Title:
Aptamere, die spezifisch sind für Immunoglobulin bindende Zellwandproteine
Kind Code:
B3
Abstract:

Die Erfindung betrifft ein Aptamer das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen sowie an Protein A, G oder L enthaltende Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bindet, Verfahren zum Nachweis und Anreicherung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, in denen das Aptamer eingesetzt wird, sowie ein Kit, einen Biosensor, eine Lateralfluss-Assay-Vorrichtung und ein Messgerät, die ein solches Aptamer enthalten und in den genannten Verfahren einsetzbar sind.



Inventors:
Stoltenburg, Regina, Dr. (04157, Leipzig, DE)
Strehlitz, Beate, Dr. (04279, Leipzig, DE)
Application Number:
DE102011006610A
Publication Date:
06/21/2012
Filing Date:
03/31/2011
Assignee:
Helmholtz-Zentrum für Umweltforschung GmbH - UFZ, 04318 (DE)
Other References:
CAO, X. u.a.: Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus. Nucleic Acids Res. (2009) 37 (14) 4621-8
KIM, D.C. u.a.: Molecular recognition and specific interactions for biosensing applications. Sensors (2008) 8 (10) 6605-6641
KULBACHINSKIY, A.V.: Methods for selection of aptamers to protein targets. Biochemistry (Mosc). (2007) 72 (13) 1505-18
Attorney, Agent or Firm:
Patentanwälte Bressel und Partner, 10785, Berlin, DE
Claims:
1. Aptamer, das an Immunoglobulin bindende Zellwandproteine, an Substanzen, die ein Immunoglobulin bindendes Zellwandprotein enthalten, und an Mikroorganismen, die ein Immunoglobulin bindendes Zellwandprotein enthalten, bindet, wobei das Immunoglobulin bindende Zellwandprotein ausgew?hlt ist aus der Gruppe umfassend Protein A, G oder L.

2. Aptamer nach Anspruch 1, das ausgew?hlt ist aus
a) einem Aptamer umfassend eine Nukleins?uresequenz, die ausgew?hlt ist aus der Gruppe bestehend aus SEQ ID NO: 1 bis SEQ ID NO: 65, mit der Ma?gabe, dass Thymin durch Uracil ersetzt sein kann,
b) einem Aptamer, dessen Nukleins?uresequenz eine Identit?t von mindestens 70% mit der Nukleins?uresequenz eines Aptamers aus a) aufweist,
c) einem Aptamer, das mit dem komplement?ren Strang eines Aptamers aus a) hybridisiert,
d) einem Aptamer bei dem gegen?ber einem Aptamer aus a) ein oder mehrere Nukleotide substituiert, deletiert, insertiert und/oder angef?gt sind
e) einem Fragment eines Aptamers nach a), b), c) oder d),
f) einem Derivat eines Aptamers nach a), b), c), d) oder e).

3. Arzneimittel, insbesondere zur Diagnose, Prophylaxe und/oder Behandlung von Erkrankungen, die auf Staphylococcus aureus, Streptococcus oder Peptostreptococcus zur?ckzuf?hren sind, umfassend ein oder mehrere verschiedene Aptamere wie in einem der Anspr?che 1 oder 2 beschrieben.

4. Aptamersonde zur Detektion von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, umfassend ein oder mehrere verschiedene Aptamere wie in einem der Anspr?che 1 oder 2 beschrieben und ein Markierungsmittel.

5. Biosensor, aufweisend ein oder mehrere verschiedene Aptamere wie in einem der Anspr?che 1 oder 2 beschrieben.

6. Feste Phase, insbesondere zur Verwendung beim Nachweis, Anreicherung, Abtrennung und/oder Isolierung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, an die ein oder mehrerere verschiedene Aptamere nach einem der Anspr?che 1 oder 2 immobilisiert ist/sind.

7. Teststreifen, insbesondere zur Verwendung in Lateralfluss-Assays, der ein oder mehrerere verschiedene Aptamere nach einem der Anspr?che 1 oder 2 enth?lt.

8. Lateralfluss-Assay-Vorrichtung, die einen Teststreifen nach Anspruch 7 aufweist.

9. Kit, umfassend ein oder mehrere verschiedene Aptamere wie in einem der Anspr?che 1 oder 2 beschrieben.

10. Messger?t zum Nachweis von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, aufweisend ein oder mehrere verschiedene Aptamere nach Anspruch 1 oder 2, eine Aptamersonde nach Anspruch 4, einen Biosensor nach Anspruch 5 oder einen Teststreifen nach Anspruch 7.

11. Verwendung des Aptamers wie in einem der Anspr?che 1 oder 2 beschrieben zum Nachweis, Anreicherung, Abtrennung und/oder Isolierung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus.

12. Verwendung des Aptamers wie in einem der Anspr?che 1 oder 2 beschrieben zur Quantifizierung der Bindung eines Immunoglobulins an Protein A, G oder L.

13. Verwendung des Aptamers wie in einem der Anspr?che 1 oder 2 beschrieben zur Blockierung oder Quantifizierung freier Bindungsstellen an Protein A, G oder L.

14. Verwendung des Aptamers wie in einem der Anspr?che 1 oder 2 beschrieben zur Diagnose, Prophylaxe, Behandlung und/oder Therapie von Erkrankungen, die auf Staphylococcus aureus zur?ckzuf?hren sind.

15. Verfahren zum Nachweis von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bei dem
a) ein oder mehrere verschiedene Aptamere wie in einem der Anspr?che 1 oder 2 beschrieben mit einer Probe, die Protein A, G oder L, die Protein A, G oder L enthaltende Substanz oder den Mikroorganismus enth?lt, in Kontakt gebracht wird/werden und
b) eine Bindung zwischen dem/den Aptamer(en) und Protein A, G oder L, oder zwischen dem/den Aptamer(en) und der Substanz, oder zwischen dem/den Aptamer(en) und dem Mikroorganismus nachgewiesen wird.

16. Verfahren zur Anreicherung, Abtrennung und/oder Isolierung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bei dem
a) ein oder mehrere verschiedene Aptamere wie in einem der Anspr?che 1 oder 2 beschrieben mit einer Probe, die Protein A, G oder L, eine Protein A, G oder L enthaltende Substanz oder einen Protein A, G oder L enthaltenden Mikroorganismus enth?lt, in Kontakt gebracht wird/werden, wobei ein Komplex oder Komplexe aus dem/den Aptamer(en) und Protein A, G oder L, aus dem/den Aptamer(en) und der Protein A, G oder L enthaltenden Substanz oder aus dem/den Aptamer(en) und dem Protein A, G oder L enthaltenden Mikroorganismus gebildet wird,
b) der/die Komplex(e) und die ?brige Probe voneinander getrennt werden, und
c) optional Protein A, G oder L, die Protein A, G oder L enthaltende Substanz oder der Protein A, G oder L enthaltende Mikroorganismus aus dem Komplex isoliert wird.

17. Verfahren zur Quantifizierung der Bindung eines Immunoglobulins an Protein A, G oder L, wobei bei dem Verfahren
a) Protein A, G oder L, Protein A, G oder L enthaltende Substanz oder ein Protein A, G oder L enthaltender Mikroorganismus bereitgestellt wird,
b) Protein A, G oder L, Protein A, G oder L enthaltende Substanz oder der Protein A, G oder L enthaltende Mikroorganismus mit dem Immunoglobulin versetzt wird,
c) das in b) erzeugte Gemisch mit einem Aptamer nach einem der Anspr?che 1 oder 2 in Kontakt gebracht wird, und
d) die Menge gebundenen Aptamers bestimmt wird und daraus die Menge gebundenen Immunoglobulins bestimmt wird.

Description:

Die vorliegende Erfindung betrifft ein Aptamer, das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bindet, Verwendungen des Aptamers sowie Verfahren zum Nachweis und Anreicherung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, in denen das Aptamer eingesetzt wird.

Staphylococcus aureus ist ein kugelf?rmiges, Gram-positives, pathogenes Bakterium. S. aureus kommt fast ?berall in der Natur, auch auf der Haut und in den oberen Atemwegen von 25 bis 30% aller Menschen vor. Besonders gef?hrlich sind Antibiotika-resistente Formen und insbesondere multiresistente Formen. Diese kommen geh?uft in Krankenh?usern, Pflegeheimen, aber auch im Kl?rschlamm vor. Auch in Lebensmitteln tierischer Herkunft werden resistente Keime des Stammes gefunden. Der Keim kann auch in das Trinkwasser gelangen. H?ufige Erkrankungen, die auf S. aureus zur?ckzuf?hren sind, sind Sepsis, Haut- und Wundinfektionen, Pneumonien, Abszesse, Furunkel, Endokarditis, Osteomyelitis, Lebensmittelvergiftungen durch S. aureus Exotoxine und Mastitis bei Rindern.

Der Nachweis von S. aureus erfolgt bisher mittels Kultivierung oder immunologischer und molekularbiologischer Methoden (Antik?rper-Assays, PCR-basierte Methoden). Die Methoden sind entweder zeitaufw?ndig oder teuer. Aufgabe der vorliegenden Erfindung war es deshalb, spezifische Substanzen zur Verf?gung zu stellen, die einen schnellen, einfachen und zuverl?ssigen Nachweis von S. aureus erm?glichen.

Die Aufgabe wird mit einem Aptamer gel?st, das an Immunoglobulin bindende Zellwandproteine, an Substanzen, die ein Immunoglobulin bindendes Zellwandprotein enthalten, und an Mikroorganismen, die ein Immunoglobulin bindendes Zellwandprotein enthalten, bindet, wobei das Immunoglobulin bindende Zellwandprotein ausgew?hlt ist aus der Gruppe umfassend oder bestehend aus Protein A, G oder L.

Der Begriff ?umfassend? bedeutet im Sinne des vorigen Absatzes, dass das Aptamer auch an weitere Immunoglobulin bindende Zellwandproteine binden kann, bzw. an Substanzen oder Mikroorganismen, die ein anderes Immunoglobulin bindendes Zellwandprotein enthalten als die genannten Proteine A, G oder L.

Bereitgestellt wird somit ein Aptamer, das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen sowie Protein A, G oder L enthaltende Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bindet. Insbesondere ist das erfindungsgem??e Aptamer spezifisch f?r Protein A, G oder L. Das erfindungsgem??e Aptamer ist ein Nukleins?ure-Aptamer, insbesondere ein einzelstr?ngiges DNA(ssDNA)- oder ein RNA-Aptamer.

Der allgemeine Begriff ?Aptamere? bezeichnet im Stand der Technik kurze einzelstr?ngige Nukleins?ure-Oligomere, auch bezeichnet als Oligonukleotide, die spezifisch an eine Zielstruktur oder ein Zielmolek?l, auch bezeichnet als Target, binden k?nnen, beispielsweise an ein Protein, an niedermolekulare Verbindungen, wie organische Substanzen, Aminos?uren und Antibiotika, Nukleins?uren, Viruspartikel oder (Mikro)Organismen. Die Aptamer-Target-Bindung erfolgt beispielsweise ?ber die Strukturkompatibilit?t, so genannte ?Stacking interactions? bei aromatischen Ringstrukturen (Stapelkr?fte durch Elektronenwechselwirkung mit Nachbarbasen), elektrostatische Wechselwirkungen (z. B. Van der Waals-, Ionen-, Dipolkr?fte) und Wasserstoffbr?ckenbindungen.

Auch Aptamere mit Peptidstruktur sind bekannt, wobei sich die vorliegende Erfindung ausschlie?lich auf Nukleins?ure-Aptamere bezieht. Somit bezeichnet der Begriff ?Aptamere? nachfolgend Nukleins?ure-Aptamere. Bei Nukleins?ure-Aptameren unterscheidet man beispielsweise DNA-Aptamere, gebildet aus einzelstr?ngiger DNA(ssDNA), und RNA-Aptamere. Aptamere zeichnen sich durch die Ausbildung einer spezifischen dreidimensionalen Struktur, die von der Nukleins?uresequenz abh?ngt, aus. Diese Struktur bef?higt Aptamere, analog einer Antigen-Antik?rper-Bindung Zielstrukturen passgenau zu binden. Eine bestimmte Nukleins?uresequenz eines Aptamers kann bei definierten Bedingungen eine dreidimensionale Struktur aufweisen, die spezifisch f?r eine definierte Zielstruktur (Target) ist. Die dreidimensionale Struktur eines Aptamers entsteht unter anderem infolge von intramolekularen Basenpaarungen nach Watson und Crick und ?ber Hoogsteen-Basenpaarungen (Quadruplex).

Die Aussage, dass ein erfindungsgem??es Aptamer an Protein A, G oder L, eine Protein A, G oder L enthaltende Substanz oder einen Protein A, G oder L enthaltenden Mikroorganismus bindet, oder daf?r spezifisch ist, bedeutet, dass es an ein oder mehrere Targets bindet, die ausgew?hlt sind aus Protein A, G oder L, einer Protein A, G oder L enthaltenden Substanz oder einem Protein A, G oder L enthaltenden Mikroorganismus.

Protein A, Protein G und Protein L sind bakterielle Zellwandproteine. Sie geh?ren zu einer Gruppe Proteine, die wiederholende Dom?nen enthalten, welche Immunoglobuline binden k?nnen.

Protein A ist ein Protein, das in der Zellwand des Bakteriums Staphylococcus aureus vorkommt. Protein A hat eine Gr??e von 40?60 kDa und wird in der biochemischen Forschung h?ufig wegen seiner F?higkeit genutzt, Immunoglobuline ?ber deren Fc-Region zu binden. Protein A bindet verschiedene Klassen von Immunoglobulinen, insbesondere verschiedene IgG-Subklassen von verschiedenen Spezies. Beispielhafte Protein A-Vertreter haben die UniProt Nr. P38507, P02976, P99134, P0A015 (aus section: Swiss-Prot, der UniProtKB = Protein knowledgebase).

Protein G ist ein Protein, das in der Zellwand von Bakterien der Gattung Streptococcus vorkommt. Es hat je nach Streptococcus-Stamm eine Molek?lmasse von etwa 58 bis 65 kDa und besitzt am C-Terminus zwei oder drei homologe Bindungsdom?nen mit hoher Affinit?t f?r die Fc-Region von Immunglobulinen, insbesondere des Isotyps IgG. Dar?ber hinaus bindet es ?ber drei homologe Dom?nen N-terminal zur IgG-Bindungsregion auch an Albuminproteine. Am N-Terminus besitzt Protein G eine weitere Bindungsregion (Region E) f?r humanes Alpha-2-Globulin in der auch als s-Form bezeichneten nativen Konformation. Beispielhafte Protein G-Vertreter haben die UniProt (Universal Protein Database) Nr. P06654 und P19909.

Protein L ist ein Protein, das in der Zellwand von Peptostreptococcus magnus vorkommt. ?hnlich wie Protein A und G ist es ebenfalls in der Lage Immunglobuline zu binden, insbesondere Immunglobuline, welche die leichten Ketten des Kappa-Typs enthalten.

Aufgrund ihrer Spezifit?t f?r Protein A, G oder L sind Aptamere der vorliegenden Erfindung auch spezifisch f?r Protein A, G oder L enthaltende Substanzen und Protein A, G oder L enthaltende Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus. Unter ?Protein A, G oder L enthaltenden Substanzen? sind Substanzen zu verstehen, die mit Protein A, G oder L fest verbunden sind, beispielsweise durch eine kovalente Bindung, Wasserstoffbr?ckenbindungen oder eine Komplexbindung. Aus ihrer Spezifit?t ergeben sich zahlreiche Verwendungsm?glichkeiten der erfindungsgem??en Aptamere, die an anderem Ort in dieser Beschreibung noch erl?utert werden.

Die erfindungsgem??en Aptamere sind auch spezifisch f?r rekombinant hergestelltes Protein A, Protein G oder Protein L, beispielsweise in E coli rekombinant hergestelltes Protein A, G, oder L.

