Title:
Verwendung von cis-Imidazolinen, insbesondere Nutlinen, zur Behandlung von chemoresistenten Krebserkrankungen
Kind Code:
A1


Abstract:

Die vorliegende Erfindung betrifft eine pharmazeutische Zusammensetzung, umfassend mindestens ein einen oder mehrere ABC-Transporter hemmendes cis-Imidazolin, insbesondere Nutlin, in Kombination mit mindestens einem oder mehreren Zytostatika, wobei das Zytostatikum durch den ABC-Transporter vermittelt aus einer Krebszelle transportiert werden kann, und deren Verwendung bei der Krebsbehandlung sowie verwandte Aspekte.




Inventors:
Michaelis, Martin (Friedrichsdorf, 61381, DE)
Dörr, Hans Wilhelm (Dreieich, 63303, DE)
Cinatl, Jindrich (Offenbach, 63069, DE)
Application Number:
DE102008047128
Publication Date:
04/15/2010
Filing Date:
09/15/2008
Assignee:
Johann Wolfgang Goethe-Universität Frankfurt am Main (Frankfurt, 60325, DE)
International Classes:
Domestic Patent References:
DE19636889A1N/A



Foreign References:
73583352008-04-15
200502882872005-12-29
Other References:
El-Deiry, W. S. The p53 pathway und cancer therapy. Cancer Journal 11 229-236 (1998)
Lane, D. P., Hupp, T. R. Drug discovery und p53. Drug Discovery Today 8 (8) 347-355 (2003)
Vassilev, L. T., Vu, B. T., Graves, B., et al. In vivo activation of the p53 pathway by small-molecule antagonists of MDM2. Science 303 844-848 (2004)
Cheok et al. (in Cheok CF, Dey A, Lane DP. Cyclin-dependent kinase inhibitors sensitize tumor cells to nutlin-induced apoptosis: a potent drug combination. Mol Cancer Res. 2007 Nov; 5 (11): 1133-45)
Mack et al. (in Mack JT, Brown CB, Tew KD. ABCA2 as a therapeutic target in cancer and nervous system disorders. Expert Opin Ther Targets. 2008 Apr; 12(4): 491-504.)
Calcagno AM, Kim IW, Wu CP, Shukla S, Ambudkar SV. ABC drug transporters as molecular targets for the prevention of multidrug resistance and drug-drug interactions. Curr Drug Deliv. 2007 Oct; 4(4): 324-33
Ambrosini G, Sambol EB, Carvajal D, Vassilev LT, Singer S, Schwartz GK. Mouse double minute antagonist Nutlin-3a enhances chemotherapy-induced apoptosis in cancer cells with mutant p53 by activating E2F1. Oncogene. 2007 May 24; 26 (24): 3473-81
Bakos B, Evers R, Szakács G, Tusnády GE, Welker E, Szabó K, de Haas M, van Deemter L, Borst P, Váradi A, Sarkadi B. Functional multidrug resistance protein (MRP1) lacking the N-terminal transmembrane domain. J Biol Chem. 1998 Nov 27; 273 (48): 32167-75
Barbieri E, Mehta P, Chen Z, Zhang L, Slack A, Berg S, Shohet JM. MDM2 inhibition sensitizes neuroblastoma to chemotherapy-induced apoptotic cell death. Mol Cancer Ther. 2006 Sep; 5 (9): 2358-65
Breitfeld PP, Meyer WH. Rhabdomyosarcoma: new windows of opportunity. Oncologist. 2005 Aug; 10 (7): 518-27
Calcagno AM, Kim IW, Wu CP, Shukla S, Ambudkar SV. ABC drug transporters as molecular targets for the prevention of multidrug resistance and drug-drug interactions. Curr Drug Deliv. 2007 Oct; 4 (4): 324-33
Cinatl J Jr, Cinatl J, Kotchetkov R, Vogel JU, Woodcock BG, Matousek J, Pouckova P, Kornhuber B. Bovine seminal ribonuclease selectively kills human multidrug-resistant neuroblastoma cells via induction of apoptosis. Int J Oncol. 1999 Nov; 15 (5): 1001-9
Kool M, van der Linden M, de Haas M, Scheffer GL, de Vree JM, Smith AJ, Jansen G, Peters GJ, Ponne N, Scheper RJ, Elferink RP, Baas F, Borst P. MRP3, an organic anion transporter able to transport anti-cancer drugs. Proc Natl Acad Sci USA. 1999 Jun 8; 96 (12): 6914-9
Kotchetkov R, Cinatl J, Blaheta R, Vogel JU, Karaskova J, Squire J, Hernáiz Driever P, Klingebiel T, Cinatl J Jr. Development of resistance to vincristine and doxorubicin in neuroblastoma alters malignant properties and induces additional karyotype changes: a preclinical model. Int J Cancer. 2003 Mar 10; 104 (1): 36-43
Kotchetkov R, Driever PH, Cinatl J, Michaelis M, Karaskova J, Blaheta R, Squire JA, Von Deimling A, Moog J, Cinatl J Jr. Increased malignant behavior in neuroblastoma cells with acquired multi-drug resistance does not depend on P-gp expression. Int J Oncol. 2005 Oct; 27 (4): 1029-37
Maris JM, Hogarty MD, Bagatell R, Cohn SL. Neuroblastoma. Lancet. 2007 Jun 23; 369 (9579): 2106-20
Michaelis M, Suhan T, Cinatl J, Driever PH, Cinatl J Jr. Valproic acid and interferon-alpha synergistically inhibit neuroblastoma cell growth in vitro und in vivo. Int J Oncol. 2004 Dec; 25 (6): 1795-9
Michaelis M, Cinatl J, Anand P, Rothweiler F, Kotchetkov R, Deimling A, Doerr HW, Shogen K, Cinatl J Jr. Onconase induces caspase-independent cell death in chemoresistant neuroblastoma cells. Cancer Lett. 2007 May 18; 250 (1): 107-16
Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods. 1983 Dec 16; 65 (1-2): 55-63
Secchiero P, Corallini F, Gonelli A, Dell'Eva R, Vitale M, Capitani S, Albini A, Zauli G. Antiangiogenic activity of the MDM2 antagonist nutlin-3. Circ Res. 2007a Jan 5; 100 (1): 61-9
Secchiero P, Zerbinati C, Melloni B, Milani D, Campioni D, Fadda R, Tiribelli M, Zauli G. The MDM-2 antagonist nutlin-3 promotes the maturation of acute myeloid leukemic blasts. Neoplasia. 2007b Oct; 9 (10): 853-61
Szakács G, Paterson JK, Ludwig JA, Booth-Genthe C, Gottesman MM. Targeting multidrug resistance in cancer. Nat Rev Drug Discov. 2006 Mar; 5 (3): 219-34
Van Maerken T, Speleman F, Vermeulen J, Lambertz I, De Clercq S, De Smet E, Yigit N, Coppens V, Philippé J, De Paepe A, Marine JC, Vandesompele J. Small-molecule MDM2 antagonists as a new therapy concept for neuroblastoma. Cancer Res. 2006 Oct 1; 66 (19): 9646-55
Vassilev LT. MDM2 inhibitors for cancer therapy. Trends Mol Med. 2007 Jan; 13 (1): 23-31
Attorney, Agent or Firm:
BOEHMERT & BOEHMERT (München, 80336)
Claims:
1. Pharmazeutische Zusammensetzung, umfassend mindestens ein oder mehrere ABC-Transporter hemmendes cis-Imidazolin in Kombination mit mindestens einem oder mehreren Zytostatika, wobei das Zytostatikum durch den ABC-Transporter vermittelt aus einer Krebszelle transportiert werden kann.

2. Pharmazeutische Zusammensetzung nach Anspruch 1, wobei das cis-Imidazolin zusammen oder in getrennten Behältern mit dem Zytostatikum vorliegt.

3. Pharmazeutische Zusammensetzung nach Anspruch 1 oder 2, wobei das cis-Imidazolin ausgewählt ist aus den Nutlinen, zum Beispiel Nutlin-2 und/oder Nutlin-3, und chemischen Derivaten davon.

4. Pharmazeutische Zusammensetzung nach einem der Ansprüche 1 bis 3, wobei das cis-Imidazolin ausgewählt ist aus einer Verbindung der allgemeinen Formel (I) worin
X1 ausgewählt ist aus der Gruppe bestehend aus C1-C12 Alkoxy und C1-C12 Alkoxy substituiert mit Trifluormethyl oder Fluor;
X2 ausgewählt ist aus der Gruppe bestehend aus Wasserstoff, Halogen, C1-C12 Alkyl, und -C(X4X5)-X6;
X3 ausgewählt ist aus der Gruppe bestehend aus Wasserstoff, C1-C12 Alkoxy, Halogen und -C(X4X5)-X6 unter der Voraussetzung, dass, wenn X2 Wasserstoff, Halogen oder C1-C12 Alkyl ist, X -C(X4X5)-X6 ist;
X4 und X5 sind C1-C12 Alkyl und können miteinander verbunden sein, um ein Cycloalkyl zu bilden;
X6 ausgewählt ist aus der Gruppe bestehend aus C1-C12 Alkyl, Cyano, -CH2-OH, -CH2-O-C1-C12 Alkyl, -CH2-O-C1-C12 Alkyl substituiert mit C1-C12 Alkoxy, -C(O)X7, und -CH2-NX8X9;
X7 ausgewählt ist aus der Gruppe bestehend aus Hydroxy, C1-C12 Alkoxy, Morpholino und NX8X9;
X8 und X9 unabhängig voneinander ausgewählt sind aus der Gruppe bestehend aus Wasserstoff, C1-C12 Alkyl, C1-C12 Alkyl substituiert mit C1-C12 Alkoxy oder Cyano und C1-C12 Alkoxy;
Y1 und Y2 unabhängig voneinander ausgewählt sind aus der Gruppe bestehend aus Halogen, Cyano und Azetylen;
R ausgewählt ist aus der Gruppe bestehend aus Piperidinyl substituiert, Heterocyclen mit fünf oder sechs Ringatomen, Piperidinyl substituiert mit -NX8X9 und worin n = 1 oder 2 ist,
R1 kann einer oder mehr Substituenten ausgewählt aus der Gruppe bestehend aus Wasserstoff, Oxo, C1-C12 Alkyl substituiert mit R2, -C(O)R3 und -SO2-C1-C12 Alkyl;
R2 ausgewählt ist aus der Gruppe bestehend aus Hydroxy, C1-C12 Alkoxy, Trifluormethyl, -cyano, -NH-SO2-C1-C12 Alkyl, -NH-C(O)-C1-C12 Alkyl, -C(O)-C1-C12 Alkyl, -C(O)R4, -C(O)-NX8X9, -SO2-C1-C12 Alkyl und -SO2-NX8X9,
R3 ausgewählt ist aus der Gruppe bestehend aus Heterocyclen mit fünf Ringatomen, C1-C12 Alkyl, C1-C12 Alkoxy und C1-C12 Alkyl substituiert mit C1-C12 Alkoxy; und
R4 ausgewählt ist aus der Gruppe bestehend aus Hydroxy, C1-C12 Alkoxy, Morpholino und -NX8X9 und wobei die absolute Stereochemie an der 4- und 5-Position des Imidazolinrings jeweils S und R ist,
und Enantiomeren und chemischen Derivaten davon,
und pharmazeutisch akzeptablen Salzen und Ester davon.

