Title:
New oligonucleotide, comprising specified sequences, is argonaute-3a expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis
Kind Code:
A1


Abstract:
Oligonucleotide comprising one or more sequences comprising SEQ ID NOs: 1-7, is new. Oligonucleotide, comprising one or more sequences including agaaaaatgaacgccccaca (SEQ ID NO: 1), cttctggagcggagaaaaat (SEQ ID NO: 2), ctagtggcaggtaggtgtgt (SEQ ID NO: 3), gtgcaggtatagaaacagat (SEQ ID NO: 4), cagacttctagtggcaggta (SEQ ID NO: 5), ccctgccacaatattacagactt (SEQ ID NO: 6) or gttgccctgccacaatatta (SEQ ID NO: 7), is new. Independent claims are included for: (1) a vector comprising the oligonucleotide; (2) a nucleic acid construct comprising the oligonucleotide and a detectable marker; (3) a composition comprising the oligonucleotide, optionally in conjunction with one or more adjuvants, diluents and/or carriers; (4) a diagnostic composition comprising the oligonucleotide or the nucleic acid construct; (5) specifically inhibiting the expression of ago-3 in a cell in vitro, comprising introducing the oligonucleotide or the vector in the cell, and providing suitable hybridization conditions; and (6) detecting ago-3 mRNA in a cell in vitro, comprising introducing the nucleic acid construct in a cell, providing the suitable hybridization conditions and detecting the detectable marker. ACTIVITY : Angiogenesis Inhibitor; Antianemic; Anticonvulsant; Nootropic; Cytostatic. MECHANISM OF ACTION : Ago-3a expression inhibitor; Ago-3b expression inhibitor. The ability of the oligonucleotide to inhibit human Ago-3a mRNA expression was tested in vitro in ECV304 cells. The results showed that the asAgo3-1 (SEQ ID NO: 1) exhibited an IC 50value of 10 nM.



Inventors:
Sczakiel, Georg, Prof. Dr. (23627 Groß Grönau, DE)
Mescalchin, Alessandra (Lübeck, 23564, DE)
Erogullari, Alev (Lübeck, 23552, DE)
Application Number:
DE102009024730
Publication Date:
12/16/2010
Filing Date:
06/12/2009
Assignee:
Universitätsklinikum Schleswig-Holstein Campus Lübeck (Lübeck, 23562, DE)
International Classes:



Foreign References:
WO2007048629A22007-05-03
WO2007048628A22007-05-03
WO2004007718A22004-01-22
Attorney, Agent or Firm:
Müller-Boré & Partner, Patentanwälte, European Patent Attorneys (München, 81671)
Claims:
1. Oligonukleotid, umfassend eine oder mehrere der Sequenzen, ausgewählt aus SEQ ID NOs: 1, 2, 3, 4, 5, 6 und 7, für die spezifische Hemmung der Argonaute-3 (Ago-3) Expression in einer Zelle.

2. Oligonukleotid nach Anspruch 1, wobei die spezifische Hemmung der Ago-3 Expression in einer Zelle in vitro durchgeführt wird.

3. Oligonukleotid nach Anspruch 1 oder 2, wobei das Oligonukleotid mindestens eine modifizierte Nukleosidverknüpfung aufweist.

4. Oligonukleotid nach Anspruch 3, wobei die modifizierte Nukleosidverknüpfung eine Phosphorothioat-Verknüpfung ist.

5. Oligonukleotid nach einem der Ansprüche 1 bis 4, bestehend aus einer der Sequenzen, ausgewählt aus SEQ ID NOs: 1, 2, 3, 4, 5, 6 und 7.

6. Oligonukleotid nach einem der Ansprüche 1 bis 5, wobei Ago-3 in der Isoform Ago-3a vorliegt.

7. Oligonukleotid nach einem der Ansprüche 1 bis 5, wobei Ago-3 in der Isoform Ago-3b vorliegt, und wobei das Oligonukleotid eine oder mehrere der Sequenzen, ausgewählt aus SEQ ID NOs: 3, 4, 5, 6 und 7, umfaßt.

