Title:
Aptamere, die spezifisch sind für Immunoglobulin bindende Zellwandproteine
Kind Code:
B3
Abstract:

Die Erfindung betrifft ein Aptamer das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen sowie an Protein A, G oder L enthaltende Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bindet, Verfahren zum Nachweis und Anreicherung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, in denen das Aptamer eingesetzt wird, sowie ein Kit, einen Biosensor, eine Lateralfluss-Assay-Vorrichtung und ein Messgerät, die ein solches Aptamer enthalten und in den genannten Verfahren einsetzbar sind.



Inventors:
Stoltenburg, Regina, Dr. (04157, Leipzig, DE)
Strehlitz, Beate, Dr. (04279, Leipzig, DE)
Application Number:
DE102011006610A
Publication Date:
06/21/2012
Filing Date:
03/31/2011
Assignee:
Helmholtz-Zentrum für Umweltforschung GmbH - UFZ, 04318 (DE)
Other References:
CAO, X. u.a.: Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus. Nucleic Acids Res. (2009) 37 (14) 4621-8
KIM, D.C. u.a.: Molecular recognition and specific interactions for biosensing applications. Sensors (2008) 8 (10) 6605-6641
KULBACHINSKIY, A.V.: Methods for selection of aptamers to protein targets. Biochemistry (Mosc). (2007) 72 (13) 1505-18
Attorney, Agent or Firm:
Patentanwälte Bressel und Partner, 10785, Berlin, DE
Claims:
1. Aptamer, das an Immunoglobulin bindende Zellwandproteine, an Substanzen, die ein Immunoglobulin bindendes Zellwandprotein enthalten, und an Mikroorganismen, die ein Immunoglobulin bindendes Zellwandprotein enthalten, bindet, wobei das Immunoglobulin bindende Zellwandprotein ausgewählt ist aus der Gruppe umfassend Protein A, G oder L.

2. Aptamer nach Anspruch 1, das ausgewählt ist aus
a) einem Aptamer umfassend eine Nukleinsäuresequenz, die ausgewählt ist aus der Gruppe bestehend aus SEQ ID NO: 1 bis SEQ ID NO: 65, mit der Maßgabe, dass Thymin durch Uracil ersetzt sein kann,
b) einem Aptamer, dessen Nukleinsäuresequenz eine Identität von mindestens 70% mit der Nukleinsäuresequenz eines Aptamers aus a) aufweist,
c) einem Aptamer, das mit dem komplementären Strang eines Aptamers aus a) hybridisiert,
d) einem Aptamer bei dem gegenüber einem Aptamer aus a) ein oder mehrere Nukleotide substituiert, deletiert, insertiert und/oder angefügt sind
e) einem Fragment eines Aptamers nach a), b), c) oder d),
f) einem Derivat eines Aptamers nach a), b), c), d) oder e).

3. Arzneimittel, insbesondere zur Diagnose, Prophylaxe und/oder Behandlung von Erkrankungen, die auf Staphylococcus aureus, Streptococcus oder Peptostreptococcus zurückzuführen sind, umfassend ein oder mehrere verschiedene Aptamere wie in einem der Ansprüche 1 oder 2 beschrieben.

4. Aptamersonde zur Detektion von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, umfassend ein oder mehrere verschiedene Aptamere wie in einem der Ansprüche 1 oder 2 beschrieben und ein Markierungsmittel.

5. Biosensor, aufweisend ein oder mehrere verschiedene Aptamere wie in einem der Ansprüche 1 oder 2 beschrieben.

6. Feste Phase, insbesondere zur Verwendung beim Nachweis, Anreicherung, Abtrennung und/oder Isolierung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, an die ein oder mehrerere verschiedene Aptamere nach einem der Ansprüche 1 oder 2 immobilisiert ist/sind.

7. Teststreifen, insbesondere zur Verwendung in Lateralfluss-Assays, der ein oder mehrerere verschiedene Aptamere nach einem der Ansprüche 1 oder 2 enthält.

8. Lateralfluss-Assay-Vorrichtung, die einen Teststreifen nach Anspruch 7 aufweist.

9. Kit, umfassend ein oder mehrere verschiedene Aptamere wie in einem der Ansprüche 1 oder 2 beschrieben.

10. Messgerät zum Nachweis von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, aufweisend ein oder mehrere verschiedene Aptamere nach Anspruch 1 oder 2, eine Aptamersonde nach Anspruch 4, einen Biosensor nach Anspruch 5 oder einen Teststreifen nach Anspruch 7.

11. Verwendung des Aptamers wie in einem der Ansprüche 1 oder 2 beschrieben zum Nachweis, Anreicherung, Abtrennung und/oder Isolierung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus.

12. Verwendung des Aptamers wie in einem der Ansprüche 1 oder 2 beschrieben zur Quantifizierung der Bindung eines Immunoglobulins an Protein A, G oder L.

13. Verwendung des Aptamers wie in einem der Ansprüche 1 oder 2 beschrieben zur Blockierung oder Quantifizierung freier Bindungsstellen an Protein A, G oder L.

14. Verwendung des Aptamers wie in einem der Ansprüche 1 oder 2 beschrieben zur Diagnose, Prophylaxe, Behandlung und/oder Therapie von Erkrankungen, die auf Staphylococcus aureus zurückzuführen sind.

15. Verfahren zum Nachweis von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bei dem
a) ein oder mehrere verschiedene Aptamere wie in einem der Ansprüche 1 oder 2 beschrieben mit einer Probe, die Protein A, G oder L, die Protein A, G oder L enthaltende Substanz oder den Mikroorganismus enthält, in Kontakt gebracht wird/werden und
b) eine Bindung zwischen dem/den Aptamer(en) und Protein A, G oder L, oder zwischen dem/den Aptamer(en) und der Substanz, oder zwischen dem/den Aptamer(en) und dem Mikroorganismus nachgewiesen wird.

16. Verfahren zur Anreicherung, Abtrennung und/oder Isolierung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bei dem
a) ein oder mehrere verschiedene Aptamere wie in einem der Ansprüche 1 oder 2 beschrieben mit einer Probe, die Protein A, G oder L, eine Protein A, G oder L enthaltende Substanz oder einen Protein A, G oder L enthaltenden Mikroorganismus enthält, in Kontakt gebracht wird/werden, wobei ein Komplex oder Komplexe aus dem/den Aptamer(en) und Protein A, G oder L, aus dem/den Aptamer(en) und der Protein A, G oder L enthaltenden Substanz oder aus dem/den Aptamer(en) und dem Protein A, G oder L enthaltenden Mikroorganismus gebildet wird,
b) der/die Komplex(e) und die übrige Probe voneinander getrennt werden, und
c) optional Protein A, G oder L, die Protein A, G oder L enthaltende Substanz oder der Protein A, G oder L enthaltende Mikroorganismus aus dem Komplex isoliert wird.

17. Verfahren zur Quantifizierung der Bindung eines Immunoglobulins an Protein A, G oder L, wobei bei dem Verfahren
a) Protein A, G oder L, Protein A, G oder L enthaltende Substanz oder ein Protein A, G oder L enthaltender Mikroorganismus bereitgestellt wird,
b) Protein A, G oder L, Protein A, G oder L enthaltende Substanz oder der Protein A, G oder L enthaltende Mikroorganismus mit dem Immunoglobulin versetzt wird,
c) das in b) erzeugte Gemisch mit einem Aptamer nach einem der Ansprüche 1 oder 2 in Kontakt gebracht wird, und
d) die Menge gebundenen Aptamers bestimmt wird und daraus die Menge gebundenen Immunoglobulins bestimmt wird.

Description:

Die vorliegende Erfindung betrifft ein Aptamer, das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bindet, Verwendungen des Aptamers sowie Verfahren zum Nachweis und Anreicherung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, in denen das Aptamer eingesetzt wird.

Staphylococcus aureus ist ein kugelförmiges, Gram-positives, pathogenes Bakterium. S. aureus kommt fast überall in der Natur, auch auf der Haut und in den oberen Atemwegen von 25 bis 30% aller Menschen vor. Besonders gefährlich sind Antibiotika-resistente Formen und insbesondere multiresistente Formen. Diese kommen gehäuft in Krankenhäusern, Pflegeheimen, aber auch im Klärschlamm vor. Auch in Lebensmitteln tierischer Herkunft werden resistente Keime des Stammes gefunden. Der Keim kann auch in das Trinkwasser gelangen. Häufige Erkrankungen, die auf S. aureus zurückzuführen sind, sind Sepsis, Haut- und Wundinfektionen, Pneumonien, Abszesse, Furunkel, Endokarditis, Osteomyelitis, Lebensmittelvergiftungen durch S. aureus Exotoxine und Mastitis bei Rindern.

Der Nachweis von S. aureus erfolgt bisher mittels Kultivierung oder immunologischer und molekularbiologischer Methoden (Antikörper-Assays, PCR-basierte Methoden). Die Methoden sind entweder zeitaufwändig oder teuer. Aufgabe der vorliegenden Erfindung war es deshalb, spezifische Substanzen zur Verfügung zu stellen, die einen schnellen, einfachen und zuverlässigen Nachweis von S. aureus ermöglichen.

Die Aufgabe wird mit einem Aptamer gelöst, das an Immunoglobulin bindende Zellwandproteine, an Substanzen, die ein Immunoglobulin bindendes Zellwandprotein enthalten, und an Mikroorganismen, die ein Immunoglobulin bindendes Zellwandprotein enthalten, bindet, wobei das Immunoglobulin bindende Zellwandprotein ausgewählt ist aus der Gruppe umfassend oder bestehend aus Protein A, G oder L.

Der Begriff „umfassend” bedeutet im Sinne des vorigen Absatzes, dass das Aptamer auch an weitere Immunoglobulin bindende Zellwandproteine binden kann, bzw. an Substanzen oder Mikroorganismen, die ein anderes Immunoglobulin bindendes Zellwandprotein enthalten als die genannten Proteine A, G oder L.

Bereitgestellt wird somit ein Aptamer, das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen sowie Protein A, G oder L enthaltende Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bindet. Insbesondere ist das erfindungsgemäße Aptamer spezifisch für Protein A, G oder L. Das erfindungsgemäße Aptamer ist ein Nukleinsäure-Aptamer, insbesondere ein einzelsträngiges DNA(ssDNA)- oder ein RNA-Aptamer.

Der allgemeine Begriff „Aptamere” bezeichnet im Stand der Technik kurze einzelsträngige Nukleinsäure-Oligomere, auch bezeichnet als Oligonukleotide, die spezifisch an eine Zielstruktur oder ein Zielmolekül, auch bezeichnet als Target, binden können, beispielsweise an ein Protein, an niedermolekulare Verbindungen, wie organische Substanzen, Aminosäuren und Antibiotika, Nukleinsäuren, Viruspartikel oder (Mikro)Organismen. Die Aptamer-Target-Bindung erfolgt beispielsweise über die Strukturkompatibilität, so genannte „Stacking interactions” bei aromatischen Ringstrukturen (Stapelkräfte durch Elektronenwechselwirkung mit Nachbarbasen), elektrostatische Wechselwirkungen (z. B. Van der Waals-, Ionen-, Dipolkräfte) und Wasserstoffbrückenbindungen.

Auch Aptamere mit Peptidstruktur sind bekannt, wobei sich die vorliegende Erfindung ausschließlich auf Nukleinsäure-Aptamere bezieht. Somit bezeichnet der Begriff „Aptamere” nachfolgend Nukleinsäure-Aptamere. Bei Nukleinsäure-Aptameren unterscheidet man beispielsweise DNA-Aptamere, gebildet aus einzelsträngiger DNA(ssDNA), und RNA-Aptamere. Aptamere zeichnen sich durch die Ausbildung einer spezifischen dreidimensionalen Struktur, die von der Nukleinsäuresequenz abhängt, aus. Diese Struktur befähigt Aptamere, analog einer Antigen-Antikörper-Bindung Zielstrukturen passgenau zu binden. Eine bestimmte Nukleinsäuresequenz eines Aptamers kann bei definierten Bedingungen eine dreidimensionale Struktur aufweisen, die spezifisch für eine definierte Zielstruktur (Target) ist. Die dreidimensionale Struktur eines Aptamers entsteht unter anderem infolge von intramolekularen Basenpaarungen nach Watson und Crick und über Hoogsteen-Basenpaarungen (Quadruplex).

Die Aussage, dass ein erfindungsgemäßes Aptamer an Protein A, G oder L, eine Protein A, G oder L enthaltende Substanz oder einen Protein A, G oder L enthaltenden Mikroorganismus bindet, oder dafür spezifisch ist, bedeutet, dass es an ein oder mehrere Targets bindet, die ausgewählt sind aus Protein A, G oder L, einer Protein A, G oder L enthaltenden Substanz oder einem Protein A, G oder L enthaltenden Mikroorganismus.

Protein A, Protein G und Protein L sind bakterielle Zellwandproteine. Sie gehören zu einer Gruppe Proteine, die wiederholende Domänen enthalten, welche Immunoglobuline binden können.

Protein A ist ein Protein, das in der Zellwand des Bakteriums Staphylococcus aureus vorkommt. Protein A hat eine Größe von 40–60 kDa und wird in der biochemischen Forschung häufig wegen seiner Fähigkeit genutzt, Immunoglobuline über deren Fc-Region zu binden. Protein A bindet verschiedene Klassen von Immunoglobulinen, insbesondere verschiedene IgG-Subklassen von verschiedenen Spezies. Beispielhafte Protein A-Vertreter haben die UniProt Nr. P38507, P02976, P99134, P0A015 (aus section: Swiss-Prot, der UniProtKB = Protein knowledgebase).

Protein G ist ein Protein, das in der Zellwand von Bakterien der Gattung Streptococcus vorkommt. Es hat je nach Streptococcus-Stamm eine Molekülmasse von etwa 58 bis 65 kDa und besitzt am C-Terminus zwei oder drei homologe Bindungsdomänen mit hoher Affinität für die Fc-Region von Immunglobulinen, insbesondere des Isotyps IgG. Darüber hinaus bindet es über drei homologe Domänen N-terminal zur IgG-Bindungsregion auch an Albuminproteine. Am N-Terminus besitzt Protein G eine weitere Bindungsregion (Region E) für humanes Alpha-2-Globulin in der auch als s-Form bezeichneten nativen Konformation. Beispielhafte Protein G-Vertreter haben die UniProt (Universal Protein Database) Nr. P06654 und P19909.

Protein L ist ein Protein, das in der Zellwand von Peptostreptococcus magnus vorkommt. Ähnlich wie Protein A und G ist es ebenfalls in der Lage Immunglobuline zu binden, insbesondere Immunglobuline, welche die leichten Ketten des Kappa-Typs enthalten.

Aufgrund ihrer Spezifität für Protein A, G oder L sind Aptamere der vorliegenden Erfindung auch spezifisch für Protein A, G oder L enthaltende Substanzen und Protein A, G oder L enthaltende Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus. Unter „Protein A, G oder L enthaltenden Substanzen” sind Substanzen zu verstehen, die mit Protein A, G oder L fest verbunden sind, beispielsweise durch eine kovalente Bindung, Wasserstoffbrückenbindungen oder eine Komplexbindung. Aus ihrer Spezifität ergeben sich zahlreiche Verwendungsmöglichkeiten der erfindungsgemäßen Aptamere, die an anderem Ort in dieser Beschreibung noch erläutert werden.

Die erfindungsgemäßen Aptamere sind auch spezifisch für rekombinant hergestelltes Protein A, Protein G oder Protein L, beispielsweise in E coli rekombinant hergestelltes Protein A, G, oder L.

