss das Probenmaterial in der Regel in einem vorgelagerten Schritt angereichert werden. Dies ist vor allem für Nukleinsäuren notwendig, die typischerweise mittels asymmetrischer PCR vervielfältigt werden. Die Geräteplattform besteht aus einer System- und Mikrochipkontrolleinheit, welche z.B. die Steuerung der angelegten Spannung und Fluidik regeln.

Ein weiterer universeller Ansatz zur Detektion von Zielmolekülen wurde von High-Throughput Genomics (HTG) vermarktet (z. B. US 2001/0034025 A1 oder US 6,238,869 B1). Grundlage für diesen Ansatz bildet ein universelles Array verschiedener Anker-Oligonukleotide, welche am 3’-Terminus an einer Festphase (Mikrotiterplatte) immobilisiert sind. Linker-Moleküle, die einen komplementären 5’-Abschnitt zu den beschriebenen Anker-Oligonukleotide und einen Zielmolekül-spezifischen 3’-Abschnitt aufweisen, ändern nach erfolgter Hybridisierung die Bindespezifität an dieser Arrayposition. Sollen mit dem neu konfigurierten Array Nukleinsäuren detektiert werden, besteht das Linker-Molekül aus einem Oligonukleotid, für den Nachweis von Proteinen besteht das Molekül typischerweise aus einem Oligonukleotid-Antikörper-Konjugat. Eine von HTG vorgestellte Ausführung zur Detektion von mRNA für Expressionsanalysen ermöglicht den parallelen Nachweis von 16 verschiedenen Loci pro Kavität einer handelsüblichen Mikrotiterplatte. Dazu werden beispielsweise Zellen in einem gesonderten Gefäß in Anwesenheit von mRNA-komplementären DNA-Sonden lysiert und denaturiert. Nach erfolgter Hybridisierung werden durch Zugabe einer S1 Nuklease einzelsträngige Nukleinsäuren (mRNA und Überschuss der DNA-Sonden) verdaut. Durch alkalische Hydrolyse wird der RNA-Anteil des Duplex degradiert, so dass nach Neutralisation stöchiometrische Mengen der DNA-Sonden im Ansatz vorhanden sind. Anschließend wird der Ansatz auf das Array transferiert, worauf sequentielle Hybridisierungen einer zur DNA-Sonde teilkomplementären Detektions-Sonde und ein dazu komplementäres Detektions-Konjugat, welches mit einer Peroxidase-Modifikation versehen ist, durchgeführt werden. Nach Zugabe geeigneter Substrate entsteht an der Position des Arrays ein lokales Chemilumeneszenz-Signal, an dem der beschriebene Hybridisierungskomplex erfolgreich gebildet werden konnte. Durch die zahlreichen Prozessierungsschritte ist das Verfahren arbeitsintensiv. Ein weiterer Nachteil besteht in der geringen Sensitivität des Assays, da keine Amplifikationsreaktion in das Assay-Protokoll integriert ist. Somit können beispielsweise sehr geringe Nukleinsäurekonzentrationen nicht ausreichend empfindlich nachgewiesen werden. Zusätzlich können die zahlreichen Hybridisierungsschritte zu Interferenzen und somit zu unerwünschten unspezifischen Reaktionen oder falsch-positiven Signalen führen.

Verfahren zum Proteinnachweis mittels Nukleinsäure-basierter Methoden sind in dem Stand der Technik offenbart. Dabei interagiert der Analyt mit einem immobilisierten Protein (z.B. ein Antikörper) und wird anschließend mit einem Protein-Nukleinsäurekonjugat inkubiert. In einem folgenden Waschschritt werden nicht-gebundenen Moleküle entfernt. Das Konjugat enthält eine Nukleotidsequenz, die komplementär zu einem zirkulären DNA-Molekül ist, welches anschließend hinzugegeben wird. Durch Prozessierung mit einer geeigneten Polymerase wird der Primer verlängert und mittels RCA Konkatamere des DNA-Moleküls generiert. Nach Inkubation mit Gold- modifizierten Sonden oder Sequenz-unspezifischen Fluoreszenzfarbstoffen, werden die Bereiche eines Mikroarrays spezifisch markiert, an denen Fängermolekül und Detektionskonjugat an den Analyten gebunden haben. Mittels geeigneter Detektionsverfahren lassen sich Bindungsereignisse des Analyten somit ortsaufgelöst nachweisen. Nachteilig ist, dass zwei verschiedene Proteine bzw. Protein-Nukleinsäure-Konjugate verwendet werden, welche direkt mit dem jeweiligen Analyten korrelieren. Die Verwendung von Proteinen und den davon abgeleiteten Verfahren ist aufgrund der Synthese ein großer Kostenfaktor. Einen prinzipiell ähnlichen Ansatz verfolgt die Firma Chimera Biotec mit der entwickelten Imperacer®-Technologie, wobei Antikörper-DNA-Chimäre, d.h. synthetische DNA-Fragmente, an die ein Antikörper gekoppelt wurde, verwendet werden. Bindet dieser Antikörper an das passende Antigen, kann nach anschließenden Waschschritten das gekoppelte DNA-Fragment mittels real-time PCR amplifiziert und detektiert werden.

In Zentrallaboratorien wird die labormedizinische Diagnostik mit Hilfe von Analysenautomaten durchgeführt und umfasst Bereiche der klinischen Chemie, medizinischen Mikrobiologie und medizinischen Immunbiologie sowie Transfusionsmedizin. Neben diesen Hochdurchsatz- Systemen gibt es deutlich kleinere Geräte, die eine patientennahe („point of care“) Multianalyt-Analyse zum Beispiel wichtiger Blutwerte oder Markerproteinen ermöglichen. Diese nutzen verschiedene Prinzipien der Detektion, wie Absorptionsmessung einer chromogenen Reaktion der Probe mit in der Reaktionskartusche vorgelagerten Reagenzien (z. B. Abaxis Piccolo® Xpress), Durchfluss-Immunoassay mittels einer mit Antikörper-markierten Membran und anschließender Markierung des Analyten mit Gold-modifizierten Detektionsantikörpern (z. B. Axis-Shield Afinion) oder eines linearen Teststreifens (z. B. Abbott Point-of-Care i-STAT®, Roche Cobas h232, BioSite® Triage®-System). Bei diesen Verfahren wird die Testflüssigkeit in eine spezielle Reaktionskartusche appliziert, in welcher ein saugfähiges Material die Probe durch Kapillarkräfte aufnimmt, transportiert und ggf. separiert. Typischerweise basieren die angebotenen Testkits auf Immunofluoreszenz-Technologie. An definierten Zonen sind auf dem Material Reagenzien vorgelagert (Detektionsantikörper) bzw. immobilisiert (Fängerantikörper). Die Durchführung erfordert typischerweise keine Probenpräparation, so dass die Tests mit Vollblut, Blutplasma oder Urin durchgeführt werden können (ggf. mit internem Filter für Blutzellen und Partikel) und detektieren in den meisten Fällen mehrere Analyte innerhalb einer Reaktion. Die Ergebnisse sind innerhalb von etwa 15 Minuten verfügbar. Die zur Verfügung stehenden Testkits umfassen Marker für Herzkrankheiten, Pathogene sowie Stoffwechselprodukte von diversen Medikamenten. Die Vorteile der beschriebenen Ausführungen bestehen in der hohen Benutzerfreundlichkeit (einfaches Durchführungsprotokoll, keine Probenvorbereitung) und geringen Prozessierungsdauer. Nachteilig ist, dass diese vor allem in der klinischen Diagnostik eingesetzten Geräte nur mit proprietärem Verbrauchsmaterial kompatibel sind und die Verwendung auf klinisch-relevante Marker und Parameter (zum Beispiel kardiovaskuläre Erkrankungen) beschränkt ist. Außerdem ist der Einsatz sehr stark durch den Hersteller beschränkt, da nur für bestimmte Zielmoleküle Nachweise durchgeführt werden können, für die der Hersteller freigegebene Testkits anbietet.

Das beschriebene Teststreifen-Prinzip findet ebenfalls Anwendung in der Nukleinsäureanalytik. Dabei wird die nachzuweisende Nukleinsäure amplifiziert und auf einen Teststreifen appliziert, auf dem sich Zielsequenz-spezifische Fänger- und Nachweismoleküle befinden. Durch Kapillarkräfte passiert die Zielsequenz verschiedene Zonen auf dem Teststreifen und interagiert mit den verschiedenen komplementären bzw. affinen Molekülen. Durch Ermittlung einer Nachweisbande (z.B. mittels Gold-markierter Nachweismoleküle) an einer definierten Stelle des Teststreifens kann das Vorhandensein der Zielsequenz in der zu untersuchenden Probenlösung ermittelt werden. Ein universeller Ansatz zur Detektion beliebiger Nukleinsäurensequenzen ist in dem Stand der Technik beschrieben (z. B. Baeumner, A.J. et al, 2004, A universal nucleic acid sequence biosensor with nanomolar detection limits, Anal. Chem., 76, 888–894.). Dabei wird die Probenlösung amplifiziert und mit bifunktionalen Reporter-Sonden inkubiert. Ein Abschnitt der Sonde hybridisiert an die Zielsequenz, wohingegen ein anderer Abschnitt an Vesikel mit immobiliserten Oligonukleotiden komplementärer Sequenz bindet. Ein weiterer Abschnitt der amplifizierten Zielsequenz bindet an ein Biotin-modifiziertes Oligonukleotid. Nach Applizierung des Teststreifens in die Lösung, erfolgt ein gerichteter Transport des Hybridisierungskomplexes, welcher an einer Streptavidin-modifizierten Zone akkumuliert und detektiert werden kann. Die Teststreifen-basierte Nukleinsäureanalytik benötigt einen vorgeschalteten Amplifikationsschritt und die damit verbundene Handhabung von post-PCR-Produkten. Zusätzlich sind die Systeme durch einen geringen Multiparameter-Grad, geringe Sensitivität und eingeschränkte Quantifizierung limitiert.

In verschiedenen Bereichen der klinischen Analytik und in vitro-Diagnostik besitzen Multianalyt-Nachweise große Bedeutung, wozu im Folgenden einige Beispiele aufgeführt werden (ohne jedoch hierauf begrenzt zu sein): Beispielsweise ist für die Blutgruppenbestimmung nicht nur die AB0-Genotypisierung relevant, sondern auch die Erstellung des Humanen Neutrophilen Antigen-Profils (HNA), welches für Blut- und Gewebetransfusionen ermittelt werden muss. Auch die parallele Überprüfung von Blutspenderproben auf HIV-Varianten und Hepatitis-B bzw. -C-Viren wird routinemäßig mit Immunoassays oder Nukleinsäure-basierten Techniken durchgeführt. Der spezifische Nachweis von Pathogenen bedingt die Bestimmung mehrerer genomischer Loci, um eine davon abgeleitete Diagnose nach kurzen Analysezeiten zu ermöglichen.

Die Aktivitätsbestimmung verschiedener Marker- und Kontrollgene erlaubt die Erstellung eines Expressionsprofils. Dies kann beispielsweise verwendet werden, um Onkogene, welche Zellteilung und -differenzierung beeinflussen und daher in enger Korrelation zu Krebserkrankungen stehen, zu identifizieren oder Vorhersagen über die Wirksamkeit bestimmter Medikamente abhängig vom Genotyp des Patienten zu treffen (Personalisierte Medizin). Auch häufig vertretene Erbkrankheiten lassen sich in der molekularbiologischen (Pränatal-)Diagnostik nachweisen, dazu zählen u. a. Zystische Fibrose (Mukoviszidose), Phenylketonurie (Stoffwechselstörung) und Thalassämie (Degradation der Erythrozyten). Des Weiteren erlaubt die gemeinsame Detektion von Entzündungsmarkern, wie Procalcitonin oder Cytokine, einen Rückschluss auf den Schweregrad einer Infektion.