Ebenso sollen die Begriffe Protein A, Protein G und Protein L auch Mutationsformen dieser Proteine, also ver?ndertes Protein A, G oder L im Vergleich zum Wildtyp, beispielsweise entstanden durch k?nstliche oder nat?rliche Genmutationen, einschlie?en.

Erfindungsgem??e Aptamere, die spezifisch f?r Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen sind, k?nnen beispielsweise mit dem SELEX-Verfahren (Systematic Evolution of Ligands by Exponential Enrichment) erhalten werden. Grundlegende Arbeiten zum SELEX-Verfahren stammen von Tuerk and Gold, Science 249 (1990) 505?510, sowie Ellington and Szostak, Nature 346 (1990) 818?822. SELEX Verfahren sind weiterhin offenbart in US 5,567,588 und US 5,270,163.

Im SELEX Verfahren wird zun?chst eine kombinatorische Zufallsbibliothek, bestehend aus einzelstr?ngigen DNA(ssDNA)-Oligonukleotiden erzeugt. Die Oligonukleotide weisen einen internen variablen Bereich auf, mit beispielsweise 40?60 Nukleotiden, der am 5' und 3' Ende von Primerregionen flankiert wird. Die Primerregionen dienen als Primerbindungsstellen f?r eine PCR Amplifikation. Kombinatorische Zufallsbibliotheken k?nnen von kommerziellen Anbietern bezogen werden. Die Variabilit?t einer Bibliothek liegt beispielsweise im Bereich von ca. 1015 verschiedenen Molek?len. Ausgehend von der einzelst?ngigen DNA-Oligonukleotid-Bibiothek werden ?ber verschiedene Selektions- und Amplifikationsschritte zyklusweise die Oligonukleotide angereichert, die am besten an das Target binden. Jeder Zyklus besteht aus folgenden Teilschritten:

  • a) Bindung der Oligonukleotide an das Target,
  • b) Waschen der Oligonukleotid-Target-Komplexe zur Entfernung von ungebundenen Oligonukleotiden,
  • c) Elution der am Target gebundenen Oligonukleotide,
  • d) Amplifikation der eluierten Oligonukleotide mittels PCR,
  • e) Reinigung der relevanten ssDNA-Oligonukleotide aus dem PCR-Produkt

Nach jedem Zyklus wird der selektierte und angereicherte Oligonukleotidpool als Ausgangsmaterial f?r einen n?chsten Zyklus genutzt. Vorteilhafterweise werden 8 bis 12 Zyklen durchlaufen.

Ein SELEX Verfahren zur Isolierung erfindungsgem??er Aptamere ist in den beigef?gten Beispielen genauer beschrieben. Ein beispielhaftes Verfahren zur Auffindung von erfindungsgem??en Aptameren ist das sogenannte FluMag-SELEX Verfahren, bei dem fluoreszenzmarkierte ssDNA Molek?le und magnetische K?gelchen (Beads) als Immobilisierungsmatrix f?r das Target eingesetzt werden. Dieses Verfahren, das in den beigef?gten Beispielen verwendet wurde, ist auch beschrieben in: R. Stoltenburg et al. (2005) FluMag-SELEX as an advantageous method for DNA aptamer selection, Anal. Bioanal. Chem. 383, 83?91.

Nach Analyse der Sequenz k?nnen erfindungsgem??e Aptamere sowie Varianten, Mutanten, Fragmente und Derivate davon, welche nachfolgend noch beschrieben werden, mit ?blichen Techniken der chemischen DNA- und RNA-Synthese hergestellt werden, die dem Fachmann bekannt sind. Ist die Sequenz eines DNA Aptamers bekannt, so kann ein RNA Aptamer mit der gleichen Sequenz durch ?bliche Syntheseverfahren hergestellt werden. Ferner k?nnen die Bindungseigenschaften einzelner Aptamere an das Target untersucht werden.

Vorzugsweise sind die erfindungsgem??en Aptamere synthetische Oligonukleotide, die insbesondere nach dem soeben beschriebenen SELEX Verfahren aus einer zugrunde gelegten synthetischen, kombinatorischen Oligonukleotid-Bibliothek selektiert wurden oder anschlie?end mit ?blichen Syntheseverfahren hergestellt sind.

Die Erfindung betrifft in einer speziellen Ausf?hrungsform ein Aptamer das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen bindet und das ausgew?hlt ist aus

  • a) einem Aptamer umfassend, oder bestehend aus, eine(r) Nukleins?uresequenz, die ausgew?hlt ist aus der Gruppe bestehend aus SEQ ID NO: 1 bis SEQ ID NO: 65, mit der Ma?gabe, dass Thymin durch Uracil ersetzt sein kann,
  • b) einem Aptamer, dessen Nukleins?uresequenz eine Identit?t von mindestens 70% mit der Nukleins?uresequenz eines Aptamers aus a) aufweist
  • c) einem Aptamer, das mit dem komplement?ren Strang eines Aptamers aus a) hybridisiert,
  • d) einem Aptamer bei dem gegen?ber einem Aptamer aus a) ein oder mehrere Nukleotide substituiert, deletiert, insertiert und/oder angef?gt sind
  • e) einem Fragment eines Aptamers nach a), b), c) oder d),
  • f) einem Derivat eines Aptamers nach a), b), c), d) oder e).

Die Funktionalit?t der Aptamere aus a)?f), also die Bindung an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen kann mit einer Sekund?rstrukturanalyse der Aptamere, abgesch?tzt werden. Auch die Funktionalit?t sonstiger in dieser Beschreibung genannter Varianten kann so abgesch?tzt werden. Die Modellierung der m?glichen Sekund?rstruktur der Aptamere kann unter Nutzung des im Internet frei verf?gbaren Programms ?mfold? (Version 3.1 oder 3.5) erfolgen. Dieses Programm f?hrt eine Analyse der zweidimensionalen Struktur mit Hilfe einer Energieminimierungsmethode aus (Zuker M., 2003, Nucleic Acid Research 31, 3406?3415). Bei der Faltung der Aptamere kann es zu Stems (doppelstr?ngige Bereiche), Loops, d. h. Ausschleifungen von einzelstr?ngigen Bereichen, wie Haarnadel- oder interne Schleifen, und Bulbs, d. h. kleine einzelstr?ngige Ausbuchtungen in doppelstr?ngigen Bereichen, kommen. Mit dem Programm mfold wird f?r eine Aptamer-Nukleotidsequenz die hypothetische Sekund?rstruktur bei Standardbedingungen bestimmt (Bindungs-/Faltungstemperatur: 21?C, Ionenst?rke des Bindungspuffers: [Na+] 100 mM/[Mg2+] 10 mM). Bindungspufferzusammensetzung: 100 mM NaCl, 20 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 5 mM KCl, 1 mM CaCl2. Der Fachmann kann sehr leicht eine gro?e Anzahl Varianten der konkret mit Sequenzen beschriebenen erfindungsgem??en Aptamere entwerfen, beispielsweise durch Substitution, Insertion oder Deletion einzelner Basen. Solche Varianten k?nnen per Computer, wie oben beschrieben, in gro?er Zahl und ohne experimentellen Aufwand auf ihre Sekund?rstruktur analysiert werden. Wenn eine ?bereinstimmung der Sekund?rstruktur einer Variante mit der Sekund?rstruktur eines konkret mit Sequenz beschriebenen Aptamers vorliegt, ist eine Funktionalit?t der Variante wahrscheinlich oder bisweilen sehr wahrscheinlich.

Varianten der Aptamere nach Anspruch 1a) werden nachfolgend erl?utert.

Von der Erfindung umfasst sind Aptamere, deren Sequenz eine Identit?t von mindestens 70%, vorzugsweise mindestens 80%, oder mindestens 85%, oder mindestens 90%, oder mindestens 93%, oder mindestens 95%, oder mindestens 96%, oder mindestens 97%, und am meisten bevorzugt mindestens 98%, mit einer der Sequenzen der SEQ ID NO: 1 bis SEQ ID NO: 65 aufweisen.

Unter dem Begriff ?Identit?t? soll im Zusammenhang mit der vorliegenden Erfindung die Anzahl der ?bereinstimmenden Nukleotide (Identit?t), ausgedr?ckt in Prozent verstanden werden. Bevorzugt wird die Identit?t zwischen zwei betreffenden Nukleins?uresequenzen mit Hilfe von Computerprogrammen ermittelt. Weisen Sequenzen, die miteinander verglichen werden, unterschiedliche L?ngen auf, ist die Identit?t so zu ermitteln, dass die Anzahl an Nukleotide, welche die k?rzere Sequenz mit der l?ngeren Sequenz gemeinsam hat, den prozentualen Anteil der Identit?t bestimmt. Vorzugsweise wird die Identit?t mittels des bekannten und der ?ffentlichkeit zur Verf?gung stehenden Computerprogramms ClustalW2 bestimmt. Auf die Definition von Identit?t in dem Programm ClustalW2 und die Methode zu ihrer Ermittlung, die ?ffentlich zug?nglich sind, wird in dieser Erfindung ausdr?cklich Bezug genommen.

ClustalW2 wird ?ffentlich zur Verf?gung gestellt vom European Bioinformatics Institute (EBI) des European Molecular Biology Laboratory (EMBL) und kann im Internet unter http://www.ebi.ac.uk/Tools/msa/clustalw2/ abgerufen werden. Wenn das ClustalW2 Computerprogramm benutzt wird, um die Identit?t zwischen z. B. der Nukleotidsequenz der im Rahmen der vorliegenden Erfindung beschriebenen Nukleins?uremolek?le und der Nukleotidsequenz von anderen Nukleins?uremolek?len zu bestimmen, werden folgende Parameter eingestellt: DNA Weight Matrix: IUB; GAP OPEN: 10; GAP EXTENSION: 0,20; GAP DISTANCES: 5; NO END GAPS: no; ITERATION: none; NUMITER: 1; CLUSTERING: NJ.

Gegenstand der Erfindung ist auch jedes Aptamer, das mit dem komplement?ren Strang eines zuvor beschriebenen, erfindungsgem??en Aptamers hybridisiert, vorausgesetzt, dass ein solches Aptamer an Protein A, G oder L, eine Protein A, G oder L enthaltende Substanz oder einen Protein A, G oder L enthaltenden Organismus, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bindet.

Der Begriff ?Hybridisierung? bedeutet im Rahmen dieser Erfindung eine Hybridisierung unter konventionellen Hybridisierungsbedingungen, vorzugsweise unter stringenten Bedingungen, wie sie beispielsweise in Sambrook et al., Molecular Cloning, A Laboratory Manual, 3. Aufl. (2001) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, beschrieben sind.

Nukleins?uremolek?le, die mit den genannten Molek?len hybridisieren k?nnen beispielsweise aus DNA-Bibliotheken isoliert werden. Die Identifizierung und Isolierung derartiger Nukleins?uremolek?le kann dabei unter Verwendung der genannten Nukleins?uremolek?le (SEQ ID NO: 1 bis SEQ ID NO: 65) oder Teile dieser Molek?le bzw. der reversen Komplemente dieser Molek?le erfolgen, z. B. mittels Hybridisierung nach Standardverfahren (siehe z. B. Sambrook et al., 2001, Molecular Cloning, A Laboratory Manual, 3. Aufl. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). Bei als Hybridisierungsprobe verwendeten Fragmenten kann es sich auch um synthetische Fragmente oder Oligonukleotide handeln, die mit Hilfe g?ngiger Synthesetechniken hergestellt wurden und deren Sequenz im Wesentlichen mit der eines in Rahmen der vorliegenden Erfindung beschriebenen Aptamers bzw. dessen komplement?ren Strangs ?bereinstimmt.

Gegenstand der Erfindung ist auch ein Aptamer, das von einem Aptamer mit einer der Sequenzen der SEQ ID NO: 1 bis SEQ ID NO: 65 dadurch abgeleitet ist, dass bei einer der Sequenzen der SEQ ID NO: 1 bis SEQ ID NO: 65 ein oder mehrere Nukleotide substituiert, entfernt (deletiert), innerhalb der Sequenz eingef?gt (insertiert) und/oder am 5'-Ende und/oder 3'-Ende angef?gt sind, wobei ein solches Aptamer an Protein A, G oder L, eine Protein A, G oder L enthaltende Substanz oder einen Protein A, G oder L enthaltenden Organismus, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bindet. Derart ver?nderte Aptamere weisen vorzugsweise eine Identit?t von mindestens 70%, oder mindestens 80%, oder mindestens 85%, oder mindestens 90%, oder mindestens 93%, oder mindestens 95%, oder mindestens 96%, oder mindestens 97%, und am meisten bevorzugt mindestens 98% mit einer der Sequenzen der SEQ ID NO: 1 bis SEQ ID NO: 65 auf. Der Begriff Identit?t wurde zuvor definiert. Eine Sequenz, bei der ein oder mehr Nukleotide substituiert sind, bezeichnet man auch als Substitutionsmutante, eine Sequenz, bei der ein oder mehr Nukleotide deletiert sind, als Deletionsmutante und eine Sequenz, bei der ein oder mehr Nukleotide insertiert sind, als Insertionsmutante. Vorzugsweise sind insgesamt, bezogen auf Substitution, Deletion und Insertion in einem Aptamermolek?l, bis zu 60 Nukleotide substituiert, deletiert, und/oder insertiert, mehr bevorzugt bis zu 50 Nukleotide, noch mehr bevorzugt bis zu 40 Nukleotide, oder bis zu 30 Nuleotide, insbesondere bevorzugt bis zu 10 Nukleotide oder bis zu 8 Nukleotide oder bis zu 5 Nukleotide, weiterhin bevorzugt bis zu 3 Nukleotide, und am meisten bevorzugt bis zu 2 Nukleotide.

Bei einer Anf?gung sind vorzugweise am 5' und/oder am 3' Ende des Aptamers bis zu 100 Nukleotide angef?gt, mehr bevorzugt bis zu 50 Nukleotide, noch mehr bevorzugt bis zu 40 Nukleotide, oder bis zu 20 Nuleotide, insbesondere bevorzugt bis zu 10 Nukleotide oder bis zu 8 Nukleotide, am meisten bevorzugt bis zu 5 Nukleotide.

In einer speziellen Ausf?hrungsform bleiben bei den in den Punkten b) bis f) beschriebenen Abwandlungen eins oder beide der Motive ATACCAGCTTATTCAATT (SEQ ID NO: 66) und ACAATCGTAATCAGTTAG (SEQ ID NO: 67) unver?ndert oder im Wesentlichen unver?ndert. Im Wesentlichen unver?ndert bedeutet, dass bis zu maximal 5 Nukleotide, vorzugsweise maximal 4 Nukleotide, am meisten bevorzugt maximal 3 Nukleotide, bei diesem Motiv substituiert, deletiert und/oder insertiert sind.

Bei einem Aptamer, bei dem gegen?ber einem Aptamer, welches eine Nukleins?uresequenz umfasst, die ausgew?hlt ist aus einer der SEQ ID NO: 1 bis SEQ ID NO: 65, ein oder mehrere Nukleotide angef?gt sind, k?nnen Anf?gungen am 5'-Ende des Aptamers und/oder am 3'-Ende des Aptamers erfolgen. Bei Anf?gungen kann es sich beispielsweise um Oligonukleotide handeln, die als Spacer zwischen der Aptamersequenz und einer Markierung dienen oder um ein Oligonukleotid das eine Sequenz aufweist, die komplement?r zu einem gelabelten Oligonukleotid ist, wie beschrieben in WO2005113817. Verschiedene weitere anf?gbare Sequenzen, welche die Bindungseigenschaften des Aptamers an sein Target nicht beeintr?chtigen, sind dem Fachmann auf dem Gebiet der SELEX Verfahren bekannt, beispielsweise aus Conrad et al., ?In Vitro Selection of Nucleic Acid Aptamers That Bind Proteins, ?Methods in Enzymology, 267: 336?83 (1996); Ciesiolka et al., ?Affinity Selection-Amplification from Randomized Ribooligonucleotide Pools, ?Methods in Enzymology, 267: 315?35 (1996); and Fitzwater et al., ?A SELEX Primer, ?Methods in Enzymology, 267: 275?301 (1996).