8. Vektor, umfassend ein Oligonukleotid nach einem der Ansprüche 1 bis 7.

9. Nukleinsäure-Konstrukt, umfassend ein Oligonukleotid nach einem der Ansprüche 1 bis 7 und eine detektierbare Markierung.

10. Pharmazeutische Zusammensetzung, umfassend ein Oligonukleotid nach einem der Ansprüche 1 bis 7, gegebenenfalls in Verbindung mit einem oder mehreren pharmazeutisch verträglichen Hilfsstoff(en) und/oder Verdünnungsmittel(n) und/oder Träger(n).

11. Diagnostische Zusammensetzung, umfassend ein Oligonukleotid nach einem der Ansprüche 1 bis 7 oder das Nukleinsäure-Konstrukt nach Anspruch 9.

12. Verfahren zur spezifischen Hemmung der Expression von Argonaute-3 (Ago-3) in einer Zelle in vitro, umfassend das Einbringen eines Oligonukleotids nach einem der Ansprüche 1 bis 7 oder des Vektors nach Anspruch 8 in die Zelle und das Bereitstellen von geeigneten Hybridisierungsbedingungen.

13. Verfahren zum Nachweis von Argonaute-3 (Ago-3) mRNA in einer Zelle in vitro, umfassend das Einbringen eines Nukleinsäure-Konstrukts nach Anspruch 9 in eine Zelle, das Bereitstellen von geeigneten Hybridisierungsbedingungen und das Nachweisen der detektierbaren Markierung.

14. Verwendung eines Oligonukleotids nach einem der Ansprüche 1 bis 7 zur Hemmung der Expression von Argonaute-3 (Ago-3) in einer Zelle in vitro.

15. Verwendung eines Oligonukleotids nach einem der Ansprüche 1 bis 7 oder des Nukleinsäure-Konstrukts nach Anspruch 9 für die Diagnose einer Störung oder Krankheit, die mit Argonaute-3 (Ago-3) in Zusammenhang steht.

16. Verwendung eines Oligonukleotids nach einem der Ansprüche 1 bis 7 für die Behandlung einer Störung oder Krankheit, die mit Argonaute-3 (Ago-3) in Zusammenhang steht.

Description:

Die vorliegende Erfindung betrifft ein Oligonukleotid, das spezifisch an das Protein Argonaute-3 kodierende mRNA hybridisiert. Mit Hilfe dieses Oligonukleotids kann die Expression von Ago-3 gehemmt und Ago-3 mRNA nachgewiesen werden. Die vorliegende Erfindung betrifft weiter pharmazeutische Zusammensetzungen enthaltend dieses Oligonukleotid, Verfahren zur spezifischen Hemmung der Ago-3 Expression und zum Nachweis von Ago-3 mRNA, sowie die Verwendung dieses Oligonukleotids zur Hemmung der Expression von Ago-3 in einer Zelle.

Die Familie der Argonaute(Ago)-Proteine ist eine hoch konservierte Proteinfamilie, deren Mitglieder Schlüsselfunktionen bei der RNA-vermittelten Interferenz (RNAi), d. h. dem durch kleine, nicht-kodierende RNAs vermittelten Gen-Silencing, innehaben. Ago-Proteine binden diese kleinen, nicht-kodierenden RNAs über ihre funktionellen Domänen, und können so unter anderem die Proteinsynthese kontrollieren oder die Stabilität von mRNA beeinflussen. Verschiedene Klassen von Ago-Proteinen lassen sich in allen höheren Eukaryonten finden, wo sie wichtige Funktionen in so verschiedenen Prozessen wie der Embryonalentwicklung, der Stammzellerneuerung oder der Zelldifferenzierung haben. Obwohl verschiedene Aspekte ihrer Biologie bereits erforscht wurden, sind viele Ago-Proteine noch immer nur sehr unzureichend charakterisiert.

Angesichts ihrer vielfältigen Funktionen werden Ago-Proteine auch mit verschiedenen Krankheiten in Verbindung gebracht. So konnte gezeigt werden, daß bestimmte Ago-Proteine mit FMRp interagieren, dem Gen, das bei dem vererbten Fragiles-X-Syndrom betroffen ist. Außerdem wurden einige Ago-Proteine mit der Regulation von Onkogenen und mit bestimmten Formen von Krebs assoziiert.