Zahlreiche diagnostische Fragestellung erfordern die Analyse mehrerer Zielmoleküle, genetischer Loci oder anderer Marker sowie interner Kontrollen bzw. Referenzen, so dass Methoden, die nur die Bestimmung eines einzelnen Parameters pro Analyse erlauben, in der Regel wenig aussagekräftig sind. Werden zur Erfassung mehrerer Parameter verschiedene Einzelanalysen parallel durchgeführt, ist das andererseits unökonomisch: Die Probenlösung muss in mehrere homogene Reaktionsansätze aufgeteilt werden, in denen unterschiedliche Zielmoleküle nachgewiesen werden. Ein Nachteil dabei ist, dass durch das Aufteilen der Probenlösungen in „n“ Aliquote die Stoffmenge in der Einzelreaktion um Faktor 1/n reduziert wird, wobei sich die Sensitivität der Nachweisreaktion entsprechend erniedrigt.

Ein weiterer Nachteil st, dass die Analytik von Proben mit niedriger Nukleinsäure- oder Protein-Konzentration ohne einen Analyt-abhängigen vorgeschalteten Aufkonzentrationsbzw. Amplifikationsschritt aufgrund der niedrigen Sensitivität mancher Detektionsverfahren nicht möglich ist. Bei der parallelen, Mikroarray-basierten Analyse niedrig konzentrierter Nukleinsäuren stellt die Voramplifikation einerseits einen zusätzlichen Arbeitsschritt dar und bringt ferner das Problem mit sich, dass abhängig von der initialen Stoffmenge und Reaktionseffizienz keine homogene Amplifikation stattfindet und quantitative Aussagen nur eingeschränkt möglich sind. Als nachteilig ist außerdem das Transferieren von amplifizierten Produkten zwischen verschiedenen Reaktionsgefäßen und Geräten anzusehen, da dies nicht nur mit einem zusätzlichen Arbeitsschritt verbunden ist, sondern zusätzlich ein Kontaminationsrisiko darstellt.

Mikroarray-Analysen beruhen auf der direkten Interaktion zwischen einem typischerweise örtlich aufgelösten, immobilisierten Fängermolekül (Bindungspartner oder Sonde) auf einem planaren Substrat und einem Zielmolekül, welches frei diffusiv in der Flüssigphase vorliegt. Ein Nachteil dieser Methoden ist, dass sie mehrere Arbeitsschritte umfassen: eine vorgeschaltete Amplifikation bzw. Anreicherung, die Markierung der Zielmoleküle, um die Interaktion der Zielmoleküle mit dem Fängermolekül nachzuweisen, sowie mehrmalige Hybridisierungs- und Waschschritte. Des Weiteren tritt bei der beschriebenen direkten Abhängigkeit zwischen Fänger- und Zielmolekül das Problem auf, dass die Immobilisierung einer anderen Sonde erforderlich ist, wenn sich eine neue experimentelle Fragestellung ergibt, z.B. ein abweichender Genotyp eines Virus nachgewiesen werden soll.

Ein weiterer Nachteil ist, dass aufgrund des aufwändigen Herstellungsprozesses und den hohen Rüstkosten (Konfiguration des Arrays, Reinigung der Prozessierungselemente) die Fertigung eines Sequenzlayouts nur in größeren Stückzahlen wirtschaftlich (Skaleneffekte) ist. Diese eingeschränkte Flexibilität reduziert den Vorteil der hoch-parallelen und automatisierbaren Prozessierungen. Nachweise mit universellen Nukleinsäure-Mikroarrays, deren Sonden unabhängig vom nachzuweisenden Zielmolekül sind, können diesen Nachteil umgehen, allerdings ist der Arbeitsaufwand dieser Methoden sehr hoch, wodurch sich diese nicht durchgesetzt haben. Weiterhin ist neben den beschriebenen technischen Nachteilen der universellen Mikroarrays bislang kein biochemisches System aus dem Stand der Technik bekannt, welches kombinierte Multiplex-Analysen in verschiedenen Stoffklassen, wie zum Beispiel Nukleinsäuren und Proteine, erlaubt, so dass für unterschiedliche Nachweise verschiedene Verfahren oder Geräte verwendet werden müssen.

Aufgabe der Erfindung war es demgemäß ein System, ein Mittel oder ein Verfahren bereitzustellen, dass die Detektion unterschiedlicher Biomoleküle ermöglicht, wobei es universell einsetzbar ist und nicht die Nachteile oder Mängel des Standes der Technik aufweist.

Gelöst wird die Aufgabe durch die unabhängigen Ansprüche. Vorteilhafte Ausführungsformen ergeben sich aus den Unteransprüchen.

Es war völlig überraschend, dass eine Mediator-Sonde zur Bindung an ein Zielmolekül und/oder ein Nachweismolekül bereitgestellt werden kann, die nicht die Nachteile oder Mängel der im Stand der Technik offenbarten Sonden oder Systeme aufweist, wobei die Mediator-Sonde eine Sonden-Region und eine Mediator-Region umfasst, wobei die Sonde ein Oligonukleotid ist und die Sonden-Region am 3’-Terminus und die Mediator-Region am 5’-Terminus des Oligonukleotides angeordnet ist, wobei zwischen den Regionen eine chemische, biologische und/oder physikalische Spaltstelle vorliegt und die Sonden-Region eine Affinität zu dem Zielmolekül und die Mediator-Region eine weitere Affinität zu dem Nachweismolekül aufweist.

In einem weiteren Aspekt betrifft die Erfindung eine Mediator-Sonde zur Bindung an ein Zielmolekül und/oder ein Nachweismolekül umfassend eine Sonden-Region und eine Mediator-Region, wobei die Sonde ein Oligonukleotid ist und die Sonden-Region am 3’-Terminus und die Mediator-Region am 5’-Terminus des Oligonukleotides angeordnet ist, wobei zwischen den Regionen eine chemische, biologische und/oder physikalische Spaltstelle vorliegt und die Sonden-Region eine Affinität zu dem Zielmolekül und die Mediator-Region eine weitere Affinität zu dem Nachweismolekül aufweist, wobei die Spaltung der Mediator-Sonde insbesondere durch eine Amplifikation des Zielmoleküls erfolgt. Die Mediator-Sonde umfasst mindestens eine Region – Region 1-, welche komplementär oder affin zum Zielmolekül ist, und eine weitere Region – Region 2-, welche nicht-komplementär oder nicht-affin zum Zielmolekül ist. Dabei können Region 1 und Region 2 vorteilhafterweise sowohl funktionell als auch räumlich überlappend sein. Die Mediator-Sonde kann in Anwesenheit des Zielmoleküls und eines oder mehrerer Hilfsmoleküle struktur-spezifisch gespalten werden. Eine erfindungsgemäße Signalentwicklung kann nur durch eine gespaltene Mediator-Sonde erfolgen.

Weiterhin ist eine Mediator-Sonde bevorzugt, die eine Region – Region 1-, welche komplementär oder affin zum Zielmolekül ist, und eine weitere Region – Region 2-, welche nicht-komplementär oder nicht-affin zum Zielmolekül ist, und eine weitere Region – Region 3-, welche komplementär oder affin zur besagten Region 2 ist, aufweist. Dabei können Region 1, Region 2 und/oder Region 3 sowohl funktionell als auch räumlich überlappend sein. Eine direkte oder indirekte Interaktion von Region 1 mit dem Zielmolekül erzeugt eine Veränderung von Region 2 oder Region 3 und verändert damit die Affinität oder Interaktion zwischen Region 2 und Region 3 bzw. der kompletten Mediator-Sonde.

Es war völlig überraschend, dass ein Mittel zur Verfügung gestellt wird, das universell einsetzbar ist und insbesondere zur Minimierung der Kontaminationsfälle bei molekularbiologischen Nachweismethoden beiträgt. Es wird mittels einer biochemischen Reaktion eine Detektion verschiedener Moleküle, bevorzugt auf einem universellen Detektions-Chip mit standardisierten Fängermolekülen erzielt. Dies wird insbesondere dadurch ermöglicht, dass die direkte, physikalische Wechselwirkung zwischen Zielmolekül und immobilisierten Nachweismolekül aufgehoben wird. Eine Detektionssonde, die im Sinne der Erfindung insbesondere als Mediator-Sonde bezeichnet wird, fungiert als Übermittler (Informationsträger) zwischen Ziel- und Nachweismolekül. Durch Interaktion mit dem Zielmolekül wird die Mediator-Sonde (in Anwesenheit von weiteren Hilfsmolekülen) bevorzugt gespalten und setzt ein aktiviertes Mediator-Molekül frei, welches eine Nachweisreaktion initiiert.

Im Sinne der Erfindung beschreibt ein abasisches Nukleotid insbesondere einen DNA-Baustein, dessen Desoxyribose nicht an eine Base verknüpft ist und somit nur ein Phosphat-Zucker-Rückgrat darstellt. In DNA-Duplexen erfolgt an dieser Position keine Wasserstoffbrückenbildung. Diese Modifikation kann unter Verwendung von Tetrahydrofuran (THF) synthetisiert werden.

Der Begriff Amplifikation bezeichnet insbesondere eine Vervielfältigung (eines Nukleinsäuremoleküls).

Aptamer beschreibt im Sinne der Erfindung insbesondere ein Oligonukleotid, das mit Molekülen aus anderen Stoffklassen (z.B. Proteinen) aufgrund ihrer strukturellen Eigenschaften interagieren bzw. an diese binden kann.

Ein Bead kennzeichnet bevorzugt Mikrokugeln mit einem Durchmesser von insbesondere 5–100 µm. Diese können ggf. auf der Oberfläche bzw. im Inneren modifiziert bzw. funktionalisiert vorliegen. Die Verwendung von Beads erlaubt die Bereitstellung großer Oberflächen in einem definierten Reaktionsvolumen.

Fängermolekül bezeichnen im Sinne der Erfindung insbesondere ein Molekül, welches mit einem anderen Molekül (typischerweise mit dem nachzuweisenden Zielmolekül) interagiert.

FRET kennzeichnet bevorzugt einen Fluoreszenz-Resonanz-Energie-Transfer, insbesondere die Energie-Übertragung von einem Donor- zu einem Akzeptor-Molekül.

Der Begriff HDA kennzeichnet vorteilhafterweise eine Helikase-abhängige Amplifikation (Helicase Dependent Amplification, HDA), insbesondere ein isothermers Nukleinsäure-Amplifikationsverfahren, welches typischerweise aus zwei enzymatischen Komponenten besteht. Eine Helikase dient zur Trennung der DNA-Doppelstränge, wobei die DNA-Polymerase zur Synthese der DNA verwendet wird.

Ein Hilfsmolekül bezeichnet insbesondere ein Molekül, welches in Anwesenheit des Zielmoleküls zur Zustandsänderung der Mediator-Sonde beiträgt. Es können verschiedene Hilfsmoleküle aus einer oder verschiedenen Stoffklassen verwendet werden. Beispiele: Enzyme (Polymerasen), Nukleinsäuren (Oligonukleotide). Es ist bevorzugt, dass die, an das Zielmolekül gebundene Sonden-Region durch ein Hilfsmolekül enzymatisch verlängert wird.

Der Begriff LDR steht bevorzugt für eine Ligationsdetektionsreaktion (Ligase Detection Reaction). Nukleinsäureamplifikationsverfahren, bei dem zwei oder mehr an einem Nukleinsäurestrang nebeneinander hybridisierte Oligonukleotide durch Ligation miteinander verknüpft werden. Bei dieser Methode dient das Produkt als Substrat für den nächsten Zyklus.

Die Mediator-Sonde kennzeichnet insbesondere ein Molekül, welches mindestens zwei funktionelle Regionen besitzt, die mit dem Zielmolekül bzw. dem Nachweismolekül interagieren können. Die Mediator-Sonde löst vorteilhafterweise bei Vorhandensein eines Zielmoleküls – ggf. unter Interaktion mit Hilfsmolekülen – eine Nachweisreaktion aus.

Ein Mikroarray bezeichnet bevorzugt eine ortsaufgelöste, mindestens 1-dimensionale Anordnung von immobilisierten Fängermolekülen auf einer geeigneten (typischerweise planaren) Festphase. Alternative Methoden ermöglichen einen Festphasen-gestützten Ansatz unter Verwendung von Beads, die z.B. durch unterschiedliche Färbungen eine eindeutige Diskriminierung erlauben. An eine definierte Bead-Klasse kann ein bestimmtes Fängermolekül immobilisiert werden.