Fragmente, auch bezeichnet als Teile oder Teilsequenzen, weisen die zuvor beschriebene Funktionalit?t der erfindungsgem??en Aptamere auf. Fragmente werden erhalten, indem man am 5'-Ende und/oder am 3'-Ende eines erfindungsgem??en Aptamers eine oder mehrere Nukleins?uren entfernt. Fragmente haben vorzugsweise eine L?nge von mindestens 10, insbesondere von mindestens 15 und besonders bevorzugt von mindestens 20 Nukleotiden, am meisten bevorzugt mindestens 30 oder mindestens 40 Nukleotiden. Fragmente sind beispielsweise solche Aptamere, bei welchen die Motive ATACCAGCTTATTCAATT (SEQ ID NO: 66) und/oder ACAATCGTAATCAGTTAG (SEQ ID NO: 67) ganz oder teilweise entfernt sind.

Der Begriff ?Derivat? bezeichnet im Zusammenhang mit der vorliegenden Erfindung ein Aptamer, das eine chemische Struktur aufweist, die in nat?rlicher DNA oder RNA nicht vorkommt.

Insbesondere bezeichnet der Begriff Derivat ein Aptamer, das eine chemische Struktur enth?lt, die von Desoxyribose, Ribose, Phosphat, Adenin (A), Guanin (G), Cytosin (C), Thymin (T), oder Uracil (U) abweichend ist. Ein Aptamer-Derivat kann an der Nukleobase, an der Pentose oder am Phosphat-R?ckgrat modifiziert sein.

Insbesondere bezeichnet der Begriff ?Derivat? ein Aptamer,

  • ? bei dem nat?rlich in DNA und RNA vorkommende Nukleotide teilweise oder vollst?ndig durch chemisch davon abweichende Nukleotide, sogenannte modifizierte Nukleotide, ersetzt sind und/oder
  • ? dessen molekulare Struktur anderweitig modifiziert ist, insbesondere durch Anbindung nicht nat?rlich in RNA oder DNA vorkommender Strukturen, und/oder
  • ? die ein modifiziertes R?ckgrat aufweisen.

Spezielle Beispiele f?r Derivate sind, ohne darauf beschr?nkt zu sein,

  • ? Aptamere, die an mindestens einem Nukleotid eine Alkylierung, Arylierung oder Acetylierung, Alkoxylierung, Halogenierung, eine Aminogruppe oder eine andere funktionelle Gruppe aufweisen. Beispiele f?r modifizierte Nukleotide sind 2'-Fluor-Ribonucleotide, 2'-NH2-, 2'-OCH3- und 2'-O-methoxyethyl-Ribonukleotide, die f?r RNA-Aptamere genutzt werden.
  • ? Aptamere, die eine Basenmodifikation aufweisen, wie Bromuridin,
  • ? Markierte Aptamere, auch bezeichnet als gelabelte Aptamere. Bevorzugte Markierungen (Label) sind visuell, optisch, photonisch, elektronisch, akustisch, opto-akustisch, nach Masse, elektrochemisch, elektrooptisch, spektrometrisch, enzymatisch, oder anderweitig chemisch, biochemisch oder physikalisch detektierbar. Label k?nnen beispielsweise angebundene Reporter-, Marker- oder Adaptermolek?le sein. Beispiele hierf?r sind markierte Aptamere, deren Markierung durch Lumineszenz, UV/VIS-Farbgebung, enzymatisch, elektrochemisch, immunologisch oder radioaktiv nachgewiesen werden kann. Beispiele f?r Markierungssubstanzen sind weiter unten bei der Erl?uterung von erfindungsgem??en Verfahren angegegeben, bei denen markierte Aptamere eingesetzt werden k?nnen.
  • ? Aptamere, die enantiomere Nukleotide aufweisen.
  • ? Aptamere, die ganz oder teilweise als Phosphorthioat-RNA oder -DNA, Phosphordithioat-RNA oder -DNA, Phosphorselenoat-RNA oder -DNA, Phosphordiselenoat-RNA oder -DNA, Phosphoroamidat-RNA oder -DNA, locked nucleic acid (LNA), peptide nucleic acid (PNA), N3'-P5' Phosphoramidat RNA/DNA, Cyclohexennukleins?ure (CeNA), Tricyclo-DNA (tcDNA) oder Spiegelmer vorliegen, oder die Phosphoramidatmorpholin (PMO) Komponenten aufweisen (siehe auch Chan et al., Clinical and Experimental Pharmacology and Physiology (2006) 33, 533?540).

Durch manche der Modifikationen k?nnen Aptamere gegen Nukleins?ure-spaltende Enzyme stabilisiert werden. Bei der Stabilisierung der Aptamere kann grunds?tzlich zwischen der nachtr?glichen Modifikation der Aptamere und der Selektion mit bereits modifizierter RNA/DNA unterschieden werden. Die Stabilisierung ber?hrt die Affinit?t der modifizierten RNA/DNA-Aptamere nicht, verhindert jedoch die schnelle Zersetzung der Aptamere in einem Organismus oder biologischen L?sungen durch RNasen/DNasen. Ein Aptamer wird im Rahmen der Erfindung als stabilisiert bezeichnet, wenn die Halbwertszeit in biologischen Seren gr?sser als eine Minute, vorzugsweise gr?sser als eine Stunde, besonders bevorzugt gr?sser als ein Tag ist. Die Aptamere k?nnen auch mit Reportermolek?len modifiziert sein, die neben der Detektion der markierten Aptamere auch zur Erh?hung der Stabilit?t beitragen k?nnen.

In einer weiteren speziellen Ausf?hrungsform betrifft die Erfindung ein Aptamer das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen bindet und das ausgew?hlt ist aus

  • a) einem Aptamer umfassend, oder bestehend aus, eine(r) Nukleins?uresequenz, mit der SEQ ID NO: 62, mit der Ma?gabe, dass Thymin durch Uracil ersetzt sein kann,
  • b) einem Aptamer, dessen Nukleins?uresequenz eine Identit?t von mindestens 70% mit der Nukleins?uresequenz eines Aptamers aus a) aufweist, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 1 bis SEQ ID NO: 4,
  • c) einem Aptamer, das mit dem komplement?ren Strang eines Aptamers aus a) hybridisiert, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 1 bis SEQ ID NO: 4,
  • d) einem Aptamer bei dem gegen?ber einem Aptamer aus a) ein oder mehrere Nukleotide substituiert, deletiert, insertiert und/oder angef?gt sind, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 1 bis SEQ ID NO: 4,
  • e) einem Fragment eines Aptamers nach a), b), c) oder d),
  • f) einem Derivat eines Aptamers nach a), b), c), d) oder e).

Zu den Punkten b)?f) gelten, auch f?r die noch folgenden Ausf?hrungsformen, analog die obigen Offenbarungen.

In einer weiteren speziellen Ausf?hrungsform betrifft die Erfindung ein Aptamer das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen bindet und das ausgew?hlt ist aus

  • a) einem Aptamer umfassend, oder bestehend aus, eine(r) Nukleins?uresequenz, mit der SEQ ID NO: 63, mit der Ma?gabe, dass Thymin durch Uracil ersetzt sein kann,
  • b) einem Aptamer, dessen Nukleins?uresequenz eine Identit?t von mindestens 70% mit der Nukleins?uresequenz eines Aptamers aus a) aufweist, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 5 bis SEQ ID NO: 8,
  • c) einem Aptamer, das mit dem komplement?ren Strang eines Aptamers aus a) hybridisiert, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 5 bis SEQ ID NO: 8,
  • d) einem Aptamer bei dem gegen?ber einem Aptamer aus a) ein oder mehrere Nukleotide substituiert, deletiert, insertiert und/oder angef?gt sind, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 5 bis SEQ ID NO: 8,
  • e) einem Fragment eines Aptamers nach a), b), c) oder d),
  • f) einem Derivat eines Aptamers nach a), b), c), d) oder e).

In noch einer weiteren speziellen Ausf?hrungsform betrifft die Erfindung ein Aptamer das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen bindet und das ausgew?hlt ist aus

  • a) einem Aptamer umfassend, oder bestehend aus, eine(r) Nukleins?uresequenz, mit der SEQ ID NO: 64, mit der Ma?gabe, dass Thymin durch Uracil ersetzt sein kann,
  • b) einem Aptamer, dessen Nukleins?uresequenz eine Identit?t von mindestens 70% mit der Nukleins?uresequenz eines Aptamers aus a) aufweist, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 9 bis SEQ ID NO: 10,
  • c) einem Aptamer, das mit dem komplement?ren Strang eines Aptamers aus a) hybridisiert, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 9 bis SEQ ID NO: 10,
  • d) einem Aptamer bei dem gegen?ber einem Aptamer aus a) ein oder mehrere Nukleotide substituiert, deletiert, insertiert und/oder angef?gt sind, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 9 bis SEQ ID NO: 10,
  • e) einem Fragment eines Aptamers nach a), b), c) oder d),
  • f) einem Derivat eines Aptamers nach a), b), c), d) oder e).

In noch einer weiteren speziellen Ausf?hrungsform betrifft die Erfindung ein Aptamer das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen bindet und das ausgew?hlt ist aus

  • a) einem Aptamer umfassend, oder bestehend aus, eine(r) Nukleins?uresequenz, mit der SEQ ID NO: 65, mit der Ma?gabe, dass Thymin durch Uracil ersetzt sein kann,
  • b) einem Aptamer, dessen Nukleins?uresequenz eine Identit?t von mindestens 70% mit der Nukleins?uresequenz eines Aptamers aus a) aufweist, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 11 bis SEQ ID NO: 12,
  • c) einem Aptamer, das mit dem komplement?ren Strang eines Aptamers aus a) hybridisiert, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 11 bis SEQ ID NO: 12,
  • d) einem Aptamer bei dem gegen?ber einem Aptamer aus a) ein oder mehrere Nukleotide substituiert, deletiert, insertiert und/oder angef?gt sind, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 11 bis SEQ ID NO: 12,
  • e) einem Fragment eines Aptamers nach a), b), c) oder d),
  • f) einem Derivat eines Aptamers nach a), b), c), d) oder e).

Eine spezielle Ausf?hrungsform der Erfindung betrifft ein Aptamer, das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen bindet, und das ausgew?hlt ist aus

  • a) einem Aptamer umfassend, oder bestehend aus, eine(r) Nukleins?uresequenz, die ausgew?hlt ist aus der Gruppe bestehend aus SEQ ID NO: 1 bis SEQ ID NO: 65, wobei
    am 5'-Ende der Nukleins?uresequenz der SEQ ID NO: 1 bis SEQ ID NO: 65 ein Oligonukleotid mit der Sequenz 5' ATACCAGCTTATTCAATT 3' (SEQ ID NO: 66) entfernt ist und/oder
    am 3'-Ende der Nukleins?uresequenz der SEQ ID NO: 1 bis SEQ ID NO: 65 ein Oligonukleotid mit der Sequenz 5' ACAATCGTAATCAGTTAG 3' (SEQ ID NO: 67) entfernt ist,
    mit der Ma?gabe, dass Thymin durch Uracil ersetzt sein kann,
  • b) einem Aptamer, dessen Nukleins?uresequenz eine Identit?t von mindestens 70% mit der Nukleins?uresequenz eines Aptamers aus a) aufweist,
  • c) einem Aptamer, das mit dem komplement?ren Strang eines Aptamers aus a) hybridisiert,
  • d) einem Aptamer bei dem gegen?ber einem Aptamer aus a) ein oder mehrere Nukleotide substituiert, deletiert, insertiert und/oder angef?gt sind,
  • e) einem Fragment eines Aptamers nach a), b), c) oder d),
  • f) einem Derivat eines Aptamers nach a), b), c), d) oder e).

Die Bindungsf?higkeit der erfindungsgem??en Aptamere wird durch die Affinit?t (Sensitivit?t) der Bindung (ausgedr?ckt durch die Dissoziationskonstante) beschrieben.

In einem weiteren Aspekt betrifft die Erfindung ein Arzneimittel, insbesondere zur Diagnose, Prophylaxe und/oder Behandlung von Erkrankungen, die auf Staphylococcus aureus, Streptococcus und/oder Peptostreptococcus zur?ckzuf?hren sind, umfassend ein oder mehrere verschiedene erfindungsgem??e Aptamere wie zuvor beschrieben. Mit dem Begriff Prophylaxe kann beispielsweise gemeint sein, dass Staphylococcus aureus, Streptococcus oder Peptostreptococcus durch Anbindung eines erfindungsgem??en Aptamers unsch?dlich gemacht werden und dadurch eine Infektion eines Organismus verhindert wird.

Ferner betrifft die Erfindung auch die Verwendung der erfindungsgem??en Aptamere zur Diagnose, Prophylaxe, Behandlung und/oder Therapie von Erkrankungen, die auf Staphylococcus aureus, Streptococcus oder Peptostreptococcus zur?ckzuf?hren sind, sowie die Verwendung der erfindungsgem??en Aptamere zur Herstellung eines Arzneimittels zur Diagnose, Prophylaxe, Behandlung und/oder Therapie von Erkrankungen, die auf Staphylococcus aureus, Streptococcus oder Peptostreptococcus zur?ckzuf?hren sind.

Ein Arzneimittel im Sinne der Erfindung ist jedes Mittel, welches in der Prophylaxe, Diagnose, Therapie, Verlaufskontrolle oder Nachbehandlung von Patienten eingesetzt werden kann, die zumindest zeitweise eine pathogene Modifikation des Gesamtzustandes bzw. des Zustandes einzelner Teile des Patientenorganismus zeigen. Das Arzneimittel kann ein Arzneimittel f?r Menschen wie auch f?r Tiere sein. Erkrankungen, die auf Staphylococcus aureus zur?ckzuf?hren und mit einem erfindungsgem??en Arzneimittel behandelbar sind, sind insbesondere Sepsis, Haut- und Wundinfektionen, Pneumonien, Abszesse, Furunkel, Karbunkel, Endokarditis, Muskelerkrankungen (Pyomyositis), Osteomyelitis, Lebensmittelvergiftungen durch S. aureus Exotoxine, Toxisches Schock-Syndrom (TSS) Sepsis und Mastitis bei Tieren.

Das erfindungsgem??e Arzneimittel enth?lt vorzugsweise pharmazeutisch vertragliche Hilfsstoffe und/oder Tr?gerstoffe, die dem Fachmann bekannt sind.

Das Arzneimittel kann das Aptamer beispielsweise als ein pharmazeutisch akzeptables Salz umfassen. Hierbei kann es sich beispielsweise um Salze anorganischer S?uren, wie z. B. der Phosphors?ure, oder um Salze organischer S?uren handeln. Die jeweilige Dosis bzw. der Dosisbereich f?r die Gabe des erfindungsgem??en Arzneimittels ist gro? genug, um den gew?nschten prophylaktischen oder therapeutischen Effekt der Bindung an Protein A, G oder L zu erreichen. Im Allgemeinen wird die Dosis mit dem Alter, der Konstitution und dem Geschlecht des Patienten variieren, sowie die Schwere der Erkrankung ber?cksichtigen. Es versteht sich, dass die spezifische Dosis, H?ufigkeit und Dauer der Verabreichung dar?ber hinaus von einer Vielzahl an Faktoren abh?ngen, wie z. B. der Bindungsf?higkeit der Aptamere, Ern?hrungsgewohnheiten des zu behandelnden Individuums, Art der Verabreichung, Ausscheidungsrate und Kombination mit anderen Medikamenten. Die exakte Dosis ist durch einen Fachmann mit bekannten Mitteln und Methoden feststellbar.

Zur Unterst?tzung der medizinischen Wirkung kann das Arzneimittel in einer bevorzugten Ausf?hrungsform der Erfindung auch weitere Wirkstoffe umfassen, wie z. B. Antik?rper.