Humanes Ago-3 liegt in zwei Splicing-Varianten vor, der Isoform a und der Isoform b. Die Ago-3b kodierende mRNA und das entsprechende Protein sind kürzer als bei der Isoform a (Tabelle 1), wobei die verbleibende Sequenz bei beiden Varianten identisch ist. Über die biologische Funktion dieser Ago-3 Varianten ist sehr wenig bekannt. Tabelle 1: mRNA Länge und Molekulargewicht von Ago-3a und Ago-3b

mRNA Länge (b)MW Protein (kDa)Ago-3a357897,4Ago-3b332071,2

Der vorliegenden Erfindung liegt daher die Aufgabe zugrunde, neue und effektive Systeme für die Untersuchung von Ago-3 und dessen biologischer Funktion, sowie für die Prävention und Behandlung von Störungen oder Krankheiten, die mit Ago-3 in Zusammenhang stehen, bereitzustellen.

Diese Aufgabe wird durch die in den Ansprüchen gekennzeichneten Ausführungsformen der vorliegenden Erfindung gelöst. Insbesondere wird erfindungsgemäß ein anti-sense Oligonukleotid (asON) für die spezifische Hemmung der Expression von Ago-3 bereitgestellt, das nicht auf RNA-vermittelter Interferenz (RNAi) basiert. Dieses asON zeichnet sich durch besonders effektives Assoziationsverhalten an Ago-3 mRNA aus.

Dementsprechend betrifft ein Gegenstand der vorliegenden Erfindung ein Oligonukleotid, umfassend eine oder mehrere der Sequenzen, ausgewählt aus der Gruppe, bestehend aus SEQ ID NO: 1 (5'-AGAAAAATGAACGCCCCACA-3'), SEQ ID NO: 2 (5'-CTTCTGGAG CGGAGAAAAAT-3'), SEQ ID NO: 3 (5'-CTAGTGGCAGGTAGGTGTGT-3'), SEQ ID NO: 4 (5'-GTGCAGGTATAGAAACAGAT-3'), SEQ ID NO: 5 (5'-CAGACTTCTAGT GGCAGGTA-3'), SEQ ID NO: 6 (5'-CCCTGCCACAATATTACAGACTT-3'), SEQ ID NO: 7 (5'-GTTGCCCTGCCACAATATTA-3') und biologisch aktiven Derivaten davon. Der Begriff „biologisch aktive Derivate” bezeichnet insbesondere Oligonukleotide, welche die gleiche Funktion wie das erfindungsgemäße Oligonukleotid aufweisen, also spezifisch an Ago-3 mRNA binden können, und mehr als 80%, bevorzugt mehr als 90%, besonders bevorzugt mehr als 95% Sequenzidentität zu dem erfindungsgemäßen Oligonukleotid zeigen.

In einer bevorzugten Ausführungsform umfaßt das erfindungsgemäße Oligonukleotid SEQ ID NO: 3 und/oder SEQ ID NO: 4 und/oder SEQ ID NO: 5 und/oder SEQ ID NO: 6 und/oder SEQ ID NO: 7 oder biologisch aktive Derivate davon.

Der Begriff „Oligonukleotid” bezeichnet ein natives, halbsynthetisches, synthetisches oder modifiziertes, einzel- oder doppelsträngiges Nukleinsäuremolekül aus Desoxyribonukleotiden und/oder Ribonukleotiden und/oder modifizierten Nukleotiden. Geeignete modifizierte Nukleotide umfassen Nukleotide mit modifizierten Basen, Zuckern und/oder Phosphatgruppen. Beispiele für modifizierte Nukleotide sind sogenannte LNAs (locked nucleic acids), bei denen das C2- und C4-Atom der Ribose über eine Sauerstoff-Methylen-Brücke verbunden ist, sowie Morpholino-Derivate von Nukleotiden, Nukleotid-Phosphorothioate, oder 2'-fluoro- und 2'-alkyl-modifizierte Nukleotide. Weiter können die erfindungsgemäßen Oligonukleotide beispielsweise als sogenannte „Gapmere” vorliegen, also als Oligonukleotide, bei denen ein zentraler Abschnitt aus Desoxyribonukleotiden von Abschnitten aus 2'-O-methyl-modifizierten Ribonukleotiden flankiert ist.