5. Pharmazeutische Zusammensetzung nach einem der Ansprüche 1 bis 4, wobei das cis-Imidazolin ausgewählt ist aus einer Verbindung der allgemeinen Formel (II) worin
R5 ausgewählt ist aus H, Oxo, und C1-C6 Alkyl,
R6 ausgewählt ist aus H, Oxo, und C1-C6 Alkyl, gegebenenfalls substituiert mit C1-C6 Alkoxy, Trifluormethyl, -Cyano, -NH-SO2-C1-C6 Alkyl, -NH-C(O)-C1-C6 Alkyl, -C(O)-C1-C6 Alkyl, und -SO2- C1-C6 Alkyl,
R7 ausgewählt ist aus C1-C6 Alkyl, gegebenenfalls substituiert mit Trifluormethyl oder Fluor,
R8 ausgewählt ist aus C1-C6 Alkyl,
und Enantiomeren und chemischen Derivaten davon,
und pharmazeutisch akzeptablen Salzen und Ester davon.

6. Pharmazeutische Zusammensetzung nach einem der Ansprüche 1 bis 5, wobei das Zytostatikum ausgewählt ist aus Vincristin, Doxorubicin, Daunorubicin, Vinblastin, Methotrexat, SN-38, CPT-11, Mitoxantron, Epirubicin, Etoposid, p-Aminohippurat, Ochratoxin, Cisplatin, Sulphinpyrazon, 9-(2-Phosphonylmethoxyethyl)adenin (PMEA), 9-(2-Phosphonylmethoxyethyl)guanin (PMEG), Azidothymidin (AZT), 3'-Azido-3'-desoxythymidin Monophosphat (AZTMP), 3TC, d4T, 6-Thioguanine, 6-Mercaptopurin, Topotecan, 5-HP, ZD1694, GW1843, Methotrexat/Antifolat, Flavopiridol, 5-FU, Lamivudin, Zidovudin, Iressa, Colchicin, Adriamycin, Digoxin, Saquinavir, Paclitaxel, Verapamil, PSC833, GG918, V-104, Cyclosporin A, V-104, Fumitremorgin C, Actinomycin D, Doxetaxel, Irinotecan, Mithramycin, Mitomycin C, Tamoxifen, Tenoposid und Gefitinib.

7. Pharmazeutische Zusammensetzung nach einem der Ansprüche 1 bis 6, wobei der ABC-Transporter ausgewählt ist aus ABCB1, ABCC1, ABCC2, ABCC3, ABCC4, ABCC5 und ABCG2.

8. Pharmazeutische Zusammensetzung nach einem der Ansprüche 1 bis 7, wobei die Krebszelle ein mutiertes oder Wildtyp-p53 Protein umfasst.

9. Pharmazeutische Zusammensetzung nach einem der Ansprüche 1 bis 8, wobei die Krebszelle mindestens einen ABC-Transporter überexprimiert.

10. Verfahren zur Identifizierung von ABC-Transporter inhibierenden Substanzen umfassend die Schritte von
a) in Kontakt bringen einer einen ABC-Transporter exprimierenden Zelle mit mindestens einer den ABC-Transporter potentiell inhibierenden Substanz, zusammen mit mindestens einem durch den ABC-Transporter vermittelt transportierten Zytostatikum, und
b) Messen des Ausstroms und/oder der Ansammlung des mindestens einen ABC-Transporter exportierten-Zytostatikums in Anwesenheit der potentiell inhibierenden Substanz und, gegebenenfalls, der Abwesenheit der potentiell inhibierenden Substanz.

11. Verfahren nach Anspruch 10, wobei die potentiell inhibierende Substanz ausgewählt ist aus einer Verbindung der allgemeinen Formel (I) worin
X1 ausgewählt ist aus der Gruppe bestehend aus C1-C12 Alkoxy und C1-C12 Alkoxy substituiert mit Trifluormethyl oder Fluor;
X2 ausgewählt ist aus der Gruppe bestehend aus Wasserstoff, Halogen, C1-C12 Alkyl, und -C(X4X5)-X6;
X3 ausgewählt ist aus der Gruppe bestehend aus Wasserstoff, C1-C12 Alkoxy, Halogen und -C(X4X5)-X6 unter der Voraussetzung, dass, wenn X2 Wasserstoff, Halogen oder C1-C12 Alkyl ist, X -C(X4X5)-X6 ist;
X4 und X5 sind C1-C12 Alkyl und können miteinander verbunden sein, um ein Cycloalkyl zu bilden;
X6 ausgewählt ist aus der Gruppe bestehend aus C1-C12 Alkyl, Cyano, -CH2-OH, -CH2-O-C1-C12 Alkyl, -CH2-O-C1-C12 Alkyl substituiert mit C1-C12 Alkoxy, -C(O)X7, und -CH2-NX8X9;
X7 ausgewählt ist aus der Gruppe bestehend aus Hydroxy, C1-C12 Alkoxy, Morpholino und NX8X9;
X8 und X9 unabhängig voneinander ausgewählt sind aus der Gruppe bestehend aus Wasserstoff, C1-C12 Alkyl, C1-C12 Alkyl substituiert mit C1-C12 Alkoxy oder Cyano und C1-C12 Alkoxy;
Y1 und Y2 unabhängig voneinander ausgewählt sind aus der Gruppe bestehend aus Halogen, Cyano und Azetylen;
R ausgewählt ist aus der Gruppe bestehend aus Piperidinyl substituiert, Heterocyclen mit fünf oder sechs Ringatomen, Piperidinyl substituiert mit -NX8X9 und worin n = 1 oder 2 ist,
R1 kann einer oder mehr Substituenten ausgewählt aus der Gruppe bestehend aus Wasserstoff, Oxo, C1-C12 Alkyl substituiert mit R2, -C(O)R3 und -SO2-C1-C12 Alkyl;
R2 ausgewählt ist aus der Gruppe bestehend aus Hydroxy, C1-C12 Alkoxy, Trifluormethyl, -cyano, -NH-SO2-C1-C12 Alkyl, -NH-C(O)-C1-C12 Alkyl, -C(O)-C1-C12 Alkyl, -C(O)R4, -C(O)-NX8X9, -SO2-C1-C12 Alkyl und -SO2-NX8X9,
R3 ausgewählt ist aus der Gruppe bestehend aus Heterocyclen mit fünf Ringatomen, C1-C12 Alkyl, C1-C12 Alkoxy und C1-C12 Alkyl substituiert mit C1-C12 Alkoxy; und
R4 ausgewählt ist aus der Gruppe bestehend aus Hydroxy, C1-C12 Alkoxy, Morpholino und -NX8X9 und wobei die absolute Stereochemie an der 4- und 5-Position des Imidazolinrings jeweils S und R ist,
und Enantiomeren und chemischen Derivaten davon,
und pharmazeutisch akzeptablen Salzen und Ester davon.

12. Verfahren nach Anspruch 10 oder 11, wobei die potentiell inhibierende Substanz ausgewählt ist aus einer Verbindung der allgemeinen Formel (II) worin
R5 ausgewählt ist aus H, Oxo, und C1-C6 Alkyl,
R6 ausgewählt ist aus H, Oxo, und C1-C6 Alkyl, gegebenenfalls substituiert mit C1-C6 Alkoxy, Trifluormethyl, -Cyano, -NH-SO2-C1-C6 Alkyl, -NH-C(O)-C1-C6 Alkyl, -C(O)-C1-C6 Alkyl, und -SO2-C1-C6 Alkyl,
R7 ausgewählt ist aus C1-C6 Alkyl, gegebenenfalls substituiert mit Trifluormethyl oder Fluor,
R8 ausgewählt ist aus C1-C6 Alkyl,
und Enantiomeren und chemischen Derivaten davon,
und pharmazeutisch akzeptablen Salzen und Ester davon.

13. Verfahren nach einem der Ansprüche 10 bis 12, wobei das Zytostatikum ausgewählt ist aus Vincristin, Doxorubicin, Daunorubicin, Vinblastin, Methotrexat, SN-38, CPT-11, Mitoxantron, Epirubicin, Etoposid, p-Aminohippurat, Ochratoxin, Cisplatin, Sulphinpyrazon, 9-(2-Phosphonylmethoxyethyl)adenin (PMEA), 9-(2-Phosphonylmethoxyethyl)guanin (PMEG), Azidothymidin (AZT), 3'-Azido-3'-desoxythymidin Monophosphat (AZTMP), 3TC, d4T, 6-Thioguanine, 6-Mercaptopurin, Topotecan, 5-HP, ZD1694, GW1843, Methotrexat/Antifolat, Flavopiridol, 5-FU, Lamivudin, Zidovudin, Iressa, Colchicin, Adriamycin, Digoxin, Saquinavir, Paclitaxel, Verapamil, PSC833, GG918, V-104, Cyclosporin A, V-104, Fumitremorgin C, Actinomycin D, Doxetaxel, Irinotecan, Mitomycin C, Tamoxifen, Tenoposid und Gefitinib.