Das Arzneimittel der vorliegenden Erfindung kann oral, transmucosal, rektal, pulmonal, enteral und/oder parenteral angewendet werden. Bevorzugt ist eine direkte Injektion in den K?rper. Die gew?hlte Art der Verabreichung richtet sich nach der Indikation, der zu verabreichenden Dosis, Individuums-spezifischen Parametern etc. Insbesondere erm?glichen die verschiedenen Arten der Verabreichung eine ortspezifische Therapie, die Nebenwirkungen minimiert und die Wirkstoffdosis verringert. Bevorzugte Injektionen sind die intradermale, subkutane, intramuskul?re oder intraven?se Injektion. Die Applikation kann z. B. mit Hilfe sogenannter Impfpistolen, die die DNA mittels Goldkugeln in die Haut einbringen, oder mittels Spritzen, die die DNA unter die Haut oder in den Muskel einbringen, geschehen. Es ist auch m?glich, das Aptamer als Aerosol bereitzustellen, welches von dem Organismus, bevorzugt einem humanen Patienten, inhaliert wird.

Um die protektive oder therapeutische Wirkung der erfindungsgem??en Aptamere zu erh?hen, k?nnen den daraus hergestellten pharmazeutischen Mitteln pharmazeutisch vertr?gliche Hilfsstoffe, wie z. B. Adjuvantien, zugesetzt werden. Im Sinne der Erfindung ist jede Substanz, die mit den erfindungsgem??en DNA-Aptameren eine Wirkung erm?glicht, verst?rkt oder modifiziert, ein Adjuvants. Bekannte Adjuvantien sind beispielsweise Aluminiumverbindungen, wie z. B. Aluminiumhydroxid oder Aluminiumphosphat, Saponine, wie z. B. OS 21, Muramyldipeptid oder Muramyltripeptid, Proteine, wie z. B. Gammainterferon oder TNF, MF 59, Phosphatdibylcholin, Squalen oder Polyole. Des Weiteren kann DNA, die eine immunstimulatorische Eigenschaft hat, oder die ein Protein mit Adjuvants-Effekt kodiert, wie z. B. ein Cytokin, parallel oder in einem Konstrukt appliziert werden.

Das pharmazeutische Mittel kann beispielsweise als Tablette, Kapsel, Pulver, L?sung, Dispersion oder Suspension vorliegen. Die Darreichungsformen des pharmazeutischen Mittels werden mit den ?blichen festen oder fl?ssigen Tr?gerstoffen und/oder Verd?nnungsmitteln und den ?blicherweise eingesetzten Hilfsstoffen entsprechend der gew?nschten Applikationsart in einer geeigneten Dosierung und in an sich bekannter Weise hergestellt.

In einem weiteren Aspekt betrifft die Erfindung ein Verfahren zum Nachweis von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bei dem

  • a) ein oder mehrere verschiedene erfindungsgem??e Aptamere, wie zuvor beschrieben, mit einer Probe, die Protein A, G oder L, die Protein A, G oder L enthaltende Substanz oder den Mikroorganismus enth?lt, in Kontakt gebracht wird und
  • b) eine Bindung zwischen dem/den Aptamer(en) und Protein A, G oder L, oder zwischen dem/den Aptamer(en) und der Substanz, oder zwischen dem/den Aptamer(en) und dem Mikroorganismus nachgewiesen wird.

Das Verfahren kann sowohl ein qualitatives als auch ein quantitatives Nachweisverfahren sein. Die Verfahrenschritte a) und b) k?nnen je nach konkreter Verfahrensgestaltung gleichzeitig oder im Wesentlichen gleichzeitig erfolgen.

Das Verfahren ist insbesondere zum Einsatz in der Lebensmittel-, Wasser- und Umweltanalytik, der Wasserbehandlung und der Wasseraufbereitung, insbesondere von Trinkwasser und Abwasser, der Diagnostik sowie zur Anwendung in Krankenh?usern und Pflegeeinrichtungen geeignet.

Das Verfahren eignet sich insbesondere zum Nachweis von Staphylococcus aureus in beliebigen Medien und Umgebungen, insbesondere in Wasser und anderen Fl?ssigkeiten, wie beispielsweise in Trink- und Abwasserproben. Im Fall von Staphylococcus aureus bindet das erfindungsgem??e Aptamer an Protein A, das in der Zellwand vorkommt und f?r das Aptamer zug?nglich ist. Das Aptamer kann ebenfalls an andere Keime binden, die Protein A, G oder L enthalten, beispielsweise als Oberfl?chenprotein in der Zellwand. Sofern das Protein A, G oder L nicht an der Oberfl?che eines Mikroorganismus sitzt, besteht die M?glichkeit, den Organismus zu zerst?ren, um darin enthaltenes Protein A, G oder L zum Nachweis freizusetzen.

Eine Probe im Sinne des obigen Nachweisverfahrens ist ein bereitgestelltes oder durch Probenentnahme erhaltenes Material, von dem angenommen wird, dass es Protein A, G oder L, Protein A, G oder L enthaltende Substanz oder einen Protein A, G oder L enthaltenden Mikroorganismus (zusammenfassend bezeichnet als ?Target? oder im Rahmen dieses Nachweisverfahrens auch als ?Analyt?) umfasst, und das auf das Vorhandensein Target gepr?ft werden soll.

Eine Probe kann eine Wasserprobe, insbesondere eine Trinkwasser-, Grundwasser, Oberfl?chenwasser oder Abwasserprobe, eine Probe von anderweitigem, aus der Umwelt entnommenem Material, eine klinische Probe oder eine Lebensmittelprobe sein.

Eine Probe k?nnen weiterhin alle biologischen Materialien sein, die von Individuen isoliert worden sind, beispielsweise biologische Gewebe und Fl?ssigkeiten, zu denen u. a. Blut, Haut, Plasma, Serum, Lymphe, Urin, Gehirnfl?ssigkeit, Tr?nen, Abstriche, Gewebeproben, Organe und Tumore z?hlen. Vorliegend sind in Proben auch Bestandteile von Zellkulturen eingeschlossen. Die Probenentnahme erfolgt insbesondere so, dass die entnommene Teilmenge einem Durchschnitt der gesamten Menge entspricht. Die durch Untersuchung der Probe ermittelten Merkmale dienen der Beurteilung der durch die Probe erfassten Menge, die wiederum R?ckschl?sse auf die Gesamtmenge, beispielsweise das Blut bzw. die Lymphe in einem Organismus, zulasst. F?r die Untersuchung k?nnen die Proben vorbehandelt, wie z. B. durch Mischen, Zugabe von Enzymen oder Markern, oder aufgereinigt werden.

Wird das Aptamer mit dem Target (Protein A, G oder L, Protein A, G oder L enthaltende Substanz oder Protein A, G oder L enthaltender Mikroorganismus) in Kontakt gebracht, so bildet sich ein Aptamer-Target-Komplex durch Bindung des Aptamers an das Target. Die Bindung bzw. das Bindungsereignis kann beispielsweise visuell, optisch, photonisch, elektronisch, akustisch, opto-akustisch, nach Masse, elektrochemisch, elektrooptisch, spektrometrisch, enzymatisch, oder anderweitig chemisch, biochemisch oder physikalisch nachgewiesen werden.

Bei einem markierungsfreien Nachweis wird das Aptamer beispielsweise auf einer Oberfl?che fixiert und die ?nderung der Schichtdicke nach Anlagerung des Targets mit einer der genannten Methoden bestimmt, wie z. B. ?ber eine ?nderung der optischen Eigenschaften der Sensorschicht (z. B. Brechungsindex). Ein weiteres Verfahren des markierungsfreien Nachweises ist die Messung der Masse?nderung nach Bindung des Aptamers an das Target mit einer Mikrowaage, oder die Messung einer Frequenz?nderung eines Schwingquarzes nach Bindung des Aptamers an das Target, welches auf der Oberfl?che des Schwingquarzes bereitgestellt wird.

In F?llen, in denen die Komplexierung nicht direkt detektierbar ist, kann der Komplex durch eine Markierung sichtbar gemacht werden, beispielsweise in einer Indikatorreaktion nach einer direkten oder indirekten Kopplung eines Komplexpartners mit einer Markierungssubstanz. Entweder kann das verwendete Aptamer oder das Target mit einer Markierung (Label) versehen sein. Bevorzugt ist das Aptamer markiert.

Bevorzugte Markierungen (Label) sind visuell, optisch, photonisch, elektronisch, akustisch, opto-akustisch, nach Masse, elektrochemisch, elektrooptisch, spektrometrisch, enzymatisch, oder anderweitig physikalisch, chemisch oder biochemisch detektierbar. In einer Ausf?hrungsform des Verfahrens wird die Markierung durch Lumineszenz, UV/VIS-Spektroskopie, enzymatisch, elektrochemisch oder radioaktiv nachgewiesen.

Lumineszenz betrifft die Emission von Licht. Im erfindungsgem??en Verfahren finden beispielsweise die Photolumineszenz, die Chemilumineszenz und die Biolumineszenz zum Nachweis der Markierung Anwendung. Bei der Photolumineszenz oder Fluoreszenz erfolgt die Anregung durch Absorption von Photonen. Beispielhafte Fluorophore sind, ohne Beschr?nkung, Bisbenzimidazol, Fluoreszein, Acridinorange, Cy5, Cy3 oder Propidiumiodid, die kovalent an Aptamere gekoppelt werden k?nnen, Tetramethyl-6-Carboxyrhodamin (TAMRA), Texas Red TR, Rhodamin, Alexa Fluor Farbstoffe (u. a. Fluoreszenzfarbstoffe verschiedener Wellenl?ngen von verschiedenen Firmen). Die Auswertung geschieht visuell oder mit entsprechenden Messger?ten, z. B. im Multilabel Counter, im Fluoreszenzmikroskop, oder durch Durchflusszytometrie, z. B. im Cytofluorimeter. Chemilumineszenz beschreibt die Emission sichtbaren Lichts als Folge einer chemischen Reaktion. Biolumineszenz bezeichnet die Emission sichtbaren Lichts als Folge einer Enzymreaktion, beispielsweise einer durch das Enzym Luciferase katalysierten Redoxreaktion.

Andere Markierungsstoffe sind Katalysatoren, kolloidale metallische Teilchen, z. B. Gold-Nanopartikel, kolloidale nicht metallische Teilchen, Quantum Dots, organische Polymere, Latexteilchen, oder Liposome mit signalerzeugenden Stoffen. Kolloidale Teilchen k?nnen kolorimetrisch nachgewiesen werden.

Auch einsetzbar sind visuell detektierbare Farbstoffe, wie beispielsweise interkalierende Farbstoffe.

Einsetzbar als Marker sind auch Enzyme, deren enzymatische Reaktion durch den Verbrauch oder die Entstehung detektierbarer Substrate oder Produkte gekennzeichnet ist, wobei ohne Beschr?nkung eine optische oder elektrochemische Detektion angewandt werden kann. Ein Nachweis kann z. B. mit Enzymen als Markierungssubstanzen gef?hrt werden, die Substrate zu farbigen Produkten umsetzen, vorzugsweise Peroxidase, Green Fluoreszent Protein (GFP), Luciferase, [beta]-Galactosidase oder Alkalische Phosphatase. Beispielsweise wird das farblose Substrat X-Gal durch die Aktivit?t der [beta]-Galactosidase zu einem blauen Produkt umgesetzt, dessen Farbgebung visuell erfasst wird.

Ein oben genanntes enzymatisches Marker- und Nachweissystem verwendet Alkalische Phosphatase. Mit Alkalischer Phosphatase (AP) sind verschiedene Nachweise m?glich, wie nachfolgend beispielhaft dargestellt:

  • ? elektrochemischer Nachweis: Substrat Phenylphosphat, enzymatische Reaktion von APP bildet Phenol, wird an Phenolsensor (z. B. mit immobilisierter Tyrosinase) elektrochemisch detektiert
  • ? Messung der Farbreaktion: Substrat p-Nitrophenylphosphat, enzymatische Reaktion von APP bildet p-Nitrophenol, ist gelb gef?rbt
  • ? Fluoreszenz-Nachweis: Substrat 4-Methylumbelliferonylphosphat: enzymatische Reaktion von APP bildet Methylumbelliferonyl-Rest, der nach Anregung Fluoreszenz freisetzt
  • ? f?r Chemilumineszenz-Nachweis: Substrat AMPPD (3-(2'-Spiroadamantan)-4-Methoxy-4-(3''-Phosphoryloxy)phenyl-1,2-Dioxetan): enzymatische Reaktion von APP bildet AMP-D und setzt hv (Chemilumineszenz) frei

Ferner setzt APP 5-Brom-4-Chlor-3-Indolylphosphat (BCIP oder X-Phosphat) und Nitroblau-Tetrazoliumsalz (NBT) farbig um. Die Farbstoffe fallen dabei in unmittelbarer N?he der AP-Molek?le aus und f?rben die Umgebung der gebundenen Verbindungen dunkelviolett an.

Die Peroxidase katalysiert z. B. die Oxidation von ABTS (2,2'-Azino-bis-[3-ethylbenzthiazolin-6-sulfons?ure]) in Gegenwart von H2O2. Aufgrund der Enzymstabilit?t und einer Vielzahl an m?glichen Substraten ist die Meerettich-Peroxidase bevorzugt. Weitere Enzymmarker, die die Erzeugung detektierbarer Produkte katalysieren sind Chloramphenicolacetyltransferase (CAT) und Glutathion-S-Transferase (GST).

Der Nachweis kann auch mittels radioaktiver Isotope erfolgen, mit denen das Aptamer markiert ist, vorzugsweise 3H, 14C, 32P, 33P, 35S oder 125I, besonders bevorzugt 32P, 33P oder 125I. Bei der Szintillationsz?hlung wird die vom radioaktiv-markierten Aptamer-Target-Komplex abgegebene radioaktive Strahlung indirekt gemessen. Eine Szintillatorsubstanz wird durch die radioaktive Strahlung angeregt. Beim ?bergang in den Grundzustand wird die Anregungsenergie wieder als Lichtblitze freigesetzt, welche durch einen Photoelektronenvervielfacher (Photomultiplier) verst?rkt und gez?hlt werden.

Die Aptamere k?nnen auch mit Digoxigenin oder Biotin markiert sein, die beispielsweise durch Antik?rper oder Streptavidin gebunden werden, die wiederum eine Markierung tragen k?nnen, wie z. B. ein Enzymkonjugat. Ist der Antik?rper an ein Enzym gekoppelt, kann ein ELISA (enzyme-linked immunosorbent assay) zum Nachweis erfolgen, was nachfolgend noch erl?utert ist. Die vorherige kovalente Verkn?pfung (Konjugation) eines Antik?rpers mit einem Enzym kann auf verschiedene bekannte Arten erfolgen. Der Nachweis der Antik?rper-Bindung kann auch radioaktiv in einem RIA (radioactive immunoassay) mit radioaktiven Isotopen, vorzugsweise mit 125 I, oder durch Fluoreszenz in einem FIA (Fluoroimmunoassay) mit Fluorophoren, vorzugsweise mit Fluorescein oder FITC, erfolgen.

Die genannten Methoden schlie?en vorzugsweise Waschschritte ein, um ungebundene und/oder unspezifisch gebundene Aptamere und/oder Nachweisreagenzien abzutrennen. Die Durchf?hrung s?mtlicher Nachweisverfahren ist dem Fachmann bekannt. Der direkte Nachweis der Markierung ist im vorliegenden Verfahren der Erfindung bevorzugt, insbesondere der direkte Nachweis durch Fluoreszenz.

In einer weiteren Ausgestaltung des Verfahrens wird der Nachweis in-situ durchgef?hrt. Diese Umsetzung erfordert einen geeigneten Inkubationsraum, auf dem der Nachweis einfach durchgef?hrt und sichtbar gemacht werden kann. Hierzu wird vorteilhaft ein fester Tr?ger verwendet, der es erm?glicht, Probe, Aptamere und ggf. Nachweisreagenzien der Komplexe zu fixieren. Die Aptamere k?nnen sowohl vor oder nach der Probe auf den festen Tr?ger aufgebracht werden. Methoden der Immobilisierung vorgenannter Aptamere sind dem Fachmann bekannt. Beispiele sind weiter unten angegeben. F?r den Nachweis kommen alle Nachweise in Betracht, die zuvor bereits genannt sind, wie markierungsfreie Nachweise und Nachweise mit Verwendung einer Markierung. Bei einem Farbnachweis k?nnen die Aptamere so markiert sein, so dass direkt im Anschluss an die Inkubation ein Ablesen und Auswerten realisiert werden kann.