Die Länge des erfindungsgemäßen Oligonukleotids unterliegt keinen besonderen Beschränkungen, wobei die Mindestlänge durch die Sequenzen SEQ ID NOs.: 1, 2, 3, 4, 5, 6 oder 7 vorgegeben ist. In einer bevorzugten Ausführungsformen umfaßt das erfindungsgemäße Oligonukleotid 28 oder weniger, bevorzugt 23 oder weniger, besonders bevorzugt 18 oder weniger Nukleotide. In einer besonders bevorzugten Ausführungsform besteht das erfindungsgemäße Oligonukleotid aus einer der Sequenzen SEQ ID NOs: 1, 2, 3, 4, 5, 6 oder 7. Verfahren zur Herstellung und/oder Isolierung von Oligonukleotiden sind dem Fachmann aus dem Stand der Technik bekannt und umfassen beispielsweise chemisch-synthetische oder enzymatische Verfahren, sowie die intrazelluläre Expression und nachfolgende Aufreinigung der Oligonukleotide.

Das erfindungsgemäße Oligonukleotid hat in einer bevorzugten Ausführungsform die Fähigkeit, spezifisch an Ago-3 mRNA zu binden bzw. zu hybridisieren. Die Hybridisierung wird bevorzugt bei Bedingungen, die den physiologischen Bedingungen um Zytosol oder Zellkern einer Zelle entsprechen, durchgeführt. In einer weiteren bevorzugten Ausführungsform wird die Hybridisierung bei Bedingungen, die für die in vitro Hybridisierung förderlich sind, durchgeführt. In einer besonders bevorzugten Ausführungsform erfolgt die Hybridisierung unter stringenten Bedingungen. Solche Bedingungen sind dem Fachmann aus dem Stand der Technik bekannt.

Das erfindungsgemäße Oligonukleotid kann Nukleotiddeletionen, -insertionen und/oder -substitutionen enthalten, solange die Fähigkeit, spezifisch an Ago-3 mRNA zu binden, im Wesentlichen erhalten bleibt. In einer weiteren bevorzugten Ausführungsform umfaßt das erfindungsgemäße Oligonukleotid mindestens eine modifizierte Nukleosidverknüpfung. In einer besonders bevorzugten Ausführungsform sind alle Nukleosidverknüpfungen modifiziert. Eine besonders bevorzugte modifizierte Nukleosidverknüpfung ist die Phosphorothioat-Verknüpfung.

Ein weiterer Gegenstand der vorliegenden Erfindung betrifft ein erfindungsgemäßes Oligonukleotid zur spezifischen Hemmung der Ago-3 Expression in einer Zelle. Der Begriff „Hemmung der Ago-3 Expression” bezeichnet eine Reduzierung der Expression von Ago-3 mRNA auf höchstens 50%, bevorzugt höchstens 35%, mehr bevorzugt höchstens 20% der normalen Expression von Ago-3 mRNA in einer Zelle.

In einer bevorzugten Ausführungsform wird die Hemmung der Ago-3 Expression bereits vier Stunden nach Transfektion einer Zelle mit dem erfindungsgemäßen Oligonukleotid erreicht. In einer weiteren bevorzugten Ausführungsform dauert die Hemmung der Ago-3 Expression bis zu 120 Stunden, mehr bevorzugt bis zu 48 Stunden und besonders bevorzugt bis zu 72 Stunden nach Transfektion einer Zelle mit dem erfindungsgemäßen Oligonukleotid an. in einer weiteren bevorzugten Ausführungsform wird die Hemmung der Ago-3 Expression in einer Zelle in vitro durchgeführt. Die Zelle, in der die Expression von Ago-3 gehemmt wird, ist bevorzugt eine humane Zelle.