14. Verfahren nach einem der Ansprüche 10 bis 13, wobei der ABC-Transporter ausgewählt ist aus ABCB1, ABCC1, ABCC2, ABCC3, ABCC4, ABCC5 und ABCG2.

15. Verfahren nach einem der Ansprüche 10 bis 14, wobei die Zelle eine Krebszelle ist, die ein mutiertes oder Wildtyp-P53 Protein umfasst.

16. Verfahren nach Anspruch 15, wobei die Krebszelle mindestens einen ABC-Transporter überexprimiert.

17. Verfahren nach einem der Ansprüche 10 bis 16, wobei die Zelle für den ABC-Transporter rekombinant ist.

18. Verfahren nach einem der Ansprüche 10 bis 17, wobei das Verfahren ein Auswählen der identifizierten Substanz, ein chemisches Derivatisieren und gegebenenfalls Wiederholen des Verfahrens umfasst.

19. ABC-Transporter inhibierende Substanz, identifiziert mit einem Verfahren nach einem der Ansprüche 10 bis 18.

20. Verwendung einer pharmazeutischen Zusammensetzung nach einem der Ansprüche 1 bis 9 oder einer ABC-Transporter inhibierenden Substanz nach Anspruch 19, gegebenenfalls in Kombination mit einem Zytostatikum, zur Behandlung von Krebserkrankungen.

21. Verwendung nach Anspruch 20, wobei die Krebserkrankung Chemoresistenz und/oder Multi-drug Resistenz umfasst.

22. Verwendung nach Anspruch 20 oder 21, wobei an der Krebserkrankung ein mutiertes oder Wildtyp-p53 Protein beteiligt ist.

23. Verwendung nach einem der Ansprüche 20 bis 22, wobei die Krebserkrankung ausgewählt ist aus soliden Tumoren, Brustkrebs, Prostatakarzinom, Neuroblastom, Rhabdomyosarkom und alveolärem Rhabdomyosarkom.

24. Verfahren zur Behandlung einer Krebserkrankung, umfassend Verabreichung einer pharmazeutischen Zusammensetzung nach einem der Ansprüche 1 bis 9 oder einer ABC-Transporter inhibierenden Substanz nach Anspruch 19, gegebenenfalls in Kombination mit einem Zytostatikum.

25. Verfahren nach Anspruch 24, wobei die Krebserkrankung Chemoresistenz und/oder Multi-drug Resistenz umfasst.

26. Verfahren nach Anspruch 24 oder 25, wobei an der Krebserkrankung ein mutiertes oder Wildtyp-P53 Protein beteiligt ist.

27. Verfahren nach einem der Ansprüche 24 bis 26, wobei die Krebserkrankung ausgewählt ist aus soliden Tumoren, Neuroblastom, Rhabdomyosarkom und alveolärem Rhabdomyosarkom.

Description:

Die vorliegende Erfindung betrifft eine pharmazeutische Zusammensetzung, umfassend mindestens ein einen oder mehrere ABC-Transporter hemmendes cis-Imidazolin, insbesondere Nutlin, in Kombination mit mindestens einem oder mehreren Zytostatika, wobei das Zytostatikum durch den ABC-Transporter vermittelt aus einer Krebszelle transportiert werden kann und deren Verwendung bei der Krebsbehandlung sowie verwandte Aspekte.

Beschreibung

Das Protein p53, oft als der „Wächter des Genoms” bezeichnet, ist ein Transkriptionsfaktor, der in Antwort auf zellulären Stress (niedriger Sauerstoffspiegel, Hitzeschock, DNA Beschädigung, usw.) aktiviert wird und so wirkt, um eine weitere Proliferation der gestressten Zelle durch Unterstützung des Anhalten des Zellzyklus oder Apoptose zu verhindern (El-Deiry, W. S. The p53 pathway und cancer therapy. Cancer Journal 11 229–236 (1998); Lane, D. P., Hupp, T. R. Drug discovery und p53. Drug Discovery Today 8 (8) 347–355 (2003)). Seine Rolle als ein Tumorsuppressor wird durch die Beobachtung deutlich, dass ungefähr 50% der menschlichen Tumore mutiertes oder nicht-funktionelles p53 aufweisen. MDM2, ein negativer Schlüsselregulator von p53, der in vielen menschlichen Tumoren überexprimiert wird, funktioniert durch Bindung an und Einbringen von p53 in den proteasomalen Abbau. Nutlin-3 inhibiert die p53-MDM2 Interaktion mit eine IC50 von 0,09 μM. Es induziert die Expression von p53-regulierten Genen und zeigt potente antiproliferative Aktivität in Zellen mit funktionellem p53, jedoch nicht in Zellen mit mutiertem p53. Nutlin-3 inhibiert auch das Wachstum von menschlichen Tumor-Xenografts in Nacktmäusen um 90% bei einer Dosis von 200 mg/kg (Vassilev, L. T., Vu, B. T., Graves, B., et al. In vivo activation of the p53 pathway by small-molecule antagonists of MDM2. Science 303 844–848 (2004)). Somit reguliert Murine double minute 2 (MDM2) die Aktivität des Tumorsuppressorproteins p53 negativ.

Nutlin-3 ist ein MDM2 Inhibitor, der als nicht-genotoxischer Aktivator des p53-Signalwegs für die Krebstherapie präklinisch erforscht wird (Vassilev, 2007) und der auch anti-angiogenetische Effekte bewirkt (Secchiero et al., 2007a).

Obwohl die anti-Krebs Aktivität von Nutlin-3 anfänglich auf Zellen beschränkt schien, die Wildtyp p53 enthalten (Vassilev, 2007), ergaben kürzliche Ergebnisse, dass Nutlin-3 auch die Cytotoxizität von Cisplatin, Carboplatin oder Doxorubicin in p53-negativen und p53-Mutanten menschlichen Tumorzellen erhöht. Der Mechanismus schließt die Inhibierung der E2F1 Bindung an MDM2 und umgekehrt die Induktion der transkriptionellen Aktivierung von freiem E2F1 ein (Ambrosini et al., 2007). Darüber hinaus fördert Nutlin-3 die Reifung von p53-negativen Zellen akuter myeloider Leukämie über die Induktion von E2F1 (Secchiero, 2007b).

Von Nutlin-3 wurde bereits gezeigt, das es Apoptose und/oder neuronale Differenzierung in p53 Wildtyp Neuroblastomzellen induziert (van Maerken et al., 2006). Darüber hinaus erhöhte Nutlin-3 die Sensitivität von Neuroblastom gegenüber der Chemotherapie-induzierten Apoptose (Barbieri et al., 2006). Das Neuroblastom ist der häufigste extracraniale solide Tumor während der Kindheit. Ungefähr die Hälfte aller Fälle tragen ein hohes Risiko für ein Wiederauftreten der Erkrankung, mit Gesamt-Überlebensraten von weniger als 40% trotz intensiver multimodaler Therapie (Maris et al., 2007).

Die Chemotherapie-Resistenz spielt eine signifikante Rolle in Neuroblastom-Patienten mit schlechter Prognose, und neue Therapieoptionen werden dringend benötigt. Das Rhabdomyosarkom ist das häufigste Sarkom in Kinder. Alveolare Rhabdomyosarkome sind durch einen schlechten Ausgang charakterisiert. Das gesamte fünf-Jahre Überleben von Patienten mit metastatischem Rhabdomyosarkom liegt bei lediglich 27%, und neue Behandlungsstrategien sind erforderlich (Breitfeld und Meyer, 2005).

Umfangreiche Untersuchungen sind durchgeführt worden, mit dem Ziel die Entwicklung der MDR in der Tumortherapie zu verhindern. Dabei wurden zahlreiche Inhibitoren der wichtigsten ABC-Transporter entwickelt. Die parallele Gabe von Inhibitoren führte jedoch meistens zu einer erhöhten allgemeinen Toxizität der Zytostatika, da ABC-Transporter wichtige physiologische Bestandteile von Blut-Gewebeschranken sind. So konnten erhöhte ZNS-Nebenwirkungen von Tumortherapeutika mit der Inhibition von an der Blut-Hirnschranke exprimiertem P-gp in Verbindung gebracht werden (Tanigawara Y. Role of P-glycoprotein in drug disposition. Ther Drug Monit. 2000 Feb; 22 (1): 137–40). Dadurch sind Dosislimitierungen der Zytostatika notwendig geworden, die für die Tumorsuppression nicht vorteilhaft waren. Neuere Untersuchungen ergaben jedoch hochspezifische Inhibitoren mit hoher Affinität zu ABCB1, die kaum zu unerwünschten Reaktionen führten oder das Zytostatika-Schema beeinflussten.

Cheok et al. (in Cheok CF, Dey A, Lane DP. Cyclin-dependent kinase inhibitors sensitize tumor cells to nutlin-induced apoptosis: a potent drug combination. Mol Cancer Res. 2007 Nov; 5 (11): 1133–45) zeigen eine Strategie zur nicht-genotoxischen Aktivierung von p53 in Krebs mit Wildtyp p53. Dabei werden Cyclin-abhängige Kinase (CDK) Inhibitoren (z. B. Roscovitin und DRB) in Kombination mit einem „small molecule” Inhibitor der MDM2 Interaktion (nutlin-3a) untersucht. Die Wirkstoffkombination ist dabei additiv bei der Verringerung der Lebensfähigkeit der Zellen und synergistisch bei Apoptose.

US 7,358,335 beschreibt ARF-BP1 als Mediator der p53-abhängigen und unabhängigen Tumorsuppression und dessen Verwendung. Die Inaktivierung von ARF-BP1 in den Tumorzellen mit Wildtyp p53 führt zu einer p53 Stabilisierung und aktiviert p53-vermittelte Apoptose.

Mack et al. (in Mack JT, Brown CB, Tew KD. ABCA2 as a therapeutic target in cancer and nervous system disorders. Expert Opin Ther Targets. 2008 Apr; 12(4): 491–504.) beschreiben den ABCA2 Transporter als Target für die Entwicklung von anti-Krebs Wirkstoffen.