Ebenso sollen die Begriffe Protein A, Protein G und Protein L auch Mutationsformen dieser Proteine, also verändertes Protein A, G oder L im Vergleich zum Wildtyp, beispielsweise entstanden durch künstliche oder natürliche Genmutationen, einschließen.

Erfindungsgemäße Aptamere, die spezifisch für Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen sind, können beispielsweise mit dem SELEX-Verfahren (Systematic Evolution of Ligands by Exponential Enrichment) erhalten werden. Grundlegende Arbeiten zum SELEX-Verfahren stammen von Tuerk and Gold, Science 249 (1990) 505–510, sowie Ellington and Szostak, Nature 346 (1990) 818–822. SELEX Verfahren sind weiterhin offenbart in US 5,567,588 und US 5,270,163.

Im SELEX Verfahren wird zunächst eine kombinatorische Zufallsbibliothek, bestehend aus einzelsträngigen DNA(ssDNA)-Oligonukleotiden erzeugt. Die Oligonukleotide weisen einen internen variablen Bereich auf, mit beispielsweise 40–60 Nukleotiden, der am 5' und 3' Ende von Primerregionen flankiert wird. Die Primerregionen dienen als Primerbindungsstellen für eine PCR Amplifikation. Kombinatorische Zufallsbibliotheken können von kommerziellen Anbietern bezogen werden. Die Variabilität einer Bibliothek liegt beispielsweise im Bereich von ca. 1015 verschiedenen Molekülen. Ausgehend von der einzelstängigen DNA-Oligonukleotid-Bibiothek werden über verschiedene Selektions- und Amplifikationsschritte zyklusweise die Oligonukleotide angereichert, die am besten an das Target binden. Jeder Zyklus besteht aus folgenden Teilschritten:

  • a) Bindung der Oligonukleotide an das Target,
  • b) Waschen der Oligonukleotid-Target-Komplexe zur Entfernung von ungebundenen Oligonukleotiden,
  • c) Elution der am Target gebundenen Oligonukleotide,
  • d) Amplifikation der eluierten Oligonukleotide mittels PCR,
  • e) Reinigung der relevanten ssDNA-Oligonukleotide aus dem PCR-Produkt

Nach jedem Zyklus wird der selektierte und angereicherte Oligonukleotidpool als Ausgangsmaterial für einen nächsten Zyklus genutzt. Vorteilhafterweise werden 8 bis 12 Zyklen durchlaufen.

Ein SELEX Verfahren zur Isolierung erfindungsgemäßer Aptamere ist in den beigefügten Beispielen genauer beschrieben. Ein beispielhaftes Verfahren zur Auffindung von erfindungsgemäßen Aptameren ist das sogenannte FluMag-SELEX Verfahren, bei dem fluoreszenzmarkierte ssDNA Moleküle und magnetische Kügelchen (Beads) als Immobilisierungsmatrix für das Target eingesetzt werden. Dieses Verfahren, das in den beigefügten Beispielen verwendet wurde, ist auch beschrieben in: R. Stoltenburg et al. (2005) FluMag-SELEX as an advantageous method for DNA aptamer selection, Anal. Bioanal. Chem. 383, 83–91.

Nach Analyse der Sequenz können erfindungsgemäße Aptamere sowie Varianten, Mutanten, Fragmente und Derivate davon, welche nachfolgend noch beschrieben werden, mit üblichen Techniken der chemischen DNA- und RNA-Synthese hergestellt werden, die dem Fachmann bekannt sind. Ist die Sequenz eines DNA Aptamers bekannt, so kann ein RNA Aptamer mit der gleichen Sequenz durch übliche Syntheseverfahren hergestellt werden. Ferner können die Bindungseigenschaften einzelner Aptamere an das Target untersucht werden.

Vorzugsweise sind die erfindungsgemäßen Aptamere synthetische Oligonukleotide, die insbesondere nach dem soeben beschriebenen SELEX Verfahren aus einer zugrunde gelegten synthetischen, kombinatorischen Oligonukleotid-Bibliothek selektiert wurden oder anschließend mit üblichen Syntheseverfahren hergestellt sind.

Die Erfindung betrifft in einer speziellen Ausführungsform ein Aptamer das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen bindet und das ausgewählt ist aus

  • a) einem Aptamer umfassend, oder bestehend aus, eine(r) Nukleinsäuresequenz, die ausgewählt ist aus der Gruppe bestehend aus SEQ ID NO: 1 bis SEQ ID NO: 65, mit der Maßgabe, dass Thymin durch Uracil ersetzt sein kann,
  • b) einem Aptamer, dessen Nukleinsäuresequenz eine Identität von mindestens 70% mit der Nukleinsäuresequenz eines Aptamers aus a) aufweist
  • c) einem Aptamer, das mit dem komplementären Strang eines Aptamers aus a) hybridisiert,
  • d) einem Aptamer bei dem gegenüber einem Aptamer aus a) ein oder mehrere Nukleotide substituiert, deletiert, insertiert und/oder angefügt sind
  • e) einem Fragment eines Aptamers nach a), b), c) oder d),
  • f) einem Derivat eines Aptamers nach a), b), c), d) oder e).

Die Funktionalität der Aptamere aus a)–f), also die Bindung an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen kann mit einer Sekundärstrukturanalyse der Aptamere, abgeschätzt werden. Auch die Funktionalität sonstiger in dieser Beschreibung genannter Varianten kann so abgeschätzt werden. Die Modellierung der möglichen Sekundärstruktur der Aptamere kann unter Nutzung des im Internet frei verfügbaren Programms „mfold” (Version 3.1 oder 3.5) erfolgen. Dieses Programm führt eine Analyse der zweidimensionalen Struktur mit Hilfe einer Energieminimierungsmethode aus (Zuker M., 2003, Nucleic Acid Research 31, 3406–3415). Bei der Faltung der Aptamere kann es zu Stems (doppelsträngige Bereiche), Loops, d. h. Ausschleifungen von einzelsträngigen Bereichen, wie Haarnadel- oder interne Schleifen, und Bulbs, d. h. kleine einzelsträngige Ausbuchtungen in doppelsträngigen Bereichen, kommen. Mit dem Programm mfold wird für eine Aptamer-Nukleotidsequenz die hypothetische Sekundärstruktur bei Standardbedingungen bestimmt (Bindungs-/Faltungstemperatur: 21°C, Ionenstärke des Bindungspuffers: [Na+] 100 mM/[Mg2+] 10 mM). Bindungspufferzusammensetzung: 100 mM NaCl, 20 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 5 mM KCl, 1 mM CaCl2. Der Fachmann kann sehr leicht eine große Anzahl Varianten der konkret mit Sequenzen beschriebenen erfindungsgemäßen Aptamere entwerfen, beispielsweise durch Substitution, Insertion oder Deletion einzelner Basen. Solche Varianten können per Computer, wie oben beschrieben, in großer Zahl und ohne experimentellen Aufwand auf ihre Sekundärstruktur analysiert werden. Wenn eine Übereinstimmung der Sekundärstruktur einer Variante mit der Sekundärstruktur eines konkret mit Sequenz beschriebenen Aptamers vorliegt, ist eine Funktionalität der Variante wahrscheinlich oder bisweilen sehr wahrscheinlich.

Varianten der Aptamere nach Anspruch 1a) werden nachfolgend erläutert.

Von der Erfindung umfasst sind Aptamere, deren Sequenz eine Identität von mindestens 70%, vorzugsweise mindestens 80%, oder mindestens 85%, oder mindestens 90%, oder mindestens 93%, oder mindestens 95%, oder mindestens 96%, oder mindestens 97%, und am meisten bevorzugt mindestens 98%, mit einer der Sequenzen der SEQ ID NO: 1 bis SEQ ID NO: 65 aufweisen.

Unter dem Begriff „Identität” soll im Zusammenhang mit der vorliegenden Erfindung die Anzahl der übereinstimmenden Nukleotide (Identität), ausgedrückt in Prozent verstanden werden. Bevorzugt wird die Identität zwischen zwei betreffenden Nukleinsäuresequenzen mit Hilfe von Computerprogrammen ermittelt. Weisen Sequenzen, die miteinander verglichen werden, unterschiedliche Längen auf, ist die Identität so zu ermitteln, dass die Anzahl an Nukleotide, welche die kürzere Sequenz mit der längeren Sequenz gemeinsam hat, den prozentualen Anteil der Identität bestimmt. Vorzugsweise wird die Identität mittels des bekannten und der Öffentlichkeit zur Verfügung stehenden Computerprogramms ClustalW2 bestimmt. Auf die Definition von Identität in dem Programm ClustalW2 und die Methode zu ihrer Ermittlung, die öffentlich zugänglich sind, wird in dieser Erfindung ausdrücklich Bezug genommen.

ClustalW2 wird öffentlich zur Verfügung gestellt vom European Bioinformatics Institute (EBI) des European Molecular Biology Laboratory (EMBL) und kann im Internet unter http://www.ebi.ac.uk/Tools/msa/clustalw2/ abgerufen werden. Wenn das ClustalW2 Computerprogramm benutzt wird, um die Identität zwischen z. B. der Nukleotidsequenz der im Rahmen der vorliegenden Erfindung beschriebenen Nukleinsäuremoleküle und der Nukleotidsequenz von anderen Nukleinsäuremolekülen zu bestimmen, werden folgende Parameter eingestellt: DNA Weight Matrix: IUB; GAP OPEN: 10; GAP EXTENSION: 0,20; GAP DISTANCES: 5; NO END GAPS: no; ITERATION: none; NUMITER: 1; CLUSTERING: NJ.

Gegenstand der Erfindung ist auch jedes Aptamer, das mit dem komplementären Strang eines zuvor beschriebenen, erfindungsgemäßen Aptamers hybridisiert, vorausgesetzt, dass ein solches Aptamer an Protein A, G oder L, eine Protein A, G oder L enthaltende Substanz oder einen Protein A, G oder L enthaltenden Organismus, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bindet.

Der Begriff ”Hybridisierung” bedeutet im Rahmen dieser Erfindung eine Hybridisierung unter konventionellen Hybridisierungsbedingungen, vorzugsweise unter stringenten Bedingungen, wie sie beispielsweise in Sambrook et al., Molecular Cloning, A Laboratory Manual, 3. Aufl. (2001) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, beschrieben sind.

Nukleinsäuremoleküle, die mit den genannten Molekülen hybridisieren können beispielsweise aus DNA-Bibliotheken isoliert werden. Die Identifizierung und Isolierung derartiger Nukleinsäuremoleküle kann dabei unter Verwendung der genannten Nukleinsäuremoleküle (SEQ ID NO: 1 bis SEQ ID NO: 65) oder Teile dieser Moleküle bzw. der reversen Komplemente dieser Moleküle erfolgen, z. B. mittels Hybridisierung nach Standardverfahren (siehe z. B. Sambrook et al., 2001, Molecular Cloning, A Laboratory Manual, 3. Aufl. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). Bei als Hybridisierungsprobe verwendeten Fragmenten kann es sich auch um synthetische Fragmente oder Oligonukleotide handeln, die mit Hilfe gängiger Synthesetechniken hergestellt wurden und deren Sequenz im Wesentlichen mit der eines in Rahmen der vorliegenden Erfindung beschriebenen Aptamers bzw. dessen komplementären Strangs übereinstimmt.

Gegenstand der Erfindung ist auch ein Aptamer, das von einem Aptamer mit einer der Sequenzen der SEQ ID NO: 1 bis SEQ ID NO: 65 dadurch abgeleitet ist, dass bei einer der Sequenzen der SEQ ID NO: 1 bis SEQ ID NO: 65 ein oder mehrere Nukleotide substituiert, entfernt (deletiert), innerhalb der Sequenz eingefügt (insertiert) und/oder am 5'-Ende und/oder 3'-Ende angefügt sind, wobei ein solches Aptamer an Protein A, G oder L, eine Protein A, G oder L enthaltende Substanz oder einen Protein A, G oder L enthaltenden Organismus, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bindet. Derart veränderte Aptamere weisen vorzugsweise eine Identität von mindestens 70%, oder mindestens 80%, oder mindestens 85%, oder mindestens 90%, oder mindestens 93%, oder mindestens 95%, oder mindestens 96%, oder mindestens 97%, und am meisten bevorzugt mindestens 98% mit einer der Sequenzen der SEQ ID NO: 1 bis SEQ ID NO: 65 auf. Der Begriff Identität wurde zuvor definiert. Eine Sequenz, bei der ein oder mehr Nukleotide substituiert sind, bezeichnet man auch als Substitutionsmutante, eine Sequenz, bei der ein oder mehr Nukleotide deletiert sind, als Deletionsmutante und eine Sequenz, bei der ein oder mehr Nukleotide insertiert sind, als Insertionsmutante. Vorzugsweise sind insgesamt, bezogen auf Substitution, Deletion und Insertion in einem Aptamermolekül, bis zu 60 Nukleotide substituiert, deletiert, und/oder insertiert, mehr bevorzugt bis zu 50 Nukleotide, noch mehr bevorzugt bis zu 40 Nukleotide, oder bis zu 30 Nuleotide, insbesondere bevorzugt bis zu 10 Nukleotide oder bis zu 8 Nukleotide oder bis zu 5 Nukleotide, weiterhin bevorzugt bis zu 3 Nukleotide, und am meisten bevorzugt bis zu 2 Nukleotide.

Bei einer Anfügung sind vorzugweise am 5' und/oder am 3' Ende des Aptamers bis zu 100 Nukleotide angefügt, mehr bevorzugt bis zu 50 Nukleotide, noch mehr bevorzugt bis zu 40 Nukleotide, oder bis zu 20 Nuleotide, insbesondere bevorzugt bis zu 10 Nukleotide oder bis zu 8 Nukleotide, am meisten bevorzugt bis zu 5 Nukleotide.

In einer speziellen Ausführungsform bleiben bei den in den Punkten b) bis f) beschriebenen Abwandlungen eins oder beide der Motive ATACCAGCTTATTCAATT (SEQ ID NO: 66) und ACAATCGTAATCAGTTAG (SEQ ID NO: 67) unverändert oder im Wesentlichen unverändert. Im Wesentlichen unverändert bedeutet, dass bis zu maximal 5 Nukleotide, vorzugsweise maximal 4 Nukleotide, am meisten bevorzugt maximal 3 Nukleotide, bei diesem Motiv substituiert, deletiert und/oder insertiert sind.

Bei einem Aptamer, bei dem gegenüber einem Aptamer, welches eine Nukleinsäuresequenz umfasst, die ausgewählt ist aus einer der SEQ ID NO: 1 bis SEQ ID NO: 65, ein oder mehrere Nukleotide angefügt sind, können Anfügungen am 5'-Ende des Aptamers und/oder am 3'-Ende des Aptamers erfolgen. Bei Anfügungen kann es sich beispielsweise um Oligonukleotide handeln, die als Spacer zwischen der Aptamersequenz und einer Markierung dienen oder um ein Oligonukleotid das eine Sequenz aufweist, die komplementär zu einem gelabelten Oligonukleotid ist, wie beschrieben in WO2005113817. Verschiedene weitere anfügbare Sequenzen, welche die Bindungseigenschaften des Aptamers an sein Target nicht beeinträchtigen, sind dem Fachmann auf dem Gebiet der SELEX Verfahren bekannt, beispielsweise aus Conrad et al., ”In Vitro Selection of Nucleic Acid Aptamers That Bind Proteins, ”Methods in Enzymology, 267: 336–83 (1996); Ciesiolka et al., ”Affinity Selection-Amplification from Randomized Ribooligonucleotide Pools, ”Methods in Enzymology, 267: 315–35 (1996); and Fitzwater et al., ”A SELEX Primer, ”Methods in Enzymology, 267: 275–301 (1996).