Eine Multiplex-Analyse beschreibt insbesondere einen parallelen Nachweis mehrere Zielmoleküle in einem Reaktionsansatz.

Der Begriff Nachweismolekül kennzeichnet im Sinne der Erfindung insbesondere ein Molekül, mit dem das Zielmolekül direkt oder indirekt interagieren kann und ggf. durch Prozessierung eine Nachweisreaktion (z.B. Änderung eines Fluoreszenzsignals) hervorrufen kann.

Ein Nachweishilfsmolekül beschreibt insbesondere ein Molekül, welches vorteilhafterweise mit Mediator und Nachweismolekül interagiert, wobei bevorzugt eine Nachweisreaktion ausgelöst wird. Es können verschiedene Hilfsmoleküle aus einer oder verschiedenen Stoffklassen verwendet werden.

Nested PCR bezeichnet bevorzugt eine verschachtelte PCR (Nukleinsäureamplifikations-Variante), wobei zwei Primer-Paare verwendet werden. Das äußere Primer-Paar dient zur Voramplifikation der Zielsequenz, das innere Primer-Paar zur Hauptamplifikation. Das Verfahren erhöht die Spezifität des Nachweises.

Der Begriff NOC-PCR beschreibt insbesondere eine spezielle Ausführung der PCR, nämlich die nested on-chip PCR, wobei neben den Primern in Flüssigphase auch mindestens ein Primer auf einer geeigneten Oberfläche immobilisiert ist, der innerhalb des amplifizierten Bereichs bindet.

PCR kennzeichnet insbesondere die Polymerase Kettenreaktion (Polymerase Chain Reaction). Verfahren, bei welchem ein von Primermolekülen begrenzter Nukleinsäureabschnitt exponentiell amplifiziert wird. Dabei wird der Reaktionsansatz zyklisch erhitzt und abgekühlt.

Ein Primer beschreibt bevorzugt ein Oligonukleotid, welches typischerweise komplementär zu einem Abschnitt der zu amplifizierenden Nukleinsäure ist und diesen Abschnitt begrenzt. Typischerweise werden zwei Primer, die ein Amplikon definieren, als Forward Primer und Reverse Primer bezeichnet. Da die Polymerisation vom 5’-Terminus in Richtung 3’-Terminus durchgeführt wird, benötigt ein Primer einen 3’-OH-Terminus, an die Polymerase die weiteren Nuklepotide kovalent verknüpft.

Der Begriff PTO steht bevorzugt für Phosphothioat, nämlich einer Verknüpfung zweier Nukleotide, in deren Phosphodiesterbindung ein Sauerstoffatom durch ein Schwefelatom ausgetauscht wurde. Durch diese Modifikation werden Nukleotidverbindung weniger anfällig für enzymatische Nuklease-Aktivität.

RCA kennzeichnet vorteilhafterweise ein isothermes Nukleinsäureamplifikationsverfahren, welches lineare Konkatamere eines zirkulären DNA-Moleküls generiert (Rolling Circle Amplification).

Reaktionseffizienz beschreibt bevorzugt die Effizienz, mit der eine Amplifikationsreaktion durchgeführt wurde. Unter idealen Bedingungen wird in jedem Zyklus das Substrat verdoppelt, wobei die Reaktionseffizienz 100% beträgt.

Der Begriff Reportersystem beschreibt insbesondere eine Kombination von mindestens zwei Molekülen, welche die Detektion eines spezifischen Zielmoleküls ermöglichen. Die Detektion erfolgt typischerweise über Fluoreszenz, Lumineszenz, Phosphoreszenz und Chemilumineszenz, ist aber nicht darauf beschränkt.

SDA beschreibt vorteilhafterweise eine Einzelstrangverdrängungs-Reaktion, nämlich ein isothermes Verfahren zur Amplifikation von Nukleinsäuren (Strand Displacement Amplification).

Der Begriff SNP kennzeichnet bevorzugt eine Punktmutation (Single Nucleotide Polymorphism), nämlich einen Nukleotidaustausch innerhalb einer Nukleotidabfolge.

Sonde Molekül, welches typischerweise mit dem Zielmolekül interagiert. Die Sonde kann immobilisiert an einer Festphase oder in der flüssigen Phase vorliegen.

Der Begriff STR steht bevorzugt für repetitive Abschnitte (typischerweise 3 bis 5 Basenpaare) im Genom (short tandem repeats).

Im Sinne der Erfindung bezeichnet TIRF bevorzugt totale innere Reflexionsfluoreszenz (Total Internal Reflection Fluorescence).

Universelle Arrays In der Regel Nukleinsäure-Mikroarray, dessen Sondensequenzen unabhängig vom Zielmolekül wählbar sind.

WGA steht vorzugsweise für die Amplifzierung eines Genoms (Whole Genome Amplification) mit Hilfe Primer zufälliger Sequenz typischerweise unter isothermern Bedingungen.

Das Zielmolekül umfasst im Sinne der Erfindung insbesondere ein Biomolekül, ausgewählt aus der Gruppe umfassend DNA, RNA, Protein, Aptamer und/oder ein Komplex aus Aptamer und assoziierter DNA, RNA, Protein oder einer Kombination hieraus, welches in einer Probenlösung nachgewiesen werden soll und auch Teile des Moleküls (Erkennungssequenzen, Epitope). Eine Kombination der Zielmoleküle kann im Sinne der Erfindung insbesondere auch als Gemisch bezeichnet werden. Überraschenderweise können Moleküle verschiedener Stoffklassen (z.B. Protein und DNA) einzeln oder parallel in einem Ansatz detektier werden, so dass ein universell einsetzbares Mittel zur Verfügung steht.

Das Zielmolekül kann auch cDNA umfassen, welche mittels Reverse-Transkription unter Verwendung von ggf. mit 5‘-Sequenzüberhang modifizierten Primern generiert werden kann. Auch ein Komplex aus Aptamer und assoziiertem Zielmolekül oder ein Interaktionsprodukt aus zwei oder mehreren Stoffklassen, wie zum Beispiel Nukleinsäuren und Proteine können als Zielmolekül verwendet werden. Dabei lassen sich verschiedene Zielmoleküle in einem Reaktionsansatz einzeln oder parallel nachweisen. Es ist bevorzugt, dass die Mediator-Sonde aus einem Oligonukleotid oder einem entsprechenden Derivat besteht, das Zielmolekül eine Nukleinsäure, ein entsprechendes Derivat oder ein Molekül umfassend DNA, RNA, Protein, Aptamer und/oder ein Komplex aus Aptamer und assoziierter DNA, RNA oder Protein darstellt und das Nachweismolekül ein Oligonukleotid oder davon abgeleitetes Derivat ist.

Die Mediator-Sonde ist bevorzugt ein lineares Oligonukleotid und weist 1 bis 70, bevorzugt 15 bis 60, besonders bevorzugt 35 bis 45 Nukleotide auf. Die Sonde ist in mindestens zwei funktionell verschiedene Regionen untergliedert (siehe hierzu 2). Der 3’-terminale Bereich – Region 1 – ist affin bzw. komplementär zu einem Bereich des Zielmoleküls. Die Region 1 kann im Sinne der Erfindung insbesondere als Sonden-Region oder Hybridisierungssequenz bezeichnet werden. Der 5’-Terminus – Region 2 – ist nicht komplementär bzw. affin zum Zielmolekül, aber komplementär bzw. affin zu einem spezifischen Nachweismolekül, welches bevorzugt immobilisiert an einer Festphase vorliegt. Die Region 2 kann im Sinne der Erfindung bevorzugt als Mediator-Region bezeichnet werden. Die Spezifität der Reaktion wird durch Region 1 der Mediator-Sonde erreicht, welche mit dem Zielmolekül interagiert. Die Mediator-Sonde weist eine potentielle Spaltstelle zwischen Region 1 und Region 2 auf.

Die Interaktion des Zielmoleküls mit der Mediator-Sonde führt bevorzugt zu einer direkten oder indirekten Spaltung der Mediator-Sonde, wobei bevorzugt folgende Spaltfragmente erzeugt werden:

  • – ein Fragment aus Region 2 und ein Fragment aus Region 1 oder
  • – Region 2 und ein Fragment aus Region 1 oder
  • – Region 2 und einen Bereich von Region 1 als ein zusammenhängendes Fragment und ein Fragment aus Region 1 oder
  • – ein Fragment aus Region 2, Region 3 bzw. ein Fragment aus Region 3 und ein Fragment aus Region 1 oder
  • – Region 2 sowie Region 3 bzw. ein Fragment aus Region 3 und ein Fragment aus Region 1 oder
  • – Region 2 und einen Bereich von Region 1 als ein zusammenhängendes Fragment sowie Region 3 bzw. ein Fragment aus Region 3 und ein Fragment aus Region 1.

Es war überraschend, dass Zielmoleküle (Analyten), insbesondere Biomolekülen wie Nukleinsäuren oder Proteinen, durch direkte oder indirekte Interaktion mit einem speziellen, signalübertragenden Molekül (Mediator-Sonde) nachgewiesen werden können. Bei der Interaktion des Zielmoleküls mit der Mediator-Sonde wird in einer direkten oder indirekten Aktivierungsreaktion die Mediator-Sonde in Sonden-Fragment und Mediator gespalten. Der aktivierte Mediator löst eine direkte oder indirekte Nachweisreaktion aus, in der ein oder mehrere Nachweismoleküle verändert werden. Die Anwesenheit des Zielmoleküls löst vorteilhafterweise eine Aktivierungsreaktion der Mediator-Sonde aus. Die Aktivierungsreaktion, welche die Mediator-Sonde in den Mediator überführt, kann bevorzugt enzymatischer, katalytischer oder physikalischer Natur sein, ferner kann sie bevorzugt parallel zur Amplifikation des Zielmoleküls erfolgen. Bei direkten Interaktionen zwischen Zielmolekül und Mediator-Sonde erzeugt die Anwesenheit des Zielmoleküls aus der Mediator-Sonde den Mediator. Bei indirekten Interaktionen induziert das Zielmolekül, insbesondere eine Nukleinsäure, eine Wechselwirkung mit der Mediator-Sonde und einem Hilfsmolekül, insbesondere einem Oligonukleotid, welches strukturell nicht mit der Mediator-Sonde interagiert. Das beschriebene Hilfsmolekül fungiert als Primer und wird dabei durch ein andersartiges Hilfsmolekül, insbesondere eine geeignete Polymerase, verlängert, worauf die Mediator-Sonde nach struktureller Interaktion mit der Polymerase in Mediator und Sonden-Fragment gespaltet wird. Der Mediator entsteht aus der Mediator-Sonde somit in Anwesenheit des Zielmoleküls. Die Hilfsmoleküle sind vorzugsweise ausgewählt aus der Gruppe umfassen Katalysatoren, Proteine, Nukleinsäuren, Naturstoffe, Enzyme, Enzym-Systeme, Zell-Lysate, Zell-Bestandteile, daraus abgeleitete Derivate oder synthetische Moleküle oder eine Mischung hieraus. Die Nachweishilfsmoleküle sind bevorzugt aus verschiedenen Stoffklassen, wie Katalysatoren, Proteinen, Nukleinsäuren, Naturstoffen, Enzymen, Enzym-Systemen, Zell-Lysaten, Zell-Bestandteilen, daraus abgeleitete Derivaten oder synthetischen Molekülen oder einer Mischung aus verschiedenen Molekülen dieser Stoffklassen ausgewählt. Es ist bevorzugt, dass die Hilfsmoleküle, Moleküle aus einem Nukleinsäureamplifikationssystem und/oder einem Restriktionsenzymsystem umfassen. Ferner ist bevorzugt, dass das Nachweishilfsmolekül strukturspezifisch spaltet. Die Region 1 der Mediator-Sonde kann bevorzugt mit dem Zielmolekül durch Basenpaarung interagieren und ein Hilfsmolekül Region 2 von Region 1 bzw. Fragmente von Region 1 oder Region 2 abspalten, wobei Region 2 mit einem Nachweismolekül durch Basenpaarung interagiert und ein Nachweishilfsmolekül Bestandteile des Nachweismoleküls abspaltet, wobei diese Abspaltungsreaktion als indirekter Nachweis für das Zielmolekül dient. Der abgespaltene Bestandteil des Nachweismoleküls kann vorzugsweise einen Fluoreszenzdonor oder einen Fluoreszenzakzeptor darstellen.