Trotz der oben genannten Verbesserungen im Rahmen der Behandlung von p53-abhängigen und unabhängigen Tumoren bleibt die Behandlung von chemoresistenten Krebserkrankungen problematisch. Es ist daher Aufgabe der vorliegenden Erfindung, die Behandlung solcher Krebserkrankungen zu verbessern.

Erfindungsgemäß wird diese Aufgabe durch das zur Verfügung stellen einer pharmazeutischen Zusammensetzung gelöst, wobei diese mindestens ein einen oder mehrere ABC-Transporter hemmendes cis-Imidazolin in Kombination mit mindestens einem oder mehreren Zytostatika, wobei das Zytostatikum durch den ABC-Transporter vermittelt aus einer Krebszelle transportiert werden kann, umfasst.

US 2005-0288287 beschreibt entsprechende chirale cis-Imidazoline und pharmazeutisch akzeptable Salze und Ester davon, die die Interaktion von MDM2 Protein mit einem p53-ähnlichen Peptid inhibieren und daher eine anti-proliferative Aktivität aufweisen.

Überraschenderweise wurde im Rahmen der Versuche, die die Grundlage für die vorliegende Erfindung darstellen gefunden, dass bestimmte cis-Imidazoline, wie bevorzugt Nutline und insbesondere Nutlin-3 den P-gp-vermittelten Wirkstoffausstrom in Multi-drug resistenten (chemoresistenten) Krebszellen inhibieren können, was einen neuen MDM2-unabhängigen anti-Krebs Mechanismus dieser Substanzen darstellt. Dieser neue Mechanismus eröffnet die Möglichkeit, P-gp-exprimierende, MRP1-exprimierende und möglicherweise weitere ABC-Transporter exprimierende Krebszellen unabhängig von ihrem p53- oder MDM2-Status mit Kombinationen von Substanzen dieser Erfindung (cis-Imidazolinen), bevorzugt ausgewählt aus Nutlinen, und Zytostatika, die in diesen Zellen als ABC-Transportersubstrate alleine unwirksam sind, zu behandeln. Unter Chemoresistenz versteht man die im Vergleich zu einer anderen Zelle verminderte Empfindlichkeit einer Zelle gegenüber einem Zytostatikum.

Bevorzugt ist eine pharmazeutische Zusammensetzung gemäß der vorliegenden Erfindung, wobei das cis-Imidazolin zusammen oder in getrennten Behältern mit dem Zytostatikum vorliegt. Die Darreichungsformen der (beiden) Bestandteile spielen solange keine Rolle, wie die (beiden) Bestandteile am erwünschten Ort der Behandlung (d. h. in dem zu behandelnden Patienten) gemeinsam wirken können.

Die vorliegende Erfindung betrifft somit eine pharmazeutische Zusammensetzung, umfassend mindestens eine erfindungsgemäße Kombination von cis-Imidazolin mit mindestens einem oder mehreren Zytostatika, zusammen mit geeigneten Zusatz- oder Hilfsstoffen. Diese pharmazeutische Zusammensetzung kann dadurch gekennzeichnet sein, dass die Verbindungen in Form einer Depotsubstanz oder als Vorläufer zusammen mit einer geeigneten, pharmazeutisch verträglichen Verdünnungslösung oder Trägersubstanz vorliegen. Als „Vorläufer” werden diejenigen Substanzen bezeichnet, die erst durch den Stoffwechsel in aktive Substanzen umgewandelt werden.

Erfindungsgemäß kann die oben genannte pharmazeutische Zusammensetzung in Form von Tabletten, Dragees, Kapseln, Tropflösungen, Suppositorien, Injektions- oder Infusionszubereitungen zur peroralen, rektalen oder parenteralen Verwendung vorliegen. Solche Darreichungsformen und deren Herstellung sind dem Fachmann bekannt.

Bevorzugt ist weiterhin pharmazeutische Zusammensetzung gemäß der vorliegenden Erfindung, wobei das cis-Imidazolin ausgewählt ist aus den Nutlinen, zum Beispiel Nutlin-2 und/oder Nutlin-3, und chemischen Derivaten davon. US 2005-0288287 beschreibt die Gruppe der entsprechenden Verbindungen und ist hiermit durch Bezugnahme aufgenommen.

Unter einer „chemischen Derivatisierung” soll im Rahmen der vorliegenden Erfindung die gezielte Veränderung von insbesondere reaktiven Seitengruppen eines Moleküls des erfindungsgemäßen Wirkstoffs verstanden werden. Entsprechende Umsetzungen sind dem Fachmann in der pharmazeutischen Chemie bekannt. Als bevorzugte Beispiele können Moleküle, die z. B. eine HOOC- oder OH-Gruppe besitzen über eine Veresterung mit einem Alkohol derivatisiert werden. Die Veresterung erfolgt dabei durch übliche Verfahren, die dem Fachmann geläufig sind. Es ist weiterhin möglich, die HOOC-Gruppe in eine Hydrazidgruppe zu überführen, z. B. durch Umsetzen mit tert.-Alkylcarbazaten und anschließende Spaltung mit Säuren (beschrieben z. B. in DE 196 36 889), und ein eine Hydrazidgruppe aufweisendes Pharmakon mit einem eine Carbonylkomponente enthaltenen Spacer umzusetzen, wie z. B. in DE 196 36 889 A1 beschrieben. Wirkstoffe der vorliegenden Erfindung, die eine H2N-Gruppe besitzen, können z. B. zu Iminderivaten derivatisiert werden. Die Reaktion zu den Iminderivaten erfolgt dabei durch übliche Verfahren, die dem Fachmann geläufig sind. Wirkstoffe der vorliegenden Erfindung, die eine Carbonylkomponente besitzen, können z. B. zu Carboxyhydrazon-, Sulfonylhydrazon-, bzw. Hydrazonderivaten durch übliche Verfahren umgesetzt werden, die dem Fachmann geläufig sind. Es ist weiterhin möglich, eine HO-Gruppe oder eine NH2-Gruppe eines Wirkstoffs in eine Carbonylkomponente zu überführen, z. B. durch Veresterung bzw. Amidbildung mit einer Carbonsäure-tragenden Carbonylkomponente. Die Carbonylkomponente kann des weiteren durch andere chemische Reaktionen eingeführt werden, so z. B. durch eine elektrophile Substitution an einer HO- oder NH2-Gruppe des Wirkstoffs mit einer geeigneten Carbonylkomponente.

Weiter bevorzugt ist dann eine pharmazeutische Zusammensetzung gemäß der vorliegenden Erfindung, bei der das cis-Imidazolin ausgewählt ist aus den Verbindungen der allgemeinen Formel (I) worin
X1 ausgewählt ist aus der Gruppe bestehend aus C1-C12 Alkoxy und C1-C12 Alkoxy substituiert mit Trifluormethyl oder Fluor;
X2 ausgewählt ist aus der Gruppe bestehend aus Wasserstoff, Halogen, C1-C12 Alkyl, und -C(X4X5)-X6;
X3 ausgewählt ist aus der Gruppe bestehend aus Wasserstoff, C1-C12 Alkoxy, Halogen und -C(X4X5)-X6 unter der Voraussetzung, dass, wenn X2 Wasserstoff, Halogen oder C1-C12 Alkyl ist, X -C(X4X5)-X6 ist;
X4 und X5 sind C1-C12 Alkyl und können miteinander verbunden sein, um ein Cycloalkyl zu bilden;
X6 ausgewählt ist aus der Gruppe bestehend aus C1-C12 Alkyl, Cyano, -CH2-OH, -CH2-O-C1-C12 Alkyl, -CH2-O-C1-C12 Alkyl substituiert mit C1-C12 Alkoxy, -C(O)X7, und -CH2-NX8X9;
X7 ausgewählt ist aus der Gruppe bestehend aus Hydroxy, C1-C12 Alkoxy, Morpholino und NX8X9;
X8 und X9 unabhängig voneinander ausgewählt sind aus der Gruppe bestehend aus Wasserstoff, C1-C12 Alkyl, C1-C12 Alkyl substituiert mit C1-C12 Alkoxy oder Cyano und C1-C12 Alkoxy;
Y1 und Y2 unabhängig voneinander ausgewählt sind aus der Gruppe bestehend aus Halogen, Cyano und Azetylen;
R ausgewählt ist aus der Gruppe bestehend aus Piperidinyl substituiert, Heterocyclen mit fünf oder sechs Ringatomen, Piperidinyl substituiert mit -NX8X9 und worin n = 1 oder 2 ist,
R1 kann einer oder mehr Substituenten ausgewählt aus der Gruppe bestehend aus Wasserstoff, Oxo, C1-C12 Alkyl substituiert mit R2, -C(O)R3 und -SO2-C1-C12 Alkyl;
R2 ausgewählt ist aus der Gruppe bestehend aus Hydroxy, C1-C12 Alkoxy, Trifluormethyl, -cyano, -NH-SO2-C1-C12 Alkyl, -NH-C(O)-C1-C12 Alkyl, -C(O)-C1-C12 Alkyl, -C(O)R4, -C(O)-NX8X9, -SO2-C1-C12 Alkyl und -SO2-NX8X9,
R3 ausgewählt ist aus der Gruppe bestehend aus Heterocyclen mit fünf Ringatomen, C1-C12 Alkyl, C1-C12 Alkoxy und C1-C12 Alkyl substituiert mit C1-C12 Alkoxy; und
R4 ausgewählt ist aus der Gruppe bestehend aus Hydroxy, C1-C12 Alkoxy, Morpholino und -NX8X9 und wobei die absolute Stereochemie an der 4- und 5-Position des Imidazolinrings jeweils S und R ist,
und Enantiomeren und chemischen Derivaten davon,
und pharmazeutisch akzeptablen Salzen und Ester davon.