Fragmente, auch bezeichnet als Teile oder Teilsequenzen, weisen die zuvor beschriebene Funktionalität der erfindungsgemäßen Aptamere auf. Fragmente werden erhalten, indem man am 5'-Ende und/oder am 3'-Ende eines erfindungsgemäßen Aptamers eine oder mehrere Nukleinsäuren entfernt. Fragmente haben vorzugsweise eine Länge von mindestens 10, insbesondere von mindestens 15 und besonders bevorzugt von mindestens 20 Nukleotiden, am meisten bevorzugt mindestens 30 oder mindestens 40 Nukleotiden. Fragmente sind beispielsweise solche Aptamere, bei welchen die Motive ATACCAGCTTATTCAATT (SEQ ID NO: 66) und/oder ACAATCGTAATCAGTTAG (SEQ ID NO: 67) ganz oder teilweise entfernt sind.

Der Begriff „Derivat” bezeichnet im Zusammenhang mit der vorliegenden Erfindung ein Aptamer, das eine chemische Struktur aufweist, die in natürlicher DNA oder RNA nicht vorkommt.

Insbesondere bezeichnet der Begriff Derivat ein Aptamer, das eine chemische Struktur enthält, die von Desoxyribose, Ribose, Phosphat, Adenin (A), Guanin (G), Cytosin (C), Thymin (T), oder Uracil (U) abweichend ist. Ein Aptamer-Derivat kann an der Nukleobase, an der Pentose oder am Phosphat-Rückgrat modifiziert sein.

Insbesondere bezeichnet der Begriff „Derivat” ein Aptamer,

  • – bei dem natürlich in DNA und RNA vorkommende Nukleotide teilweise oder vollständig durch chemisch davon abweichende Nukleotide, sogenannte modifizierte Nukleotide, ersetzt sind und/oder
  • – dessen molekulare Struktur anderweitig modifiziert ist, insbesondere durch Anbindung nicht natürlich in RNA oder DNA vorkommender Strukturen, und/oder
  • – die ein modifiziertes Rückgrat aufweisen.

Spezielle Beispiele für Derivate sind, ohne darauf beschränkt zu sein,

  • – Aptamere, die an mindestens einem Nukleotid eine Alkylierung, Arylierung oder Acetylierung, Alkoxylierung, Halogenierung, eine Aminogruppe oder eine andere funktionelle Gruppe aufweisen. Beispiele für modifizierte Nukleotide sind 2'-Fluor-Ribonucleotide, 2'-NH2-, 2'-OCH3- und 2'-O-methoxyethyl-Ribonukleotide, die für RNA-Aptamere genutzt werden.
  • – Aptamere, die eine Basenmodifikation aufweisen, wie Bromuridin,
  • – Markierte Aptamere, auch bezeichnet als gelabelte Aptamere. Bevorzugte Markierungen (Label) sind visuell, optisch, photonisch, elektronisch, akustisch, opto-akustisch, nach Masse, elektrochemisch, elektrooptisch, spektrometrisch, enzymatisch, oder anderweitig chemisch, biochemisch oder physikalisch detektierbar. Label können beispielsweise angebundene Reporter-, Marker- oder Adaptermoleküle sein. Beispiele hierfür sind markierte Aptamere, deren Markierung durch Lumineszenz, UV/VIS-Farbgebung, enzymatisch, elektrochemisch, immunologisch oder radioaktiv nachgewiesen werden kann. Beispiele für Markierungssubstanzen sind weiter unten bei der Erläuterung von erfindungsgemäßen Verfahren angegegeben, bei denen markierte Aptamere eingesetzt werden können.
  • – Aptamere, die enantiomere Nukleotide aufweisen.
  • – Aptamere, die ganz oder teilweise als Phosphorthioat-RNA oder -DNA, Phosphordithioat-RNA oder -DNA, Phosphorselenoat-RNA oder -DNA, Phosphordiselenoat-RNA oder -DNA, Phosphoroamidat-RNA oder -DNA, locked nucleic acid (LNA), peptide nucleic acid (PNA), N3'-P5' Phosphoramidat RNA/DNA, Cyclohexennukleinsäure (CeNA), Tricyclo-DNA (tcDNA) oder Spiegelmer vorliegen, oder die Phosphoramidatmorpholin (PMO) Komponenten aufweisen (siehe auch Chan et al., Clinical and Experimental Pharmacology and Physiology (2006) 33, 533–540).

Durch manche der Modifikationen können Aptamere gegen Nukleinsäure-spaltende Enzyme stabilisiert werden. Bei der Stabilisierung der Aptamere kann grundsätzlich zwischen der nachträglichen Modifikation der Aptamere und der Selektion mit bereits modifizierter RNA/DNA unterschieden werden. Die Stabilisierung berührt die Affinität der modifizierten RNA/DNA-Aptamere nicht, verhindert jedoch die schnelle Zersetzung der Aptamere in einem Organismus oder biologischen Lösungen durch RNasen/DNasen. Ein Aptamer wird im Rahmen der Erfindung als stabilisiert bezeichnet, wenn die Halbwertszeit in biologischen Seren grösser als eine Minute, vorzugsweise grösser als eine Stunde, besonders bevorzugt grösser als ein Tag ist. Die Aptamere können auch mit Reportermolekülen modifiziert sein, die neben der Detektion der markierten Aptamere auch zur Erhöhung der Stabilität beitragen können.

In einer weiteren speziellen Ausführungsform betrifft die Erfindung ein Aptamer das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen bindet und das ausgewählt ist aus

  • a) einem Aptamer umfassend, oder bestehend aus, eine(r) Nukleinsäuresequenz, mit der SEQ ID NO: 62, mit der Maßgabe, dass Thymin durch Uracil ersetzt sein kann,
  • b) einem Aptamer, dessen Nukleinsäuresequenz eine Identität von mindestens 70% mit der Nukleinsäuresequenz eines Aptamers aus a) aufweist, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 1 bis SEQ ID NO: 4,
  • c) einem Aptamer, das mit dem komplementären Strang eines Aptamers aus a) hybridisiert, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 1 bis SEQ ID NO: 4,
  • d) einem Aptamer bei dem gegenüber einem Aptamer aus a) ein oder mehrere Nukleotide substituiert, deletiert, insertiert und/oder angefügt sind, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 1 bis SEQ ID NO: 4,
  • e) einem Fragment eines Aptamers nach a), b), c) oder d),
  • f) einem Derivat eines Aptamers nach a), b), c), d) oder e).

Zu den Punkten b)–f) gelten, auch für die noch folgenden Ausführungsformen, analog die obigen Offenbarungen.

In einer weiteren speziellen Ausführungsform betrifft die Erfindung ein Aptamer das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen bindet und das ausgewählt ist aus

  • a) einem Aptamer umfassend, oder bestehend aus, eine(r) Nukleinsäuresequenz, mit der SEQ ID NO: 63, mit der Maßgabe, dass Thymin durch Uracil ersetzt sein kann,
  • b) einem Aptamer, dessen Nukleinsäuresequenz eine Identität von mindestens 70% mit der Nukleinsäuresequenz eines Aptamers aus a) aufweist, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 5 bis SEQ ID NO: 8,
  • c) einem Aptamer, das mit dem komplementären Strang eines Aptamers aus a) hybridisiert, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 5 bis SEQ ID NO: 8,
  • d) einem Aptamer bei dem gegenüber einem Aptamer aus a) ein oder mehrere Nukleotide substituiert, deletiert, insertiert und/oder angefügt sind, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 5 bis SEQ ID NO: 8,
  • e) einem Fragment eines Aptamers nach a), b), c) oder d),
  • f) einem Derivat eines Aptamers nach a), b), c), d) oder e).

In noch einer weiteren speziellen Ausführungsform betrifft die Erfindung ein Aptamer das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen bindet und das ausgewählt ist aus

  • a) einem Aptamer umfassend, oder bestehend aus, eine(r) Nukleinsäuresequenz, mit der SEQ ID NO: 64, mit der Maßgabe, dass Thymin durch Uracil ersetzt sein kann,
  • b) einem Aptamer, dessen Nukleinsäuresequenz eine Identität von mindestens 70% mit der Nukleinsäuresequenz eines Aptamers aus a) aufweist, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 9 bis SEQ ID NO: 10,
  • c) einem Aptamer, das mit dem komplementären Strang eines Aptamers aus a) hybridisiert, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 9 bis SEQ ID NO: 10,
  • d) einem Aptamer bei dem gegenüber einem Aptamer aus a) ein oder mehrere Nukleotide substituiert, deletiert, insertiert und/oder angefügt sind, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 9 bis SEQ ID NO: 10,
  • e) einem Fragment eines Aptamers nach a), b), c) oder d),
  • f) einem Derivat eines Aptamers nach a), b), c), d) oder e).

In noch einer weiteren speziellen Ausführungsform betrifft die Erfindung ein Aptamer das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen bindet und das ausgewählt ist aus

  • a) einem Aptamer umfassend, oder bestehend aus, eine(r) Nukleinsäuresequenz, mit der SEQ ID NO: 65, mit der Maßgabe, dass Thymin durch Uracil ersetzt sein kann,
  • b) einem Aptamer, dessen Nukleinsäuresequenz eine Identität von mindestens 70% mit der Nukleinsäuresequenz eines Aptamers aus a) aufweist, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 11 bis SEQ ID NO: 12,
  • c) einem Aptamer, das mit dem komplementären Strang eines Aptamers aus a) hybridisiert, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 11 bis SEQ ID NO: 12,
  • d) einem Aptamer bei dem gegenüber einem Aptamer aus a) ein oder mehrere Nukleotide substituiert, deletiert, insertiert und/oder angefügt sind, insbesondere ein Aptamer mit einer Sequenz nach SEQ ID NO: 11 bis SEQ ID NO: 12,
  • e) einem Fragment eines Aptamers nach a), b), c) oder d),
  • f) einem Derivat eines Aptamers nach a), b), c), d) oder e).

Eine spezielle Ausführungsform der Erfindung betrifft ein Aptamer, das an Protein A, G oder L, Protein A, G oder L enthaltende Substanzen oder Protein A, G oder L enthaltende Mikroorganismen bindet, und das ausgewählt ist aus

  • a) einem Aptamer umfassend, oder bestehend aus, eine(r) Nukleinsäuresequenz, die ausgewählt ist aus der Gruppe bestehend aus SEQ ID NO: 1 bis SEQ ID NO: 65, wobei
    am 5'-Ende der Nukleinsäuresequenz der SEQ ID NO: 1 bis SEQ ID NO: 65 ein Oligonukleotid mit der Sequenz 5' ATACCAGCTTATTCAATT 3' (SEQ ID NO: 66) entfernt ist und/oder
    am 3'-Ende der Nukleinsäuresequenz der SEQ ID NO: 1 bis SEQ ID NO: 65 ein Oligonukleotid mit der Sequenz 5' ACAATCGTAATCAGTTAG 3' (SEQ ID NO: 67) entfernt ist,
    mit der Maßgabe, dass Thymin durch Uracil ersetzt sein kann,
  • b) einem Aptamer, dessen Nukleinsäuresequenz eine Identität von mindestens 70% mit der Nukleinsäuresequenz eines Aptamers aus a) aufweist,
  • c) einem Aptamer, das mit dem komplementären Strang eines Aptamers aus a) hybridisiert,
  • d) einem Aptamer bei dem gegenüber einem Aptamer aus a) ein oder mehrere Nukleotide substituiert, deletiert, insertiert und/oder angefügt sind,
  • e) einem Fragment eines Aptamers nach a), b), c) oder d),
  • f) einem Derivat eines Aptamers nach a), b), c), d) oder e).

Die Bindungsfähigkeit der erfindungsgemäßen Aptamere wird durch die Affinität (Sensitivität) der Bindung (ausgedrückt durch die Dissoziationskonstante) beschrieben.

In einem weiteren Aspekt betrifft die Erfindung ein Arzneimittel, insbesondere zur Diagnose, Prophylaxe und/oder Behandlung von Erkrankungen, die auf Staphylococcus aureus, Streptococcus und/oder Peptostreptococcus zurückzuführen sind, umfassend ein oder mehrere verschiedene erfindungsgemäße Aptamere wie zuvor beschrieben. Mit dem Begriff Prophylaxe kann beispielsweise gemeint sein, dass Staphylococcus aureus, Streptococcus oder Peptostreptococcus durch Anbindung eines erfindungsgemäßen Aptamers unschädlich gemacht werden und dadurch eine Infektion eines Organismus verhindert wird.

Ferner betrifft die Erfindung auch die Verwendung der erfindungsgemäßen Aptamere zur Diagnose, Prophylaxe, Behandlung und/oder Therapie von Erkrankungen, die auf Staphylococcus aureus, Streptococcus oder Peptostreptococcus zurückzuführen sind, sowie die Verwendung der erfindungsgemäßen Aptamere zur Herstellung eines Arzneimittels zur Diagnose, Prophylaxe, Behandlung und/oder Therapie von Erkrankungen, die auf Staphylococcus aureus, Streptococcus oder Peptostreptococcus zurückzuführen sind.

Ein Arzneimittel im Sinne der Erfindung ist jedes Mittel, welches in der Prophylaxe, Diagnose, Therapie, Verlaufskontrolle oder Nachbehandlung von Patienten eingesetzt werden kann, die zumindest zeitweise eine pathogene Modifikation des Gesamtzustandes bzw. des Zustandes einzelner Teile des Patientenorganismus zeigen. Das Arzneimittel kann ein Arzneimittel für Menschen wie auch für Tiere sein. Erkrankungen, die auf Staphylococcus aureus zurückzuführen und mit einem erfindungsgemäßen Arzneimittel behandelbar sind, sind insbesondere Sepsis, Haut- und Wundinfektionen, Pneumonien, Abszesse, Furunkel, Karbunkel, Endokarditis, Muskelerkrankungen (Pyomyositis), Osteomyelitis, Lebensmittelvergiftungen durch S. aureus Exotoxine, Toxisches Schock-Syndrom (TSS) Sepsis und Mastitis bei Tieren.

Das erfindungsgemäße Arzneimittel enthält vorzugsweise pharmazeutisch vertragliche Hilfsstoffe und/oder Trägerstoffe, die dem Fachmann bekannt sind.

Das Arzneimittel kann das Aptamer beispielsweise als ein pharmazeutisch akzeptables Salz umfassen. Hierbei kann es sich beispielsweise um Salze anorganischer Säuren, wie z. B. der Phosphorsäure, oder um Salze organischer Säuren handeln. Die jeweilige Dosis bzw. der Dosisbereich für die Gabe des erfindungsgemäßen Arzneimittels ist groß genug, um den gewünschten prophylaktischen oder therapeutischen Effekt der Bindung an Protein A, G oder L zu erreichen. Im Allgemeinen wird die Dosis mit dem Alter, der Konstitution und dem Geschlecht des Patienten variieren, sowie die Schwere der Erkrankung berücksichtigen. Es versteht sich, dass die spezifische Dosis, Häufigkeit und Dauer der Verabreichung darüber hinaus von einer Vielzahl an Faktoren abhängen, wie z. B. der Bindungsfähigkeit der Aptamere, Ernährungsgewohnheiten des zu behandelnden Individuums, Art der Verabreichung, Ausscheidungsrate und Kombination mit anderen Medikamenten. Die exakte Dosis ist durch einen Fachmann mit bekannten Mitteln und Methoden feststellbar.

Zur Unterstützung der medizinischen Wirkung kann das Arzneimittel in einer bevorzugten Ausführungsform der Erfindung auch weitere Wirkstoffe umfassen, wie z. B. Antikörper.