Es kann jedoch auch bevorzugt sein, dass das Nachweishilfsmolekül sequenzspezifisch spaltet. Hierbei sind die Hilfsmoleküle ein Nukleinsäureamplifikationssystem und das Nachweishilfsmolekül ein Restriktionsenzymsystem oder eine Mischung aus einem Nukleinsäureamplifikationssystem und einem Restriktionsenzymsystem. Das Nachweismolekül ist ein Oligonukleotid oder ein Derivat und enthält die entsprechende Erkennungssequenz für das Restriktionsenzymsystem. Hierbei bindet der Mediator an das Nachweismolekül an den komplementären Abschnitt und wird durch das Nukleinsäureamplifikationssystem verlängert. Der generierte Sequenzduplex enthält somit mindestens ein Erkennungssequenzmotiv des Restriktionsenzymsystems, welches diesen in mindestens zwei Teile spaltet. Nach der Spaltung des Sequenzduplex kann bevorzugt ein Signal, zum Beispiel die Änderung der Fluoreszenz oder der Masse, detektiert werden. Es kann jedoch auch vorteilhaft sein, wenn nach Spaltung des Sequenzduplex mindestens ein Spaltfragment eine Amplifikationsreaktion mit vorliegenden komplementären oder teilkomplementären Nukleinsäuresequenzen initiieren kann, wobei besagte Nukleinsäuresequenzen frei in Lösung oder an einer Festphase immobilisiert vorliegen können.

In einer bevorzugten Ausführungsform kann die Amplifikation durch Inkorporation von Fluoreszenz- oder anderweitig markierter Nukleotide oder durch Anlagerung sequenzspezifischer, fluorogener oder chromogener Sonden oder durch Anlagerung eines sequenzunspezifischen Fluoreszenzfarbstoffes detektiert werden. Die Amplifikationsprodukte können vorteilhafterweise direkt oder indirekt nachgewiesen werden, wobei die Detektion als indirekter Nachweis für das Zielmolekül dient.

Der freigesetzte Mediator kann bevorzugt in Anwesenheit einer geeigneten Nukleinsäure durch eines oder mehrerer verschiedener Enzyme, wie zum Beispiel Polymerasen, eine enzymatisch-katalysierte Amplifikations- oder Polymerisationsreaktion initiieren. Dabei kann die geeignete Nukleinsäure einzel- oder doppelsträngig vorliegen und in der Nachweisreaktion zusätzlich ein gegenläufiger Primer (Reverse Primer) verwendet werden.

Die Anwesenheit des Mediators löst bevorzugt eine Nachweisreaktion aus. Die Kopplung zwischen Zielmolekül und Nachweisreaktion hängt dabei nur von den Eigenschaften des Mediators bzw. der Mediator-Sonde ab und erlaubt somit eine freie Kopplung zwischen einem beliebigen Zielmolekül und einer beliebigen Nachweisreaktion bzw. Nachweismolekül. Bei einer direkten Nachweisreaktion des Mediators verändert der Mediator direkt das Nachweismolekül. Bei einer indirekten Nachweisreaktion induziert der Mediator durch Interaktion mit Nachweishilfsmolekülen, insbesondere einer Polymerase, welche den Mediator verlängert, die Veränderung des Nachweismoleküls. Vorteilhafterweise verursacht der Mediator während der Nachweisreaktion eine Veränderung des Nachweismoleküls und erfährt durch geeignete Nachweishilfsmoleküle selbst eine Änderung, womit ein Mediator, der in der Nachweisreaktion verändert wurde, von einem Mediator, der unmittelbar aus einer Mediator-Sonden-Spaltung hervorgegangen ist, eindeutig unterschieden werden kann. Die genannten Nachweismoleküle wechselwirken nicht physikalisch mit den genannten Zielmolekülen. Eine Kopplung zwischen Zielmolekül und Nachweismolekül erfolgt indirekt über die entsprechenden Mediator-Sonden. Durch die Verwendung der Mediator-Sonde erfolgt eine freie Zuordenbarkeit eines Zielmoleküls zu einem beliebigen Nachweismolekül. Die Nachweismoleküle können an einer Festphase immobilisiert vorliegen und einen universellen Detektionsmikroarray darstellen, welcher für verschiedenartige Nachweise verwendet werden kann.

Findet eine Interaktion zwischen Zielmolekül und Mediator-Sonde statt, erfolgt in Anwesenheit von weiteren Molekülen und Hilfsmolekülen eine enzymatisch-prozessierte Spaltung der Mediator-Sonde, wobei ein Mediator-Molekül freigesetzt und die Hybridisierungssequenz fragmentiert wird (3). Der Mediator weist durch dieses Spaltungsereignis einen 3’-OH-Teminus auf, welcher für die anschließende Nachweisreaktion erforderlich ist. Daher dient der abgespaltene Mediator als Informationsträger für die Anwesenheit des Zielmoleküls im Reaktionsmedium. In Gegenwart von Nachweishilfsmolekülen kann der Mediator in einem weiteren Schritt an einem spezifischen Nachweismolekül eine Signal-generierende Reaktion auslösen, deren Detektion als indirekter Nachweis für das Zielmolekül dient. Um die Sensitivität des Nachweises zu erhöhen, kann die Spaltung der Mediator- Sonde bevorzugt an eine parallel erfolgende Amplifizierung des Zielmoleküls gekoppelt werden. Die unerwünschte, enzymatischkatalysierte Sequenzverlängerung der ungespaltenen Mediator-Sonde wird bevorzugt dadurch verhindert, dass die Mediator-Sonde am 3’-Terminus der Sonden-Region eine chemische Schutzgruppe aufweist. Die chemische Schutzgruppe kann ausgewählt sein aus der Gruppe umfassend Phosphatgruppe, Biotin, invertiertes Nukleotid, Nukleotide, die nicht komplementär zur Zielsequenz sind. Dem Fachmann sind weitere chemische Schutzgruppen bekannt, die eine Verlängerung einen Oligonukleotides, insbesondere des 3‘-Terminus verhindern können. Eine Detektion des Mediators erfolgt mit Hilfe einer Nachweisreaktion. Der Reaktionsmechanismus (siehe 4) kann parallel zu der beschriebenen Amplifikation des Zielmoleküls erfolgen.

In einer bevorzugten Ausführungsform betrifft die Erfindung ein System umfassend eine Mediator-Sonde und ein Nachweismolekül, wobei das Nachweismolekül ein Oligonukleotid ist und mindestens folgende Regionen aufweist:

  • a. eine Region an einem 5’-Terminus des Nachweismoleküls, die einen Fluoreszenzakzeptor oder einen -donor und/oder eine chemische Gruppe zur Bindung an eine Festphase und/oder eine chemische Schutzgruppe aufweist,
  • b. eine weitere Region, die mit der Mediator-Region interagiert,
  • c. eine dritte Region, die einen Fluoreszenzdonor oder einen -akzeptor aufweist und
  • d. eine vierte Region an einem 3’-Terminus des Nachweismoleküls, die eine chemische Gruppe zur Bindung an eine Festphase und/oder eine chemische Schutzgruppe aufweist.

Beispielhaft sind mögliche chemische Gruppen zur Immobilisierung eines Oligonukleotids aufgelistet. Die chemische Gruppe ist abhängig von der verwendenden Oberflächenchemie und evtl. benötigten Kopplungsmolekülen: -OH (Hydroxyl), -NH2 (Amino), -Ph (Phosphat), -Acrydite oder -Silan. Dem Fachmann sind Methoden bekannt, um Oligonukleotide an einer Oberfläche zu immobilisieren. Um insbesondere eine putative Immobilisierung des 5‘-Terminus zu ermöglichen, weist das Nachweismolekül eine chemische Gruppe und/oder eine chemische Schutzgruppe auf.

Das Nachweismolekül ist bevorzugt ein einzelsträngiges Nukleinsäuremolekül oder ein Nukleinsäurederivat. Das Nachweismolekül ist vorzugsweise eine Nukleinsäure und verfügt über eine oder mehrere gleichartige oder verschiedene Modifikationen (beispielsweise abasische Nukleotide und/oder Phosphothioate und/oder funktionelle Gruppen wie Fluoreszenzfarbstoffe). Vorteilhafterweise erfolgt eine Änderung des Nachweismoleküls durch direkte oder indirekte Interaktion mit dem Mediator und kann eine oder mehrere Änderungen der Fluoreszenz, Phosphoreszenz, Masse, Absorption, Streuung des Lichts, elektrischen Leitfähigkeit, enzymatischen Aktivität oder der Affinität betreffen und dadurch physikalisch erfassbar werden. In Anwesenheit des Mediators kann das Nachweismolekül bevorzugt eine chemische Modifizierung, wie z.B. Phosphorylierung, Dephosphorylierung, Amidierung, Anbindung oder Abspaltung einer chemischen Gruppe, Fluoreszenz-, Phosphoreszenz- oder Lumineszenzänderung erfahren.

Ein Nachweismolekül besteht in einer bevorzugten Ausführungsform aus einem Oligonukleotid, welches in sechs Regionen unterteilt ist (siehe 4). Region 1 umfasst den 5’-Terminus des Nachweismoleküls, welcher in einer bevorzugten Ausführungsform aus einem Sequenzabschnitt und einem Fluoreszenzakzeptor Q besteht. Region 3 ist eine revers-komplementäre Sequenzabfolge von Region 1 und wird durch Region 2 davon abgetrennt. Region 4 trennt Region 3 und Region 5, welche spezifisch mit einem Mediator-Molekül interagieren kann. Region 6 umfasst den 3’-terminalen Sequenzbereich, welcher bevorzugt über eine chemische Modifikation verfügt und somit eine gerichtete Immobilisierung des Oligonukleotids ermöglicht. Ein Fluoreszenzdonor F ist in dem Fachmann bekannter Weise an einen Bereich der Region 2 bis Region 6, beispielsweise Region 4, assoziiert. Es ist bevorzugt, dass das Nachweismolekül eine Haarnadel-Struktur aufweist. Region 1 und Region 3 des Nachweismoleküls bilden unter Reaktionsbedingungen eine definierte Sekundärstruktur (im Sinne der Erfindung als Haarnadel-Struktur bezeichnet), bei welcher der 5’-Terminus mit einem internen Sequenzabschnitt hybridisiert. Bevorzugt ist, dass die Haarnadel-Struktur ausgebildet ist, indem der 5’-Terminus des Nachweismoleküls mit einem internen Sequenzabschnitt komplementär hybridisiert und der 3’-Terminus des Nachweismoleküls einen ungepaarten Sequenzabschnitt umfasst. Nach Anlagerung des Mediators an einen Sequenzbereich des ungepaarten 3’-Sequenzabschnitt wird der Mediator durch eine Polymerase verlängert, wobei Nukleotide des 5’-Terminus der Haarnadelstruktur des Nachweismoleküls aufgrund der Nuklease-Aktivität der Polymerase entfernt werden. Nach Ausbildung dieser Struktur interagieren Fluoreszenzdonor F und Fluoreszenzakzeptor Q miteinander, wobei das Fluoreszenzsignal von F unterdrückt wird (Fluoreszenz-Resonanz-Energietransfer, FRET). Es ist bevorzugt, dass die Mediator-Sonde und/oder das Nachweismolekül fluoreszenzmarkierte Nukleotide aufweisen. Insbesondere ist es bevorzugt, dass das Nachweismolekül mindestens eine Fluoreszenz-Modifikationen am 5’-Terminus und/oder innerhalb der Haarnadelstruktur aufweist. Das Nachweismolekül weist eine oder mehrere Fluoreszenz-Modifikationen auf, die zu einem Fluoreszenz-Resonanz-Energie-Transfer befähigt sind und die nach der Abspaltung räumlich voneinander getrennt werden können, woraus eine Änderung des Fluoreszenzsignals detektiert werden kann.