Noch weiter bevorzugt ist dann eine pharmazeutische Zusammensetzung gemäß der vorliegenden Erfindung, bei der das cis-Imidazolin ausgewählt ist aus den Verbindungen der allgemeinen der allgemeinen Formel (II) worin
R5 ausgewählt ist aus H, Oxo, und C1-C6 Alkyl,
R6 ausgewählt ist aus H, Oxo, und C1-C6 Alkyl, gegebenenfalls substituiert mit C1-C6 Alkoxy, Trifluormethyl, -Cyano, -NH-SO2-C1-C6 Alkyl, -NH-C(O)-C1-C6 Alkyl, -C(O)-C1-C6 Alkyl, und -SO2-C1-C6 Alkyl,
R7 ausgewählt ist aus C1-C6 Alkyl, gegebenenfalls substituiert mit Trifluormethyl oder Fluor,
R8 ausgewählt ist aus C1-C6 Alkyl,
und Enantiomeren und chemischen Derivaten davon,
und pharmazeutisch akzeptablen Salzen und Ester davon.

Der zweite wesentliche Bestandteil der pharmazeutischen Zusammensetzung gemäß der vorliegenden Erfindung ist ein Zytostatikum. Erfindungsgemäß ist das Zytostatikum dadurch gekennzeichnet, das es im Rahmen der Resistenzentwicklung einer Krebszelle durch einen ABC-Transporter vermittelt aus einer Krebszelle transportiert wird. Entsprechende, im Rahmen der „Multi-drug” Resistenz dann wirkungslose (oder schlechter wirksame) Zytostatika sind zum Beispiel bevorzugt ausgewählt aus Vincristin, Doxorubicin, Daunorubicin, Vinblastin, Methotrexat, SN-38, CPT-11, Mithramycin, Mitoxantron, Epirubicin, Etoposid, p-Aminohippurat, Ochratoxin, Cisplatin, Sulphinpyrazon, 9-(2-Phosphonylmethoxyethyl)adenin (PMEA), 9-(2-Phosphonylmethoxyethyl)guanin (PMEG), Azidothymidin (AZT), 3'-Azido-3'-desoxythymidin Monophosphat (AZTMP), 3TC, d4T, 6-Thioguanine, 6-Mercaptopurin, Topotecan, 5-HP, ZD1694, GW1843, Methotrexat/Antifolat, Flavopiridol, 5-FU, Lamivudin, Zidovudin, Iressa, Colchicin, Adriamycin, Digoxin, Saquinavir, Paclitaxel, Verapamil, PSC833, GG918, V-104, Cyclosporin A, V-104, Fumitremorgin C, Actinomycin D, Doxetaxel, Irinotecan, Mitomycin C, Tamoxifen, Tenoposid und Gefitinib. Die Effektivität aller dieser Zytostatika kann gemäß der vorliegenden Erfindung verbessert werden (siehe z. B. Calcagno AM, Kim IW, Wu CP, Shukla S, Ambudkar SV. ABC drug transporters as molecular targets for the prevention of multidrug resistance and drug-drug interactions. Curr Drug Deliv. 2007 Oct; 4(4): 324–33).

In einem weiteren Aspekt der vorliegenden Erfindung ist eine pharmazeutische Zusammensetzung gemäß der vorliegenden Erfindung bevorzugt, in welcher der den Wirkstoff transportierende ABC-Transporter ausgewählt ist aus ABCB1, ABCC1, ABCC2, ABCC3, ABCC4, ABCC5 und/oder ABCG2. Weiter bevorzugt ist eine pharmazeutische Zusammensetzung gemäß der vorliegenden Erfindung, wobei die Krebszelle ein mutiertes oder Wildtyp-p53 Protein umfasst. Besonders bevorzugt ist die Verwendung in p53-negativen und p53-Mutanten menschlichen Tumorzellen. Noch weiter bevorzugt ist eine pharmazeutische Zusammensetzung gemäß der vorliegenden Erfindung, wobei die Krebszelle mindestens einen ABC-Transporter überexprimiert. Die Überexpression von ABC-Transporter ist einer der wesentlichen Schritte bei der Entwicklung vieler Multi-drug resistenten Krebserkrankungen.

In einem weiteren Aspekt betrifft die vorliegende Erfindung dann ein Verfahren zur Identifizierung von ABC-Transporter inhibierenden Substanzen, wobei das die Schritte von a) in Kontakt bringen einer einen ABC-Transporter exprimierenden Zelle mit mindestens einer den ABC-Transporter potentiell inhibierenden Substanz, zusammen mit mindestens einem durch den ABC-Transporter vermittelt transportierten Zytostatikum, und b) Messen des Ausstroms und/oder der Ansammlung des mindestens einen ABC-Transporter exportierten Zytostatikums in Anwesenheit der potentiell inhibierenden Substanz und, gegebenenfalls, der Abwesenheit der potentiell inhibierenden Substanz, umfasst. Das Verfahren kann in vitro oder in vivo (z. B. in einem nicht-humanen rekombinanten ABC-Transporter exprimierenden Tiermodell) durchgeführt werden. Bevorzugt sind die potentiell inhibierenden Substanzen erfindungsgemäß ausgewählt aus einer Verbindung der allgemeinen Formel (I) worin X1 ausgewählt ist aus der Gruppe bestehend aus C1-C12 Alkoxy und C1-C12 Alkoxy substituiert mit Trifluormethyl oder Fluor; X2 ausgewählt ist aus der Gruppe bestehend aus Wasserstoff, Halogen, C1-C12 Alkyl, und -C(X4X5)-X6; X3 ausgewählt ist aus der Gruppe bestehend aus Wasserstoff, C1-C12 Alkoxy, Halogen und -C(X4X5)-X6 unter der Voraussetzung, dass, wenn X2 Wasserstoff, Halogen oder C1-C12 Alkyl ist, X -C(X4X5)-X6 ist; X4 und X5 sind C1-C12 Alkyl und können miteinander verbunden sein, um ein Cycloalkyl zu bilden; X6 ausgewählt ist aus der Gruppe bestehend aus C1-C12 Alkyl, Cyano, -CH2-OH, -CH2-O-C1-C12 Alkyl, -CH2-O-C1-C12 Alkyl substituiert mit C1-C12 Alkoxy, -C(O)X7, und -CH2-NX8X9; X7 ausgewählt ist aus der Gruppe bestehend aus Hydroxy, C1-C12 Alkoxy, Morpholino und NX8X9; X8 und X9 unabhängig voneinander ausgewählt sind aus der Gruppe bestehend aus Wasserstoff, C1-C12 Alkyl, C1-C12 Alkyl substituiert mit C1-C12 Alkoxy oder Cyano und C1-C12 Alkoxy; Y1 und Y2 unabhängig voneinander ausgewählt sind aus der Gruppe bestehend aus Halogen, Cyano und Azetylen; R ausgewählt ist aus der Gruppe bestehend aus Piperidinyl substituiert, Heterocyclen mit fünf oder sechs Ringatomen, Piperidinyl substituiert mit -NX8X9 und worin n = 1 oder 2 ist, R1 kann einer oder mehr Substituenten ausgewählt aus der Gruppe bestehend aus Wasserstoff, Oxo, C1-C12 Alkyl substituiert mit R2, -C(O)R3 und -SO2-C1-C12 Alkyl; R2 ausgewählt ist aus der Gruppe bestehend aus Hydroxy, C1-C12 Alkoxy, Trifluormethyl, -cyano, -NH-SO2-C1-C12 Alkyl, -NH-C(O)-C1-C12 Alkyl, -C(O)-C1-C12 Alkyl, -C(O)R4, -C(O)-NX8X9, -SO2-C1-C12 Alkyl und -SO2-NX8X9, R3 ausgewählt ist aus der Gruppe bestehend aus Heterocyclen mit fünf Ringatomen, C1-C12 Alkyl, C1-C12 Alkoxy und C1-C12 Alkyl substituiert mit C1-C12 Alkoxy; und R4 ausgewählt ist aus der Gruppe bestehend aus Hydroxy, C1-C12 Alkoxy, Morpholino und -NX8X9 und wobei die absolute Stereochemie an der 4- und 5-Position des Imidazolinrings jeweils S und R ist, und Enantiomeren und chemischen Derivaten davon, und pharmazeutisch akzeptablen Salzen und Ester davon.

Weiter bevorzugt sind die potentiell inhibierenden Substanzen erfindungsgemäß ausgewählt aus einer Verbindung der allgemeinen Formel (II) worin R5 ausgewählt ist aus H, Oxo, und C1-C6 Alkyl, R6 ausgewählt ist aus H, Oxo, und C1-C6 Alkyl, gegebenenfalls substituiert mit C1-C6 Alkoxy, Trifluormethyl, -Cyano, -NH-SO2-C1-C6 Alkyl, -NH-C(O)-C1-C6 Alkyl, -C(O)-C1-C6 Alkyl, und -SO2-C1-C6 Alkyl, R7 ausgewählt ist aus C1-C6 Alkyl, gegebenenfalls substituiert mit Trifluormethyl oder Fluor, R8 ausgewählt ist aus C1-C6 Alkyl, und Enantiomeren und chemischen Derivaten davon, und pharmazeutisch akzeptablen Salzen und Ester davon.

Der zweite wesentliche Bestandteil im Screeningverfahren gemäß der vorliegenden Erfindung ist ein Zytostatikum. Erfindungsgemäß ist das Zytostatikum dadurch gekennzeichnet, das es in Rahmen der Resistenzentwicklung einer Krebszelle durch einen ABC-Transporter vermittelt aus einer Krebszelle transportiert wird. Entsprechende Zytostatika sind zum Beispiel bevorzugt ausgewählt aus Vincristin, Doxorubicin, Daunorubicin, Vinblastin, Methotrexat, SN-38, CPT-11, Mitoxantron, Epirubicin, Etoposid, p-Aminohippurat, Ochratoxin, Cisplatin, Sulphinpyrazon, 9-(2-Phosphonylmethoxyethyl)adenin (PMEA), 9-(2-Phosphonylmethoxyethyl)guanin (PMEG), Azidothymidin (AZT), 3'-Azido-3'-desoxythymidin Monophosphat (AZTMP), 3TC, d4T, 6-Thioguanine, 6-Mercaptopurin, Topotecan, 5-HP, ZD1694, GW1843, Methotrexat/Antifolat, Flavopiridol, 5-FU, Lamivudin, Zidovudin, Iressa, Colchicin, Adriamycin, Digoxin, Saquinavir, Paclitaxel, Verapamil, PSC833, GG918, V-104, Cyclosporin A, V-104, Fumitremorgin C, Actinomycin D, Doxetaxel, Irinotecan, Mitomycin C, Tamoxifen, Tenoposid und Gefitinib.