In den zuvor erl?uterten Verfahren und allen anderen von dieser Erfindung offenbarten Verfahren kann das erfindungsgem??e Aptamer allein, oder eine Mischung verschiedener erfindungsgem??er Aptamere eingesetzt werden. Erfindungsgem??e Aptamere k?nnen auch in Kombination mit anderen Aptameren angewendet werden. Eine Kombination mit anderen Aptameren f?r andere Targets (d. h. andere Targets als Protein A, G oder L, Protein A, G oder L enthaltende Substanzen, und Protein A, G oder L enthaltende Mikroorganismen) bietet den Vorteil, dass ein entsprechendes Verfahren gleichzeitig auch zum Nachweis, Anreicherung, Abtrennung und/oder Isolierung anderer Targets anwendbar ist.

Wie bereits erw?hnt, k?nnen die Probe oder das Aptamer je nach Verfahrensgestaltung an eine feste Phase immobilisiert sein. In dem Verfahren k?nnen beispielsweise (Micro)-Arrays des erfindungsgem??en Aptamers, oder Mikrotiterplatten-Testsysteme eingesetzt werden.

Aptamere binden an das Target ?hnlich stark wie Antik?rper an ihr Target (Antigen). Daher ist das oben beschriebene Nachweisverfahren analog durchf?hrbar wie bekannte Immunoassays, wobei im Vergleich zu einem bekannten Immunoassay einer oder mehrere Antik?rper durch ein erfindungsgem??es Aptamer ersetzt sind.

Beispielsweise ist es m?glich, das Nachweisverfahrens in Form eines kompetitiven Assays oder eines Sandwich-Assays durchzuf?hren.

Bei einer Ausf?hrungsform eines kompetitiven Assays wird ein f?r das Target spezifisches erfindungsgem??es Aptamer an eine feste Phase gebunden. Anschlie?end erfolgt die Zugabe der Probenl?sung, die das zu messende Target enth?lt und gleichzeitig mit einer bekannten Konzentration an markiertem Target versetzt ist. Sowohl das in der Probenl?sung in unbekannter Konzentration vorliegende unmarkierte Target als auch das markierte Target konkurrieren um die Bindung an das gebundene Aptamer. Je h?her die Konzentration des Targets in der Probe ist, desto weniger markiertes Target wird demzufolge an das Aptamer gebunden. ?ber die Erkennung und gegebenenfalls eine quantitative Bestimmung der Markierung sind der Nachweis des Targets in der Probe und die Messung seiner Konzentration m?glich.

In einer anderen Ausf?hrungsform eines kompetetiven Assays wird ebenfalls zun?chst ein f?r das Target spezifisches erfindungsgem??es Aptamer an eine feste Phase gebunden. Daran wird markiertes Target gebunden. Die Messung der Markierung ergibt das Ausgangssignal. Die Zugabe von Probe mit unmarkiertem Target verdr?ngt gebundenes markiertes Target, und das abnehmende Messignal ist der Probenkonzentration proportional.

Bei einem klassischen immunologischen Sandwich-Assay werden mindestens zwei Antik?rper eingesetzt. Zun?chst wird einer der beiden Antik?rper an eine feste Phase immobilisiert. Dieser wird als Prim?rantik?rper oder auch als F?nger bezeichnet. Nach der Zugabe der Probe bindet das darin enthaltene Antigen an den Prim?rantik?rper. Anschlie?end wird die Probenl?sung entfernt und der als Sekund?rantik?rper oder Detektor bezeichnete zweite Antik?rper in gel?ster Form auf die feste Phase gegeben. Der Detektor bindet nun ebenfalls an das durch den Prim?rantik?rper gebundene Antigen. F?r den Nachweis und die Quantifizierung ist der Sekund?rantik?rper entweder selbst markiert, oder er wird ?ber ein markiertes Reagens nachgewiesen. in der vorliegenden Erfindung wird dieses Verfahren dahin gehend abgewandelt, dass entweder der Prim?rantik?rper oder der Sekund?rantik?rper, oder beide, durch ein erfindungsgem??es Aptamer ersetzt werden und dass das Antigen ein Target f?r das Aptamer, also Protein A, G oder L, eine Protein A, G oder L enthaltende Substanz oder ein Protein A, G oder L enthaltender Mikroorganismus, ist. Der Assay kann mit allen bekannten festen Phasen durchgef?hrt werden, beispielsweise Mikrotiterplatten, Streifen, Membranen, K?vetten etc.

Die Erfindung stellt somit in einer speziellen Ausf?hrungsform ein Verfahren zum Nachweis von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, zur Verf?gung, bei dem

  • a) ein erster Antik?rper oder ein erfindungsgem??es Aptamer, der/das f?r Protein A, G oder L spezifisch ist, an eine feste Phase immobilisiert wird,
  • b) die feste Phase mit daran immobilisiertem Antik?rper oder Aptamer mit einer Probe, die Protein A, G oder L, die Protein A, G oder L enthaltende Substanz oder den Protein A, G oder L enthaltenden Mikroorganismus enth?lt, inkubiert wird, und
  • c) die feste Phase mit einem zweiten Antik?rper oder einem erfindungsgem??en Aptamer, der/das f?r Protein A, G oder L spezifisch ist, inkubiert wird und
  • d) eine Bindung zwischen dem zweiten Antik?rper oder dem Aptamer und Protein A, G oder L, Protein A, G oder L enthaltender Substanzen oder Protein A, G oder L enthaltendem Mikroorganismus nachgewiesen wird,
    unter der Bedingung, dass mindestens in einem der Schritte a) oder c) ein erfindungsgem??es Aptamer statt eines Antik?rpers eingesetzt wird.

Die Immobilisierung in Schritt a) kann mit allen ?blichen Techniken erfolgen, die auch aus immunologischen Assays bekannt sind. Der Nachweis in Schritt d) kann im Falle eines Antik?rpers durch die bekannten Methoden erfolgen, die aus immunologischen direkten und indirekten Sandwich-Assays bekannt sind. Entweder kann der Antik?rper selbst markiert sein, beispielsweise durch Anbindung eines Enzyms, das eine Farbreaktion zum Nachweis katalysieren kann, oder es kann ein dritter Antik?rper zugegeben werden, der seinerseits an den zweiten Antik?rper bindet und eine Markierung aufweist. Sofern in Schritt c) ein Aptamer eingesetzt wird, ist dieses vorzugsweise ein markiertes Aptamer, das mit geeigneten Nachweisreaktionen detektiert werden kann, wie zuvor bereits beschrieben. Zwischen den genannten Schritten a)?d) werden vorzugsweise Waschschritte durchgef?hrt, z. B. mit ?blichen und bekannten Waschpuffern. Der Begriff Immobilierung bedeutet bei diesem Verfahren, dass der in Schritt a) immobilisierte Antik?rper oder das Aptamer nicht durch einen Waschschritt von der festen Phase entfernt wird.

In einem weiteren Aspekt betrifft die Erfindung ein Verfahren zur Anreicherung, Abtrennung und/oder Isolierung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bei dem

  • a) ein oder mehrere verschiedene Aptamere wie zuvor beschrieben mit einer Probe, die Protein A, G oder L, eine Protein A, G oder L enthaltende Substanz oder einen Protein A, G oder L enthaltenden Mikroorganismus enth?lt, in Kontakt gebracht wird/werden, wobei ein Komplex oder Komplexe aus dem/den Aptamer(en) und Protein A, G oder L, aus dem/den Aptamer(en) und der Protein A, G oder L enthaltenden Substanz oder aus dem/den Aptamer(en) und dem Protein A, G oder L enthaltenden Mikroorganismus gebildet wird,
  • b) der/die Komplex(e) und die ?brige Probe voneinander getrennt werden, und
  • c) optional Protein A, G oder L, die Protein A, G oder L enthaltende Substanz oder der Protein A, G oder L enthaltende Mikroorganismus aus dem Komplex isoliert wird.

Eine ?Probe? im Sinne dieses Verfahrens ist ebenso definiert wie eine Probe im Sinne des zuvor beschriebenen Nachweisverfahrens. Eine Probe ist insbesondere eine Wasserprobe, wie zum Beispiel eine Trinkwasser-, Grundwasser-, Oberfl?chenwasser- oder Abwasserprobe, eine Probe von anderweitigem aus der Umwelt entnommenem Material, oder eine Lebensmittelprobe.

Auch dieses Verfahren kommt insbesondere zum Einsatz in der Lebensmittel-, Wasserund Umweltanalytik, der Wasserbehandlung und der Wasseraufbereitung, insbesondere von Trinkwasser und Abwasser, der Diagnostik sowie in Krankenh?usern und Pflegeeinrichtungen.

Eine ?Abtrennung? von Protein A, G oder L, Protein A, G oder L enthaltender Substanz oder eines Protein A, G oder L enthaltenden Mikroorganismus (zusammengefasst bezeichnet als ?Target?) aus einer Probe kann, im Rahmen der analytischen Nachweisgrenze, vollst?ndig sein oder nicht vollst?ndig sein. Eine vollst?ndige Abtrennung wird hierin auch als ?Entfernung? bezeichnet. Mit diesem Verfahren kann insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus aus Umgebungen, in denen es unerw?nscht ist, abgetrennt werden, beispielsweise aus w?ssrigen oder anderen fl?ssigen Proben.

Eine ?Anreicherung? wird in Schritt b) erzielt, wenn der gebildete Aptamer-Target-Komplex und die ?brige Probe voneinander getrennt werden. Es werden zwei Fraktionen erhalten, wobei in der Fraktion, die den Komplex enth?lt, der Komplex angereichert ist. Der Begriff ?Anreicherung? kann sich auf den Komplex beziehen, der aus Aptamer und Protein A, G oder L, aus Aptamer und der Protein A, G oder L enthaltenden Substanz oder aus Aptamer und dem Protein A, G oder L enthaltenden Mikroorganismus gebildet ist, oder auf das Protein A, G oder L, die Protein A, G oder L enthaltende Substanz oder den Protein A, G oder L enthaltenden Mikroorganismus (zusammengefasst bezeichnet als ?Target?) selbst, d. h. das Target ohne Aptamer. Zur Anreicherung des Targets kann der Verfahrensschritt c) durchgef?hrt werden. Eine Anreicherung bedeutet mit anderen Worten eine Erh?hung der Konzentration des Aptamer-Target-Komplexes oder des Targets selbst.

Der Begriff ?Isolierung? kann sich auf den Komplex beziehen, der aus Aptamer und Protein A, G oder L, aus Aptamer und der Protein A, G oder L enthaltenden Substanz oder aus Aptamer und dem Protein A, G oder L enthaltenden Mikroorganismus gebildet ist, oder auf das Protein A, G oder L, die Protein A, G oder L enthaltende Substanz oder den Protein A, G oder L enthaltenden Mikroorganismus selbst. Daher ist der letzte Verfahrensschritt optional.

Die oben beschriebene Abtrennung, Anreicherung, und Isolierung k?nnen mit dem Verfahren gleichzeitig verwirklicht werden. Vorzugsweise wird das Verfahren aber zu einem dieser Zwecke durchgef?hrt.

Der Begriff ?Komplex? bezeichnet die Struktur, die bei der Bindung des Aptamers an sein Target gebildet wird. Somit bezeichnet der Begriff ?Komplex? eine Aptamer-Target-Struktur, bei der das Aptamer an das Target gebunden ist. Wie einleitend erl?utert, erfolgt die Aptamer-Target-Bindung vorwiegend, aber nicht unbedingt ausschlie?lich, ?ber die Strukturkompatibilit?t, so genannte ?Stacking interactions? bei aromatischen Ringstrukturen (Stapelkr?fte durch Elektronenwechselwirkung mit Nachbarbasen), elektrostatische Wechselwirkungen (z. B. Van der Waals-, Ionen-, Dipolkr?fte) und Wasserstoffbr?ckenbindungen.

Die genannten Verfahrensschritte a), b) und c) k?nnen je nach Verfahrensgestaltung gleichzeitig erfolgen, und insbesondere k?nnen die Verfahrensschritte a) und b) gleichzeitig erfolgen.

Bei der Kontaktierung von Target und Aptamer kann die Bildung des Aptamer-Target-Komplexes durch Temperierung auf die optimale Aptamer-Target-Bindungstemperatur, bevorzugt 20?25?C, und/oder R?hren der Probe bef?rdert werden. Nach einer Inkubationszeit werden die Aptamer-Target-Komplexe, von der restlichen Probenl?sung abgetrennt. Geeignete Methoden sind dem Fachmann bekannt, wie z. B. Dialyse, Ultrafiltration, Gelfiltration, Chromatographie, magnetische Trennung oder Waschschritte, sofern der Komplex immobilisiert vorliegt.

Durch Ver?nderungen der f?r die Aptamerbindung erforderlichen definierten Bedingungen wird im optionalen Schritt c) der Aptamer-Target-Komplex getrennt. Hierzu sind physiko-chemische Einwirkungen, wie z. B. eine Variation von Salzkonzentration oder pH oder eine hitzebedingte Denaturierung, denkbar. Abschlie?end ist eine weitere Reinigung des Targets m?glich, wobei das Aptamer zuvor abgebaut werden kann, z. B. durch saure (thermische) Hydrolyse oder DNasen. Sofern das Aptamer immobilisiert ist, kann das Target eluiert werden, wie z. B. von einer S?ule, die anschlie?end regeneriert und wiederverwendet wird.

Erfindungsgem?? k?nnen die Aptamere auch an einer festen Phase, genauer gesagt an der Oberfl?che einer festen Phase, immobilisiert sein, vorzugsweise ?ber ein Spacer-Molek?l, das beispielsweise eine Linker-Nukleins?ure sein kann. Geeignete Methoden der Immobilisierung sind dem Fachmann bekannt, die sowohl mit einer kovalenten Kopplung als auch einer nicht-kovalenten Kopplung mittels geeigneter Affinit?tspaare, wie z. B. Biotin/Streptavidin, einhergehen k?nnen. Die feste Phase k?nnen beispielsweise Platten, Streifen, Membranen, Filme, Gele, Perlen, Mikro- und Nanopartikel sein. Beispielhafte Tr?germaterialien sind anorganische und organische Polymere, Keramiken, Glaser, Metalle, insbesondere Edelmetalle. Hierzu z?hlen Kunststoffe, beispielsweise auf Basis von Polystyrol. Des Weiteren sind Biopolymere, vorzugsweise Cellulose, Dextran, Agar, Agarose und Sephadex, die funktionalisiert sein k?nnen, insbesondere als Nitrocellulose oder Cyanbromid-Sephadex, als Polymere im erfindungsgem??en Verfahren einsetzbar. Aptamere k?nnen an Magnetic Beads gebunden werden, deren Oberfl?che z. B. mit Tosyl- oder Epoxy-Gruppen, mit Amino- oder Carboxyl-Gruppen oder mit Streptavidin funktionalisiert sind. Weiterhin ist eine Kopplung von Magnetic Beads an die Desoxyribose der Aptamere, wie z. B. ?ber eine Hydrazon-Bindung, m?glich. Die Beispiele f?r Polymere sind nicht limitierend und andere sind denkbar. Bevorzugte Kombinationen von geometrischer Form und Material sind Gele aus Biopolymeren, insbesondere Agarose, und Gelmatrices aus Dextran und Sephadex, die ? beispielsweise in S?ulen verpackt ? Hohlr?ume definierter Porengr??e ausbilden. In einer speziellen Ausgestaltung ist das soeben beschriebene Abtrennungs-, Anreicherungs-, und/oder Isolierungsverfahren ein Affinit?tschromatographie-Verfahren, bei dem ein erfindungsgem??es Aptamer an einer festen Phase immobilisiert ist, vorzugsweise an K?gelchen (Beads) oder einem anderweitigen chromatographischen S?ulenmaterial, wobei alle geometrische Formen einer festen Phase verwendbar und alle oben genannten Substanzen beispielhaft einsetzbar sind.