Ein weiterer Gegenstand der vorliegenden Erfindung betrifft ein erfindungsgemäßes Oligonukleotid zur Herstellung einer diagnostischen oder pharmazeutischen Zusammensetzung. Die erfindungsgemäße pharmazeutische Zusammensetzung wird in einer bevorzugten Ausführungsform zur spezifischen Hemmung der Ago-3 Expression in einer Zelle verwendet. In einer weiteren bevorzugten Ausführungsform wird die erfindungsgemäße diagnostische oder pharmazeutische Zusammensetzung für die Prävention oder Behandlung einer Störung oder Krankheit, die mit Ago-3 in Zusammenhang steht, in einem Individuum verwendet. Ein weiterer Gegenstand der vorliegenden Erfindung betrifft die Verwendung des erfindungsgemäßen Oligonukleotids oder des erfindungsgemäßen Vektors zur Hemmung der Expression von Ago-3 in einer Zelle. Dabei wird in einer bevorzugten Ausführungsform die Expression von Ago-3 in einer Zelle in vitro gehemmt.

Die Störung oder Krankheit, die mit Ago-3 in Zusammenhang steht, ist in einer bevorzugten Ausführungsform eine Störung oder Krankheit der Angiogenese, der Hämatopoese, der Embryogenese oder der microRNA-Biogenese, Chorea Huntington oder die Entstehung von Tumoren. Das Individuum, das eine mit Ago-3 in Zusammenhang stehende Störung oder Krankheit aufweist, kann jedes Wirbeltier sein und ist in einer bevorzugten Ausführungsform ein Säuger, besonders bevorzugt ein Mensch.

In einer bevorzugten Ausführungsform liegt Ago-3 als Isoform Ago-3a vor. In einer weiteren bevorzugten Ausführungsform liegt Ago-3 als Isoform Ago-3b vor. Liegt Ago-3 als Ago-3b vor, so umfaßt das erfindungsgemäße Oligonukleotid bevorzugt eine oder mehrere der Sequenzen, ausgewählt aus SEQ ID NOs: 3, 4, 5, 6 und 7.

Ein weiterer Gegenstand der vorliegenden Erfindung betrifft ein Nukleinsäure-Konstrukt, umfassend mindestens ein erfindungsgemäßes Oligonukleotid und mindestens eine detektierbare Markierung, sowie dessen Verwendung zum Nachweis von Ago-3 mRNA. In einer bevorzugten Ausführungsform wird die Ago-3 mRNA in einer Zelle nachgewiesen. in einer weiteren bevorzugten Ausführungsform wird die Ago-3 mRNA in einer Zelle in vitro nachgewiesen.

Der Begriff „detektierbare Markierung” beinhaltet geeignete, direkt oder indirekt nachweisbare Atome oder Moleküle, die in das erfindungsgemäße Oligonukleotid eingebaut und daran gebunden sind. Geeignete Markierungen sind beispielsweise solche, die Fluoreszenzfarbstoffe und/oder beispielsweise Biotin und/oder Digoxigenin und/oder radioaktive Isotope umfassen. in einer bevorzugten Ausführungsform ist die detektierbare Markierung ein Fluoreszenzfarbstoff.

Ein weiterer Gegenstand der vorliegenden Erfindung betrifft einen Vektor, umfassend mindestens ein erfindungsgemäßes Oligonukleotid und/oder mindestens eine zum erfindungsgemäßen Oligonukleotid komplementäre Nukleinsäuresequenz, insbesondere DNA-Sequenz. Der erfindungsgemäße Vektor unterliegt keiner besonderen Einschränkung, wobei geeignete Vektoren im Stand der Technik bekannt sind. Der Vektor ist vorzugsweise zur Expression in einer eukaryontischen oder prokaryontischen Zelle befähigt. Dazu enthält der Vektor beispielsweise einen Promotor und gegebenenfalls geeignete regulatorische Elemente, wie Enhancer und Terminationssequenzen. Der Vektor kann auch zur stabilen Integration des erfindungsgemäßen Oligonukleotids in das genetische Material einer Zelle verwendet werden.

Ein weiterer Gegenstand der vorliegenden Erfindung betrifft eine Wirtszelle, welche mindestens ein erfindungsgemäßes Oligonukleotid oder mindestens einen erfindungsgemäßen Vektor enthält. Geeignete Wirtszellen sind beispielsweise Säugerzellen, insbesondere menschliche Zellen.