Die beiden Bestandteile werden dann erfindungsgemäß mit einer einen ABC-Transporter exprimierenden Zelle in Kontakt gebracht. Bevorzugt ist ein Verfahren gemäß der vorliegenden Erfindung, wobei der ABC-Transporter ausgewählt ist aus ABCB1 (MDR1/P-gp), ABCC1, ABCC2 (MRP2), ABCC3, ABCC4, ABCC5 und ABCG2 (BCRP). Weiter bevorzugt ist ein erfindungsgemäßes Verfahren, wobei die Zelle eine Krebszelle ist, die ein mutiertes oder Wildtyp-p53 Protein umfasst. Besonders bevorzugt ist ein Screening in p53-negativen und p53-Mutanten menschlichen Tumorzellen. UKF-NB-3-Zellen und UKF-NB-3rDOX20Zellen exprimieren Wildtype p53, während UKF-NB-3rVCR10(C135F), UKF-NB-4(C175F), und Be(2)-C(C135F)-Zellen p53-Mutationen aufweisen. Noch weiter bevorzugt ist ein Verfahren gemäß der vorliegenden Erfindung, wobei die Krebszelle mindestens einen ABC-Transporter überexprimiert. Die Überexpression von ABC-Transporter ist einer der wesentlichen Schritte bei der Entwicklung vieler Multi-drug resistenten Krebserkrankungen.

Weiter bevorzugt ist ein erfindungsgemäßes Verfahren, wobei die Zelle für den ABC-Transporter rekombinant ist. Verfahren zur Herstellung solcher rekombinanten Zellen sind dem Fachmann bekannt. Bevorzugte Beispiele sind Zellen auf Basis von UKF-NB-3 oder UKF-Rhb-1 (siehe Beispiele).

Das oben genannte Verfahren umfasst weiterhin das Messen des Ausstroms und/oder der Ansammlung des mindestens einen ABC-Transporter exportierten-Zytostatikums in Anwesenheit der potentiell inhibierenden Substanz und, gegebenenfalls, der Abwesenheit der potentiell inhibierenden Substanz. Beispiele für geeignete Zytostatika sind Rhodamin 123, JC-1 und Calcein-AM. Bevorzugt ist weiter, dass das Zytostatikum markiert ist, so dass der Ausstrom leicht gemessen werden kann. Dazu können alle, die Wirkung und den Ausstrom des Zytostatikums bevorzugt nicht oder nur wenig behindernden Marker verwendet werden, wie zum Beispiel Fluoreszenzmarker oder radioaktive Markierungen. Der Ausstrom kann dabei chromatographisch, photometrisch, fluorometrisch (z. B. per FACS) oder über einen Antikörper gemessen werden. Gegebenenfalls kann bevorzugt zur Erzeugung eines Vergleichswertes der Ausstrom auch in Abwesenheit der potentiell inhibierenden Substanz vorgenommen werden.

Gemäß einem weiteren bevorzugten Aspekt des erfindungsgemäßen Verfahrens wird dann in einem weiteren Schritt die identifizierte Substanz ausgewählt und chemisch derivatisiert (siehe oben) und, gegebenenfalls, das Verfahren wiederholt. In mehreren Selektionsrunden kann die identifizierte Substanz so in ihrer Aktivität verbessert werden, d. h. den Ausstrom noch besser inhibieren.

Ein weiterer bevorzugter Aspekt der Erfindung betrifft dann eine ABC-Transporter inhibierende Substanz, identifiziert mit einem erfindungsgemäßen Verfahren. Optimalerweise wird diese Substanz zusammen mit dem entsprechenden Zytostatikum gemeinsam entwickelt, um als Kombination in einer pharmazeutischen Zusammensetzung gemäß der Erfindung angewendet zu werden.

Ein weiterer bevorzugter Aspekt der Erfindung betrifft dann die Verwendung einer pharmazeutischen Zusammensetzung gemäß der vorliegenden Erfindung oder einer ABC-Transporter inhibierenden Substanz gemäß der vorliegenden Erfindung, gegebenenfalls in Kombination mit einem Zytostatikum, zur Behandlung von proliferativen Erkrankungen, insbesondere bevorzugt von Krebserkrankungen. Bevorzugt ist eine Verwendung gemäß der vorliegenden Erfindung, wobei die Krebserkrankung Chemoresistenz und/oder Multi-drug Resistenz umfasst, wobei diese bevorzugt ABC-Transporter-vermittelt sind. Weiter bevorzugt ist eine Verwendung gemäß der vorliegenden Erfindung, wobei an der Krebserkrankung ein mutiertes oder Wildtyp-p53 Protein beteiligt ist. Die Verwendung kann zum Beispiel zusammen mit einer geeigneten, pharmazeutisch verträglichen Verdünnungslösung oder Trägersubstanz erfolgen.

Beispiele für entsprechende Krebserkrankungen im Rahmen der vorliegenden Erfindung sind ausgewählt ist aus soliden Tumoren, Brustkrebs, Neuroblastom, Rhabdomyosarkom und alveolärem Rhabdomyosarkom, insbesondere bei Kinder und Jugendlichen, sowie Prostatakarzinome.

Ein noch weiterer bevorzugter Aspekt der Erfindung betrifft dann ein Verfahren zur Behandlung einer Krebserkrankung, umfassend Verabreichung einer pharmazeutischen Zusammensetzung gemäß der vorliegenden Erfindung oder einer ABC-Transporter inhibierenden Substanz gemäß der vorliegenden Erfindung, gegebenenfalls in Kombination mit einem Zytostatikum. Bevorzugt ist eine Behandlung gemäß der vorliegenden Erfindung, wobei die Krebserkrankung Chemoresistenz und/oder Multi-drug Resistenz umfasst, wobei diese bevorzugt ABC-Transporter-vermittelt sind. Weiter bevorzugt ist eine Behandlung gemäß der vorliegenden Erfindung, wobei an der Krebserkrankung ein mutiertes oder Wildtyp-p53 Protein beteiligt ist. Auch hier sind Beispiele für entsprechende Krebserkrankungen ausgewählt aus soliden Tumoren, Brustkrebs, Neuroblastom, Rhabdomyosarkom und alveolärem Rhabdomyosarkom, insbesondere bei Kinder und Jugendlichen, sowie Prostatakarzinome.

Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung einer oder mehrerer der erfindungsgemäßen Verbindung(en) Herstellung eines Medikaments zur Behandlung von zur Behandlung von proliferativen Erkrankungen, und bevorzugt Krebserkrankungen. Diese Herstellung und Anwendung kann analog zu den oben beschriebenen Weisen erfolgen.

Obwohl der breite Bereich von anti-Krebs Wirkstoffen, die eine verbesserte Aktivität in Kombination mit Nutlin 3 zeigten, und die Inhibierung des Rhodamin 123 Ausstroms eine zentrale Rolle of P-gp anzeigen, kann die Interferenz mit anderen ABC Transportern mit den vorliegenden Daten nicht unbedingt ausgeschlossen werden. Eine weitere systematische Analyse des Einflusses von Nutlin-3 auf die Aktivität of ABC Transporter wird gerade durchgeführt. Darüber hinaus ist Nutlin-3 ein Razemat, wobei Nutlin-3a dasjenige Enantiomer ist, das als MDM2 Antagonist wirkt, während Mutlin-3b MDM2 nicht beeinträchtigt (Vassilev, 2007). Da die Überexpression of ABC Transporter zu den wichtigsten Chemoresistenzmechanismen zählt, können Nutline und insbesondere Nutlin-3 als eine neue Lead-Struktur für das Design von ABC Transporter Inhibitoren dienen.

Die Erfindung soll nun in den folgenden Beispielen unter Bezugnahme auf die beigefügten Figuren und das Sequenzprotokoll weiter beschrieben werden, ohne jedoch auf die Beispiele beschränkt zu werden. Für die Zwecke der Erfindung sind alle hier zitierten Publikationen durch Bezugnahme aufgenommen.

Legenden für Figuren

1. Einfluss von Nutlin-3 auf die chemosensitiven p53-Wildtyp (UKF-NB-3) oder Vincristin-resistenten, p53-mutierten, P-Glycoprotein-überexprimierenden (UKF-NB-3rVCR10) Neuroblastom- und chemosensitiven, p53-Wildtyp (UKF-Rhb-1) oder Vincristin-resistenten, p53-mutierten, P-Glycoprotein-überexprimierenden (UKF-Rhb-1rVCR10) Rhabdomyosarcomzellen. A) Zell-Lebensfähigkeit relativ zur nicht-behandelten Kontrolle von Nutlin-3-behandelten UKF-NB-3 (•), UKF-NB-3rVCR10 (), UKF-Rhb-1 () oder UKF-Rhb-1rVCR10 () Zellen bestimmt durch den MTT Assay nach 96 h Inkubation; B) Expression der p53 Zielgene p21, MDM2 und GADD45 (GADD) in Nutlin-3 (20 μM)-behandelten UKF-NB-3 oder UKF-NB-3rVCR10 Zellen nach 8 h, nachgewiesen durch real-time PCR; C) Expression der p53 Zielgene p21, MDM2 und GADD45 (GADD) in Nutlin-3 (20 μM)-behandelten UKF-Rhb-1 oder UKF-Rhb-1rVCR10 Zellen nach 8 h, nachgewiesen durch real-time PCR; D) Repräsentative Photographien, die die Effekte von Vincristin, Nutlin-3 oder deren Kombination auf UKF-NB-3rVCR10 oder UKF-Rhb-1rVCR10 Zellen zeigen. * P < 0,05 verglichen mit nicht-behandelten Kontrollen.