Es können vorteilhafterweise sequenzspezifische oder -unspezifische, fluorogene und/oder chromogene Sonden oder Fluoreszenzfarbstoffe mit mindestens einer Region der Mediator-Sonde und/oder dem Nachweismolekül interagieren. Weiterhin kann vorteilhaft sein, wenn das Nachweismolekül über mindestens eine Fluoreszenz-Modifikationen am 5’-terminalen Bereich und/oder innerhalb der Haarnadelstruktur verfügt und nach der Reaktion mit der Mediator-Region mittels eines Hilfsmoleküls von dem Nachweismolekül die Fluoreszenz-Modifikationen abgespalten und/oder der 5’-Terminus der Haarnadelstruktur des Nachweismoleküls entfernt wird und eine Änderung des Fluoreszenzsignals am Nachweismolekül detektiert wird.

Das Nachweismolekül kann außerdem in einer bevorzugten Ausführungsform über eine oder mehrere Fluoreszenz-Modifikationen am 5’-terminalen Bereich und/oder innerhalb der Haarnadelstruktur verfügen, wobei nach der Prozessierung des hybridisierten Mediators mithilfe eines geeigneten Enzyms von diesem Nachweismolekül die 5’-terminalen Nukleotide abgespalten und eine Änderung des Fluoreszenzsignals am Nachweismolekül detektiert werden kann. Der freigesetzte Mediator interagiert vorzugsweise mit mindestens einem frei in der Lösung vorliegenden oder an einer Festphase immobilisierten Nachweismolekülkomplex, wobei aus zwei oder mehreren gleichartigen oder verschiedenen Molekülen wie z.B. Peptid, Nukleinsäure, ein von den genannten Gruppen abgeleitetes Derivat oder anderes Molekül, erfolgen kann. Der Nachweismolekülkomplex kann über eine bis mehrere verschiedene oder gleichartige chemische Modifizierungen verfügen und nach der Interaktion mit dem Mediator ein detektierbares Signal generieren. Es ist bevorzugt, dass durch eine indirekte oder direkte Interaktion der Mediator-Region mit der zweiten Region des Nachweismoleküls eine physikalisch oder chemisch messbare Veränderung des Nachweismoleküls erfolgt. Diese Region kann erst nach der Spaltung der Mediator-Sonde ein Signal auslösen. Die Region 2 der Mediator-Sonde löst bevorzugt -soweit sie noch assoziiert an die Mediator-Sonde vorliegt- kein Signal aus, weder direkt (z.B. Hybridisierung) noch indirekt (z.B. Prozessierung durch Polymerase), da sonst eine Zielmolekülunabhängige Signalentstehung erfolgt. Diese messbare Veränderung kann auch durch die Hilfsmoleküle (z. B. Polymerase) hervorgehen.

In einem weiteren Aspekt betrifft die Erfindung ein Verfahren zum Nachweis von mindestens einem Zielmolekül, umfassend ein System, umfassend folgende Schritte:

  • a. komplementäre Bindung der Sonden-Region der Mediator-Sonde an eine Sequenz des Zielmoleküls oder eines Aptamers. Ein Aptamer ist im Sinne der Erfindung eine einzelsträngige Nukleinsäure, welche eine erhöhte Bindungsaffinität für andere Moleküle, z.B. Proteine, zeigt. Ein bevorzugtes Aptamer besitzt zusätzlich terminale Regionen „Region 1“ und „Region 2“, die miteinander interagieren können (im Sinne der Erfindung als geschlossene Form bezeichnet). Davon begrenzt sind zwei Regionen, wobei „Region 3“ die Affinität für das Zielmolekül besitzt und die „Region 4“ eine Bindesequenz für ein Primermolekül und eine Mediator-Sonde darstellt. „Region 4“ erlaubt nur eine Bindung des Primers und der Mediator-Sonde, sofern „Region 3“ mit dem Zielmolekül interagiert bzw. assoziiert ist.
  • b. Spaltung der Mediator-Sonde an der Spaltstelle zwischen der Sonden-Region am 5’-Terminus und der Mediator-Region am 3’-Terminus durch Hilfsmoleküle, und
  • c. komplementäre Bindung der abgespaltenen Mediator-Region der Mediator-Sonde an die zweite Region des Nachweismoleküls.

Es war überraschend, dass die Spaltung der Mediator-Sonde eine Veränderung der physikalischen und/oder chemischen Eigenschaften mindestens einer Region der Mediator-Sonde bewirkt, ausgewählt aus der Gruppe umfassend:

  • a. molekulare Masse (nach Spaltung der Sonde unterscheiden sich die Spaltfragmente von der Mediator-Sonde),
  • b. enzymatische Aktivität (Die Sonde ändert vorteilhafterweise ihre Eigenschaft eine Nachweisreaktion initiieren zu können – Vorhandensein eines freien 3‘ Endes),
  • c. Bindungseigenschaften umfassend Affinität oder Avidität,
  • d. chemische Reaktivität (Nach Spaltung der Mediator-Sonde besitzt das Spaltfragment, welches die Region 2 der Mediator-Sonde enthält, eine Hydroxyl-Gruppe am 3‘-Ende, welches durch ein Hilfsmolekül (z. B. Polymerase) verlängert werden kann. Dies ist für die ungespaltene Sonde nicht möglich),
  • e. Vorhandensein chemischer Gruppen,
  • f. elektrischer Eigenschaft umfassend Leitfähigkeit, Polarisierbarkeit oder Ladung und/oder
  • g. optischer Eigenschaft umfassend Absorption und Emission von Licht (Sofern die Mediator-Sonde mit mindestens einem Fluoreszenzfarbstoff markiert ist, kann bevorzugt nach der Spaltung ein verändertes Fluoreszenzsignal detektiert werden).

Die Mediator-Region, die im Sinne der Erfindung insbesondere als Mediator bezeichnet werden kann, liegt nach der Spaltung vorteilhafterweise diffusiv in der Reaktionslösung vor und kann mit der Mediator-Hybridisierungssequenz (Region 5) des Nachweismoleküls interagieren (siehe 5i) + ii)). Das Nachweismolekül kann bevorzugt an eine Festphase gebunden oder frei in einer Lösung vorliegen. Hierdurch kann ein universeller Detektionsarray bereitgestellt werden. Durch ein geeignetes Hilfsmolekül (z.B. ein Enzym, insbesondere eine Polymerase) erfolgt eine Elongation des Mediators, wobei Region 1 des Nachweismoleküls sequentiell abgebaut wird. Dabei wird das Nachweismolekül bevorzugt durch Abspaltung des 5’-Terminus und den damit assoziierten Fluoreszenzakzeptors Q, verändert und das zuvor unterdrückte Fluoreszenzsignal des Fluoreszenzdonors F wiederhergestellt (siehe 5iii) + iv)). Wird durch die Abspaltung die Interaktion von Region 1 und Region 3 unterbunden, wird die Ausbildung der Sekundärstruktur aufgehoben. In diesem Fall kann der Mediator durch das beschriebene Hilfsmolekül unter bestimmten Bedingungen bis zum neu entstehenden 5’-Terminus des Nachweismoleküls komplementär verlängert werden (siehe 5v) + vi)). Durch diese vollständige Elongation besitzt der verlängerte Mediator einen Sequenzabschnitt, der komplementär zu Region 1 und Region 2 des Nachweismoleküls ist.

In einer bevorzugten Ausführung erfolgt die serielle Interaktion des Mediators mit mehreren gleichartigen Nachweismolekülen, womit eine Signalverstärkung erfolgt. Dies erhöht die Sensitivität der Nachweisreaktion. Bei dieser Ausführung werden vorteilhafterweise modifizierte Nukleotide für die Synthese des Nachweismoleküls verwendet, die nur einen begrenzten 5’-Terminusabbau während der Nachweisreaktion erlauben. Dies kann durch den Einbau einer oder mehrerer Phosphothioat-Modifikationen (PTO) beispielsweise am vorletzten Nukleotid des 5’-Terminus während der Synthese des Moleküls erfolgen. Die Position der PTO-Modifikation befindet sich bevorzugt in Region 1, besonders bevorzugt zwischen Fluoreszenzdonor F und Fluoreszenzakzeptor Q. Eine Darstellung bevorzugter Positionen modifizierter Nukleotide ist in 6 dargestellt. Bevorzugte Nachweishilfsmoleküle können PTO-Verbindungen nicht oder nur mit geringer Effizienz spalten, worauf der 5’-Terminus (Region 1) nicht über dieses Nukleotid hinaus abgebaut wird. Folglich wird auch der Mediator nicht weiter verlängert. Durch geeignetes Einstellen der Reaktionsbedingung können das Nachweishilfsmolekül und der Mediator vom Nachweismolekül dissoziieren und für die Aktivierung eines weiteren Nachweismoleküls wieder zur Verfügung stehen.

In einer weiteren bevorzugten Ausführung, die mit der oben beschriebenen PTO-Modifikation kompatibel, aber nicht auf eine kombinierte Anwendung beschränkt ist, wird in Region 3 ein abasisches Nukleotid (Tetrahydrofuran-Modifkation, THF) eingebaut, welches keine Wasserstoffbrücken mit einem komplementären Nukleotid ausbilden kann. Dadurch wird die Verlängerungsreaktion des Mediators an der gegenüberliegenden Position des abasischen Nukleotids unterbunden, worauf das Nachweishilfsmolekül und der verlängerte Mediator vom Nachweismolekül dissoziieren (siehe 7). Die Verwendung einer der bevorzugten Modifikationen ermöglicht die serielle Interaktion eines Mediator-Moleküls mit mehreren Nachweismolekülen, was im Sinne der Erfindung insbesondere als Mediator-Wiederverwendung bezeichnet werden kann. Der Mediator wird bei der ersten Interaktion mit einem Nachweismolekül und erfolgter Prozessierung mittels eines Nachweishilfsmoleküls verlängert und kann auch in diesem verlängerten Zustand mit weiteren Nachweismolekülen interagieren und eine Degradation des 5’-Terminus – und somit auch des Fluoreszenzakzeptors Q – mit Hilfe eines geeigneten Nachweishilfsmoleküls (z.B. Polymerase mit 5’-Nukleaseaktivität) ermöglichen. Dieser Reaktionsmechanismus erlaubt eine Signalamplifikation, da unabhängig von einer Zielmolekülamplifikation ein Signal generiert und verstärkt wird. Wird das Zielmolekül mithilfe geeigneter Hilfsmoleküle amplifiziert und dieser Vorgang an eine Mediator-Sonden-Spaltung gekoppelt, tritt eine Mediator-Akkumulation auf, die eine Zielmolekül-Amplifikation mit einer Signalverstärkung kombiniert und die Nachweisgrenze der Detektionsreaktion um mehrere Größenordnungen verringert. Dies war völlig überraschend und ist nicht im Stand der Technik beschrieben. Außerdem stellt es eine Abkehr vom technisch Üblichen dar. Die Reaktionsbedingungen können vorteilhafterweise nach Ablauf dieses Prozesses, z.B. durch Erhöhen der Reaktionstemperatur, geändert werden, so dass das Enzym, z. B. die Polymerase und der verlängerte Mediator vom Nachweismolekül dissoziiert. Dem Fachmann ist bekannt, dass die Reaktionsbedingungen zyklisch verändert werden können, so dass ein Mediator-Molekül in einer besonders bevorzugten Ausgestaltung der Erfindung mit mehreren gleichartigen Nachweismolekülen interagieren kann. Dadurch entsteht überraschenderweise eine Signalamplifizierung, welche die Sensitivität der Reaktion deutlich erhöht.

Die Nachweisreaktion ist bevorzugt derartig ausgelegt, dass im Gegensatz zum Mediator die ungespaltene Mediator-Sonde keine Signal-generierende Reaktion auslöst und somit keine falsch-positiven Ergebnisse erzeugt werden. Der Mediator, welcher aus der Mediator-Sonden-Spaltung hervorgeht, besitzt einen 3’-OH-Terminus, der für eine Polymerasevermittelte Verlängerungsreaktion besonders vorteilhaft ist. Tritt diese Spaltung nicht auf, ist eine Mediator-Elongation nicht möglich, da die Mediator-Sequenz kovalent mit der Hybridisierungssequenz der Mediator-Sonde verknüpft ist (siehe 8). Zusätzlich kann eine unspezifische Verlängerung des 3’-Terminus der Mediator-Sonde beispielsweise mit einer Phosphatgruppe oder anderen chemischen Gruppen verhindert werden.