Das Arzneimittel der vorliegenden Erfindung kann oral, transmucosal, rektal, pulmonal, enteral und/oder parenteral angewendet werden. Bevorzugt ist eine direkte Injektion in den Körper. Die gewählte Art der Verabreichung richtet sich nach der Indikation, der zu verabreichenden Dosis, Individuums-spezifischen Parametern etc. Insbesondere ermöglichen die verschiedenen Arten der Verabreichung eine ortspezifische Therapie, die Nebenwirkungen minimiert und die Wirkstoffdosis verringert. Bevorzugte Injektionen sind die intradermale, subkutane, intramuskuläre oder intravenöse Injektion. Die Applikation kann z. B. mit Hilfe sogenannter Impfpistolen, die die DNA mittels Goldkugeln in die Haut einbringen, oder mittels Spritzen, die die DNA unter die Haut oder in den Muskel einbringen, geschehen. Es ist auch möglich, das Aptamer als Aerosol bereitzustellen, welches von dem Organismus, bevorzugt einem humanen Patienten, inhaliert wird.

Um die protektive oder therapeutische Wirkung der erfindungsgemäßen Aptamere zu erhöhen, können den daraus hergestellten pharmazeutischen Mitteln pharmazeutisch verträgliche Hilfsstoffe, wie z. B. Adjuvantien, zugesetzt werden. Im Sinne der Erfindung ist jede Substanz, die mit den erfindungsgemäßen DNA-Aptameren eine Wirkung ermöglicht, verstärkt oder modifiziert, ein Adjuvants. Bekannte Adjuvantien sind beispielsweise Aluminiumverbindungen, wie z. B. Aluminiumhydroxid oder Aluminiumphosphat, Saponine, wie z. B. OS 21, Muramyldipeptid oder Muramyltripeptid, Proteine, wie z. B. Gammainterferon oder TNF, MF 59, Phosphatdibylcholin, Squalen oder Polyole. Des Weiteren kann DNA, die eine immunstimulatorische Eigenschaft hat, oder die ein Protein mit Adjuvants-Effekt kodiert, wie z. B. ein Cytokin, parallel oder in einem Konstrukt appliziert werden.

Das pharmazeutische Mittel kann beispielsweise als Tablette, Kapsel, Pulver, Lösung, Dispersion oder Suspension vorliegen. Die Darreichungsformen des pharmazeutischen Mittels werden mit den üblichen festen oder flüssigen Trägerstoffen und/oder Verdünnungsmitteln und den üblicherweise eingesetzten Hilfsstoffen entsprechend der gewünschten Applikationsart in einer geeigneten Dosierung und in an sich bekannter Weise hergestellt.

In einem weiteren Aspekt betrifft die Erfindung ein Verfahren zum Nachweis von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bei dem

  • a) ein oder mehrere verschiedene erfindungsgemäße Aptamere, wie zuvor beschrieben, mit einer Probe, die Protein A, G oder L, die Protein A, G oder L enthaltende Substanz oder den Mikroorganismus enthält, in Kontakt gebracht wird und
  • b) eine Bindung zwischen dem/den Aptamer(en) und Protein A, G oder L, oder zwischen dem/den Aptamer(en) und der Substanz, oder zwischen dem/den Aptamer(en) und dem Mikroorganismus nachgewiesen wird.

Das Verfahren kann sowohl ein qualitatives als auch ein quantitatives Nachweisverfahren sein. Die Verfahrenschritte a) und b) können je nach konkreter Verfahrensgestaltung gleichzeitig oder im Wesentlichen gleichzeitig erfolgen.

Das Verfahren ist insbesondere zum Einsatz in der Lebensmittel-, Wasser- und Umweltanalytik, der Wasserbehandlung und der Wasseraufbereitung, insbesondere von Trinkwasser und Abwasser, der Diagnostik sowie zur Anwendung in Krankenhäusern und Pflegeeinrichtungen geeignet.

Das Verfahren eignet sich insbesondere zum Nachweis von Staphylococcus aureus in beliebigen Medien und Umgebungen, insbesondere in Wasser und anderen Flüssigkeiten, wie beispielsweise in Trink- und Abwasserproben. Im Fall von Staphylococcus aureus bindet das erfindungsgemäße Aptamer an Protein A, das in der Zellwand vorkommt und für das Aptamer zugänglich ist. Das Aptamer kann ebenfalls an andere Keime binden, die Protein A, G oder L enthalten, beispielsweise als Oberflächenprotein in der Zellwand. Sofern das Protein A, G oder L nicht an der Oberfläche eines Mikroorganismus sitzt, besteht die Möglichkeit, den Organismus zu zerstören, um darin enthaltenes Protein A, G oder L zum Nachweis freizusetzen.

Eine Probe im Sinne des obigen Nachweisverfahrens ist ein bereitgestelltes oder durch Probenentnahme erhaltenes Material, von dem angenommen wird, dass es Protein A, G oder L, Protein A, G oder L enthaltende Substanz oder einen Protein A, G oder L enthaltenden Mikroorganismus (zusammenfassend bezeichnet als „Target” oder im Rahmen dieses Nachweisverfahrens auch als „Analyt”) umfasst, und das auf das Vorhandensein Target geprüft werden soll.

Eine Probe kann eine Wasserprobe, insbesondere eine Trinkwasser-, Grundwasser, Oberflächenwasser oder Abwasserprobe, eine Probe von anderweitigem, aus der Umwelt entnommenem Material, eine klinische Probe oder eine Lebensmittelprobe sein.

Eine Probe können weiterhin alle biologischen Materialien sein, die von Individuen isoliert worden sind, beispielsweise biologische Gewebe und Flüssigkeiten, zu denen u. a. Blut, Haut, Plasma, Serum, Lymphe, Urin, Gehirnflüssigkeit, Tränen, Abstriche, Gewebeproben, Organe und Tumore zählen. Vorliegend sind in Proben auch Bestandteile von Zellkulturen eingeschlossen. Die Probenentnahme erfolgt insbesondere so, dass die entnommene Teilmenge einem Durchschnitt der gesamten Menge entspricht. Die durch Untersuchung der Probe ermittelten Merkmale dienen der Beurteilung der durch die Probe erfassten Menge, die wiederum Rückschlüsse auf die Gesamtmenge, beispielsweise das Blut bzw. die Lymphe in einem Organismus, zulasst. Für die Untersuchung können die Proben vorbehandelt, wie z. B. durch Mischen, Zugabe von Enzymen oder Markern, oder aufgereinigt werden.

Wird das Aptamer mit dem Target (Protein A, G oder L, Protein A, G oder L enthaltende Substanz oder Protein A, G oder L enthaltender Mikroorganismus) in Kontakt gebracht, so bildet sich ein Aptamer-Target-Komplex durch Bindung des Aptamers an das Target. Die Bindung bzw. das Bindungsereignis kann beispielsweise visuell, optisch, photonisch, elektronisch, akustisch, opto-akustisch, nach Masse, elektrochemisch, elektrooptisch, spektrometrisch, enzymatisch, oder anderweitig chemisch, biochemisch oder physikalisch nachgewiesen werden.

Bei einem markierungsfreien Nachweis wird das Aptamer beispielsweise auf einer Oberfläche fixiert und die Änderung der Schichtdicke nach Anlagerung des Targets mit einer der genannten Methoden bestimmt, wie z. B. über eine Änderung der optischen Eigenschaften der Sensorschicht (z. B. Brechungsindex). Ein weiteres Verfahren des markierungsfreien Nachweises ist die Messung der Masseänderung nach Bindung des Aptamers an das Target mit einer Mikrowaage, oder die Messung einer Frequenzänderung eines Schwingquarzes nach Bindung des Aptamers an das Target, welches auf der Oberfläche des Schwingquarzes bereitgestellt wird.

In Fällen, in denen die Komplexierung nicht direkt detektierbar ist, kann der Komplex durch eine Markierung sichtbar gemacht werden, beispielsweise in einer Indikatorreaktion nach einer direkten oder indirekten Kopplung eines Komplexpartners mit einer Markierungssubstanz. Entweder kann das verwendete Aptamer oder das Target mit einer Markierung (Label) versehen sein. Bevorzugt ist das Aptamer markiert.

Bevorzugte Markierungen (Label) sind visuell, optisch, photonisch, elektronisch, akustisch, opto-akustisch, nach Masse, elektrochemisch, elektrooptisch, spektrometrisch, enzymatisch, oder anderweitig physikalisch, chemisch oder biochemisch detektierbar. In einer Ausführungsform des Verfahrens wird die Markierung durch Lumineszenz, UV/VIS-Spektroskopie, enzymatisch, elektrochemisch oder radioaktiv nachgewiesen.

Lumineszenz betrifft die Emission von Licht. Im erfindungsgemäßen Verfahren finden beispielsweise die Photolumineszenz, die Chemilumineszenz und die Biolumineszenz zum Nachweis der Markierung Anwendung. Bei der Photolumineszenz oder Fluoreszenz erfolgt die Anregung durch Absorption von Photonen. Beispielhafte Fluorophore sind, ohne Beschränkung, Bisbenzimidazol, Fluoreszein, Acridinorange, Cy5, Cy3 oder Propidiumiodid, die kovalent an Aptamere gekoppelt werden können, Tetramethyl-6-Carboxyrhodamin (TAMRA), Texas Red TR, Rhodamin, Alexa Fluor Farbstoffe (u. a. Fluoreszenzfarbstoffe verschiedener Wellenlängen von verschiedenen Firmen). Die Auswertung geschieht visuell oder mit entsprechenden Messgeräten, z. B. im Multilabel Counter, im Fluoreszenzmikroskop, oder durch Durchflusszytometrie, z. B. im Cytofluorimeter. Chemilumineszenz beschreibt die Emission sichtbaren Lichts als Folge einer chemischen Reaktion. Biolumineszenz bezeichnet die Emission sichtbaren Lichts als Folge einer Enzymreaktion, beispielsweise einer durch das Enzym Luciferase katalysierten Redoxreaktion.

Andere Markierungsstoffe sind Katalysatoren, kolloidale metallische Teilchen, z. B. Gold-Nanopartikel, kolloidale nicht metallische Teilchen, Quantum Dots, organische Polymere, Latexteilchen, oder Liposome mit signalerzeugenden Stoffen. Kolloidale Teilchen können kolorimetrisch nachgewiesen werden.

Auch einsetzbar sind visuell detektierbare Farbstoffe, wie beispielsweise interkalierende Farbstoffe.

Einsetzbar als Marker sind auch Enzyme, deren enzymatische Reaktion durch den Verbrauch oder die Entstehung detektierbarer Substrate oder Produkte gekennzeichnet ist, wobei ohne Beschränkung eine optische oder elektrochemische Detektion angewandt werden kann. Ein Nachweis kann z. B. mit Enzymen als Markierungssubstanzen geführt werden, die Substrate zu farbigen Produkten umsetzen, vorzugsweise Peroxidase, Green Fluoreszent Protein (GFP), Luciferase, [beta]-Galactosidase oder Alkalische Phosphatase. Beispielsweise wird das farblose Substrat X-Gal durch die Aktivität der [beta]-Galactosidase zu einem blauen Produkt umgesetzt, dessen Farbgebung visuell erfasst wird.

Ein oben genanntes enzymatisches Marker- und Nachweissystem verwendet Alkalische Phosphatase. Mit Alkalischer Phosphatase (AP) sind verschiedene Nachweise möglich, wie nachfolgend beispielhaft dargestellt:

  • – elektrochemischer Nachweis: Substrat Phenylphosphat, enzymatische Reaktion von APP bildet Phenol, wird an Phenolsensor (z. B. mit immobilisierter Tyrosinase) elektrochemisch detektiert
  • – Messung der Farbreaktion: Substrat p-Nitrophenylphosphat, enzymatische Reaktion von APP bildet p-Nitrophenol, ist gelb gefärbt
  • – Fluoreszenz-Nachweis: Substrat 4-Methylumbelliferonylphosphat: enzymatische Reaktion von APP bildet Methylumbelliferonyl-Rest, der nach Anregung Fluoreszenz freisetzt
  • – für Chemilumineszenz-Nachweis: Substrat AMPPD (3-(2'-Spiroadamantan)-4-Methoxy-4-(3''-Phosphoryloxy)phenyl-1,2-Dioxetan): enzymatische Reaktion von APP bildet AMP-D und setzt hv (Chemilumineszenz) frei

Ferner setzt APP 5-Brom-4-Chlor-3-Indolylphosphat (BCIP oder X-Phosphat) und Nitroblau-Tetrazoliumsalz (NBT) farbig um. Die Farbstoffe fallen dabei in unmittelbarer Nähe der AP-Moleküle aus und färben die Umgebung der gebundenen Verbindungen dunkelviolett an.

Die Peroxidase katalysiert z. B. die Oxidation von ABTS (2,2'-Azino-bis-[3-ethylbenzthiazolin-6-sulfonsäure]) in Gegenwart von H2O2. Aufgrund der Enzymstabilität und einer Vielzahl an möglichen Substraten ist die Meerettich-Peroxidase bevorzugt. Weitere Enzymmarker, die die Erzeugung detektierbarer Produkte katalysieren sind Chloramphenicolacetyltransferase (CAT) und Glutathion-S-Transferase (GST).

Der Nachweis kann auch mittels radioaktiver Isotope erfolgen, mit denen das Aptamer markiert ist, vorzugsweise 3H, 14C, 32P, 33P, 35S oder 125I, besonders bevorzugt 32P, 33P oder 125I. Bei der Szintillationszählung wird die vom radioaktiv-markierten Aptamer-Target-Komplex abgegebene radioaktive Strahlung indirekt gemessen. Eine Szintillatorsubstanz wird durch die radioaktive Strahlung angeregt. Beim Übergang in den Grundzustand wird die Anregungsenergie wieder als Lichtblitze freigesetzt, welche durch einen Photoelektronenvervielfacher (Photomultiplier) verstärkt und gezählt werden.

Die Aptamere können auch mit Digoxigenin oder Biotin markiert sein, die beispielsweise durch Antikörper oder Streptavidin gebunden werden, die wiederum eine Markierung tragen können, wie z. B. ein Enzymkonjugat. Ist der Antikörper an ein Enzym gekoppelt, kann ein ELISA (enzyme-linked immunosorbent assay) zum Nachweis erfolgen, was nachfolgend noch erläutert ist. Die vorherige kovalente Verknüpfung (Konjugation) eines Antikörpers mit einem Enzym kann auf verschiedene bekannte Arten erfolgen. Der Nachweis der Antikörper-Bindung kann auch radioaktiv in einem RIA (radioactive immunoassay) mit radioaktiven Isotopen, vorzugsweise mit 125 I, oder durch Fluoreszenz in einem FIA (Fluoroimmunoassay) mit Fluorophoren, vorzugsweise mit Fluorescein oder FITC, erfolgen.

Die genannten Methoden schließen vorzugsweise Waschschritte ein, um ungebundene und/oder unspezifisch gebundene Aptamere und/oder Nachweisreagenzien abzutrennen. Die Durchführung sämtlicher Nachweisverfahren ist dem Fachmann bekannt. Der direkte Nachweis der Markierung ist im vorliegenden Verfahren der Erfindung bevorzugt, insbesondere der direkte Nachweis durch Fluoreszenz.