Mit Aptamer-modifizierten Oberfl?chen k?nnen die entsprechenden Targets ausgehend von geringen Konzentrationen angereichert werden.

Die Erfindung betrifft auch die Verwendung des zuvor beschriebenen Aptamers zum Nachweis, Anreicherung, Abtrennung und/oder Isolierung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus. Insbesondere kann das Aptamer in den zuvor erl?uterten Verfahren eingesetzt werden. Der Begriff Anreicherung schlie?t die Aufreinigung des Targets mit ein.

In einem weiteren Aspekt betrifft die Erfindung auch Verfahren zur Quantifizierung der Bindung eines Immunoglobulins an Protein A, G oder L, wobei bei dem Verfahren

  • a) Protein A, G oder L oder ein Protein A, G oder L enthaltender Mikroorganismus bereitgestellt wird,
  • b) Protein A, G oder L oder der Protein A, G oder L enthaltende Mikroorganismus mit dem Immunoglobulin versetzt wird,
  • c) das in b) erzeugte Gemisch mit einem erfindungsgem??en Aptamer in Kontakt gebracht wird,
  • d) die Menge gebundenen Aptamers bestimmt wird und daraus die Menge gebundenen Immunoglobulins bestimmt wird.

Verschiedene Verfahrensvarianten sind denkbar:
In einer Variante bindet das erw?hnte Immunoglobulin an das gleiche Epitop des Protein A, G oder L wie das erfindungsgem??e Aptamer. Der Begriff ?Epitope? bedeutet dann, dass es sich um gleiche Epitope handelt, die mehrfach vorkommen weil mehrere Protein A, G oder L Molek?le im Verfahren eingesetzt werden und/oder weil Protein A, G oder L mehrere Epitope des gleichen Typs aufweist. In Schritt c) des Verfahrens bindet das Aptamer an Protein A, G oder L Molek?le, an die kein Immunoglobulin gebunden hat. Die Menge gebundenen Proteins A, G oder L wird in Schritt d) bestimmt, beispielsweise ?ber die Intensit?t eine Fluoreszenzmarkierung. Der Ort der Bindung kann bei einem Array von Protein A, G oder L durch den erkennbaren Ort der Markierung bestimmt werden.

In einer anderen Variante binden das Aptamer und das Immunoglobulin an verschiedene Epitope. Dennoch bindet das Aptamer in Schritt c) aufgrund sterischer Hinderung nicht mehr an Protein A, G oder L Molek?le, an die bereits Immunoglobulin gebunden hat. In Schritt c) des Verfahrens bindet das Aptamer an Protein A, G oder L Molek?le, an die kein Immunoglobulin gebunden hat.

Im Zusammenhang mit dem obigen Verfahren betrifft die Erfindung auch die Verwendung des zuvor beschriebenen Aptamers zur Quantifizierung der Bindung von Immunoglobulinen an Protein A, G oder L. Diese Anwendung und das zugeh?rige Verfahren sind insbesondere als Assay f?r die medizinische Diagnostik geeignet.

Die Bereitstellung von Protein A, G oder L oder des Protein A, G oder L enthaltenden Mikroorganismus kann auf verschiedene Art und Weise erfolgen. Beispielsweise kann Protein A, G oder L oder der Protein A, G oder L enthaltende Mikroorganismus in einer fl?ssigen Phase in definierter Menge bereitgestellt werden. Es ist auch m?glich, das Aptamer in definierter Menge an einer festen Phase zu immobilisieren oder Protein A, G oder L oder den Mikroorganismus in definierter Menge an einer festen Phase zu immobilisieren. Die feste Phase k?nnen beispielsweise Platten, wie beispielsweise Mikrotiterplatten, Streifen, Membranen, Filme, Gele, Perlen, Mikro- und Nanopartikel sein.

Anschlie?end wird in Schritt b) ein Immunoglobulinzugegeben, das an Protein A, G oder L oder an in der Zellwand des Mikroorganismus vorhandenes Protein A, G oder L bindet. Der Antik?rper ist ?blicherweise in einer fl?ssigen Phase suspendiert.

Sofern Protein A, G oder L oder der Mikroorganismus an einer festen Phase gebunden sind, wird nach dem Schritt b) vorzugsweise ungebundener Antik?rper durch Waschen, beispielsweise mit einem geeigneten Waschpuffer, entfernt.

Es werden nach dem Schritt b), und gegebenenfalls einem Waschschritt, mit Antik?rper belegte Protein A, G oder L Molek?le/Mikroorganismen und nicht mit Antik?rper belegte Protein A, G oder L Molek?le/Mikroorganismen erhalten, hier bezeichnet als ?Gemisch?.

Im n?chsten Schritt wird das Gemisch mit erfindungsgem??em Aptamer in Kontakt gebracht, Das Aptamer bindet an nicht mit Antik?rper belegte Protein A, G oder L Molek?le/Mikroorganismen. Nach dem Schritt c) wird vorzugsweise nicht gebundenes Aptamer durch Waschen, beispielsweise mit einem geeigneten Waschpuffer, entfernt.

Im letzten Schritt wird ermittelt, wie viel Aptamer an Protein A, G oder L oder den Mikroorganismus gebunden hat. Eine Bindung zwischen dem Aptamer und Protein A, G oder L oder dem Mikroorganismus kann nachgewiesen werden wie bereits zuvor bei dem erfindungsgem??en Nachweisverfahren erl?utert. Vorzugsweise wird ein markiertes Aptamer eingesetzt.

Eine weitere Verwendung des erfindungsgem??en Aptamers betrifft die Verwendung zur Blockierung oder Quantifizierung freier Bindungsstellen an Protein A, G oder L. Es gibt kommerziell verf?gbare Protein A, G oder L modifizierte Oberfl?chen, wie z. B. K?gelchen (Beads) oder Mikrotiterplatten.

Wird die mit Protein A, G oder L modifizierte Oberfl?che f?r die Immobilisierung von Protein A, G oder L bindenden Substanzen verwendet, k?nnen die Aptamere zur Blockierung der nach der Immobilisierung frei gebliebenen Protein A, G oder L ? Bindungsstellen benutzt werden. Dies setzt voraus, dass das Aptamer und die andere Protein A, G oder L bindende Substanz die gleiche Bindungsstelle im Protein A, G oder L haben oder sich gegenseitig in ihrer Bindungsf?higkeit beeinflussen.

In bestimmten Anwendungen kann es auch w?nschenswert sein, Protein A, G oder L an der Oberfl?che mit Aptamer zu belegen, so dass keine anderen Substanzen, insbesondere Immunoglobuline, daran binden k?nnen.

Ebenso k?nnen die Aptamere zur Quantifizierung der nach der Immobilisierung frei gebliebenen Bindungsstellen, oder anders ausgedr?ckt, zur Kontrolle der Oberfl?chenbelegung verwendet werden.

In einem weiteren Aspekt betrifft die Erfindung auch eine Aptamersonde zur Detektion von Protein A, G oder L, Protein A, G oder L enthalten Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, wobei die Sonde ein erfindungsgem??es Aptamer und ein Markierungsmittel (Label) umfasst. Das Markierungsmittel kann auf verschiedene Art und Weise an das Aptamer gebunden sein, beispielsweise, und nicht beschr?nkend, durch kovalente Bindung, Komplexierung, DNA/RNA-Hybridisierung. Beispielsweise kann ein Markierungsmittel an ein erfindungsgem??es Aptamer gebunden werden, wie in WO2005113817 beschreiben. WO2005113817 beschreibt ein Aptamer mit einem angef?gten Oligonukleotidschwanz (oligonucleotide tail) und einem Linker-Oligonukleotid, der ein Label tr?gt, wobei die Sequenz des Linker-Oligonukleotid komplement?r zu der Sequenz des Oligonukleotidschwanzes des Aptamers ist, sodass das Linker-Oligonukleotid an den Oligonukleotidschwanz des Aptamers hybridisiert und das Aptamer mit dem Label markiert wird. Eine weitere M?glichkeit ist die Bindung von Biotin an das Aptamer und die Bindung von Markierungsmittel an Steptavidin. Durch eine Biotin-Streptavidin Bindung wird das Markierungsmittel an das Aptamer gebunden.

Alle Markierungsmittel sind grunds?tzlich einsetzbar, die sich an DNA oder RNA binden lassen. Konkrete Beispiele f?r Markierungssubstanzen wurden weiter oben bei der Erl?uterung von erfindungsgem??en Verfahren angegeben, bei denen markierte Aptamere eingesetzt werden k?nnen. Beispielsweise ist die Markierung ein Farbstoff. In einer speziellen Variante ist das Markierungsmittel eine Substanz, die eine Bilderzeugung durch das markierte Aptamer in einem bildgebenden Verfahren erm?glicht. Das Bild kann durch Strahlung erzeugt sein, die ein f?r das menschliche Auge direkt sichtbares Bild erzeugt, oder durch Strahlung, die nicht direkt sichtbar ist, beispielsweise R?ntgenstrahlung oder radioaktive Strahlung, die anderweitig sichtbar gemacht wird, beispielsweise auf einem Film. Markierungsmittel k?nnen beispielsweise Lumineszenz-, Phosphoreszenz, Fluoreszenz-, radioaktive, oder UV/VIS-Markierungssubstanzen sein. Die erfindungsgem??e Sonde ist besonders f?r die in dieser Beschreibung erl?uterten Nachweis-, Anreicherungs-, Abtrennungs- und/oder Isolierungsverfahren einsetzbar, insbesondere in Assays zur Detektion von Protein A, G oder L oder Protein A, G oder L enthaltenden Mikroorganismen, wie Staphylococcus aureus, Streptococcus oder Peptostreptococcus. Assays k?nnen z. B. direkte und indirekte Sandwich-Assays sein.

In einem weiteren Aspekt betrifft die Erfindung einen Biosensor, der ein erfindungsgem??es Aptamer aufweist.

Ein solcher Biosensor weist gem?? der vorliegenden Erfindung vorzugsweise die folgenden Elemente auf:

  • ? einen Rezeptor, aufweisend oder bestehend aus einem erfindungsgem??en Aptamer, und
  • ? einen Transducer, der das Bindungsereignis zwischen Aptamer und Target in ein elektrisch quantifizierbares Signal wandelt.

Au?erdem k?nnen weitere Elemente, wie beispielsweise eine Signalverarbeitungseinrichtung, eine Ausgabeelektronik, eine Anzeigevorrichtung, eine Datenverarbeitungseinrichtung, ein Datenspeicher sowie Schnittstellen zu anderen Ger?ten vorhanden sein.

Der biologische Rezeptor des Aptamer-Biosensors weist das erfindungsgem??e Aptamer vorzugsweise in immobilisierter Form auf oder besteht nur aus dem Aptamer in immobilisierter Form. Die Funktion des Rezeptors ist die auf einem biochemischen Mechanismus beruhende Erkennung des Analyten, hier die Bindung des erfindungsgem??en Aptamers an sein Target (Protein A, G oder L, Protein A, G oder L enthaltende Substanz, Protein A, G oder L enthaltender Mikroorganismus). Aus einer Probe, die man mit dem Biosensor in Kontakt bringt, beispielsweise einem komplexen Gemisch, das Target enth?lt, kann das Target ?ber die spezifische Anbindung des Aptamers identifiziert und quantifiziert werden.

Die Spezifit?t des Biosensors wird durch den Rezeptor vorgegeben, w?hrend die Sensitivit?t des Sensors vorwiegend durch den verwendeten Transducer beeinflusst wird. Die am Rezeptor stattfindende Aptamer-Target Bindung wird durch den Transducer in ein elektronisch verwertbares Signal umgesetzt. Der Transducer wandelt das Signal aus der selektiven Erkennungsreaktion des Rezeptors (Bindung Target an Aptamer), das der Konzentration des Targets in der Probe proportional ist, in ein elektrisch quantifizierbares Messsignal um. Die Signalbildung erfolgt auf Grund der molekularen Interaktion zwischen dem Target und dem Aptamer.

Mit einem erfindungsgem??en Biosensor k?nnen vorzugsweise qualitative, quantitative und/oder halb-quantitative analytische Informationen gewonnen werden. Er ist insbesondere zum Einsatz in der Lebensmittel-, Wasser- und Umweltanalytik, der Wasserbehandlung und der Wasseraufbereitung, insbesondere von Trinkwasser und Abwasser, in der Diagnostik sowie zur Verwendung in Krankenh?usern und Pflegeeinrichtungen geeignet.

Die Kopplung zwischen Rezeptor und Transducer erfolgt vorzugsweise durch die Immobilisierung des Aptamers auf der Transduceroberfl?che, beispielsweise ?ber eine Streptavidin-Biotin-Bindung, wobei vorzugsweise das Aptamer mit Biotin verbunden ist und die Oberfl?che des Transducers immobilisiertes Streptavidin aufweist.

Die Bindung des Targets an das erfindungsgem??e Aptamer kann beispielsweise ?ber optische, mikrogravimetrische, thermische oder akustische Transducer gemessen werden, vorzugsweise ?ber optische oder mikrogravimetrische Transducer.

Die Messung in optischen Transducern kann auf Prinzipien der Photometrie beruhen, wobei beispielsweise Farb- oder Lumineszenz-Intensit?ts?nderungen erfasst werden. Zu den optischen Methoden z?hlen die Messung von Fluoreszenz, Phosphoreszenz, Biolumineszenz und Chemolumineszenz, Infrarot?berg?ngen und die Lichtstreuung. Zu den optischen Methoden z?hlt auch die Messung von Schichtdicken?nderungen wenn Target an Aptamer gebunden wird. Die Schichtdicken?nderung kann z. B. mittels Oberfl?chenplasmonenresonanz (SPR) oder reflektometrischer Interferenzspektroskopie (RIfS) durchgef?hrt werden. Ferner kann die Interferenz an d?nnen Schichten (reflektrometrische Interferenzspektroskopie) sowie die ?nderung des evaneszenten Feldes gemessen werden.

Mikrogravimetrische Transducer sind zum Beispiel QCM-Sensoren (Quartz Crystal Microbalance), die eine Masse?nderung detektieren, wenn Target an Aptamer gebunden wird.

Akustische Transducer nutzen die Frequenz?nderungen eines piezoelektrischen Schwingquarzes, der Masse?nderungen hochempfindlich nachweist, die auftreten wenn Target an Aptamer bindet. Der verwendete Quarzkristall wird in einem oszillierenden elektrischen Feld platziert und die Resonanzfrequenz des Kristalls gemessen. Eine Masse?nderung auf der Oberfl?che des Schwingquarzes, z. B. durch Reaktion des Analyten mit dem vorher auf der Kristalloberfl?che immobilisierten Rezeptor, bewirkt eine ?nderung der Resonanzfrequenz, welche quantifiziert werden kann.

Elektrochemische Transducer k?nnen z. B. die ?nderung der Konzentration redoxaktiver Marker an der Elektrodenoberfl?che messen, oder die ?nderung der Konzentration redoxaktiver Substrate oder Produkte, die z. B. in der enzymatischen Reaktion eines Enzym-Markers verbraucht werden oder entstehen.

Thermische Transducer messen die W?rmet?nung der Aptamer-Target-Bindungsreaktion.

Die Erfindung betrifft in einem weiteren Aspekt eine feste Phase, auch bezeichnet als fester Tr?ger, insbesondere zur Verwendung beim Nachweis, Anreicherung, Abtrennung und/oder Isolierung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, an dem ein erfindungsgem??es Aptamer immobilisiert ist.