Durch das Interaktionsereignis des Mediators mit dem Nachweismolekül entsteht bevorzugt ein lokales, detektierbares (Fluoreszenz-)Signal. Werden ausreichend viele Nachweismoleküle durch die bevorzugte Mediatorverlängerung mit resultierender Abspaltung des 5’-Terminus aktiviert, wird das Signal verstärkt und kann mittels geeigneter (insbesondere optischer) Detektionsvorrichtungen nachgewiesen werden. Dies ermöglicht die Detektion in Anwesenheit des Reaktionsgemisches und bedarf keiner Prozessierungsschritte. Damit besitzt die bevorzugte Ausführungsform die vorteilhafte Eigenschaft, innerhalb eines geeigneten Reaktionsraumes eine Detektion zu erlauben, ohne dieses nach durchgeführter Reaktion öffnen zu müssen. Dies vermeidet die im Stand der Technik beschriebenen Probleme von Mikroarray-Analysen durch Hybridisierungs-, Färbe-, und/oder Waschschritten, welche zusätzlichen Arbeitsaufwand und hohes Kontaminationsrisiko darstellen. Demnach kann die bevorzugte Ausführungsform als Abkehr vom technischen Üblichen bezeichnet werden, da sie ein neues technisches Feld eröffnet und ein im Stand der Technik lang bestehendes Problem löst.

Ergänzend zu den beschriebenen Vorteilen ermöglicht die bevorzugte Ausführungsform das Auslesen der entstehenden Signale zu beliebigen Zeitpunkten der Reaktion. Somit kann eine Echtzeitüberwachung der Reaktion erfolgen, welche z.B. für die Quantifizierung von Nukleinsäureamplifikationen oder Ermittlung der Bindekinetik von Protein-Interaktionen benötigt wird. Damit hebt sich die bevorzugte Ausführungsform vom Stand der Technik ab, in dem typischerweise nur Endpunkt-Bestimmungen erfolgen und daher eine Signaldetektion zu beliebigen Zeitpunkten nicht durchführbar ist.

Multiplex-Analysen bedingen die Detektion mehrerer verschiedener Analyte in einem Reaktionsgemisch. Für die Erhöhung des Multiplexgrads der bevorzugten Reaktion ist die Verwendung von „n“ verschiedenartiger Mediator-Sonden für „n“ unterschiedliche Zielmoleküle bevorzugt. Jedem zu detektierenden Zielmolekül kann in einer bevorzugten Ausführungsform eine Mediator-Sonde zugeordnet werden, deren Region 1 spezifisch mit dem Zielmolekül interagiert. Die Region 2 der jeweiligen Mediator-Sonde, welche nach erfolgter Spaltung den Mediator darstellt, ist nicht affin bzw. komplementär zum Zielmolekül, stellt aber einen spezifischen Interaktionspartner für ein definiertes Nachweismolekül dar. Dadurch ist jedem Zielmolekül indirekt ein Nachweismolekül zugewiesen, dessen Zuordnung durch die Mediator-Sonde erfolgt. Die Detektion verschiedener Zielmoleküle bedingt verschiedenartige Nachweismoleküle. Aufgrund des bevorzugten Aufbaus ist es ausreichend, wenn sich diese Moleküle ausschließlich in Region 5 unterscheiden. Aufgrund beliebiger Sequenzabfolgen innerhalb dieser Region ist der Parallelitätsgrad nahezu beliebig hoch und somit ein Detektionsverfahren für eine Multiparameter-Analyse gegeben. Es ist somit bevorzugt, das System als Detektionsverfahren für eine Multiparameter-Analyse zu verwenden. Das System kann bevorzugt zur Detektion von einem oder mehreren gleichartigen oder verschiedenen Biomolekülen in einem Gemisch verwendet werden. Außerdem kann das System vorteilhafterweise zur Amplifikation von mindestens einem oder insbesondere mehreren Zielmolekülen verwendet werden, wobei es sich vorteilhafterweise um nicht identische Zielmoleküle handelt. Es kann weiterhin bevorzugt sein, das System unter Verwendung der Aktivität eines Restriktionsenzyms zu verwenden, wobei das Nachweismolekül über eine chemische Schutzgruppe am 3‘-terminalen Bereich verfügt, die nach der Reaktion mit der Mediator-Region mittels eines Hilfsmoleküls von dem Nachweismolekül abgespalten wird und eine 3‘-terminale OH-Gruppe generiert wird.

Da Region 1 und Region 2 der Mediator-Sonde bevorzugt unabhängig voneinander frei kombiniert werden können, kann ein Nachweismolekül auch mit einem anderen Zielmolekül korreliert werden, indem die passende Region 2 (Mediator) mit einer beliebigen Region 1 der Mediator-Sonde verknüpft und synthetisiert wird. Das erfindungsgemäße Verfahren erlaubt daher die Zielmolekül-unabhängige Gestaltung des Nachweismoleküls. Somit können mit einem standardisierten Satz von Nachweismolekülen unterschiedliche Zielmoleküle in einer Probe nachgewiesen werden, wodurch die Reaktion kostengünstig durch Anpassen der Mediator-Sonde und Verwendung geeigneter Hilfsmoleküle (z.B. Primer oder Aptamere) an das jeweilige Zielmolekül adaptiert werden kann. Durch diese vorteilhafte Eigenschaft wird das im Stand der Technik beschriebene Problem der typischerweise direkten Korrelation zwischen Zielmolekül und immobilisierten Fängermolekül gelöst.

In einer erfindungsgemäßen Problemlösung wird die Mediator-Sonde mit der zu untersuchenden Probe zu den in einer Einweg-Reaktionskartusche immobilisierten Nachweismolekülen appliziert, in geeigneter Weise prozessiert und detektiert. Die Reaktionskartusche kann anschließend kontaminationsfrei entsorgt werden. Des Weiteren kann ein Amplifikationsschritt im Reaktionsgefäß vorgeschaltet bzw. parallel zur Detektion durchgeführt werden, womit ggf. eine spezifische Anreicherung des Zielmoleküls erfolgen kann. Dadurch wird das Transferieren von Reaktionsansätzen mit hoher Zielmolekül-Konzentration (z.B. post PCR-Ansätze) aus einem Amplifikations- in einen Detektionsbereich und den damit entstehenden Arbeitsschritten und Kontaminationsrisiken überflüssig.

Die Erfindung betrifft ferner ein Prozessierungsgerät und ein mikrofluidische Reaktionskartusche zur Verwendung des Verfahrens oder des Systems. Die Kartusche weist mindestens eine Reaktionskammer auf, in der insbesondere ein universelles Detektionsarray vorliegt, welches vorzugsweise aus einer örtlich aufgelösten Anordnung eines oder mehreren Nachweismolekülen besteht.

Das Prozessierungsgerät unterzieht bevorzugt die Kartusche und Reaktionsflüssigkeit bei einer konstanten Temperatur bzw. einem definierten Temperaturverlauf (Heizen und/oder Kühlen). Das Prozessierungsgerät kann die Änderung des Nachweismoleküls durch ein bevorzugtes System oder Verfahren detektieren. Hierfür kann beispielsweise ein Fluoreszenzsignal verwendet werden. Zusätzlich kann das Gerät mittels aktiver oder passiver Elemente einen Flüssigkeitstransport innerhalb der Reaktionskartusche ermöglichen. Die oben dargelegten Ausführungen sind auf die Mediator-Sonde, das System und das Verfahren zu beziehen.

Vorteile der Erfindung umfassen:

  • – Entwicklung einer neuartigen Flüssigphasenreaktion, die die Abhängigkeit von Ziel- und Nachweismolekül entkoppelt und in Verbindung mit einem standardisierten Mikroarrays nahezu jedes beliebige Zielmolekül detektiert.
  • – Kombination aus neuartiger Flüssigphasenreaktion und universellem Mikroarray erlaubt den parallelen Nachweis verschiedener Zielmoleküle.
  • – Ein vom Zielmolekül unabhängiger, standardisierter Mikroarray kann für verschiedenste Multianalyt-Analysen verwendet werden, da die spezifische Flüssigphasenreaktion schnell und kostengünstig an das Zielmolekül anpasst werden kann.
  • – Durch die Herstellung eines standardisierten Mikroarrays können verschiedene Experimente mit einer Reaktionskartusche ohne Vor- bzw. Nachprozessierungsschritte durchgeführt werden, wodurch Kosten eingespart und hohe Stückzahlen produziert werden können (Skaleneffekte). Somit lassen sich mit einer Charge der standardisierten Reaktionskartusche verschiedene Nachweisreaktionen (z.B. im Bereich der Routineuntersuchungen) durchführen.
  • – Abhängig von den Reaktionsbedingungen ermöglicht eine Multianalyt-Analyse die parallele Detektion verschiedener Moleküle und Molekülklassen, wie zum Beispiel Proteine und Nukleinsäuren in einem Arbeitsschritt, womit ein kombiniertes DNA-RNA-Protein-Profil einer Probe erstellt werden kann.
  • – Mit einem standardisierten Array-Layout und Adaptierung der Mediator-Sonden kann kostengünstig eine Vielzahl an verschiedenen Zielmolekülen detektiert werden, die den Multiplexing-Grad einer im Stand der Technik beschriebenen PCR-Reaktion potentiell um Größenordnungen übersteigt. Der Multiplex-Grad dieses Verfahrens wird in der Praxis nicht ausgeschöpft werden. Ein Mediator, beispielsweise bestehend aus einem Nukleinsäuremolekül mit einer Länge von 20 Nukleotiden kann rechnerisch 4^20 (~ 1·10^12) mögliche verschiedene Nukleotidabfolgen annehmen.
  • – Die Erfindung erlaubt den Nachweis verschiedener Zielmoleküle in einem geschlossenen Reaktionsgefäß, welches nach Prozessierung ohne Kontaminationsrisiko entsorgt werden kann.
  • – Die Mediator-Sonde besteht aus einem Oligonukleotid, welches ohne technisch komplexe Modifikationen wie zum Beispiel Fluoreszenzdonoren und/oder -akzeptoren kostengünstig synthetisiert werden kann.
  • – Durch Spaltung der Mediator-Sonde wird ein Mediator freigesetzt, welcher außer dem immobilisierten Nachweismolekül keinen Interaktionspartner besitzt. Im Vergleich zu konventionellen Nukleinsäure-basierten Ansätzen besteht somit kein Bedarf, wie im Falle von asymmetrischer PCR oder LATE-PCR, durch zusätzliche Optimierung der Primerverhältnise ein Wiederanlagern (Re-annealing) des nachzuweisenden Stranges zu verhindern. Durch eine Länge von typischerweise 20 bis 25 Nukleotiden besitzt der Mediator eine höhere Diffusionskonstante als durch Amplifikationsmechanismen generierte Nukleinsäurefragmente, welche z.B. für eine Hybridisierungsreaktion generiert werden.
  • – In einer besonders vorteilhaften Ausführung kann eine Nukleinsäure-basierte Amplifikation das Zielmolekül direkt bzw. ein Nachweishilfsmolekül (z.B. Aptamer) indirekt amplifizieren, womit die Sensitivität erhöht wird. Dabei lassen sich Amplifikations- und Nachweisreaktion kombinieren und parallel durchführen. Damit hebt sich die Erfindung deutlich von der im Stand der Technik beschriebenen Invader®-Reaktion ab, bei welcher die Detektion mit linearer Signalamplifikation bzw. eine konsekutive Amplifikation und Detektion durchgeführt wird.
  • – Die Kosten für die Durchführung eines Experiments können reduziert werden, da in einer möglichen Ausführungsform die Applizierung der zu untersuchenden Probe und der benötigten Reagenzien in eine Einweg-Kartusche automatisiert durchgeführt werden kann. Somit entfällt die Notwendigkeit geschultes Personal für diese Arbeiten einzusetzen.
  • – Die Detektion der Nachweismoleküle kann unter Verwendung geeigneter Vorrichtungen in Echtzeit- bzw. Endpunkt-Messung ermittelt werden. In beiden Fällen benötigt die erfindungsgemäße Ausführung keine Nachprozessierung, wie z.B. Wasch- oder Inkubationsschritte.
  • – In einer besonders bevorzugten Ausführung kann ein Mediator in jedem Reaktionszyklus bzw. zeitlichen Abschnitt der Reaktion mit mehreren identischen spezifischen Nachweismolekülen interagieren und eine Signalgenerierende Nachweisreaktion auslösen. Da ein akkumulativer Effekt durch Amplifizierung des Zielmoleküls erfolgt, wird die Sensitivität der Reaktion deutlich.
  • – Die hergestellten universellen Mikroarrays können unter definierten Lagerbedingungen über längere Zeit aufbewahrt werden, was v.a. gegenüber Protein-Arrays ein deutlicher Vorteil ist. Dadurch ist eine Bevorratung unabhängig von geplanten Experimenten unkritisch.