In einer weiteren Ausgestaltung des Verfahrens wird der Nachweis in-situ durchgeführt. Diese Umsetzung erfordert einen geeigneten Inkubationsraum, auf dem der Nachweis einfach durchgeführt und sichtbar gemacht werden kann. Hierzu wird vorteilhaft ein fester Träger verwendet, der es ermöglicht, Probe, Aptamere und ggf. Nachweisreagenzien der Komplexe zu fixieren. Die Aptamere können sowohl vor oder nach der Probe auf den festen Träger aufgebracht werden. Methoden der Immobilisierung vorgenannter Aptamere sind dem Fachmann bekannt. Beispiele sind weiter unten angegeben. Für den Nachweis kommen alle Nachweise in Betracht, die zuvor bereits genannt sind, wie markierungsfreie Nachweise und Nachweise mit Verwendung einer Markierung. Bei einem Farbnachweis können die Aptamere so markiert sein, so dass direkt im Anschluss an die Inkubation ein Ablesen und Auswerten realisiert werden kann.

In den zuvor erläuterten Verfahren und allen anderen von dieser Erfindung offenbarten Verfahren kann das erfindungsgemäße Aptamer allein, oder eine Mischung verschiedener erfindungsgemäßer Aptamere eingesetzt werden. Erfindungsgemäße Aptamere können auch in Kombination mit anderen Aptameren angewendet werden. Eine Kombination mit anderen Aptameren für andere Targets (d. h. andere Targets als Protein A, G oder L, Protein A, G oder L enthaltende Substanzen, und Protein A, G oder L enthaltende Mikroorganismen) bietet den Vorteil, dass ein entsprechendes Verfahren gleichzeitig auch zum Nachweis, Anreicherung, Abtrennung und/oder Isolierung anderer Targets anwendbar ist.

Wie bereits erwähnt, können die Probe oder das Aptamer je nach Verfahrensgestaltung an eine feste Phase immobilisiert sein. In dem Verfahren können beispielsweise (Micro)-Arrays des erfindungsgemäßen Aptamers, oder Mikrotiterplatten-Testsysteme eingesetzt werden.

Aptamere binden an das Target ähnlich stark wie Antikörper an ihr Target (Antigen). Daher ist das oben beschriebene Nachweisverfahren analog durchführbar wie bekannte Immunoassays, wobei im Vergleich zu einem bekannten Immunoassay einer oder mehrere Antikörper durch ein erfindungsgemäßes Aptamer ersetzt sind.

Beispielsweise ist es möglich, das Nachweisverfahrens in Form eines kompetitiven Assays oder eines Sandwich-Assays durchzuführen.

Bei einer Ausführungsform eines kompetitiven Assays wird ein für das Target spezifisches erfindungsgemäßes Aptamer an eine feste Phase gebunden. Anschließend erfolgt die Zugabe der Probenlösung, die das zu messende Target enthält und gleichzeitig mit einer bekannten Konzentration an markiertem Target versetzt ist. Sowohl das in der Probenlösung in unbekannter Konzentration vorliegende unmarkierte Target als auch das markierte Target konkurrieren um die Bindung an das gebundene Aptamer. Je höher die Konzentration des Targets in der Probe ist, desto weniger markiertes Target wird demzufolge an das Aptamer gebunden. Über die Erkennung und gegebenenfalls eine quantitative Bestimmung der Markierung sind der Nachweis des Targets in der Probe und die Messung seiner Konzentration möglich.

In einer anderen Ausführungsform eines kompetetiven Assays wird ebenfalls zunächst ein für das Target spezifisches erfindungsgemäßes Aptamer an eine feste Phase gebunden. Daran wird markiertes Target gebunden. Die Messung der Markierung ergibt das Ausgangssignal. Die Zugabe von Probe mit unmarkiertem Target verdrängt gebundenes markiertes Target, und das abnehmende Messignal ist der Probenkonzentration proportional.

Bei einem klassischen immunologischen Sandwich-Assay werden mindestens zwei Antikörper eingesetzt. Zunächst wird einer der beiden Antikörper an eine feste Phase immobilisiert. Dieser wird als Primärantikörper oder auch als Fänger bezeichnet. Nach der Zugabe der Probe bindet das darin enthaltene Antigen an den Primärantikörper. Anschließend wird die Probenlösung entfernt und der als Sekundärantikörper oder Detektor bezeichnete zweite Antikörper in gelöster Form auf die feste Phase gegeben. Der Detektor bindet nun ebenfalls an das durch den Primärantikörper gebundene Antigen. Für den Nachweis und die Quantifizierung ist der Sekundärantikörper entweder selbst markiert, oder er wird über ein markiertes Reagens nachgewiesen. in der vorliegenden Erfindung wird dieses Verfahren dahin gehend abgewandelt, dass entweder der Primärantikörper oder der Sekundärantikörper, oder beide, durch ein erfindungsgemäßes Aptamer ersetzt werden und dass das Antigen ein Target für das Aptamer, also Protein A, G oder L, eine Protein A, G oder L enthaltende Substanz oder ein Protein A, G oder L enthaltender Mikroorganismus, ist. Der Assay kann mit allen bekannten festen Phasen durchgeführt werden, beispielsweise Mikrotiterplatten, Streifen, Membranen, Küvetten etc.

Die Erfindung stellt somit in einer speziellen Ausführungsform ein Verfahren zum Nachweis von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, zur Verfügung, bei dem

  • a) ein erster Antikörper oder ein erfindungsgemäßes Aptamer, der/das für Protein A, G oder L spezifisch ist, an eine feste Phase immobilisiert wird,
  • b) die feste Phase mit daran immobilisiertem Antikörper oder Aptamer mit einer Probe, die Protein A, G oder L, die Protein A, G oder L enthaltende Substanz oder den Protein A, G oder L enthaltenden Mikroorganismus enthält, inkubiert wird, und
  • c) die feste Phase mit einem zweiten Antikörper oder einem erfindungsgemäßen Aptamer, der/das für Protein A, G oder L spezifisch ist, inkubiert wird und
  • d) eine Bindung zwischen dem zweiten Antikörper oder dem Aptamer und Protein A, G oder L, Protein A, G oder L enthaltender Substanzen oder Protein A, G oder L enthaltendem Mikroorganismus nachgewiesen wird,
    unter der Bedingung, dass mindestens in einem der Schritte a) oder c) ein erfindungsgemäßes Aptamer statt eines Antikörpers eingesetzt wird.

Die Immobilisierung in Schritt a) kann mit allen üblichen Techniken erfolgen, die auch aus immunologischen Assays bekannt sind. Der Nachweis in Schritt d) kann im Falle eines Antikörpers durch die bekannten Methoden erfolgen, die aus immunologischen direkten und indirekten Sandwich-Assays bekannt sind. Entweder kann der Antikörper selbst markiert sein, beispielsweise durch Anbindung eines Enzyms, das eine Farbreaktion zum Nachweis katalysieren kann, oder es kann ein dritter Antikörper zugegeben werden, der seinerseits an den zweiten Antikörper bindet und eine Markierung aufweist. Sofern in Schritt c) ein Aptamer eingesetzt wird, ist dieses vorzugsweise ein markiertes Aptamer, das mit geeigneten Nachweisreaktionen detektiert werden kann, wie zuvor bereits beschrieben. Zwischen den genannten Schritten a)–d) werden vorzugsweise Waschschritte durchgeführt, z. B. mit üblichen und bekannten Waschpuffern. Der Begriff Immobilierung bedeutet bei diesem Verfahren, dass der in Schritt a) immobilisierte Antikörper oder das Aptamer nicht durch einen Waschschritt von der festen Phase entfernt wird.

In einem weiteren Aspekt betrifft die Erfindung ein Verfahren zur Anreicherung, Abtrennung und/oder Isolierung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, bei dem

  • a) ein oder mehrere verschiedene Aptamere wie zuvor beschrieben mit einer Probe, die Protein A, G oder L, eine Protein A, G oder L enthaltende Substanz oder einen Protein A, G oder L enthaltenden Mikroorganismus enthält, in Kontakt gebracht wird/werden, wobei ein Komplex oder Komplexe aus dem/den Aptamer(en) und Protein A, G oder L, aus dem/den Aptamer(en) und der Protein A, G oder L enthaltenden Substanz oder aus dem/den Aptamer(en) und dem Protein A, G oder L enthaltenden Mikroorganismus gebildet wird,
  • b) der/die Komplex(e) und die übrige Probe voneinander getrennt werden, und
  • c) optional Protein A, G oder L, die Protein A, G oder L enthaltende Substanz oder der Protein A, G oder L enthaltende Mikroorganismus aus dem Komplex isoliert wird.

Eine „Probe” im Sinne dieses Verfahrens ist ebenso definiert wie eine Probe im Sinne des zuvor beschriebenen Nachweisverfahrens. Eine Probe ist insbesondere eine Wasserprobe, wie zum Beispiel eine Trinkwasser-, Grundwasser-, Oberflächenwasser- oder Abwasserprobe, eine Probe von anderweitigem aus der Umwelt entnommenem Material, oder eine Lebensmittelprobe.

Auch dieses Verfahren kommt insbesondere zum Einsatz in der Lebensmittel-, Wasserund Umweltanalytik, der Wasserbehandlung und der Wasseraufbereitung, insbesondere von Trinkwasser und Abwasser, der Diagnostik sowie in Krankenhäusern und Pflegeeinrichtungen.

Eine „Abtrennung” von Protein A, G oder L, Protein A, G oder L enthaltender Substanz oder eines Protein A, G oder L enthaltenden Mikroorganismus (zusammengefasst bezeichnet als „Target”) aus einer Probe kann, im Rahmen der analytischen Nachweisgrenze, vollständig sein oder nicht vollständig sein. Eine vollständige Abtrennung wird hierin auch als „Entfernung” bezeichnet. Mit diesem Verfahren kann insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus aus Umgebungen, in denen es unerwünscht ist, abgetrennt werden, beispielsweise aus wässrigen oder anderen flüssigen Proben.

Eine „Anreicherung” wird in Schritt b) erzielt, wenn der gebildete Aptamer-Target-Komplex und die übrige Probe voneinander getrennt werden. Es werden zwei Fraktionen erhalten, wobei in der Fraktion, die den Komplex enthält, der Komplex angereichert ist. Der Begriff „Anreicherung” kann sich auf den Komplex beziehen, der aus Aptamer und Protein A, G oder L, aus Aptamer und der Protein A, G oder L enthaltenden Substanz oder aus Aptamer und dem Protein A, G oder L enthaltenden Mikroorganismus gebildet ist, oder auf das Protein A, G oder L, die Protein A, G oder L enthaltende Substanz oder den Protein A, G oder L enthaltenden Mikroorganismus (zusammengefasst bezeichnet als „Target”) selbst, d. h. das Target ohne Aptamer. Zur Anreicherung des Targets kann der Verfahrensschritt c) durchgeführt werden. Eine Anreicherung bedeutet mit anderen Worten eine Erhöhung der Konzentration des Aptamer-Target-Komplexes oder des Targets selbst.

Der Begriff „Isolierung” kann sich auf den Komplex beziehen, der aus Aptamer und Protein A, G oder L, aus Aptamer und der Protein A, G oder L enthaltenden Substanz oder aus Aptamer und dem Protein A, G oder L enthaltenden Mikroorganismus gebildet ist, oder auf das Protein A, G oder L, die Protein A, G oder L enthaltende Substanz oder den Protein A, G oder L enthaltenden Mikroorganismus selbst. Daher ist der letzte Verfahrensschritt optional.

Die oben beschriebene Abtrennung, Anreicherung, und Isolierung können mit dem Verfahren gleichzeitig verwirklicht werden. Vorzugsweise wird das Verfahren aber zu einem dieser Zwecke durchgeführt.

Der Begriff „Komplex” bezeichnet die Struktur, die bei der Bindung des Aptamers an sein Target gebildet wird. Somit bezeichnet der Begriff „Komplex” eine Aptamer-Target-Struktur, bei der das Aptamer an das Target gebunden ist. Wie einleitend erläutert, erfolgt die Aptamer-Target-Bindung vorwiegend, aber nicht unbedingt ausschließlich, über die Strukturkompatibilität, so genannte „Stacking interactions” bei aromatischen Ringstrukturen (Stapelkräfte durch Elektronenwechselwirkung mit Nachbarbasen), elektrostatische Wechselwirkungen (z. B. Van der Waals-, Ionen-, Dipolkräfte) und Wasserstoffbrückenbindungen.

Die genannten Verfahrensschritte a), b) und c) können je nach Verfahrensgestaltung gleichzeitig erfolgen, und insbesondere können die Verfahrensschritte a) und b) gleichzeitig erfolgen.

Bei der Kontaktierung von Target und Aptamer kann die Bildung des Aptamer-Target-Komplexes durch Temperierung auf die optimale Aptamer-Target-Bindungstemperatur, bevorzugt 20–25°C, und/oder Rühren der Probe befördert werden. Nach einer Inkubationszeit werden die Aptamer-Target-Komplexe, von der restlichen Probenlösung abgetrennt. Geeignete Methoden sind dem Fachmann bekannt, wie z. B. Dialyse, Ultrafiltration, Gelfiltration, Chromatographie, magnetische Trennung oder Waschschritte, sofern der Komplex immobilisiert vorliegt.

Durch Veränderungen der für die Aptamerbindung erforderlichen definierten Bedingungen wird im optionalen Schritt c) der Aptamer-Target-Komplex getrennt. Hierzu sind physiko-chemische Einwirkungen, wie z. B. eine Variation von Salzkonzentration oder pH oder eine hitzebedingte Denaturierung, denkbar. Abschließend ist eine weitere Reinigung des Targets möglich, wobei das Aptamer zuvor abgebaut werden kann, z. B. durch saure (thermische) Hydrolyse oder DNasen. Sofern das Aptamer immobilisiert ist, kann das Target eluiert werden, wie z. B. von einer Säule, die anschließend regeneriert und wiederverwendet wird.

Erfindungsgemäß können die Aptamere auch an einer festen Phase, genauer gesagt an der Oberfläche einer festen Phase, immobilisiert sein, vorzugsweise über ein Spacer-Molekül, das beispielsweise eine Linker-Nukleinsäure sein kann. Geeignete Methoden der Immobilisierung sind dem Fachmann bekannt, die sowohl mit einer kovalenten Kopplung als auch einer nicht-kovalenten Kopplung mittels geeigneter Affinitätspaare, wie z. B. Biotin/Streptavidin, einhergehen können. Die feste Phase können beispielsweise Platten, Streifen, Membranen, Filme, Gele, Perlen, Mikro- und Nanopartikel sein. Beispielhafte Trägermaterialien sind anorganische und organische Polymere, Keramiken, Glaser, Metalle, insbesondere Edelmetalle. Hierzu zählen Kunststoffe, beispielsweise auf Basis von Polystyrol. Des Weiteren sind Biopolymere, vorzugsweise Cellulose, Dextran, Agar, Agarose und Sephadex, die funktionalisiert sein können, insbesondere als Nitrocellulose oder Cyanbromid-Sephadex, als Polymere im erfindungsgemäßen Verfahren einsetzbar. Aptamere können an Magnetic Beads gebunden werden, deren Oberfläche z. B. mit Tosyl- oder Epoxy-Gruppen, mit Amino- oder Carboxyl-Gruppen oder mit Streptavidin funktionalisiert sind. Weiterhin ist eine Kopplung von Magnetic Beads an die Desoxyribose der Aptamere, wie z. B. über eine Hydrazon-Bindung, möglich. Die Beispiele für Polymere sind nicht limitierend und andere sind denkbar. Bevorzugte Kombinationen von geometrischer Form und Material sind Gele aus Biopolymeren, insbesondere Agarose, und Gelmatrices aus Dextran und Sephadex, die – beispielsweise in Säulen verpackt – Hohlräume definierter Porengröße ausbilden. In einer speziellen Ausgestaltung ist das soeben beschriebene Abtrennungs-, Anreicherungs-, und/oder Isolierungsverfahren ein Affinitätschromatographie-Verfahren, bei dem ein erfindungsgemäßes Aptamer an einer festen Phase immobilisiert ist, vorzugsweise an Kügelchen (Beads) oder einem anderweitigen chromatographischen Säulenmaterial, wobei alle geometrische Formen einer festen Phase verwendbar und alle oben genannten Substanzen beispielhaft einsetzbar sind.