Ein beispielhafter Biosensor ist im beigef?gten Ausf?hrungsbeispiel erl?utert. Anleitung zur Konstruktion weiterer Biosensoren findet der Fachmann in Cho, E. J., Lee, J.-W., Ellington, A. D. (2009): Applications of Aptamers as Sensors, Annual Review of Analytical Chemistry 2: 241?264; Mok, W and Li, Y. (2008): Recent Progress in Nucleic Acid Aptamer-Based Biosensors and Bioassays, Sensors 8: 7050?7084; Song, S., Wang, L., Li, J., Fan, C., Zhao, J. (2008): Aptamer-based biosensors, TrAC Trends in Analytical Chemistry 27: 108?117.

Feste Phasen sind in allen m?glichen geometrischen Formen denkbar. Beispiele f?r feste Tr?ger sind Platten, Streifen, Membranen, Mikrotiterplatten, Filme, Gele, Mikropartikel, Nanopartikel oder Perlen. Besonders geeignete Materialien, aus denen eine feste Phase hergestellt werden kann, sind anorganische Polymere, organische Polymere, Gl?ser, organische und anorganische Kristalle, Keramiken, Metalle, insbesondere Edelmetalle, und Halbleiter. Ein besonders geeignetes organisches Polymer ist ein Polymer auf Basis von Polystyrol. Desweiteren sind Biopolymere, vorzugsweise Cellulose, Dextran, Agar, Agarose und Sephadex, die funktionalisiert sein k?nnen, insbesondere als Nitrocellulose oder Cyanbromid-Sephadex, als Polymere einsetzbar. Aptamere k?nnen an magnetische K?gelchen (Magnetic Beads) gebunden sein, die z. B. Carboxy-terminierte oder Epoxy-aktivierte Seitenketten tragen. Des Weiteren ist eine Kopplung von Magnetic Beads an die Ribose oder Desoxyribose der Aptamere, wie z. B. ?ber eine Hydrazon-Bindung, m?glich. Die Beispiele f?r Polymere sind nicht limitierend und andere Molek?le denkbar. Bevorzugte Kombinationen von geometrischer Form und Material sind Gele aus Biopolymeren, insbesondere Agarose, und Gelmatrices aus Dextran und Sephadex, die ? beispielsweise in S?ulen verpackt ? Hohlr?ume definierter Porengr??e ausbilden. In einer speziellen Ausf?hrungsform ist der feste Tr?ger mit immobilisiertem Aptamer eine station?re Phase f?r die Affinit?tschromatographie, wobei der Tr?ger vorzugsweise die Form von Kugeln oder anderweitig geformten Partikeln hat.

In einer speziellen Ausf?hrungsform ist die feste Phase ein Teststreifen, der ein oder mehrerere verschiedene erfindungsgem??e Aptamere enth?lt. Der Teststreifen ist insbesondere einsetzbar f?r qualitative, halb-quantitative und quantitative Assays, die mit visuellen Nachweisverfahren arbeiten, insbesondere f?r Lateralfluss-Assays.

Ein Lateralfluss-Assay arbeitet wie folgt: Eine fl?ssige Probe, die mutma?lich ein Target f?r das erfindungsgem??e Aptamer enth?lt, wird an einer Stelle auf den Streifen aufgebracht bzw. der Streifen an einer Stelle mit der Probe benetzt. Diese Stelle ist die sogenannte Probeauftragszone des Streifens. Der Streifen enth?lt ein Matrixmaterial, durch welches das fl?ssige Testmedium und das darin suspendierte oder gel?ste Target durch Kapillarwirkung aus einer Probeauftragszone in eine Nachweiszone str?men kann, wo ein nachweisbares Signal oder die Abwesenheit eines solchen Signals auf das Vorhandensein des Targets hinweist.

Der Streifen, der f?r Lateralfluss-Assays einsetzbar ist, enth?lt ein oder mehrere erfindungsgem??e Aptamere, beispielsweise in der Probeauftragszone oder zumindest noch ?rtlich vor der Nachweiszone. Wenn Target in der Testprobe vorhanden ist bildet es mit dem im Streifen vorhandenen Aptamer einen Komplex, der zur Nachweiszone str?mt und dort detektiert wird. Anders ausgedr?ckt str?mt das Target innerhalb des Streifens zu dem Aptamer, bildet mit diesem einen Komplex, welcher anschlie?end zur Nachweiszone str?mt.

Die Bindungsreaktion kann auch direkt auf der Auftragsstelle stattfinden, wenn z. B. der Teststreifen das Aptamer enth?lt und die Aptamer-Target-Bindung direkt mit einem entsprechenden Marker sichtbar gemacht wird.

Vorzugsweise wird ein markiertes Aptamer eingesetzt, wobei jede bereits weiter oben beschriebene Markierung einsetzbar ist. Vorzugsweise wird eine Markierung eingesetzt, die in der Nachweiszone des Teststreifens zu einem visuell detektierbaren Signal f?hrt. Grunds?tzlich kann das Vorhandensein oder die Abwesenheit von Target in der Probe durch Nachweis oder fehlenden Nachweis eines markierten Aptamers in der Nachweiszone ermittelt werden.

In einer Ausf?hrungsform eines Teststreifens wird ein Enzym-markiertes Aptamer eingesetzt. in der Probe vorhandenes Target bildet mit dem Enzym-markierten Aptamer einen Komplex, der entlang des Streifens zu einer Nachweiszone str?mt, die ein Substrat f?r den Enzymmarker enth?lt, der in Anwesenheit des Enzymmarkers eine farbige Reaktion zu erzeugen vermag. Der Streifen enth?lt vorzugsweise eine weitere Zone, in der Target immobilisiert ist, so dass markiertes Aptamer, das sich aufgrund der Abwesenheit von ausreichendem Target in der Probe nicht mit dem Target vereinigt, erfasst wird und dadurch gehindert wird, die Nachweiszone zu erreichen.

In einer weiteren Ausf?hrungsform funktioniert der Teststreifen nach dem Prinzip eines immunologischen Lateralfluss-Assays, beispielsweise eines Schwangerschaftsteststreifens, wobei ein dort verwendetes markiertes Immunglobulin durch ein erfindungsgem??es, vorzugsweise markiertes, Aptamer ersetzt ist.

Eine spezielle Variante funktioniert nach folgendem Prinzip: Ein Teststreifen wird mit Probe benetzt und in der Probe vorhandenes Target bindet an ein Farbstoff-markiertes Aptamer. Der Target-Aptamer-Farbstoff-Komplex wandert zur Nachweiszone, in der ein zweiter Antik?rper fixiert ist, welcher ebenfalls an das Target bindet. Der immobilisierte Antik?rper bindet den wandernden Target-Aptamer-Farbstoff-Komplex in der Nachweiszone und diese wird angef?rbt. ?bersch?ssiges Farbstoff-markiertes Aptamer wandert weiter zu einer Kontrollzone, in der eine Substanz fixiert ist, die das Farbstoff-markierte Aptamer bindet und dadurch angef?rbt wird.

Der Teststreifen ist aus jedem Material herstellbar, das mit einer Probe benetzbar ist und in das ein erfindungsgem??es Aptamer eingebracht werden kann. Insbesondere bevorzugt sind Materialien durch die eine Probe und ein darin enthaltenes Target durch Kapillarwirkung str?men k?nnen. Beispiele sind Nitrozellulose, Nitrozellulosemischungen mit Polyester oder Zellulose, unbeschichtetes Papier, por?ses Papier, Viskosefilament, Glasfaser, Acrylnitrilcopolymer oder Nylon, sowie alle weiteren Materialien, die bei Lateralfluss-Assays ?blich sind.

Der Teststreifen kann bereits als solcher verwendet werden, um das Vorhandensein von Target in einer Probe festzustellen. Zur Anwendung kann der Streifen in eine Probe eingetaucht werden, im Falle eines Lateralfluss-Assays beispielsweise mit nur einem Ende, das dann als Probeauftragszone dient.

Gegenstand der Erfindung ist auch eine Lateralfluss-Assay-Vorrichtung, die den oben beschriebenen Teststreifen aufweist. Die Vorrichtung kann neben dem Teststreifen beispielsweise ein Geh?use aufweisen, in das der Teststreifen eingebettet ist und das eine, vorzugsweise verschlie?bare, ?ffnung zur Probenauftragszone des Teststreifens aufweist, sowie Aussparungen zur Beobachtung einer Nachweis und ggf. Kontrollzone. Ein solcher Aufbau ist aus dem Gebiet der Schwangerschaftstests bekannt und entsprechend sind bekannte Aufbauten von Lateralfluss-Assay-Vorrichtung auch in der vorliegenden Erfindung verwendbar.

In einer anderen speziellen Ausf?hrungsform bilden der feste Tr?ger und das Aptamer ein Microarray oder einen sogenannten ?DNA oder RNA-Chip?, der einkanalig oder mehrkanalig sein kann. Im Microarray k?nnen auf mehreren Array-f?rmig angeordneten Messpunkten ein oder mehrere Aptamere sowie Referenzmaterialien zur Grundsignalkompensation bzw. Funktionstestung angeordnet sein. In einem Mehrkanal-Chip erfolgt diese Anordnung in den einzelnen Kan?len. Dadurch ist die parallele Mehrfachmessung einer Probe, oder bei verschiedenen Aptameren, die parallele Messung unterschiedlicher Analyte in einer Probe m?glich.

Die Immobilisierung von Aptamer an fester Phase kann auf verschiedene Art und Weise erfolgen und auf jegliche Art und Weise, die dem Fachmann zur Immobilisierung von DNA oder RNA an Feststoffen bekannt ist. Bekannte M?glichkeiten wurden bereits zuvor in dieser Beschreibung genannt. Die Immobilisierung von Aptameren auf Nanopartikeln ist z. B. beschrieben in WO2005/13817. Eine feste Phase aus Papier oder einem por?sen Material kann mit dem Aptamer in fl?ssiger Phase benetzt und die fl?ssige Phase anschlie?end verfl?chtigt werden, so dass das Aptamer in dem Papier bzw. dem por?sen Material zur?ckbleibt.

In einem weiteren Aspekt betrifft die vorliegende Erfindung auch ein Kit umfassend ein erfindungsgem??es Aptamer.

Das Kit umfasst vorzugsweise ein erfindungsgem??es Aptamer, insbesondere ein markiertes erfindungsgem??es Aptamer bzw. eine erfindungsgem??e Aptamersonde, sowie weitere Komponenten f?r die mit dem Kit beabsichtigte Reaktion oder das mit dem durchzuf?hrende Verfahren, beispielsweise Komponenten f?r ein beabsichtigtes Nachweis Anreicherungs-, Abtrennungs- und/oder Isolierungsverfahren. Beispiele sind Pufferl?sungen, Substrate f?r eine Farbreaktion, Farbstoffe oder enzymatische Substrate. Das Aptamer und/oder weitere Komponenten k?nnen an einer festen Phase immobilisiert sein. Beispielhafte Formen und Materialien f?r feste Phasen wurden bereits an anderer Stelle in dieser Beschreibung genannt. Die feste Phase kann beispielsweise in Form eines (Micro)-Arrays oder einer Mikrotiterplatte-bereitgestellt werden. Die feste Phase kann im konkreten Fall eine immobilisierte F?ngersubstanz f?r Protein A, G oder L, Protein A, G oder L enthaltende Substanz oder einen Protein A, G oder L enthaltenden Mikroorganismus aufweisen, insbesondere einen immobilisierten Antik?rper, der zur Anbindung von Protein A, G oder L, einer Protein A, G oder L enthaltenden Substanz oder eines Protein A, G oder L enthaltenden Mikroorganismus dient. Die immobilisierte F?ngersubstanz ist vorzugsweise in Form eines (Micro)-Arrays, in einer Mikrotiterplatte oder in Chips angeordnet.

Das Kit dient vorzugsweise zur Durchf?hrung eines erfindungsgem??en Nachweis-, Anreicherungs, Abtrennungs- und/oder Isolierungsverfahrens f?r Protein A, G oder L, Protein A, G oder L enthaltender Substanz oder eines Protein A, G oder L enthaltenden Mikroorganismus, oder zur Durchf?hrung anderweitiger Assays unter Zuhilfenahme eines erfindungsgem??en Aptamers. Insofern wird auf die vorangehende Offenbarung Bezug genommen.

In dem Kit kann das Aptamer in verschiedensten Formen bereitgestellt werden, beispielsweise gefriergetrocknet oder in einem fl?ssigen Medium.

Die Erfindung betrifft auch ein Messger?t zum Nachweis von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen. Das Messger?t weist ein oder mehrere verschiedene der zuvor beschriebenen Aptamere, eine Aptamersonde wie zuvor beschrieben oder einen Biosensor wie zuvor beschrieben auf. Dar?ber hinaus kann das Messger?t unter anderem eine Probeentnahmeeinrichtung, eine Signalverarbeitungseinrichtung, eine Anzeigevorrichtung zum Ablesen von Messergebnissen oder Messwerten, eine Datenverarbeitungseinrichtung, einen Datenspeichereinrichtung und Schnittstellen zur Verbindung mit externen Ger?ten oder Speichermedien aufweisen.

Mit dem Messger?t k?nnen je nach Ausgestaltung qualitative, quantitative und/oder halbquantitative analytische Informationen ?ber das zu messende Target gewonnen werden. Mit dem Messger?t k?nnen die zuvor erl?uterten Nachweisverfahren durchgef?hrt werden. Es ist insbesondere zum Einsatz in der Lebensmittel-, Wasser- und Umweltanalytik, der Wasserbehandlung und der Wasseraufbereitung, insbesondere von Trinkwasser und Abwasser, in der Diagnostik sowie zur Verwendung in Krankenh?usern und Pflegeeinrichtungen geeignet.

Das Messger?t ist insbesondere ein transportables Messger?t, das vor Ort eingesetzt werden kann, beispielsweise ein leichtes Messger?t im Taschenformat.

Die Probeentnahmeeinrichtung des Messger?ts kann auf verschiedene Art und Weise aufgebaut sein. In einer Variante ist die Probeentnahmeeinrichtung eine Kapillare oder ein por?ser Streifen, im dem Fl?ssigkeiten aufgesaugt werden k?nnen. Eine solche Probeentnahmevorrichtung wird zur Probeentnahme ?blicherweise in eine fl?ssige Probe eingetaucht. Durch Kapillarkraft wird die Probe zu dem gew?nschten Ort im Messger?t transportiert, an dem sich das Aptamer befindet und wo die Nachweisreaktion stattfinden kann. Beispielsweise wird die Probe zu einem das Aptamer aufweisenden Biosensor transportiert, welcher seinerseits ein Messsignal erzeugt.

In einer anderen Variante weist die Probeentnahmeeinrichtung einen Schlauch oder ein R?hrchen sowie eine Pumpe auf. Mit der Pumpe wird eine fl?ssige Probe angesaugt und die Probe zu dem gew?nschten Ort im Messger?t transportiert, an dem sich das Aptamer befindet und wo die Nachweisreaktion stattfinden kann. Beispielsweise wird die Probe zu einem das Aptamer ausweisenden Biosensor transportiert, welcher seinerseits ein Messsignal erzeugt.

Im Folgenden wird die Erfindung anhand von nicht limitierenden Beispielen f?r konkrete Ausf?hrungsformen n?her erl?utert. In den Beispielexperimenten werden Standardreagenzien und Puffer verwendet, die frei von Kontaminationen sind.

BEISPIEL 1: Pr?paration der Target-modifizierten Magnetic Beads.

Dynabeads? M-280 Streptavidin (Invitrogen, UK) wurden nach Herstellerangaben verwendet. 1 ? 109 Magnetic Beads wurden zun?chst 3? mit je 500 ?l PBS, pH 7.4 gewaschen und anschlie?end mit 510 ?g biotinyliertem Protein A f?r 1 h bei 21?C unter Sch?tteln inkubiert (natives, biotinyliertes Protein A von Staphylococcus aureus (Sigma, P2165); gel?st in 0,1 M Natriumphosphatpuffer pH 7.4 zu einer Stamml?sung von 2 mg/ml). Danach folgten weitere Waschschritte: 3 ? 500 ?l PBS, pH 7.4; 1 ? 500 ?l PBS, pH 7.4 + 0,05% Tween 20 mit einer Inkubation von 5 min bei 21?C unter Sch?tteln; 1 ? 500 ?l PBS, pH 7.4 + 0,05% Tween 20 (ohne Inkubation); 2 ? 500 ?l PBS, pH 7.4. Die Abtrennung der Beads von den L?sungen erfolgte jeweils unter Verwendung eines Magnet-Separationsstandes (Promega, Deutschland). Die Protein A ? modifizierten Beads wurden dann in 500 ?l PBS, pH 7.4 + 0,02% Natriumazid suspendiert und bei 4?C gelagert.