Im Folgenden soll die Erfindung sowie der Stand der Technik anhand von Figuren und Ausführungsbeispielen erläutert werden, ohne jedoch hierauf beschränkt zu sein. Es zeigen:

1(A–D) Verschiedene Festphasen-basierte Detektionsverfahren nach invasiver Spaltung einer immobilisierten Sonde

2 Bevorzugten Aufbau einer Mediator-Sonde

3A, B Bevorzugte Interaktion der Mediator-Sonde mit dem Zielmolekül und Mediator-Sonden-Spaltung

4A, B Darstellung eines bevorzugten Nachweismoleküls

5i).vi) Schematische Darstellung einer bevorzugten enzymatischen Mediatorverlängerung

6 Schematische Darstellung bevorzugter Position chemischer Modifikation innerhalb des Nachweismoleküls

7 Bevorzugte Detektion des Mediators mit Hilfe eines immobilisierten Nachweismoleküls

8 Bevorzugte Interaktion von Mediator-Sonde und Nachweismolekül

9 Schematische Darstellung der bevorzugten Anwendungsbereiche der Mediator-Sonden-Technologie

10 Normalisierter Fluoreszenz-Plot einer PCR unter Verwendung einer bevorzugten Mediator-Sonden und im Reaktionsgefäß immobilisierter Nachweismoleküle

1(A–D) zeigt verschiedene Festphasen-basierte Detektionsverfahren nach invasiver Spaltung einer immobilisierten Sonde. (A) Direkte, Fluoreszenz-basierte invasive Spaltungsdetektion. Möglichkeit 1: Die Sonde liegt immobilisiert an der Substratoberfläche vor. Das Invader-Oligonukleotid (upstream oligonucleotide) und die Zielsequenz (target) werden zu der Reaktionslösung hinzugegeben (siehe ). Möglichkeit 2: Die Sonde und das Invader-Oligonukleotid sind auf der Oberfläche immobilisiert. Die Zielsequenz wird zu dem Reaktionsmix hinzugegeben (siehe ). In beiden Fällen erfolgt eine Spaltung des Sondenmoleküls, woraus die Änderung eines Fluoreszenzsignals resultiert. Quelle: (Lu, M.C. et al, 2002, A surface invasive cleavage assay for highly parallel SNP analysis, Hum. Mutat., 19, 416–422.).

(B) Indirekte Spaltungsdetektion. Eine Dabcyl-modifizierte Sonde liegt immobilisiert an einer Festphase vor. Nach erfolgter invasiver Spaltung erfolgt die Ligation eines Biotin-markierten Linkers, an welchen Streptavidin-beschichtete Goldpartikel gebunden werden. Quelle: (Nie, B. et al, 2006, Quantitative detection of individual cleaved DNA molecules on surfaces using gold nanoparticles and scanning electron microscope imaging, Anal. Chem., 78, 1528–1534.).

(C) Indirekte Spaltungsdetektion durch anschließende Rolling Circle Amplification. Nach invasiver Spaltung einer immobilisierten, 5’-markierten Sonde erfolgt ein Ligationsschritt mit anschließender Rolling Ciricle Amplification. Es werden zwei unterschiedliche Strategien dargestellt, bei welchen nur die Sonde (a) bzw. die Sonde und das Invader-Oligonukleotid (b) immobilisiert vorliegen. Quelle: (Chen, Y. et al, 2004, Surface amplification of invasive cleavage products, J. Amer. Chem. Soc., 126, 3016–3017.).

(D) Indirekte, Fluoreszenz-basierte Spaltungsdetektion. An eine Fluoreszenz-markierte Sonde wird eine markierte Detektionssonde hybridisiert und das Fluoreszenzsignal detektiert. Nach erfolgten Waschschritten und durchgeführter invasiven Spaltung erfolgt ein weiterer Hybridisierungsschritt mit der beschriebenen Detektionssonde. Die anschließende Fluoreszenzmessung erlaubt einen Rückschluss auf die Anwesenheit der Zielsequenz im Reaktionsansatz. Quelle: (Lockett, M.R. et al, 2007, Molecular beacon-style hybridization assay for quantitative analysis of surface invasive cleavage reactions, Anal. Chem., 79, 6031–6036.).

2 zeigt einen bevorzugten Aufbau einer Mediator-Sonde. Die Mediator-Sonde besteht insbesondere aus einem Oligonukleotid und ist in zwei funktionelle Regionen unterteilt. Region 1 ist affin bzw. komplementär zum Zielmolekül, Region 2 interagiert ausschließlich mit einem spezifischen Nachweismolekül. Zwischen den Regionen befindet sich eine potentielle Spaltstelle.

3 zeigt eine bevorzugte Interaktion der Mediator-Sonde mit dem Zielmolekül und Mediator-Sonden-Spaltung. Die Mediator-Sonde, Hilfsmolekül 1 (hier: Primer) und Hilfsmolekül 2 (hier: Enzym mit Polymerisations- und Nuklease-Aktivität (Polymerase)) interagieren mit dem Zielmolekül (hier: Nukleinsäuresequenz) (A). Unter geeigneten Reaktionsbedingungen wird der Primer durch die Polymerase verlängert und die Mediator-Sonde gespalten, wobei ein Mediator-Molekül freigesetzt wird. (B).

4A, B zeigt eine Darstellung eines bevorzugten Nachweismoleküls. Lineare Darstellung (A). Darstellung eines 3’-immobilisierten Nachweismoleküls unter Ausbildung der Sekundärstruktur (B). Die revers-komplementären Sequenzabschnitte, durch deren Interaktion die Sekundärstruktur des Nachweismoleküls entsteht, sind als schwarze Bereiche, die Mediator-Hybridisierungssequenz als diagonal-gestreifter Bereich dargestellt.

5i)–vi) stellt eine schematische Darstellung einer bevorzugten enzymatischen Mediatorverlängerung dar. i) Ein Nachweismolekül liegt immobilisiert an einer Festphase vor und nimmt unter Reaktionsbedingungen eine definierte Sekundärstruktur an. Zwei geeignete Fluoreszenz-Modifikationen F und Q interagieren miteinander, wobei das Fluoreszenzsignal von F unterdrückt wird. ii) Der Mediator kann mit dem Nachweismolekül an definierter Position (Mediator-Hybridisierungssequenz, Region 5) interagieren iii)–iv) und wird dabei von einem Nachweishilfsmolekül (hier: Polymerase) enzymatisch verlängert. Dabei wird das Fluoreszenzakzeptormolekül Q vom Nachweismolekül abgespalten, womit die Fluoreszenzintensität des Fluoreszenzfarbstoffes F wiederhergestellt wird. vi) Nach Abspaltung von Region 1 nimmt das Nachweismolekül eine lineare Konformation an, wodurch eine weitere Verlängerung des Mediators erfolgen kann.

6 zeigt eine schematische Darstellung bevorzugter Position chemischer Modifikation innerhalb des Nachweismoleküls. An geeigneten Sequenzpositionen innerhalb der Region 1 und/oder Region 2 sind modifizierte Nukleotide eingebaut, welche eine potentielle Mediator-Elongation an definierter Position terminieren.

7 stellt eine bevorzugte Detektion des Mediators mit Hilfe eines immobilisierten Nachweismoleküls dar. i) Ein Nachweismolekül liegt immobilisiert an einer Festphase vor und nimmt unter Reaktionsbedingungen eine definierte Sekundärstruktur an. Zwei geeignete Fluoreszenz-Modifikationen F und Q interagieren miteinander, wobei das Fluoreszenzsignal von F unterdrückt wird. Der 3’-terminale Sequenzbereich liegt ungepaart vor und dient als potentielle Mediator-Hybridisierungssequenz (diagonal gestreifter Bereich). ii) An dieser definierten Position kann der Mediator mit dem Nachweismolekül interagieren iii, iv) und wird dabei von einem Nachweishilfsmolekül (hier: Polymerase) enzymatisch verlängert. v) Dabei wird das Fluoreszenzakzeptormolekül Q vom Nachweismolekül abgespalten, womit die Fluoreszenzintensität des Fluoreszenzfarbstoffes F wiederhergestellt wird. Nach einer geeigneter Dauer werden die Reaktionsbedingungen durch Erhitzen der Reaktionslösung geändert, so dass die Polymerase und der verlängerte Mediator vom Nachweismolekül abdissoziiert.

8 zeigt eine bevorzugte Interaktion von Mediator-Sonde und Nachweismolekül. Falls die ungespaltene Mediator-Sonde mit dem Nachweismolekül interagiert, erfolgt selbst in Anwesenheit geeigneter Nachweishilfsmoleküle keine enzymatische Verlängerungsreaktion, da diese einen 3’-OH-Terminus der Mediator-Sequenz benötigt. Somit wird die Generierung falsch-positiver Signale verhindert. Zusätzlich kann eine 3’-terminale Modifizierung vorhanden sein, um eine unspezifische Elongation zu unterbinden.

9 stellt eine schematische Darstellung der bevorzugten Anwendungsbereiche der Mediator-Sonden-Technologie dar. Die Mediator-Sonden-Technologie kann DNA, in cDNA umgeschriebene RNA oder an Protein-assoziierte Aptamere detektieren. Die Prozessierung der Medaitor-Sonde kann ggf. an einen Amplifikationsschritt (A) des Zielmoleküls integriert werden. Dargestellt ist die Detektion mittels eines immobilisierten, Mediator-spezifischen Nachweismoleküls. Durch Interaktion mit einem Hilfsmolekül (hier: Polymerase) wird durch eine Mediator-vermittelte Reaktion eine Zustandsänderung des Nachweismoleküls generiert (hier: Fluoreszenzänderung).

10 zeigt einen normalisierten Fluoreszenz-Plot einer PCR unter Verwendung einer bevorzugten Mediator-Sonden und im Reaktionsgefäß immobilisierter Nachweismoleküle. Die Reagenzien, welche u.a. Zielsequenz-spezifische Primer sowie die Mediator-Sonde und verschiedene Staphylococcus aureus-Genomäquivalente beinhalten, werden in ein geeignetes Reaktionsgefäß mit immobilisierten Nachweismolekülen pipettiert und mit einer geeigneten Versiegelungsfolie verschlossen. Die Reaktion wurde in einem Thermocycler durchgeführt, wobei die Messung der Fluoreszenz zu den angegebenen Zyklen in einem gesonderten Gerät vorgenommen wurde. In jedem PCR-Zyklus wird der zu amplifizierende Sequenzabschnitt verdoppelt, wobei bei jeder Duplikation ein Mediator aus der Spaltung einer Mediator-Sonde hervorgeht. Der freigesetzte Mediator interagiert mit dem Nachweismolekül in geeigneter Weise, wobei ein detektierbares Fluoreszenzsignal entsteht. Der Plot zeigt eine Korrelation der DNA-Menge und dem Fluoreszenzverlauf. Die Fluoreszenzintensitäten wurden auf den Wert von Zyklus 1 normiert (Der Messwert von Zyklus 37 wurde durch Kondensat an der Deckelfolie verfälscht und daher nicht berücksichtigt).