Des Weiteren wird erfindungsgemäß eine pharmazeutische Zusammensetzung, umfassend mindestens ein erfindungsgemäßes Oligonukleotid oder mindestens einen erfindungsgemäßen Vektor, bereitgestellt. Gegebenenfalls umfaßt die erfindungsgemäße pharmazeutische Zusammensetzung weiter einen oder mehrere pharmazeutisch verträgliche(n) Hilfsstoff(e) und/oder ein oder mehrere pharmazeutisch verträgliche(s) Verdünnungsmittel und/oder einen oder mehrere pharmazeutisch verträgliche(n) Träger. Die erfindungsgemäße pharmazeutische Zusammensetzung wird vorzugsweise zur präventiven oder therapeutischen Behandlung einer Störung oder Krankheit, die mit Ago-3 in Zusammenhang steht, verwendet. Besonders bevorzugte Einsatzgebiete sind die Behandlung von Störungen oder Krankheiten der Angiogenese, der Hämatopoese, der Embryogenese oder der microRNA-Biogenese, von Chorea Huntington oder von Tumoren. Dementsprechend betrifft ein Gegenstand der vorliegenden Erfindung eine pharmazeutische Zusammensetzung, umfassend mindestens ein erfindungsgemäßes Oligonukleotid oder mindestens einen erfindungsgemäßen Vektor, gegebenenfalls in Verbindung mit einem oder mehreren pharmazeutisch verträglichen Hilfsstoff(en) und/oder Verdünnungsmittel(n) und/oder Träger(n) zur Verwendung in der präventiven oder therapeutischen Behandlung einer Störung oder Krankheit, die mit Ago-3 in Zusammenhang steht, in einem Individuum. Die erfindungsgemäße pharmazeutische Zusammensetzung kann jegliche im vorliegenden Fachgebiet als geeignet betrachtete galenische Formen annehmen. Vorzugsweise ist sie fest, flüssig oder aerosolartig. Verabreichungsformen der erfindungsgemäßen pharmazeutischen Zusammensetzung unterliegen keinerlei bestimmten Beschränkungen. Geeignete Verabreichungsformen sind im Stand der Technik bekannt und umfassen beispielsweise orale, intravenöse, subkutane, intraperitoneale, intramuskuläre oder intratumorale Verabreichungsformen. Ebenso wird erfindungsgemäß eine diagnostische Zusammensetzung, umfassend mindestens ein erfindungsgemäßes Oligonukleotid oder mindestens ein erfindungsgemäßes Nukleinsäure-Konstrukt, bereitgestellt.

Ein weiterer Gegenstand der vorliegenden Erfindung betrifft ein Verfahren zur spezifischen Hemmung der Expression von Ago-3 in einer Zelle, umfassend das Einbringen mindestens eines erfindungsgemäßen Oligonukleotids oder mindestens eines erfindungsgemäßen Vektors in die Zeile und gegebenenfalls das Bereitstellen von geeigneten Hybridisierungsbedingungen, so daß die Expression von Ago-3 gehemmt wird. In einer bevorzugten Ausführungsform wird das erfindungsgemäße Verfahren zur spezifischen Hemmung der Expression der Ago-3 in einer Zelle in vivo, d. h. innerhalb des tierischen oder menschlichen Körpers durchgeführt. In einer weiteren bevorzugten Ausführungsform wird das genannte Verfahren in vitro, d. h. außerhalb des tierischen oder menschlichen Körpers durchgeführt. Verfahren zum Einbringen einer Nukleinsäure in eine Zelle sind im vorliegenden Fachgebiet wohlbekannt, und umfassen beispielsweise die Transfektion durch Elektroporation oder mit einem Transfektionsmittel wie z. B. Lipofectamin. Die Hemmung der Ago-3 Expression in der Zelle hat vorzugsweise zur Folge, daß die RNA-vermittelte Interferenz (RNAi) der Zelle moduliert wird. In einer bevorzugten Ausführungsform ist die Zelle, deren Ago-3 Expression gehemmt werden soll, eine humane Zeile.