2. Einfluss von Nutlin-3 auf die Vincristin Cytotoxizität und Rhodamin Ansammlung in Krebszellen. A) Lebensfähigkeit von chemosensitiven, p53-Wildtyp (UKF-NB-3) oder Vincristin-resistenten, p53-mutierten, P-Glycoprotein-überexprimierenden (UKF-NB-3rVCR10) Neuroblastomzellen, behandelt mit Vincristin (VCR), Nutlin-3 oder Kombinationen von VCR und Nutlin-3; B) Lebensfähigkeit von chemosensitiven, p53-Wildtyp (UKF-Rhb-1) oder Vincristin-resistenten, p53-mutierten, P-Glycoprotein-überexprimierenden (UKF-Rhb-1rVCR10) Rhabdomyosarcomzellen, behandelt mit Vincristin (VCR), Nutlin-3 oder Kombinationen von VCR und Nutlin-3; C) Repräsentative Photographien, die die Rhodamin 123 Fluoreszenz in p53-Wildtyp (UKF-NB-3) oder Vincristin-resistenten, p53-mutierten, P-Glycoprotein-überexprimierenden (UKF-NB-3rVCR10) Neuroblastomzellen; Rhodamin Fluoreszenz in p53-Wildtyp (UKF-NB-3) oder Vincristin-resistenten, p53-mutierten, P-Glycoprotein-überexprimierenden (UKF-NB-3rVCR10) Neuroblastomzellen zeigen, bestimmt durch Durchflusszytometrie. n. d. = keine lebensfähigen Zellen nachweisbar; * P < 0,05 verglichen mit nicht-behandelter Kontrolle; # P < 0,05 verglichen mit jeder einzelnen Behandlung

3. Einfluss of Nutlin-3 auf die zelluläre Ansammlung von ABC Transportersubstrat. A) Konzentrations-abhängiger Effekt von Nutlin auf Rhodamin (0,5 μM). Ansammlung in p53-mutierten, P-Glycoprotein-überexprimierenden (UKF-NB-3rVCR10) Neuroblastomzellen; B) Repräsentative Durchflusszytometrie-Experimente, die die Rhodamin 123 (2 μM) oder Calcein-AM (2 μM) Ansammlung in MDCKII Zellen, MDCKII Zellen, stabil transfiziert mit MDR-1, das für P-Glycoprotein (MDCKII MDR1) kodiert, oder MDCKII Zellen, stabil transfiziert mit MRP-1 (MDCKII MRP1), ohne (weiße Peaks) oder mit (schwarze Peaks) Nutlin-3 (20 μM) Behandlung; zeigen C) Rhodamin (2 μM) Ansammlung in MDCKII, MDCKII MDR1, oder MDCKII MRP1 Zellen ohne oder mit Nutlin-3 (20 μM) Behandlung, bestimmt durch Durchflusszytometrie; D) Calcein-AM (2 μM) Ansammlung in MDCKII, MDCKII MDR1, oder MDCKII MRP1 Zellen, ohne oder mit Nutlin-3 (20 μM) Behandlung, bestimmt durch Durchflusszytometrie. * P < 0,05 verglichen mit nicht-behandelter Kontrolle.

Materialien und MethodenZelllinien

Die Neuroblastomzelllinien UKF-NB-4 und UKF-NB-3 sowie die Sublinien adaptiert an Doxorubicin (20 ng/ml) (UKF-NB-3rDOX20) oder Vincristin (10 ng/ml) (UKF-NB-3rVCR10) wurden wie beschrieben etabliert (8,9). Be(2)-C-Zellen wurden von ATCC (Manassass, VA, USA) bezogen. Die alveoläre Rhabdomyosarkomzelllinie UKF-Rhb-1 wurde in unserem Labor aus einer Knochenmarksmetastase etabliert. Die alveoläre Rhabdomyosarkomzelllinie Rh30 wurde von Dr. P. J. Houghton (St. Jude’s Children’s Research Hospital, Memphis, Tennessee) zur Verfügung gestellt. Die Vincristin-resistenten Rhabdomyosarkomzelllinien UKF-Rhb-1rVCR10 und Rh30rVCR10 wurden durch Adaptation von UKF-Rhb-1 bzw. Rh30 an das Wachstum in Gegenwart von 10 ng/ml etabliert.

UKF-NB-3-Zellen und UKF-NB-3rDOX20Zellen exprimieren Wildtype p53, während UKF-NB-3rVCR10(C135F), UKF-NB-4(C175F), und Be(2)-C(C135F)-Zellen p53-Mutationen aufweisen (Kotchetkov et al., 2005; Michaelis et al., 2007). UKF-NB-3-Zellen exprimieren keine erhöhten P-gp-Mengen, während alle anderen Neuroblastomazellen eine hohe P-gp-Expression zeigen (Kotchetkov et al., 2005; Michaelis et al., 2007). Die Untersuchung des p53-Status von UKF-Rhb-1 und UKF-Rhb-1rVCR10 ergab, dass parenterale UKF-Rhb-1-Zellen Wildtype-p53 exprimieren und UKF-Rhb-1rVCR10-Zellen eine p53-Mutation aufweisen (K291X). UKF-Rhb-1-Zellen zeigen keine P-gp-Expression, UKF-Rhb-1rVCR10-Zellen eine hohe P-gp-Expression (Daten nicht gezeigt). Rh30 hat eine p53-Mutation (R273C) (12) aber keine P-gp-Expression. Rh30rVCR10 zeigt eine hohe P-gp-Expression.

Die Zelllinien MDCKII MDR1 (Bakos et al., 1998), MDCKII MRP1 (Bakos et al., 1998), MDCKII MRP3 (Kool et al., 1999), und die nicht-transfizierte Kontrollzelllinie MDCKII wurden von Dr. P. Borst, Dr. M. de Haas, und Dr. A. H. Schinkel (Nederlands Kanker Instituut, NKI, Amsterdam, Niederlande) zur Verfügung gestellt. P53-negative, P-gp-negative PC-3 Prostatakrebszellen, die kein MRP-1 exprimieren, wurden von ATCC (Manassass, VA, USA) bezogen. Die Adaptation von PC-3 an Vincristin 10 ng/ml resultierte in einer Zelllinie (PC-3rVCR10), die MRP-1-Überexpression jedoch keine P-gp-Expression zeigte.

Alle Zelllinien wurden in IMDM, ergänzt mit 10% FBS, 100 IU/ml Penicillin und 100 mg/ml Streptomycin bei 37°C kultiviert.

Mutationsanalyse von p53

Das TP53-Gen wurde mit cDNAs mit den folgenden Primerpaaren sequenziert: TP53 Ex2-3-f GTGACACGCTTCCCTGGAT (SEQ ID No. 1) und TP53 Ex2-3-r TCATCTGGACCTGGGTCTTC (SEQ ID No. 2); TP53 Ex4-5-f CCCTTCCCAGAAAACCTACC (SEQ ID No. 3) und TP53 Ex4-5-r CTCCGTCATGTGCTGTGACT (SEQ ID No. 4); TP53 EX6-7f GTGCAGCTGTGGGTTGATT (SEQ ID No. 5) und TP53 Ex6-7r GGTGGTACAGTCAGAGCCAAC (SEQ ID No. 6); Tp53 Ex8-9-f CCTCACCATCATCACACTGG (SEQ ID No. 7) und TP53 Ex8-9-r GTCTGGTCCTGAAGGGTGAA (SEQ ID No. 8). Darüber hinaus wurden die Zelllinien auf TP53-Mutationen mittels Sequenzanalyse genomischer DNA wie beschrieben untersucht. Die PCR wurde wie beschrieben durchgeführt. Jedes Amplikon wurde bidirektional sequenziert.

Die P53 cDNA wurde durch Amplifizieren von vier überlappenden Polymerase Kettenreaktions-(PCR)Fragmenten sequenziert, die die gesamte kodierende Sequenz abdeckten. Die Primersequenzen und Fragmentgrößen waren:
GACACGCTTCCCTGGATTGGC (SEQ ID No. 9) und GCAAAACATCTTGTTCAGGGC (SEQ ID No. 10), 452 bp;
GTTTCCGTCTGGGCTTCTTGC (SEQ ID No. 11) und GGTACAGTCAGAGCCAACCTC (SEQ ID No. 12), 367 bp;
TGGCCCCTCCTCAGCATCTTA (SEQ ID No. 13) und CAAGGCCTCATTCAGCTCTC (SEQ ID No. 14), 481 bp;
CGGCGCACAGAGGAAGAGAATC (SEQ ID No. 15) und
CGCACACTTATTGCAAGCAAGGG (SEQ ID No. 16), 444 bp.

Die Amplifikationsprodukte wurden gereinigt, und 25 ng des sauberen Produkts wurden Zyklus-Sequenzierung unter der Verwendung des BigDye Terminator v1.1 Cycle Sequencing Kits (Applied Biosystems, Foster City, CA, USA) unterzogen.

Wirkstoffe

Lösungen von Vincristin (Sigma-Aldrich, Deisenhofen, Germany) und Doxorubicin (Cell Pharm, Hannover, Germany) wurden nach den Herstellerangaben hergestellt. Nutlin-3, Rhodamin 123, Calcein-AM und JC-1 wurden von Merck Biosciences (Darmstadt, Germany) bezogen.

Zelllebensfähigkeitstests

Die Zelllebensfähigkeit wurde mit Hilfe des 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromid(MTT)-Assays nach 96 h-Inkubation (Mosmann, 1983) wie beschrieben (Michaelis et al., 2004) gemessen.

Real-time PCR

Die Gesamt-DNA wurde mit TRI-Reagenz (Sigma-Aldrich, Munich, Germany) isoliert. Die reverse Transkription und die Real-time PCR wurden wie beschrieben durchgeführt. Die folgenden Primer-Sequencen wurden verwendet:
18s rRNA forward 5'-GTG AAA CTG CGA ATG GCT CAT (SEQ ID No. 17),
18s rRNA reverse 5'-CTG ACC GGG TTG GTT TTG AT (SEQ ID No. 18),
18s rRNA probe 5'-(VIC) TGG TCG CTC CTC TCC CAC – (TAMPA) (SEQ ID No. 19),
MDM2 forward 5'-TGT TGG TGC ACA AAA AGA CA (SEQ ID No. 20),
MDM2 reverse 5'-CAC GCC AAA CAA ATC TCC TA (SEQ ID No. 21),
p21 forward 5'-GCC CGT GAG CGA TGG AA (SEQ ID No. 22),
p21 reverse 5'-ACG CTC CCA GGC GAA GTC (SEQ ID No. 23),
GADD45 forward 5'-GCA CGC CGC GCT CTC T (SEQ ID No. 24),
GADD45 reverse CTT ATC CAT CCT TTC GGT CTT CTG (SEQ ID No. 25).