Mit Aptamer-modifizierten Oberflächen können die entsprechenden Targets ausgehend von geringen Konzentrationen angereichert werden.

Die Erfindung betrifft auch die Verwendung des zuvor beschriebenen Aptamers zum Nachweis, Anreicherung, Abtrennung und/oder Isolierung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus. Insbesondere kann das Aptamer in den zuvor erläuterten Verfahren eingesetzt werden. Der Begriff Anreicherung schließt die Aufreinigung des Targets mit ein.

In einem weiteren Aspekt betrifft die Erfindung auch Verfahren zur Quantifizierung der Bindung eines Immunoglobulins an Protein A, G oder L, wobei bei dem Verfahren

  • a) Protein A, G oder L oder ein Protein A, G oder L enthaltender Mikroorganismus bereitgestellt wird,
  • b) Protein A, G oder L oder der Protein A, G oder L enthaltende Mikroorganismus mit dem Immunoglobulin versetzt wird,
  • c) das in b) erzeugte Gemisch mit einem erfindungsgemäßen Aptamer in Kontakt gebracht wird,
  • d) die Menge gebundenen Aptamers bestimmt wird und daraus die Menge gebundenen Immunoglobulins bestimmt wird.

Verschiedene Verfahrensvarianten sind denkbar:
In einer Variante bindet das erwähnte Immunoglobulin an das gleiche Epitop des Protein A, G oder L wie das erfindungsgemäße Aptamer. Der Begriff „Epitope” bedeutet dann, dass es sich um gleiche Epitope handelt, die mehrfach vorkommen weil mehrere Protein A, G oder L Moleküle im Verfahren eingesetzt werden und/oder weil Protein A, G oder L mehrere Epitope des gleichen Typs aufweist. In Schritt c) des Verfahrens bindet das Aptamer an Protein A, G oder L Moleküle, an die kein Immunoglobulin gebunden hat. Die Menge gebundenen Proteins A, G oder L wird in Schritt d) bestimmt, beispielsweise über die Intensität eine Fluoreszenzmarkierung. Der Ort der Bindung kann bei einem Array von Protein A, G oder L durch den erkennbaren Ort der Markierung bestimmt werden.

In einer anderen Variante binden das Aptamer und das Immunoglobulin an verschiedene Epitope. Dennoch bindet das Aptamer in Schritt c) aufgrund sterischer Hinderung nicht mehr an Protein A, G oder L Moleküle, an die bereits Immunoglobulin gebunden hat. In Schritt c) des Verfahrens bindet das Aptamer an Protein A, G oder L Moleküle, an die kein Immunoglobulin gebunden hat.

Im Zusammenhang mit dem obigen Verfahren betrifft die Erfindung auch die Verwendung des zuvor beschriebenen Aptamers zur Quantifizierung der Bindung von Immunoglobulinen an Protein A, G oder L. Diese Anwendung und das zugehörige Verfahren sind insbesondere als Assay für die medizinische Diagnostik geeignet.

Die Bereitstellung von Protein A, G oder L oder des Protein A, G oder L enthaltenden Mikroorganismus kann auf verschiedene Art und Weise erfolgen. Beispielsweise kann Protein A, G oder L oder der Protein A, G oder L enthaltende Mikroorganismus in einer flüssigen Phase in definierter Menge bereitgestellt werden. Es ist auch möglich, das Aptamer in definierter Menge an einer festen Phase zu immobilisieren oder Protein A, G oder L oder den Mikroorganismus in definierter Menge an einer festen Phase zu immobilisieren. Die feste Phase können beispielsweise Platten, wie beispielsweise Mikrotiterplatten, Streifen, Membranen, Filme, Gele, Perlen, Mikro- und Nanopartikel sein.

Anschließend wird in Schritt b) ein Immunoglobulinzugegeben, das an Protein A, G oder L oder an in der Zellwand des Mikroorganismus vorhandenes Protein A, G oder L bindet. Der Antikörper ist üblicherweise in einer flüssigen Phase suspendiert.

Sofern Protein A, G oder L oder der Mikroorganismus an einer festen Phase gebunden sind, wird nach dem Schritt b) vorzugsweise ungebundener Antikörper durch Waschen, beispielsweise mit einem geeigneten Waschpuffer, entfernt.

Es werden nach dem Schritt b), und gegebenenfalls einem Waschschritt, mit Antikörper belegte Protein A, G oder L Moleküle/Mikroorganismen und nicht mit Antikörper belegte Protein A, G oder L Moleküle/Mikroorganismen erhalten, hier bezeichnet als „Gemisch”.

Im nächsten Schritt wird das Gemisch mit erfindungsgemäßem Aptamer in Kontakt gebracht, Das Aptamer bindet an nicht mit Antikörper belegte Protein A, G oder L Moleküle/Mikroorganismen. Nach dem Schritt c) wird vorzugsweise nicht gebundenes Aptamer durch Waschen, beispielsweise mit einem geeigneten Waschpuffer, entfernt.

Im letzten Schritt wird ermittelt, wie viel Aptamer an Protein A, G oder L oder den Mikroorganismus gebunden hat. Eine Bindung zwischen dem Aptamer und Protein A, G oder L oder dem Mikroorganismus kann nachgewiesen werden wie bereits zuvor bei dem erfindungsgemäßen Nachweisverfahren erläutert. Vorzugsweise wird ein markiertes Aptamer eingesetzt.

Eine weitere Verwendung des erfindungsgemäßen Aptamers betrifft die Verwendung zur Blockierung oder Quantifizierung freier Bindungsstellen an Protein A, G oder L. Es gibt kommerziell verfügbare Protein A, G oder L modifizierte Oberflächen, wie z. B. Kügelchen (Beads) oder Mikrotiterplatten.

Wird die mit Protein A, G oder L modifizierte Oberfläche für die Immobilisierung von Protein A, G oder L bindenden Substanzen verwendet, können die Aptamere zur Blockierung der nach der Immobilisierung frei gebliebenen Protein A, G oder L – Bindungsstellen benutzt werden. Dies setzt voraus, dass das Aptamer und die andere Protein A, G oder L bindende Substanz die gleiche Bindungsstelle im Protein A, G oder L haben oder sich gegenseitig in ihrer Bindungsfähigkeit beeinflussen.

In bestimmten Anwendungen kann es auch wünschenswert sein, Protein A, G oder L an der Oberfläche mit Aptamer zu belegen, so dass keine anderen Substanzen, insbesondere Immunoglobuline, daran binden können.

Ebenso können die Aptamere zur Quantifizierung der nach der Immobilisierung frei gebliebenen Bindungsstellen, oder anders ausgedrückt, zur Kontrolle der Oberflächenbelegung verwendet werden.

In einem weiteren Aspekt betrifft die Erfindung auch eine Aptamersonde zur Detektion von Protein A, G oder L, Protein A, G oder L enthalten Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, insbesondere Staphylococcus aureus, Streptococcus oder Peptostreptococcus, wobei die Sonde ein erfindungsgemäßes Aptamer und ein Markierungsmittel (Label) umfasst. Das Markierungsmittel kann auf verschiedene Art und Weise an das Aptamer gebunden sein, beispielsweise, und nicht beschränkend, durch kovalente Bindung, Komplexierung, DNA/RNA-Hybridisierung. Beispielsweise kann ein Markierungsmittel an ein erfindungsgemäßes Aptamer gebunden werden, wie in WO2005113817 beschreiben. WO2005113817 beschreibt ein Aptamer mit einem angefügten Oligonukleotidschwanz (oligonucleotide tail) und einem Linker-Oligonukleotid, der ein Label trägt, wobei die Sequenz des Linker-Oligonukleotid komplementär zu der Sequenz des Oligonukleotidschwanzes des Aptamers ist, sodass das Linker-Oligonukleotid an den Oligonukleotidschwanz des Aptamers hybridisiert und das Aptamer mit dem Label markiert wird. Eine weitere Möglichkeit ist die Bindung von Biotin an das Aptamer und die Bindung von Markierungsmittel an Steptavidin. Durch eine Biotin-Streptavidin Bindung wird das Markierungsmittel an das Aptamer gebunden.

Alle Markierungsmittel sind grundsätzlich einsetzbar, die sich an DNA oder RNA binden lassen. Konkrete Beispiele für Markierungssubstanzen wurden weiter oben bei der Erläuterung von erfindungsgemäßen Verfahren angegeben, bei denen markierte Aptamere eingesetzt werden können. Beispielsweise ist die Markierung ein Farbstoff. In einer speziellen Variante ist das Markierungsmittel eine Substanz, die eine Bilderzeugung durch das markierte Aptamer in einem bildgebenden Verfahren ermöglicht. Das Bild kann durch Strahlung erzeugt sein, die ein für das menschliche Auge direkt sichtbares Bild erzeugt, oder durch Strahlung, die nicht direkt sichtbar ist, beispielsweise Röntgenstrahlung oder radioaktive Strahlung, die anderweitig sichtbar gemacht wird, beispielsweise auf einem Film. Markierungsmittel können beispielsweise Lumineszenz-, Phosphoreszenz, Fluoreszenz-, radioaktive, oder UV/VIS-Markierungssubstanzen sein. Die erfindungsgemäße Sonde ist besonders für die in dieser Beschreibung erläuterten Nachweis-, Anreicherungs-, Abtrennungs- und/oder Isolierungsverfahren einsetzbar, insbesondere in Assays zur Detektion von Protein A, G oder L oder Protein A, G oder L enthaltenden Mikroorganismen, wie Staphylococcus aureus, Streptococcus oder Peptostreptococcus. Assays können z. B. direkte und indirekte Sandwich-Assays sein.

In einem weiteren Aspekt betrifft die Erfindung einen Biosensor, der ein erfindungsgemäßes Aptamer aufweist.

Ein solcher Biosensor weist gemäß der vorliegenden Erfindung vorzugsweise die folgenden Elemente auf:

  • – einen Rezeptor, aufweisend oder bestehend aus einem erfindungsgemäßen Aptamer, und
  • – einen Transducer, der das Bindungsereignis zwischen Aptamer und Target in ein elektrisch quantifizierbares Signal wandelt.

Außerdem können weitere Elemente, wie beispielsweise eine Signalverarbeitungseinrichtung, eine Ausgabeelektronik, eine Anzeigevorrichtung, eine Datenverarbeitungseinrichtung, ein Datenspeicher sowie Schnittstellen zu anderen Geräten vorhanden sein.

Der biologische Rezeptor des Aptamer-Biosensors weist das erfindungsgemäße Aptamer vorzugsweise in immobilisierter Form auf oder besteht nur aus dem Aptamer in immobilisierter Form. Die Funktion des Rezeptors ist die auf einem biochemischen Mechanismus beruhende Erkennung des Analyten, hier die Bindung des erfindungsgemäßen Aptamers an sein Target (Protein A, G oder L, Protein A, G oder L enthaltende Substanz, Protein A, G oder L enthaltender Mikroorganismus). Aus einer Probe, die man mit dem Biosensor in Kontakt bringt, beispielsweise einem komplexen Gemisch, das Target enthält, kann das Target über die spezifische Anbindung des Aptamers identifiziert und quantifiziert werden.

Die Spezifität des Biosensors wird durch den Rezeptor vorgegeben, während die Sensitivität des Sensors vorwiegend durch den verwendeten Transducer beeinflusst wird. Die am Rezeptor stattfindende Aptamer-Target Bindung wird durch den Transducer in ein elektronisch verwertbares Signal umgesetzt. Der Transducer wandelt das Signal aus der selektiven Erkennungsreaktion des Rezeptors (Bindung Target an Aptamer), das der Konzentration des Targets in der Probe proportional ist, in ein elektrisch quantifizierbares Messsignal um. Die Signalbildung erfolgt auf Grund der molekularen Interaktion zwischen dem Target und dem Aptamer.

Mit einem erfindungsgemäßen Biosensor können vorzugsweise qualitative, quantitative und/oder halb-quantitative analytische Informationen gewonnen werden. Er ist insbesondere zum Einsatz in der Lebensmittel-, Wasser- und Umweltanalytik, der Wasserbehandlung und der Wasseraufbereitung, insbesondere von Trinkwasser und Abwasser, in der Diagnostik sowie zur Verwendung in Krankenhäusern und Pflegeeinrichtungen geeignet.

Die Kopplung zwischen Rezeptor und Transducer erfolgt vorzugsweise durch die Immobilisierung des Aptamers auf der Transduceroberfläche, beispielsweise über eine Streptavidin-Biotin-Bindung, wobei vorzugsweise das Aptamer mit Biotin verbunden ist und die Oberfläche des Transducers immobilisiertes Streptavidin aufweist.

Die Bindung des Targets an das erfindungsgemäße Aptamer kann beispielsweise über optische, mikrogravimetrische, thermische oder akustische Transducer gemessen werden, vorzugsweise über optische oder mikrogravimetrische Transducer.

Die Messung in optischen Transducern kann auf Prinzipien der Photometrie beruhen, wobei beispielsweise Farb- oder Lumineszenz-Intensitätsänderungen erfasst werden. Zu den optischen Methoden zählen die Messung von Fluoreszenz, Phosphoreszenz, Biolumineszenz und Chemolumineszenz, Infrarotübergängen und die Lichtstreuung. Zu den optischen Methoden zählt auch die Messung von Schichtdickenänderungen wenn Target an Aptamer gebunden wird. Die Schichtdickenänderung kann z. B. mittels Oberflächenplasmonenresonanz (SPR) oder reflektometrischer Interferenzspektroskopie (RIfS) durchgeführt werden. Ferner kann die Interferenz an dünnen Schichten (reflektrometrische Interferenzspektroskopie) sowie die Änderung des evaneszenten Feldes gemessen werden.

Mikrogravimetrische Transducer sind zum Beispiel QCM-Sensoren (Quartz Crystal Microbalance), die eine Masseänderung detektieren, wenn Target an Aptamer gebunden wird.

Akustische Transducer nutzen die Frequenzänderungen eines piezoelektrischen Schwingquarzes, der Masseänderungen hochempfindlich nachweist, die auftreten wenn Target an Aptamer bindet. Der verwendete Quarzkristall wird in einem oszillierenden elektrischen Feld platziert und die Resonanzfrequenz des Kristalls gemessen. Eine Masseänderung auf der Oberfläche des Schwingquarzes, z. B. durch Reaktion des Analyten mit dem vorher auf der Kristalloberfläche immobilisierten Rezeptor, bewirkt eine Änderung der Resonanzfrequenz, welche quantifiziert werden kann.

Elektrochemische Transducer können z. B. die Änderung der Konzentration redoxaktiver Marker an der Elektrodenoberfläche messen, oder die Änderung der Konzentration redoxaktiver Substrate oder Produkte, die z. B. in der enzymatischen Reaktion eines Enzym-Markers verbraucht werden oder entstehen.

Thermische Transducer messen die Wärmetönung der Aptamer-Target-Bindungsreaktion.

Die Erfindung betrifft in einem weiteren Aspekt eine feste Phase, auch bezeichnet als fester Träger, insbesondere zur Verwendung beim Nachweis, Anreicherung, Abtrennung und/oder Isolierung von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen, an dem ein erfindungsgemäßes Aptamer immobilisiert ist.