Ein weiterer Gegenstand der vorliegenden Erfindung betrifft ein Verfahren zum Nachweis von Ago-3 mRNA, umfassend das Inkontaktbringen des erfindungsgemäßen Nukleinsäure-Konstrukts mit einer Ago-3 mRNA und das Bereitstellen von geeigneten Hybridisierungsbedingungen. Dieses Verfahren wird in einer bevorzugten Ausführungsform in vitro durchgeführt.

Ein weiterer Gegenstand der vorliegenden Erfindung betrifft ein Verfahren zum Nachweis von Ago-3 mRNA in einer Zelle, umfassend das Einbringen des erfindungsgemäßen Nukleinsäure-Konstrukts in eine Zelle, das Bereitstellen von geeigneten Hybridisierungsbedingungen und das Nachweisen der detektierbaren Markierung. Verfahren zum Nachweis der jeweiligen Markierung sind im vorliegenden Fachgebiet wohlbekannt. In einer bevorzugten Ausführungsform ist die Zelle, in der Ago-3 mRNA nachgewiesen werden soll, eine humane Zelle. Dieses Verfahren wird in einer bevorzugten Ausführungsform in vitro durchgeführt.

Ein weiterer Gegenstand der vorliegenden Erfindung betrifft einen Biochip/Microarray, umfassend ein oder mehrere immobilisierte(s) erfindungsgemäße(s) Oligonukleotid(e) und/oder ein oder mehrere immobilisierte(s) erfindungsgemäße(s) Nukleinsäure-Konstrukt(e). Der erfindungsgemäße Biochip/Microarray kann zum Nachweis von Ago-3 mRNA verwendet werden. Die vorliegende Erfindung umfaßt die Verwendung des erfindungsgemäßen Biochips/Microarrays zum Nachweis von Ago-3 mRNA.

Ein weiterer Gegenstand der vorliegenden Erfindung betrifft die Verwendung des erfindungsgemäßen Oligonukleotids oder des erfindungsgemäßen Nukleinsäure-Konstrukts für die Diagnose einer Störung oder Krankheit, die mit Ago-3 in Zusammenhang steht. Ein weiterer Gegenstand der vorliegenden Erfindung betrifft die Verwendung des erfindungsgemäßen Oligonukleotids oder des erfindungsgemäßen Vektors zur Behandlung einer Störung oder Krankheit, die mit Ago-3 in Zusammenhang steht.

Ein weiterer Gegenstand der vorliegenden Erfindung betrifft ein Verfahren zur Behandlung einer Störung oder Krankheit, die mit Ago-3 in Zusammenhang steht, in einem Individuum, umfassend das Verabreichen mindestens eines erfindungsgemäßen Oligonukleotids und/oder mindestens eines erfindungsgemäßen Vektors oder der erfindungsgemäßen pharmazeutischen Zusammensetzung an das Individuum. Die Störung oder Krankheit, die mit Ago-3 in Zusammenhang steht, ist in einer bevorzugten Ausführungsform eine Störung oder Krankheit der Angiogenese, der Hämatopoese, der Embryogenese oder der microRNA-Biogenese, Chorea Huntington oder die Entstehung von Tumoren. Das Individuum, das eine mit Ago-3 in Zusammenhang stehende Störung oder Krankheit aufweist, ist in einer bevorzugten Ausführungsform ein Mensch.

Die Figuren zeigen:

1: Schematische Darstellung der Ago-3a mRNA und der Ago-3b mRNA mit den Bindungsstellen für SEQ ID NOs: 1 bis 7. Die asONs asAgo3-1 und asAgo3-2 binden nur an Ago-3a mRNA, und die asONs asAgo3-6 und asAgo3-7 nur an Ago-3b mRNA. Alle anderen asONs binden an beide Isoformen.

2: Hemmung der Expression von humaner Ago-3a mRNA (A) und Ago-3b mRNA (B) in ECV304 Zellen durch gegen Ago-3a mRNA und/oder Ago-3b mRNA gerichtete asONs. Die Expression von Ago-3a mRNA und Ago-3b mRNA wurde gegen das Kontroll-Oligonukleotid T1-inv (SEQ ID NO: 13; 5'-TACCGCTCTTTTGACTTTTA-3'), das auf 100% gesetzt wurde, normalisiert.