BEISPIEL 2: In vitro Selektion (FluMag-SELEX).

Die Selektion von DNA-Aptameren f?r Protein A erfolgte unter Anwendung des FluMag-SELEX-Prozesses. Biotinyliertes Protein A wurde daf?r auf Streptavidin-funktionalisierte Magnetic Beads immobilisiert und in dieser Form als Target f?r die Aptamerselektion eingesetzt. Eine Fluoresceinmarkierung der DNA ab der zweiten SELEX-Runde erm?glichte au?erdem deren Quantifizierung in den verschiedenen Schritten des SELEX-Prozesses mittels Fluoreszenzmessung (Wallac Victor2V Multilabel Counter; Perkin Elmer, Deutschland; Messbedingungen: Excitation 485 nm/Emission 535 nm, time 1 s, CW-lamp energy 22500, Messvolumen 100 ?l/well, Messung in schwarzen 96 well Mikrotiterplatten (NUNC; Deutschland)).

Ausgangspunkt des Selektionsprozesses war eine randomisierte DNA-Oligonukleotid-Bibliothek, die mittels chemischer Synthese (Microsynth AG, CH) hergestellt wurde: 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'. N40 stellt den Bereich mit variablen Nukleotiden (Zufallssequenz) dar.

Alle Oligonukleotide dieser Bibliothek besitzen am 5'- und 3'-Ende spezifische Sequenzen, die als Primerbindungsorte f?r die Amplifizierung der Oligonukleotide mittels PCR dienen. Folgende modifizierte PCR-Primer wurden verwendet:
als Sense-Primer 5'-FI-ATACCAGCTTATTCAATT-3' (siehe SEQ ID NO: 66) mit einer Fluorescein(FI)-Markierung am 5'-Ende und als Antisense-Primer 5'-dA20HEGL-CTAACTGATTACGATTGT-3' mit einer Verl?ngerung am 5'-Ende (dA20 = 20 Nukleotide mit der Base Adenin; HEGL = Hexaethylenglycolspacer, Primersequenz siehe SEQ ID NO: 68).

F?r die Aptamerselektion wurden aufeinanderfolgende SELEX-Runden durchgef?hrt, die aus mehreren Schritten bestehen: den Selektionsschritten ? (i) Bindung der DNA-Oligonukleotid-Bibliothek (~2,5 nmol ssDNA) bzw. des in der vorhergehenden Runde selektierten Oligonukleotidpools an die Target-modifizierten Magnetic Beads (Inkubation f?r 30 min bei 21?C unter Sch?tteln in Bindungspuffer [100 mM NaCl, 20 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 5 mM KCl, 1 mM CaCl2]; Bindungsvolumen 250 ?l), (ii) Abtrennen der ungebundenen Oligonukleotide durch mehrere Waschschritte der Bindungskomplexe, (iii) Elution der gebundenen Oligonukleotide mittels Hitze (2? Inkubation der Bindungskomplexe in 250 ?l Bindungspuffer f?r 10 min bei 95?C unter Sch?tteln); dem Amplifikationsschritt ? (iv) Vervielf?ltigung der eluierten Oligonukleotide mittels PCR und dem Reinigungsschritt ? (v) Trennung der doppelstr?ngigen PCR-Produkte und Gewinnung der relevanten DNA-Einzelstr?nge (sense-Str?nge) mittels denaturierender PAGE und anschlie?ender Gelelution. Der auf diese Weise generierte neue Oligonukleotid-Pool am Ende einer SELEX-Runde wurde f?r eine erneute Bindungsreaktion mit den Target-modifizierten Magnetic Beads in der n?chsten SELEX-Runde eingesetzt. In jeder SELEX-Runde wurde dabei ein frisches Aliquot von ~108 Target-modifizierte Magnetic Beads verwendet. In den Runden 3 und 7?11 wurde zus?tzlich ein negativer Selektionsschritt eingef?gt. Dies bedeutet, die Oligonukleotide wurden zun?chst mit Streptavidin-funktionalisierten Magnetic Beads (ohne Target) inkubiert, um alle Oligonukleotide zu entfernen, die unspezifisch an die Immobilisierungsmatrix binden. Die im ?berstand verbliebenen Oligonukleotide wurden anschlie?end mit den Target-modifizierten Magnetic Beads zur Bindung gebracht (siehe Selektionsschritt ? (i)). Nach einer schrittweisen Anreicherung Target-bindender Oligonukleotide insbesondere in den Runden 8?11 (siehe 1), wurde der SELEX-Prozess in der 11. Runde nach dem Amplifikationsschritt, in diesem Fall mit unmodifizierten Primern, beendet.

Die beigef?gte 1 zeigt den Verlauf des SELEX-Prozesses zur Selektion Protein A-bindender Aptamere. Dargestellt ist die an die Target-modifizierten Magnetic Beads bindende Menge an Oligonukleotiden in jeder SELEX-Runde. In den Runden 3 und 7?11 (gekennzeichnet in der 1 mit *-Symbol) wurde zus?tzlich ein negativer Selektionsschritt durchgef?hrt. Die Menge an Oligonukleotiden, die an die Immobilisierungsmatrix des Targets bindet ist ebenfalls dargestellt (0?0,07 pmol), lag jedoch oftmals am Nachweislimit der Fluoreszenzmessung.

BEISPIEL 3: Klonierung and Sequenzierung.

In der letzten 11. SELEX-Runde wurden die selektierten Oligonukleotide (Aptamer-Pool) mit unmodifizierten Primern amplifiziert, um anschlie?end die entstandenen PCR-Produkte direkt in den Vektor pCR2.1-TOPO zu klonieren und in E. coli TOP10 Zellen (TOPO TA Cloning Kit; Invitrogen, UK) zu transformieren. Positive Klone wurden mittels Kolonie-PCR identifiziert. Unter Verwendung des QIAprep 96 Turbo Miniprep Kit (Qiagen, Deutschland) wurde die Plasmid-DNA von einigen der Klone pr?pariert und zur Sequenzierung des Aptamer-Inserts gegeben (Microsynth AG, CH).

Eine ?bersicht der aus der Klonierung erhaltenen Aptamersequenzen ist in der Tabelle 1 angegeben. Die Primersequenz (Sense) am 5'-Ende ist ATACCAGCTTATTCAATT (SEQ ID NO: 66) und die Primerbindungsregion f?r den Antisense-Primer am 3'-Ende ist ACAATCGTAATCAGTTAG (SEQ ID NO: 67). Sie sind jeweils in Fettschrift dargestellt. Die Sequenzen mit der SEQ ID NOs: 66 und 67 sind Bestandteil der Aptamere, vorbehaltlich verk?rzter Sequenzen, wie in der vorangehenden allgemeinen Beschreibung definiert. Die Spalte Anzahl? gibt die Anzahl Klone mit identischer Aptamersequenz an. Wenn mehrere Klone mit identischer Sequenz gefunden wurden, ist die Aptamerbezeichnung in Fettschrift markiert (siehe z. B. PA#2/8).

Einige Aptamere lassen sich aufgrund ihrer Sequenzen in Gruppen einteilen. Innerhalb einer Gruppe im Vergleich zum Stellvertreter einer Gruppe abweichende Nukleotide sind unterstrichen gekennzeichnet. Die in einer Gruppe zusammengefassten Sequenzen sind bis auf Punktmutationen und Deletionen identisch bzw. vom Stellvertreter abzuleiten. Die Aptamernummer des Stellvertreters einer Gruppe ist unterstrichen gekennzeichnet (siehe z. B. Aptamer Nr. PA#2/8 f?r Gruppe 1).

Die Aptamere lassen sich aufgrund ihrer Sequenzen in Gruppen einteilen. Innerhalb einer Gruppe abweichende Nukleotide sind mit Unterstreichung gekennzeichet.

Die Sequenz mit der SEQ ID NO: 62 fasst die Sequenzen der Gruppe 1 zusammen und zeigt variable Nukleotide unterstrichen.

Die Sequenz mit der SEQ ID NO: 63 fasst die Sequenzen der Gruppe 2 zusammen und zeigt variable Nukleotide unterstrichen.

Die Sequenz mit der SEQ ID NO: 64 fasst die Sequenzen der Gruppe 3 zusammen und zeigt variable Nukleotide unterstrichen.

Die Sequenz mit der SEQ ID NO: 65 fasst die Sequenzen der Gruppe 4 zusammen und zeigt variable Nukleotide unterstrichen.

In der SEQ ID NO: 65 bedeutet X1 entweder A oder L, wobei L f?r kein Nukleotid (Deletion) steht.

Vergleichende Sequenzanalysen wurden mittels ClustalW2, einem Multiple Sequence Alignment Tool (htt://www.ebi.ac.uk/Tools/msa/clustalw2/), durchgef?hrt.

Die Analyse der Sekund?rstruktur einiger Aptamer-Klone erfolgte mittels des Internet-Tools ?The mfold Web Server? (http://mfold.rna.albany.edu/?q=mfold), einer frei verf?gbaren Software zur Faltung von Nukleins?uren, die auf einem Energie-Minimierungs-Algorithmus beruht. Das Aptamer PA#2/8 (SEQ ID NO: 1) f?llt aufgrund seiner G-reichen Sequenz auf, welche die Faltung zu einer G-Quartett-Struktur vermuten l??t:
PA#2/8 AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT

Eine m?gliche Sekund?rstruktur von Aptamer PA#2/8 (SEQ ID NO: 1) ist der 2 gezeigt.

BEISPIEL 4: Bindungstests.

Aptamer-Klone mit unterschiedlicher Sequenz wurden auf ihre individuelle Bindungsf?higkeit zum Selektionstarget (biotinyliertes Protein A, immobilisiert an Streptavidin-funktionalisierte Magnetic Beads) untersucht. Die Bindungsversuche wurden entsprechend den SELEX-Bedingungen durchgef?hrt. F?r jeden Versuch kamen 2,5?3 ? 10 Target-modifizierte Magnetic Beads und ~55 pmol Fluorescein-markierte Aptamer-ssDNA in Bindungspuffer (100 mM NaCl, 20 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 5 mM KCl, 1 mM CaCl2) und in einem Bindungsvolumen von 250 ?l zum Einsatz. Die Target-modifizierte Magnetic Beads wurden vor der Verwendung mehrmals in Bindungspuffer gewaschen und die Aptamer-ssDNA wurde thermisch equilibriert durch Inkubation bei 90?C f?r 8 min, auf Eis f?r 10 min und bei RT f?r ~5 min. Anschlie?end wurden die vorbereitete Aptamer-ssDNA und die gewaschenen Target-modifizierten Magnetic Beads zur Bindung zusammengegeben f?r 30 min bei 21?C unter Sch?tteln. Die ungebundene ssDNA wurde entfernt und die Bindungskomplexe mehrmals in Bindungspuffer gewaschen. Danach erfolgte die Elution der Target-gebundenen ssDNA mittels Hitze durch Inkubation der Bindungskomplexe in Bindungspuffer bei 95?C f?r 10 min unter Sch?tteln. Diese Elutionsprozedur wurde insgesamt zweimal durchgef?hrt. Aufgrund der Fluoresceinmarkierung der Aptamer-ssDNA und mittels einer Kalibrierkurve konnte die Menge der eluierten ssDNA quantifiziert werden. Diese entspricht der Menge an Target-gebundenem Aptamer im Bindungsversuch.

BEISPIEL 5: Aufbau eines Biosensors und Durchf?hrung eines Nachweises auf Protein ABezugszeichenliste

zu Fig. 3
1
Sensorchip (Glaschip)
2
Goldfilm
3
Flusszelle
4
Probel?sung
5
Target
6
Lichtquelle
7
Prisma
8
Detektor
9
Aptamer
L
monochromatisches polarisiertes Licht
R
reflektiertes Licht

Das Biacore?-System ist ein kommerziell erh?ltliches Biosensor-System, welches den markierungsfreien Nachweis von biomolekularen Wechselwirkungen in Echtzeit erm?glicht und daf?r das physikalische Prinzip der Oberfl?chenplasmonenresonanz-Spektroskopie (Surface Plasmon Resonance, SPR) nutzt, wie in der 3 dargestellt.

Der Biosensorchip des Biacore-Systems besteht aus einem Glaschip 1, der mit einem d?nnen Goldfilm 2 beschichtet ist und die Sensoroberfl?che darstellt. Eine spezielle Funktionalisierung dieser Sensoroberfl?che, beispielsweise mit Carboxymethyldextran (CM), erlaubt die kovalente Immobilisierung der biologischen Rezeptormolek?le. Im Falle der Aptamere 9 wird bevorzugt das Biotin-Streptavidin-Kopplungssystem genutzt, um die biotinylierten Aptamere auf die Streptavidin-beschichtete Sensoroberfl?che des Biosensorchips zu immobilisieren. Die anschlie?ende Interaktion zwischen Target und Aptamer findet in einer Flusszelle 3 statt, wobei durch ein integriertes, kontinuierliches Flusssystem die Probel?sung 4 mit Target 5 ?ber die Sensoroberfl?che geleitet wird. Die optische Detektionseinheit des Biacore-Systems besteht aus einer Lichtquelle 6 (Leuchtdioden), einem Prisma 7 und einem Detektor 8 (Diodenarray-Detektor).

Monochromatisches, polarisiertes Licht L wird unter den Bedingungen der Totalreflexion von einem Medium mit hohem Brechungsindex (Sensorchip mit Goldfilm) in ein Medium mit niedrigem Brechungsindex (Sensorschicht, Pufferl?sung) eingestrahlt. Dabei tritt bei einem bestimmten Einfallswinkel eine Abschw?chung des reflektierten Lichtes R auf. Dieser Winkel, der Resonanzwinkel, reagiert sehr sensitiv auf Ver?nderungen des Brechungsindexes der Sensorschicht. Die Anbindung des Targets 5 an das immobilisierte Aptamer 9 auf der Sensoroberfl?che resultiert in einem Massezuwachs in der Sensorschicht, welcher zu einer ?nderung des Brechungsindexes dieser Schicht und damit zu einer Verschiebung des Resonanzwinkels f?hrt. Diese ?nderungen werden als messbares Signal, ausgedr?ckt in Resonanz-Einheiten (RU), ausgegeben und sind proportional zu der Menge an gebundenem Target 5 auf der Sensoroberfl?che. W?hrend der Bindungsanalyse werden die ?nderungen des Resonanzwinkels kontinuierlich aufgezeichnet und aufgetragen gegen die Zeit als Sensorgramm dargestellt, das in der 4 schematisch dargestellt ist. Im Abschnitt II der Signalkurve ist eine Verschiebung des Resonanzwinkels durch die Anbindung von Target an das immobilisierte Aptamer erkennbar. Die Verschiebung des Resonanzwinkels ist auch in der 3 gezeigt, anhand eines mit ?I? und eines mit ?II? bezeichneten reflektierten Lichtstrahles.

Der Aptamer-Target-Komplex kann unter geeigneten Pufferbedingungen wieder gel?st werden, so dass die Sensoroberfl?che regeneriert wird und f?r eine erneute Bindung mit Targetmolek?len zu Verf?gung steht.

An der Oberfl?che des oben beschriebenen Biosensors wird erfindungsm??es Aptamer immobilisiert. Eine L?sung von Protein A wird ?ber die Sensoroberfl?che geleitet, wobei Protein A an das Aptamer bindet. Die Anbindung von Protein A wird als Verschiebung des Resonanzwinkels detektiert. SEQUENZPROTOKOLL