Ein beispielhafter Biosensor ist im beigefügten Ausführungsbeispiel erläutert. Anleitung zur Konstruktion weiterer Biosensoren findet der Fachmann in Cho, E. J., Lee, J.-W., Ellington, A. D. (2009): Applications of Aptamers as Sensors, Annual Review of Analytical Chemistry 2: 241–264; Mok, W and Li, Y. (2008): Recent Progress in Nucleic Acid Aptamer-Based Biosensors and Bioassays, Sensors 8: 7050–7084; Song, S., Wang, L., Li, J., Fan, C., Zhao, J. (2008): Aptamer-based biosensors, TrAC Trends in Analytical Chemistry 27: 108–117.

Feste Phasen sind in allen möglichen geometrischen Formen denkbar. Beispiele für feste Träger sind Platten, Streifen, Membranen, Mikrotiterplatten, Filme, Gele, Mikropartikel, Nanopartikel oder Perlen. Besonders geeignete Materialien, aus denen eine feste Phase hergestellt werden kann, sind anorganische Polymere, organische Polymere, Gläser, organische und anorganische Kristalle, Keramiken, Metalle, insbesondere Edelmetalle, und Halbleiter. Ein besonders geeignetes organisches Polymer ist ein Polymer auf Basis von Polystyrol. Desweiteren sind Biopolymere, vorzugsweise Cellulose, Dextran, Agar, Agarose und Sephadex, die funktionalisiert sein können, insbesondere als Nitrocellulose oder Cyanbromid-Sephadex, als Polymere einsetzbar. Aptamere können an magnetische Kügelchen (Magnetic Beads) gebunden sein, die z. B. Carboxy-terminierte oder Epoxy-aktivierte Seitenketten tragen. Des Weiteren ist eine Kopplung von Magnetic Beads an die Ribose oder Desoxyribose der Aptamere, wie z. B. über eine Hydrazon-Bindung, möglich. Die Beispiele für Polymere sind nicht limitierend und andere Moleküle denkbar. Bevorzugte Kombinationen von geometrischer Form und Material sind Gele aus Biopolymeren, insbesondere Agarose, und Gelmatrices aus Dextran und Sephadex, die – beispielsweise in Säulen verpackt – Hohlräume definierter Porengröße ausbilden. In einer speziellen Ausführungsform ist der feste Träger mit immobilisiertem Aptamer eine stationäre Phase für die Affinitätschromatographie, wobei der Träger vorzugsweise die Form von Kugeln oder anderweitig geformten Partikeln hat.

In einer speziellen Ausführungsform ist die feste Phase ein Teststreifen, der ein oder mehrerere verschiedene erfindungsgemäße Aptamere enthält. Der Teststreifen ist insbesondere einsetzbar für qualitative, halb-quantitative und quantitative Assays, die mit visuellen Nachweisverfahren arbeiten, insbesondere für Lateralfluss-Assays.

Ein Lateralfluss-Assay arbeitet wie folgt: Eine flüssige Probe, die mutmaßlich ein Target für das erfindungsgemäße Aptamer enthält, wird an einer Stelle auf den Streifen aufgebracht bzw. der Streifen an einer Stelle mit der Probe benetzt. Diese Stelle ist die sogenannte Probeauftragszone des Streifens. Der Streifen enthält ein Matrixmaterial, durch welches das flüssige Testmedium und das darin suspendierte oder gelöste Target durch Kapillarwirkung aus einer Probeauftragszone in eine Nachweiszone strömen kann, wo ein nachweisbares Signal oder die Abwesenheit eines solchen Signals auf das Vorhandensein des Targets hinweist.

Der Streifen, der für Lateralfluss-Assays einsetzbar ist, enthält ein oder mehrere erfindungsgemäße Aptamere, beispielsweise in der Probeauftragszone oder zumindest noch örtlich vor der Nachweiszone. Wenn Target in der Testprobe vorhanden ist bildet es mit dem im Streifen vorhandenen Aptamer einen Komplex, der zur Nachweiszone strömt und dort detektiert wird. Anders ausgedrückt strömt das Target innerhalb des Streifens zu dem Aptamer, bildet mit diesem einen Komplex, welcher anschließend zur Nachweiszone strömt.

Die Bindungsreaktion kann auch direkt auf der Auftragsstelle stattfinden, wenn z. B. der Teststreifen das Aptamer enthält und die Aptamer-Target-Bindung direkt mit einem entsprechenden Marker sichtbar gemacht wird.

Vorzugsweise wird ein markiertes Aptamer eingesetzt, wobei jede bereits weiter oben beschriebene Markierung einsetzbar ist. Vorzugsweise wird eine Markierung eingesetzt, die in der Nachweiszone des Teststreifens zu einem visuell detektierbaren Signal führt. Grundsätzlich kann das Vorhandensein oder die Abwesenheit von Target in der Probe durch Nachweis oder fehlenden Nachweis eines markierten Aptamers in der Nachweiszone ermittelt werden.

In einer Ausführungsform eines Teststreifens wird ein Enzym-markiertes Aptamer eingesetzt. in der Probe vorhandenes Target bildet mit dem Enzym-markierten Aptamer einen Komplex, der entlang des Streifens zu einer Nachweiszone strömt, die ein Substrat für den Enzymmarker enthält, der in Anwesenheit des Enzymmarkers eine farbige Reaktion zu erzeugen vermag. Der Streifen enthält vorzugsweise eine weitere Zone, in der Target immobilisiert ist, so dass markiertes Aptamer, das sich aufgrund der Abwesenheit von ausreichendem Target in der Probe nicht mit dem Target vereinigt, erfasst wird und dadurch gehindert wird, die Nachweiszone zu erreichen.

In einer weiteren Ausführungsform funktioniert der Teststreifen nach dem Prinzip eines immunologischen Lateralfluss-Assays, beispielsweise eines Schwangerschaftsteststreifens, wobei ein dort verwendetes markiertes Immunglobulin durch ein erfindungsgemäßes, vorzugsweise markiertes, Aptamer ersetzt ist.

Eine spezielle Variante funktioniert nach folgendem Prinzip: Ein Teststreifen wird mit Probe benetzt und in der Probe vorhandenes Target bindet an ein Farbstoff-markiertes Aptamer. Der Target-Aptamer-Farbstoff-Komplex wandert zur Nachweiszone, in der ein zweiter Antikörper fixiert ist, welcher ebenfalls an das Target bindet. Der immobilisierte Antikörper bindet den wandernden Target-Aptamer-Farbstoff-Komplex in der Nachweiszone und diese wird angefärbt. Überschüssiges Farbstoff-markiertes Aptamer wandert weiter zu einer Kontrollzone, in der eine Substanz fixiert ist, die das Farbstoff-markierte Aptamer bindet und dadurch angefärbt wird.

Der Teststreifen ist aus jedem Material herstellbar, das mit einer Probe benetzbar ist und in das ein erfindungsgemäßes Aptamer eingebracht werden kann. Insbesondere bevorzugt sind Materialien durch die eine Probe und ein darin enthaltenes Target durch Kapillarwirkung strömen können. Beispiele sind Nitrozellulose, Nitrozellulosemischungen mit Polyester oder Zellulose, unbeschichtetes Papier, poröses Papier, Viskosefilament, Glasfaser, Acrylnitrilcopolymer oder Nylon, sowie alle weiteren Materialien, die bei Lateralfluss-Assays üblich sind.

Der Teststreifen kann bereits als solcher verwendet werden, um das Vorhandensein von Target in einer Probe festzustellen. Zur Anwendung kann der Streifen in eine Probe eingetaucht werden, im Falle eines Lateralfluss-Assays beispielsweise mit nur einem Ende, das dann als Probeauftragszone dient.

Gegenstand der Erfindung ist auch eine Lateralfluss-Assay-Vorrichtung, die den oben beschriebenen Teststreifen aufweist. Die Vorrichtung kann neben dem Teststreifen beispielsweise ein Gehäuse aufweisen, in das der Teststreifen eingebettet ist und das eine, vorzugsweise verschließbare, Öffnung zur Probenauftragszone des Teststreifens aufweist, sowie Aussparungen zur Beobachtung einer Nachweis und ggf. Kontrollzone. Ein solcher Aufbau ist aus dem Gebiet der Schwangerschaftstests bekannt und entsprechend sind bekannte Aufbauten von Lateralfluss-Assay-Vorrichtung auch in der vorliegenden Erfindung verwendbar.

In einer anderen speziellen Ausführungsform bilden der feste Träger und das Aptamer ein Microarray oder einen sogenannten „DNA oder RNA-Chip”, der einkanalig oder mehrkanalig sein kann. Im Microarray können auf mehreren Array-förmig angeordneten Messpunkten ein oder mehrere Aptamere sowie Referenzmaterialien zur Grundsignalkompensation bzw. Funktionstestung angeordnet sein. In einem Mehrkanal-Chip erfolgt diese Anordnung in den einzelnen Kanälen. Dadurch ist die parallele Mehrfachmessung einer Probe, oder bei verschiedenen Aptameren, die parallele Messung unterschiedlicher Analyte in einer Probe möglich.

Die Immobilisierung von Aptamer an fester Phase kann auf verschiedene Art und Weise erfolgen und auf jegliche Art und Weise, die dem Fachmann zur Immobilisierung von DNA oder RNA an Feststoffen bekannt ist. Bekannte Möglichkeiten wurden bereits zuvor in dieser Beschreibung genannt. Die Immobilisierung von Aptameren auf Nanopartikeln ist z. B. beschrieben in WO2005/13817. Eine feste Phase aus Papier oder einem porösen Material kann mit dem Aptamer in flüssiger Phase benetzt und die flüssige Phase anschließend verflüchtigt werden, so dass das Aptamer in dem Papier bzw. dem porösen Material zurückbleibt.

In einem weiteren Aspekt betrifft die vorliegende Erfindung auch ein Kit umfassend ein erfindungsgemäßes Aptamer.

Das Kit umfasst vorzugsweise ein erfindungsgemäßes Aptamer, insbesondere ein markiertes erfindungsgemäßes Aptamer bzw. eine erfindungsgemäße Aptamersonde, sowie weitere Komponenten für die mit dem Kit beabsichtigte Reaktion oder das mit dem durchzuführende Verfahren, beispielsweise Komponenten für ein beabsichtigtes Nachweis Anreicherungs-, Abtrennungs- und/oder Isolierungsverfahren. Beispiele sind Pufferlösungen, Substrate für eine Farbreaktion, Farbstoffe oder enzymatische Substrate. Das Aptamer und/oder weitere Komponenten können an einer festen Phase immobilisiert sein. Beispielhafte Formen und Materialien für feste Phasen wurden bereits an anderer Stelle in dieser Beschreibung genannt. Die feste Phase kann beispielsweise in Form eines (Micro)-Arrays oder einer Mikrotiterplatte-bereitgestellt werden. Die feste Phase kann im konkreten Fall eine immobilisierte Fängersubstanz für Protein A, G oder L, Protein A, G oder L enthaltende Substanz oder einen Protein A, G oder L enthaltenden Mikroorganismus aufweisen, insbesondere einen immobilisierten Antikörper, der zur Anbindung von Protein A, G oder L, einer Protein A, G oder L enthaltenden Substanz oder eines Protein A, G oder L enthaltenden Mikroorganismus dient. Die immobilisierte Fängersubstanz ist vorzugsweise in Form eines (Micro)-Arrays, in einer Mikrotiterplatte oder in Chips angeordnet.

Das Kit dient vorzugsweise zur Durchführung eines erfindungsgemäßen Nachweis-, Anreicherungs, Abtrennungs- und/oder Isolierungsverfahrens für Protein A, G oder L, Protein A, G oder L enthaltender Substanz oder eines Protein A, G oder L enthaltenden Mikroorganismus, oder zur Durchführung anderweitiger Assays unter Zuhilfenahme eines erfindungsgemäßen Aptamers. Insofern wird auf die vorangehende Offenbarung Bezug genommen.

In dem Kit kann das Aptamer in verschiedensten Formen bereitgestellt werden, beispielsweise gefriergetrocknet oder in einem flüssigen Medium.

Die Erfindung betrifft auch ein Messgerät zum Nachweis von Protein A, G oder L, Protein A, G oder L enthaltenden Substanzen oder Protein A, G oder L enthaltenden Mikroorganismen. Das Messgerät weist ein oder mehrere verschiedene der zuvor beschriebenen Aptamere, eine Aptamersonde wie zuvor beschrieben oder einen Biosensor wie zuvor beschrieben auf. Darüber hinaus kann das Messgerät unter anderem eine Probeentnahmeeinrichtung, eine Signalverarbeitungseinrichtung, eine Anzeigevorrichtung zum Ablesen von Messergebnissen oder Messwerten, eine Datenverarbeitungseinrichtung, einen Datenspeichereinrichtung und Schnittstellen zur Verbindung mit externen Geräten oder Speichermedien aufweisen.

Mit dem Messgerät können je nach Ausgestaltung qualitative, quantitative und/oder halbquantitative analytische Informationen über das zu messende Target gewonnen werden. Mit dem Messgerät können die zuvor erläuterten Nachweisverfahren durchgeführt werden. Es ist insbesondere zum Einsatz in der Lebensmittel-, Wasser- und Umweltanalytik, der Wasserbehandlung und der Wasseraufbereitung, insbesondere von Trinkwasser und Abwasser, in der Diagnostik sowie zur Verwendung in Krankenhäusern und Pflegeeinrichtungen geeignet.

Das Messgerät ist insbesondere ein transportables Messgerät, das vor Ort eingesetzt werden kann, beispielsweise ein leichtes Messgerät im Taschenformat.

Die Probeentnahmeeinrichtung des Messgeräts kann auf verschiedene Art und Weise aufgebaut sein. In einer Variante ist die Probeentnahmeeinrichtung eine Kapillare oder ein poröser Streifen, im dem Flüssigkeiten aufgesaugt werden können. Eine solche Probeentnahmevorrichtung wird zur Probeentnahme üblicherweise in eine flüssige Probe eingetaucht. Durch Kapillarkraft wird die Probe zu dem gewünschten Ort im Messgerät transportiert, an dem sich das Aptamer befindet und wo die Nachweisreaktion stattfinden kann. Beispielsweise wird die Probe zu einem das Aptamer aufweisenden Biosensor transportiert, welcher seinerseits ein Messsignal erzeugt.

In einer anderen Variante weist die Probeentnahmeeinrichtung einen Schlauch oder ein Röhrchen sowie eine Pumpe auf. Mit der Pumpe wird eine flüssige Probe angesaugt und die Probe zu dem gewünschten Ort im Messgerät transportiert, an dem sich das Aptamer befindet und wo die Nachweisreaktion stattfinden kann. Beispielsweise wird die Probe zu einem das Aptamer ausweisenden Biosensor transportiert, welcher seinerseits ein Messsignal erzeugt.

Im Folgenden wird die Erfindung anhand von nicht limitierenden Beispielen für konkrete Ausführungsformen näher erläutert. In den Beispielexperimenten werden Standardreagenzien und Puffer verwendet, die frei von Kontaminationen sind.

BEISPIEL 1: Präparation der Target-modifizierten Magnetic Beads.

Dynabeads® M-280 Streptavidin (Invitrogen, UK) wurden nach Herstellerangaben verwendet. 1 × 109 Magnetic Beads wurden zunächst 3× mit je 500 μl PBS, pH 7.4 gewaschen und anschließend mit 510 μg biotinyliertem Protein A für 1 h bei 21°C unter Schütteln inkubiert (natives, biotinyliertes Protein A von Staphylococcus aureus (Sigma, P2165); gelöst in 0,1 M Natriumphosphatpuffer pH 7.4 zu einer Stammlösung von 2 mg/ml). Danach folgten weitere Waschschritte: 3 × 500 μl PBS, pH 7.4; 1 × 500 μl PBS, pH 7.4 + 0,05% Tween 20 mit einer Inkubation von 5 min bei 21°C unter Schütteln; 1 × 500 μl PBS, pH 7.4 + 0,05% Tween 20 (ohne Inkubation); 2 × 500 μl PBS, pH 7.4. Die Abtrennung der Beads von den Lösungen erfolgte jeweils unter Verwendung eines Magnet-Separationsstandes (Promega, Deutschland). Die Protein A – modifizierten Beads wurden dann in 500 μl PBS, pH 7.4 + 0,02% Natriumazid suspendiert und bei 4°C gelagert.