Ausführungsbeispiel i)

Die Ausführungsbeispiele sind außerdem schematisch in 9 dargestellt. Eine einfache Demonstration eines bevorzugten Nukleinsäurenachweises kann wie folgt durchgeführt werden: Zum Nachweis bakterieller DNA in einer zu untersuchenden Probe wird ein Nachweismolekül in einem geeignetem Reaktionsgefäß immobilisiert. Anschließend werden die Probe und die benötigten Reagenzien dem Reaktionsgefäß zugegeben und das Gemisch nach einer initialen Temperaturhalteschritt bei 95 °C zyklisch erhitzt und abgekühlt. Während diesem Prozess wird an definierten Zeitpunkten des Zyklus’ die Fluoreszenz im Reaktionsgefäß detektiert. Im Folgenden wird das Ausführungsbeispiel im Detail beschrieben:

In „NucleoLink-Strips“ (NUNC, Langenselbold, Deutschland, Cat.-No. 248650) werden 25 µL einer 100 nM Lösung eines Nachweismoleküls der Sequenz 5’-DABCYL-CCGCAG*A*A*GATGAGATC(dT-FAM)GCGGTGTTGGTCGTAGAGCCCAGAACGATTTTTTTTTTTTTTTTTTTTT-[C6NH2]-3’ (* = Phosphothioat) (IBA, Göttingen, Deutschland) in Kopplungspuffer (10 mM 1-Methyl-Imidazole (1-MeIm) (pH 7,0) (Sigma-Aldrich, Steinheim, Deutschland) und 10 mM 1-Ethyl-3-(3-Dimethylaminopropyl)-Carbodiimide (EDC) (Sigma-Aldrich, Steinheim, Deutschland)) pipettiert, mit ViewSEALTM-Deckelfolie (Greiner-BioOne, Frickenhausen, Germany, Cat.-No.676070) verschlossen und über Nacht bei 50°C inkubiert. Der Überstand wird verworfen und die Mikroreaktionsgefäße werden anschließend mit 100 µL Waschpuffer (100 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.1% Tween 20 (Carl Roth, Karlsruhe, Deutschland)) gewaschen und mit 25 µL einer 1 M Glycin-Lösung (Carl Roth, Karlsruhe, Deutschland) in Kopplungspuffer 1 Stunde bei 50 °C inkubiert und erneut gewaschen.

Die Reaktionsgefäße werden mit 25 µL PCR-Reaktionsmix (1x Finnzymes DyNamo Flash Probe (Finnzymes, Cat.-No. F-455), Primer-Moleküle der Sequenzen 5’-GAGGTAGGAAACTCTGGATCAGGTAT-3’ (300 nM) (biomers.net, Ulm, Deutschland), 5’-TCTATTGAAAAACACTCCTATTGGAAGA-3’ (300 nM) (biomers.net, Ulm, Deutschland), eine Mediator-Sonde der Sequenz 5’-TCTGGGCTCTACGACCAACAGGTATTCACAGTGGTAAAGGCGGACAACAAGAGCCCAG

A-[Phosphat]-3’ (200 nM) (biomers.net, Ulm, Deutschland)) sowie unterschiedlichen Konzentrationen einer Staphylococcus aureus DNA, die den Lokus Exfoliatin-Toxin B (NCBI Accession-Number M17348) enthält, befüllt. Je DNA-Konzentration werden vier Mikroreaktionsgefäße verwendet. Die Reaktionsgefäße werden mit ViewSEALTM-Deckelfolie verschlossen und in einen GeneAmp® 9700 Thermocycler (Perkin-Elmer, Massachusetts) überführt. Nach einer Inkubationsphase (7 min bei 95 °C) wird das zyklische Temperaturprotokoll (30 s bei 95 °C, 3 min bei 58 °C) durchgeführt und die Reaktionsgefäße nach definierten Zyklen aus dem Thermocycler entnommen und mit Hilfe des Mikrotiterplatten-Lesegeäts Victor2 1420 Multilabel Counter (Perkin-Elmer, Massachusetts) das Fluorescein-Signal gemessen. Anschließend werden die Reaktionsgefäße wieder in den Thermocycler überführt. Die Fluoreszenzwerte der einzelnen Mikroreaktionsgefäße werden auf den jeweiligen Wert des ersten Zyklus normalisiert, so dass für jedes Reaktionsgefäß ein Amplifikationsfaktor in Abhängigkeit des Prozessierungszyklus erstellt werden kann (siehe 10).

Ausführungsbeispiel ii)

Eine Ausführung wie in Ausführungsbeispiel i) beschrieben, wobei als Nukleinsäurevorlage RNA verwendet wird, welche mittels Reverse-Transkription oder durch ein anderes geeignetes enzymatisches System in cDNA umgeschrieben wird. Dabei wird dieser Schritt in einem gesonderten Reaktionsgefäß durchgeführt und ein Aliquot zu einer Nachweisreaktion gemäß Ausführungsbeispiel i) hinzugegeben. Alternativ kann die Reverse Transkription und anschließende Amplifikation gemäß Ausführungsbeispiel i) findet im selben Reaktionsgefäß stattfinden. Als Versuchsziel steht die Expressionsanalyse eines oder mehrerer Gene im Vordergrund.

Ausführungsbeispiel iii)

Der parallele Nachweis von DNA und RNA in einer Probe kann durch Kombination geeigneter Enzymsysteme durchgeführt werden. Dabei wird die nachzuweisende RNA mit Hilfe von Primern mit definiertem 5’-Sequenzüberhang amplifiziert (Siehe 9). Die für diesen Nachweis verwendete Mediator-Sonde ist derartig ausgelegt, dass sie teilweise an den Sequenzüberhang, den Primer sowie einen Abschnitt des verlängerten Primers bindet. Durch diesen definierten Lokus ist sichergestellt, dass nur aus RNA generierte cDNA durch eine spezifische Mediator-Sonde detektiert wird, jedoch nicht der genomische Lokus, von dem die RNA transkribiert wurde. Zur Detektion von genomischer DNA im Reaktionsansatz werden Mediator-Sonden verwendet, die ausschließlich komplementär zu dieser Sequenz sind. In der ggf. durchgeführten Amplifikationsreaktion wird die generierte cDNA und spezifische Abschnitte der genomischen DNA amplifiziert, wobei lokus-spezifische Mediator-Sonden gespalten und der Mediator durch geeignete Nachweisverfahren an einem örtlich aufgelösten immobilisierten Nachweismolekül detektiert werden kann.

Ausführungsbeispiel iv)

In ein geeignetes Reaktionsgefäß werden Reagenzien, welche Zielmolekül-spezifische Aptamere umfassen und die zu untersuchende Probe gegeben, wobei die Nachweismoleküle örtlich aufgelöst immobilisiert vorliegen (siehe 9). Das nachzuweisende Zielmolekül kann beispielsweise ein Protein oder Peptid sein ist aber nicht darauf beschränkt. Ein Aptamer bindet an das Zielmolekül und verändert seine Struktur, so dass sich nach erfolgter Interaktion eine Aptamer-spezifische Mediator-Sonde und Primer anlagern können. Durch Prozessierung mit einem geeigneten Enzymsystem kann der angelagerte Primer verlängert werden, wobei eine Spaltung der Mediator-Sonde erfolgt. Der freigesetzte Mediator kann mit Hilfe eines spezifischen Nachweismoleküls detektiert werden. Der enzymatische Amplifikationsprozess kann isotherme Verfahren beinhalten, ist aber nicht darauf beschränkt.

Ausführungsbeispiel v)

In einer besonderen Ausführungsvariante werden DNA, RNA und Peptide bzw. Proteine oder eine andere Kombination der genannten Stoffklassen durch die beschriebenen Verfahren i)-iv) in einem Ansatz parallel detektiert. Das Verfahren beinhaltet isotherme Amplifiaktionsverfahren, ist aber nicht auf diese beschränkt. Diese Ausführung wird in 9 illustriert.

Ausführungsbeispiel vi)

Unabhängig von der Art des Nachweises kann das Reaktionsgefäß beispielsweise das etablierte und weit verbreitete Mikrotiterplattenformat (96-well plate) besitzen, womit handelsübliche Temperierungs- und Auslesegeräte, bzw. Geräte, die beide Funktionen kombinieren, verwendet werden können. In allen Fällen sind die Nachweismoleküle örtlich aufgelöst immobilisiert (Array). Als mögliches Reaktionsgefäß kann auch eine Flusszelle betrachtet werden, die nach durchgeführter Analyse ggf. gereinigt und wiederverwendet werden kann. In einer besonderen Ausführungsform kann das Reaktionsgefäß eine Kartusche darstellen, in welcher die Nachweismoleküle immobilsiert vorliegen. Der Reaktionsraum kann auch durch die Verwendung eines modifizierten Mikroskop-Objektträger und eines geeigneten Rahmens definiert werden. Diese Ausführung hat die vorteilhafte Eigenschaft, dass die Immobilisierung der Nachweismoleküle auf geeigneten Materialien im Stand der Technik beschrieben ist und passende Kleberahmen (Peqlab in-situ Kleberahmen, Peqlab Biotechnologie, Erlangen, Deutschland) sowie temperierbare Prozessierungsgeräte (Peqlab PeqStar in-situ, Peqlab Biotechnologie, Erlangen, Deutschland) und Auslesegeräte (BioAnalyzer, LaVision BioTec GmbH, Bielefeld, Deutschland) kommerziell erhältlich sind. Das Format der Kartusche ist nicht festgelegt und kann ggf. nach den Wünschen des Benutzers erstellt sein. Die Kartusche kann mit Hilfe von integrierten Prismen einen eingekoppelten Lichtstrahl zur Anregung oberflächennaher Fluorophore mittels TIRF durch einen Auslesebereich leiten. Ferner kann diese Kartusche in Kombination mit einem Gerät verwendet werden, welches über eine Temperierungsvorrichtung und optischen Komponenten zur Anregung und Detektion von Fluoreszenzsignalen verfügt. Die Kartusche kann ggf. über mikrofluidische Strukturen, zum Beispiel Einfüll- und Belüftungsöffnungen, Konnektierungen für aktive Elemente, Misch-, Mess- und Aliquotierungskammern, -kanäle oder -strukturen, oder Strukturen, die für andersweiteige Zwecke verwendet werden können, verfügen. Das System kann über Pumpen oder andere Aktoren verfügen, mit deren Hilfe die Flüssigkeit prozessiert werden kann. Zusätzlich können weitere Reagenzien vorgelagert sein.

ZITATE ENTHALTEN IN DER BESCHREIBUNG

Diese Liste der vom Anmelder aufgeführten Dokumente wurde automatisiert erzeugt und ist ausschließlich zur besseren Information des Lesers aufgenommen. Die Liste ist nicht Bestandteil der deutschen Patent- bzw. Gebrauchsmusteranmeldung. Das DPMA übernimmt keinerlei Haftung für etwaige Fehler oder Auslassungen.

Zitierte Patentliteratur

  • US 5641658 [0009]
  • US 6300070 B1 [0009]
  • DE 10316159 A1 [0014]
  • US 5653939 [0021]
  • US 6099803 [0021]
  • US 2001/0034025 A1 [0022]
  • US 6238869 B1 [0022]

Zitierte Nicht-Patentliteratur

  • Liu, Q. et al, 2007, Microarray-in-a-tube for detection of multiple viruses. Clin Chem, 53, 188–194 [0007]
  • Pemov, A. et al, 2005, DNA analysis with multiplex microarray-enhanced PCR. Nucleic Acids Res., 33, e11. [0010]
  • Andresen, D., von Nickisch-Rosenegk, M. and Bier, F.F., 2009, Helicase dependent OnChipamplification and its use in multiplex pathogen detection, Clin. Chim. Acta, 403, 244–248 [0012]
  • Liu, H.P. et al, 2006, TaqMan probe array for quantitative detection of DNA targets, Nucleic Acids Research, 34. [0015]
  • Baeumner, A.J. et al, 2004, A universal nucleic acid sequence biosensor with nanomolar detection limits, Anal. Chem., 76, 888–894. [0025]
  • Lu, M.C. et al, 2002, A surface invasive cleavage assay for highly parallel SNP analysis, Hum. Mutat., 19, 416–422. [0108]
  • Nie, B. et al, 2006, Quantitative detection of individual cleaved DNA molecules on surfaces using gold nanoparticles and scanning electron microscope imaging, Anal. Chem., 78, 1528–1534. [0109]
  • Chen, Y. et al, 2004, Surface amplification of invasive cleavage products, J. Amer. Chem. Soc., 126, 3016–3017. [0110]
  • Lockett, M.R. et al, 2007, Molecular beacon-style hybridization assay for quantitative analysis of surface invasive cleavage reactions, Anal. Chem., 79, 6031–6036. [0111]