3: Spezifität der asONs asAgo3-1 und asAgo3-10 gegenüber anderen humanen Argonaute-Proteinen (Agos). Die Expression der Ago mRNAs wurde gegen das Kontroll-Oligonukleotid T1-inv, das auf 100% gesetzt wurde, normalisiert.

4: Zeitkinetik der Hemmung der Expression von Ago-3a mRNA und Ago-3b mRNA durch die asONs asAgo3-1 (SEQ ID NO: 1) und asAgo3-10 (SEQ ID NO: 7). Die Expression von Ago-3 mRNA wurde gegen das Kontroll-Oligonukleotid T1-inv, das auf 100% gesetzt wurde, normalisiert.

Die vorliegende Erfindung wird anhand der folgenden, nicht-einschränkenden Beispiele näher erläutert.

Beispiel 1: Anti-sense Oligonukleotide

Es wurden zwölf vollständig Phosphorothioat-modifizierte asONs getestet (Tabelle 2). Die Lage der Bindungsstellen der asONs an Ago-3a mRNA bzw. Ago-3b mRNA ist in 1 dargestellt. Die asONs asAgo3-6 und asAgo3-7 sind gegen Bereiche der 5' untranslatierten Region (5'-UTR) der Ago-3b mRNA gerichtet. Die übrigen asONs sind gegen Bereiche des offenen Leserasters (open reading frame, ORF) der Ago-3a mRNA bzw. Ago-3b mRNA gerichtet.

Tabelle 2: Getestete asONs.

Beispiel 2: Hemmung humaner Ago-3a mRNA bzw. Ago-3b mRNA

Die Fähigkeit der in Tabelle 2 gezeigten asONs, humane Ago-3a mRNA bzw. Ago-3b mRNA zu hemmen, wurde in vitro in ECV304 Zellen als Modellsystem getestet. ECV304 Zellen wurden mit 100 nM der spezifischen asONs durch Verwendung von Lipofectamin 2000 als Transfektionsmittel transfiziert. Nach 24 h in Kultur wurden die Zellen gesammelt, ihre RNA extrahiert, in cDNA umgeschrieben, und diese mittels quantitativer PCR amplifiziert. Die Wirkung der asONs auf die Ago-3a mRNA-Level bzw. Ago-3b mRNA-Level ist in 2 gezeigt.

IC50-Werte, d. h. die jeweilige asON-Konzentration, die benötigt wird, um 50% der Ago-3a mRNA bzw. Ago-3b mRNA Expression zu hemmen, wurden durch Transfektion von ECV304 Zellen mit aufsteigenden asON-Konzentrationen bestimmt. Nach quantitativer PCR wurden die Daten mit Hilfe der Software GraFit 5 ausgewertet (Tabelle 3). Tabelle 3: IC50-Werte

Beispiel 3: Spezifität der asONs

Die asONs asAgo3-1 und asAgo3-10 wurden auf ihre Spezifität für Ago-3a mRNA bzw. Ago-3b mRNA gegenüber anderen Ago mRNAs getestet. 100 nM der asONs wurden in ECV304 Zellen mit Hilfe von Lipofectamin 2000 als Transfektionsmittel transfiziert. Nach der Transfektion wurde RNA extrahiert und in cDNA umgeschrieben. Die darauf folgende quantitative PCR wurde mit Primern für jedes Mitglied der humanen Ago-Familie durchgeführt. Die jeweiligen mRNA Expressionslevel für jedes Ago-Protein sind in 3 dargestellt.

Beispiel 4: Kinetik der Ago-3a mRNA und Ago-3b mRNA Hemmung

Das asON asAgo3-1 hemmt die Expression von Ago-3a mRNA bereits 4 h nach Transfektion. Dieser Effekt dauert bis zu 72 h nach Transfektion an. Das asON asAgo3-10 zeigt eine ähnliche Kinetik und wirkt auf beide Ago-3 mRNA Isoformen (4).

Es folgt ein Sequenzprotokoll nach WIPO St. 25.Dieses kann von der amtlichen Veröffentlichungsplattform des DPMA heruntergeladen werden.