BEISPIEL 2: In vitro Selektion (FluMag-SELEX).

Die Selektion von DNA-Aptameren für Protein A erfolgte unter Anwendung des FluMag-SELEX-Prozesses. Biotinyliertes Protein A wurde dafür auf Streptavidin-funktionalisierte Magnetic Beads immobilisiert und in dieser Form als Target für die Aptamerselektion eingesetzt. Eine Fluoresceinmarkierung der DNA ab der zweiten SELEX-Runde ermöglichte außerdem deren Quantifizierung in den verschiedenen Schritten des SELEX-Prozesses mittels Fluoreszenzmessung (Wallac Victor2V Multilabel Counter; Perkin Elmer, Deutschland; Messbedingungen: Excitation 485 nm/Emission 535 nm, time 1 s, CW-lamp energy 22500, Messvolumen 100 μl/well, Messung in schwarzen 96 well Mikrotiterplatten (NUNC; Deutschland)).

Ausgangspunkt des Selektionsprozesses war eine randomisierte DNA-Oligonukleotid-Bibliothek, die mittels chemischer Synthese (Microsynth AG, CH) hergestellt wurde: 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'. N40 stellt den Bereich mit variablen Nukleotiden (Zufallssequenz) dar.

Alle Oligonukleotide dieser Bibliothek besitzen am 5'- und 3'-Ende spezifische Sequenzen, die als Primerbindungsorte für die Amplifizierung der Oligonukleotide mittels PCR dienen. Folgende modifizierte PCR-Primer wurden verwendet:
als Sense-Primer 5'-FI-ATACCAGCTTATTCAATT-3' (siehe SEQ ID NO: 66) mit einer Fluorescein(FI)-Markierung am 5'-Ende und als Antisense-Primer 5'-dA20HEGL-CTAACTGATTACGATTGT-3' mit einer Verlängerung am 5'-Ende (dA20 = 20 Nukleotide mit der Base Adenin; HEGL = Hexaethylenglycolspacer, Primersequenz siehe SEQ ID NO: 68).

Für die Aptamerselektion wurden aufeinanderfolgende SELEX-Runden durchgeführt, die aus mehreren Schritten bestehen: den Selektionsschritten – (i) Bindung der DNA-Oligonukleotid-Bibliothek (~2,5 nmol ssDNA) bzw. des in der vorhergehenden Runde selektierten Oligonukleotidpools an die Target-modifizierten Magnetic Beads (Inkubation für 30 min bei 21°C unter Schütteln in Bindungspuffer [100 mM NaCl, 20 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 5 mM KCl, 1 mM CaCl2]; Bindungsvolumen 250 μl), (ii) Abtrennen der ungebundenen Oligonukleotide durch mehrere Waschschritte der Bindungskomplexe, (iii) Elution der gebundenen Oligonukleotide mittels Hitze (2× Inkubation der Bindungskomplexe in 250 μl Bindungspuffer für 10 min bei 95°C unter Schütteln); dem Amplifikationsschritt – (iv) Vervielfältigung der eluierten Oligonukleotide mittels PCR und dem Reinigungsschritt – (v) Trennung der doppelsträngigen PCR-Produkte und Gewinnung der relevanten DNA-Einzelstränge (sense-Stränge) mittels denaturierender PAGE und anschließender Gelelution. Der auf diese Weise generierte neue Oligonukleotid-Pool am Ende einer SELEX-Runde wurde für eine erneute Bindungsreaktion mit den Target-modifizierten Magnetic Beads in der nächsten SELEX-Runde eingesetzt. In jeder SELEX-Runde wurde dabei ein frisches Aliquot von ~108 Target-modifizierte Magnetic Beads verwendet. In den Runden 3 und 7–11 wurde zusätzlich ein negativer Selektionsschritt eingefügt. Dies bedeutet, die Oligonukleotide wurden zunächst mit Streptavidin-funktionalisierten Magnetic Beads (ohne Target) inkubiert, um alle Oligonukleotide zu entfernen, die unspezifisch an die Immobilisierungsmatrix binden. Die im Überstand verbliebenen Oligonukleotide wurden anschließend mit den Target-modifizierten Magnetic Beads zur Bindung gebracht (siehe Selektionsschritt – (i)). Nach einer schrittweisen Anreicherung Target-bindender Oligonukleotide insbesondere in den Runden 8–11 (siehe 1), wurde der SELEX-Prozess in der 11. Runde nach dem Amplifikationsschritt, in diesem Fall mit unmodifizierten Primern, beendet.

Die beigefügte 1 zeigt den Verlauf des SELEX-Prozesses zur Selektion Protein A-bindender Aptamere. Dargestellt ist die an die Target-modifizierten Magnetic Beads bindende Menge an Oligonukleotiden in jeder SELEX-Runde. In den Runden 3 und 7–11 (gekennzeichnet in der 1 mit *-Symbol) wurde zusätzlich ein negativer Selektionsschritt durchgeführt. Die Menge an Oligonukleotiden, die an die Immobilisierungsmatrix des Targets bindet ist ebenfalls dargestellt (0–0,07 pmol), lag jedoch oftmals am Nachweislimit der Fluoreszenzmessung.

BEISPIEL 3: Klonierung and Sequenzierung.

In der letzten 11. SELEX-Runde wurden die selektierten Oligonukleotide (Aptamer-Pool) mit unmodifizierten Primern amplifiziert, um anschließend die entstandenen PCR-Produkte direkt in den Vektor pCR2.1-TOPO zu klonieren und in E. coli TOP10 Zellen (TOPO TA Cloning Kit; Invitrogen, UK) zu transformieren. Positive Klone wurden mittels Kolonie-PCR identifiziert. Unter Verwendung des QIAprep 96 Turbo Miniprep Kit (Qiagen, Deutschland) wurde die Plasmid-DNA von einigen der Klone präpariert und zur Sequenzierung des Aptamer-Inserts gegeben (Microsynth AG, CH).

Eine Übersicht der aus der Klonierung erhaltenen Aptamersequenzen ist in der Tabelle 1 angegeben. Die Primersequenz (Sense) am 5'-Ende ist ATACCAGCTTATTCAATT (SEQ ID NO: 66) und die Primerbindungsregion für den Antisense-Primer am 3'-Ende ist ACAATCGTAATCAGTTAG (SEQ ID NO: 67). Sie sind jeweils in Fettschrift dargestellt. Die Sequenzen mit der SEQ ID NOs: 66 und 67 sind Bestandteil der Aptamere, vorbehaltlich verkürzter Sequenzen, wie in der vorangehenden allgemeinen Beschreibung definiert. Die Spalte Anzahl” gibt die Anzahl Klone mit identischer Aptamersequenz an. Wenn mehrere Klone mit identischer Sequenz gefunden wurden, ist die Aptamerbezeichnung in Fettschrift markiert (siehe z. B. PA#2/8).

Einige Aptamere lassen sich aufgrund ihrer Sequenzen in Gruppen einteilen. Innerhalb einer Gruppe im Vergleich zum Stellvertreter einer Gruppe abweichende Nukleotide sind unterstrichen gekennzeichnet. Die in einer Gruppe zusammengefassten Sequenzen sind bis auf Punktmutationen und Deletionen identisch bzw. vom Stellvertreter abzuleiten. Die Aptamernummer des Stellvertreters einer Gruppe ist unterstrichen gekennzeichnet (siehe z. B. Aptamer Nr. PA#2/8 für Gruppe 1).

Die Aptamere lassen sich aufgrund ihrer Sequenzen in Gruppen einteilen. Innerhalb einer Gruppe abweichende Nukleotide sind mit Unterstreichung gekennzeichet.

Die Sequenz mit der SEQ ID NO: 62 fasst die Sequenzen der Gruppe 1 zusammen und zeigt variable Nukleotide unterstrichen.

Die Sequenz mit der SEQ ID NO: 63 fasst die Sequenzen der Gruppe 2 zusammen und zeigt variable Nukleotide unterstrichen.

Die Sequenz mit der SEQ ID NO: 64 fasst die Sequenzen der Gruppe 3 zusammen und zeigt variable Nukleotide unterstrichen.

Die Sequenz mit der SEQ ID NO: 65 fasst die Sequenzen der Gruppe 4 zusammen und zeigt variable Nukleotide unterstrichen.

In der SEQ ID NO: 65 bedeutet X1 entweder A oder L, wobei L für kein Nukleotid (Deletion) steht.

Vergleichende Sequenzanalysen wurden mittels ClustalW2, einem Multiple Sequence Alignment Tool (htt://www.ebi.ac.uk/Tools/msa/clustalw2/), durchgeführt.

Die Analyse der Sekundärstruktur einiger Aptamer-Klone erfolgte mittels des Internet-Tools „The mfold Web Server” (http://mfold.rna.albany.edu/?q=mfold), einer frei verfügbaren Software zur Faltung von Nukleinsäuren, die auf einem Energie-Minimierungs-Algorithmus beruht. Das Aptamer PA#2/8 (SEQ ID NO: 1) fällt aufgrund seiner G-reichen Sequenz auf, welche die Faltung zu einer G-Quartett-Struktur vermuten läßt:
PA#2/8 AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT

Eine mögliche Sekundärstruktur von Aptamer PA#2/8 (SEQ ID NO: 1) ist der 2 gezeigt.

BEISPIEL 4: Bindungstests.

Aptamer-Klone mit unterschiedlicher Sequenz wurden auf ihre individuelle Bindungsfähigkeit zum Selektionstarget (biotinyliertes Protein A, immobilisiert an Streptavidin-funktionalisierte Magnetic Beads) untersucht. Die Bindungsversuche wurden entsprechend den SELEX-Bedingungen durchgeführt. Für jeden Versuch kamen 2,5–3 × 10 Target-modifizierte Magnetic Beads und ~55 pmol Fluorescein-markierte Aptamer-ssDNA in Bindungspuffer (100 mM NaCl, 20 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 5 mM KCl, 1 mM CaCl2) und in einem Bindungsvolumen von 250 μl zum Einsatz. Die Target-modifizierte Magnetic Beads wurden vor der Verwendung mehrmals in Bindungspuffer gewaschen und die Aptamer-ssDNA wurde thermisch equilibriert durch Inkubation bei 90°C für 8 min, auf Eis für 10 min und bei RT für ~5 min. Anschließend wurden die vorbereitete Aptamer-ssDNA und die gewaschenen Target-modifizierten Magnetic Beads zur Bindung zusammengegeben für 30 min bei 21°C unter Schütteln. Die ungebundene ssDNA wurde entfernt und die Bindungskomplexe mehrmals in Bindungspuffer gewaschen. Danach erfolgte die Elution der Target-gebundenen ssDNA mittels Hitze durch Inkubation der Bindungskomplexe in Bindungspuffer bei 95°C für 10 min unter Schütteln. Diese Elutionsprozedur wurde insgesamt zweimal durchgeführt. Aufgrund der Fluoresceinmarkierung der Aptamer-ssDNA und mittels einer Kalibrierkurve konnte die Menge der eluierten ssDNA quantifiziert werden. Diese entspricht der Menge an Target-gebundenem Aptamer im Bindungsversuch.

BEISPIEL 5: Aufbau eines Biosensors und Durchführung eines Nachweises auf Protein ABezugszeichenliste

zu Fig. 3
1
Sensorchip (Glaschip)
2
Goldfilm
3
Flusszelle
4
Probelösung
5
Target
6
Lichtquelle
7
Prisma
8
Detektor
9
Aptamer
L
monochromatisches polarisiertes Licht
R
reflektiertes Licht

Das Biacore®-System ist ein kommerziell erhältliches Biosensor-System, welches den markierungsfreien Nachweis von biomolekularen Wechselwirkungen in Echtzeit ermöglicht und dafür das physikalische Prinzip der Oberflächenplasmonenresonanz-Spektroskopie (Surface Plasmon Resonance, SPR) nutzt, wie in der 3 dargestellt.

Der Biosensorchip des Biacore-Systems besteht aus einem Glaschip 1, der mit einem dünnen Goldfilm 2 beschichtet ist und die Sensoroberfläche darstellt. Eine spezielle Funktionalisierung dieser Sensoroberfläche, beispielsweise mit Carboxymethyldextran (CM), erlaubt die kovalente Immobilisierung der biologischen Rezeptormoleküle. Im Falle der Aptamere 9 wird bevorzugt das Biotin-Streptavidin-Kopplungssystem genutzt, um die biotinylierten Aptamere auf die Streptavidin-beschichtete Sensoroberfläche des Biosensorchips zu immobilisieren. Die anschließende Interaktion zwischen Target und Aptamer findet in einer Flusszelle 3 statt, wobei durch ein integriertes, kontinuierliches Flusssystem die Probelösung 4 mit Target 5 über die Sensoroberfläche geleitet wird. Die optische Detektionseinheit des Biacore-Systems besteht aus einer Lichtquelle 6 (Leuchtdioden), einem Prisma 7 und einem Detektor 8 (Diodenarray-Detektor).

Monochromatisches, polarisiertes Licht L wird unter den Bedingungen der Totalreflexion von einem Medium mit hohem Brechungsindex (Sensorchip mit Goldfilm) in ein Medium mit niedrigem Brechungsindex (Sensorschicht, Pufferlösung) eingestrahlt. Dabei tritt bei einem bestimmten Einfallswinkel eine Abschwächung des reflektierten Lichtes R auf. Dieser Winkel, der Resonanzwinkel, reagiert sehr sensitiv auf Veränderungen des Brechungsindexes der Sensorschicht. Die Anbindung des Targets 5 an das immobilisierte Aptamer 9 auf der Sensoroberfläche resultiert in einem Massezuwachs in der Sensorschicht, welcher zu einer Änderung des Brechungsindexes dieser Schicht und damit zu einer Verschiebung des Resonanzwinkels führt. Diese Änderungen werden als messbares Signal, ausgedrückt in Resonanz-Einheiten (RU), ausgegeben und sind proportional zu der Menge an gebundenem Target 5 auf der Sensoroberfläche. Während der Bindungsanalyse werden die Änderungen des Resonanzwinkels kontinuierlich aufgezeichnet und aufgetragen gegen die Zeit als Sensorgramm dargestellt, das in der 4 schematisch dargestellt ist. Im Abschnitt II der Signalkurve ist eine Verschiebung des Resonanzwinkels durch die Anbindung von Target an das immobilisierte Aptamer erkennbar. Die Verschiebung des Resonanzwinkels ist auch in der 3 gezeigt, anhand eines mit „I” und eines mit „II” bezeichneten reflektierten Lichtstrahles.

Der Aptamer-Target-Komplex kann unter geeigneten Pufferbedingungen wieder gelöst werden, so dass die Sensoroberfläche regeneriert wird und für eine erneute Bindung mit Targetmolekülen zu Verfügung steht.

An der Oberfläche des oben beschriebenen Biosensors wird erfindungsmäßes Aptamer immobilisiert. Eine Lösung von Protein A wird über die Sensoroberfläche geleitet, wobei Protein A an das Aptamer bindet. Die Anbindung von Protein A wird als Verschiebung des Resonanzwinkels detektiert. SEQUENZPROTOKOLL