Die Ergebnisse sind als relative Veränderungen dargestellt. Die relative Quantifizierung wurde mit der SDS2.1 Software (Applied Biosystems) bestimmt, die auf dem ABI PRISM 7900HT zur Verfügung gestellt wurde. Eine Normalisierung wurde unter der Verwendung von 18S rRNA als endogene Kontrolle erhalten. Die Ergebnisse sind als -fache Veränderung angegeben.

Durchflusszytometrie und Untersuchung des Ausstroms von ABC-Transportersubstraten

Die Expression der ABC-Transporter P-gp (Alexis Biochemicals via AXXORA Deutschland, Lörrach, Germany), MRP-1 (Kamiya Biomedical Company, Seattle, WA, USA), MRP-3 (ABCC3, Kamiya Biomedical Company, Seattle, WA, USA), und Brustkrebs Resistenzprotein (BCRP/ABCG2, Kamiya Biomedical Company, Seattle, WA, USA) wurde durchflusszytometrisch unter Verwendung der Antikörper nach den Herstellerangaben durchgeführt.

Um den ABC-Transporter-vermittelten Ausstrom zu messen, wurden die Zellen mit Rhodamin 123 (0.1 μM, P-gp, MRPs), JC-1 (0.1 μM, P-gp), oder Clcein-AM (2 μM, MRPs) für 60 min inkubiert. Dann wurden die Zellen mit PBS gewaschen und für 60 min inkubiert, um den Substanzausstrom zu ermöglichen. Anschließend wurden die Zellen im Durchflusszytometer untersucht (FACSCalibur, Becton Dickinson, Heidelberg, Germany). Rhodamin 123 wurde auf dem Fl1-Kanal gemessen, JC-1 und Calcein-AM auf dem FL2-Kanal.

Daher wurde im Rahmen der Erfindung der Einfluss von Nutlin-3 auf chemoresistente Neuroblastom- und Rhabdomyosarkom-Zellen allein oder in Kombination mit cytotoxischen Wirkstoffen untersucht. Da von Nutlin-3 gezeigt wurde, dass es anti-Krebs Effekte bewirkt, die von der MDM2 Inhibierung unabhängig sind, wurden p53-mutierte Zellen mit eingeschlossen. Das überraschendste Ergebnis dabei war, dass Nutlin-3 als ein potenter Inhibitor der ATP-Bindungskassetten (ABC) Transporter P-Glykoprotein wirkt und daher eine neue Klasse von ABC Transporter-Inhibitoren definiert.

ErgebnisseEinfluss von Nutlin-3 auf die Lebensfähigkeit von Krebszellen

Die Nutlin-3 Sensitivität unterscheidet sich zwischen p53 Wildtyp und p53 mutierten Zellen deutlich (Tabelle 1; 1A). Die p53 Wildtyp Zellen zeigten IC50 Werte < 3 μM. Die p53-mutierten Zellen haben IC50 Werte > 17 μM. In Übereinstimmung damit induzierte die Nutlin-3 Behandlung die Expression of p53 Zielgenen (p21, MDM2, GADD45) in p53 Wildtyp Zellen, jedoch nicht in p53-mutierten Zellen wie für UKF-NB-3, UKF-NB-3rVCR10, UKF-Rhb-1, und UKF-Rhb-1rVCR10 Zellen mittels real-time PCR in 1B und C gezeigt ist.

Effizienz von Nutlin-3 in Kombination mit anti-Krebs Wirkstoffen

Von Nutlin-3 wurde bereits gezeigt, dass es die cytotoxische Aktivität von anti-Krebs Wirkstoffen verstärkt (Vassilev et al., 2007). Die Erfinder untersuchten zuerst die Kombination von Nutlin-3 und Vincristin in UKF-NB-3 und in UKF-NB-3rVCR10 Zellen. In UKF-NB-3 Zellen induzierten Nutlin-3 und Vincristin eine additive Cytotoxizität (2A). Überraschenderweise und in scharfem Gegensatz zu den mit UKF-NB-3 erhaltenen Ergebnissen, erhöhten Nutlin dramatisch die Vincristin Sensitivität dieser Zellen in Konzentrationen, die für UKF-NB-3rVCR10 Zellen nicht-toxisch waren (2A). Die Kombination of Nutlin-3 und Vincristin in Konzentrationen, die allein die Lebensfähigkeit der UKF-NB-3rVCR10 Zellen nicht beeinträchtigten (Nutlin-3 20 μM, Vincristin 1,6 ng/ml) verursachten, die vollständige Zerstörung aller UKF-NB-3rVCR10 Zellen. Ähnliche Ergebnisse wurden für den Vergleich von UKF-Rhb-1 Zellen (p53 Wildtyp, geringe P-gp Expression) und UKF-Rhb-1rVCR10 Zellen (2B) erhalten. Die Untersuchung von weiteren Zelllinien ergab, dass nicht-toxische oder moderat toxische Nutlin-3 Konzentration die IC50 Konzentration von Vincristin in p53 Wildtyp und P-gp negativen Zellen leicht erhöhten (< 2-fach; UKF-NB-3, UKF-Rhb-1), jedoch die IC50 Konzentrationen von Vincristin in p53-mutierten und P-gp positiven Zellen massiv abnehmen ließen (92 bis 3434-fach; UKF-NB-3rVCR10, UKF-Rhb-1rVCR10, UKF-NB-4; Be(2)-C) (Tabelle 1). Das lässt vermuten, dass Nutlin-3 möglicherweise den P-gp-vermittelten Vincristin Ausstrom inhibiert. In der p53 Wildtyp- und P-gp überexprimierenden Zelllinie UKF-NB-3rDOX20, wurde die IC50 Konzentration für Vincristin durch Nutlin-3 (1 μM) 28,9-fach verringert (Tabelle 1). Der verringerte Effekt auf die Vincristin Sensitivität, verglichen mit anderen P-gp-überexprimierenden Zelllinien kann vielleicht durch die relativ geringe Nutlin-3 Konzentration erklärt werden, die aufgrund der höheren Nutlin-3 Sensitivität dieser p53 Wildtyp Zelllinie angewendet werden musste.

Um weiter zu untersuchen, ob Nutlin-3 Krebszellen gegenüber anti-Krebs Wirkstoffen durch Interferenz mit P-gp-vermitteltem Wirkstoff-Ausstrom sensitiver macht, wurden UKF-NB-3rVCR10 oder UKF-Rhb-1rVCR10 Zellen mit Nutlin-3 in Kombination mit einer Zahl von zusätzlichen cytotoxischen Wirkstoffen mit verschiedenen cytotoxischen Wirkweisen behandelt. Die Nutlin-3 Behandlung erhöhte die Sensitivität von UKF-NB-3rVCR10 und UKF-Rhb-1rVCR10 Zellen gegenüber den strukturell nicht-verwandten P-gp Substraten Doxorubicin, Paclitaxel, Etoposid, Mitoxantron und Actinomycin D deutlich, beeinträchtigt jedoch die Sensitivität gegen Cisplatin, das als ein P-gp Substrat bekannt ist, nicht signifikant.

Einfluss von Nutlin auf den ABC-Transporter-vermittelten Ausstrom von Fluoreszenz-Substraten

Um den Einfluss von Nutlin-3 auf den P-gp-vermittelten Substanzausstrom zu untersuchen, wurde dessen Einfluss auf den Ausstrom des fluoreszierenden P-gp Substrats Rhodamin 123 gemessen. Die Rhodamin 123 Fluoreszenz wurde in P-gp-negativen UKF-NB-3 Zellen, jedoch nicht in P-gp-überexprimierenden UKF-NB-3rVCR10 Zellen (2C, D) nachgewiesen. Die Nutlin-3 Behandlung induzierte eine Ansammlung von Rhodamin 123 in UKF-NB-3rVCR10 Zellen (2C, D) in einer Konzentrations-abhängigen Weise (3A). Diese Effekte waren ähnlich zu denjenigen, die durch den bekannten P-gp Ausstrom-Inhibitor Verapamil induziert (2D) werden. Die Untersuchung des P-gp Substrats JC-1, das strukturell nicht mit Rhodamin 123 verwandt ist, führten zu ähnlichen Ergebnissen, der Ansammlung in UKF-NB-3 Zellen, jedoch nicht in UKF-NB-3rVCR10 Zellen, und der Inhibierung des JC-1 Ausstroms durch Nutlin-3 in UKF-NB-3rVCR10 Zellen.

P-gp gehört zur Familie der sogenannten ATP-Bindungs-Kassette(ABC)-Transporter, von denen bekannt ist, dass sie viele Substanzen einschließlich vieler anti-Krebs Wirkstoffe aus der Zelle (Szakacs et al., 2006; Calcagno et al., 2007) hinaus transportieren. Zusätzlich zu P-gp, der das Genprodukt des Multi-drug Resistenzgens 1 (MDR1 auch ABCB1 genannt) ist, wurde von anderen ABC-Transportern einschließlich Multi-drug Resistenzprotein 1 (MRP-1/ABCC1) gezeigt, dass es an der Krebszellen-Chemoresistenz beteiligt ist (Szakacs et al., 2006; Calcagno et al., 2007). In UKF-NB-3rVCR10 Zellen, spielt P-gp eine dominante Rolle unter den ABC-Transportern. Keine signifikante Überexpression anderer ABC Transporter konnte nachgewiesen werden. Darüber hinaus beeinträchtigte ein MRP-3-spezifischer oder Brustkrebs Resistenzprotein (BCRP/ABCG2)-spezifischer Inhibitor den Ausstrom verschiedener Fluoreszenzsubstrate aus UKF-NB-3rVCR10 Zellen nicht signifikant. Um weiter zu bestätigen, dass Nutlin-3 P-gp inhibiert, und um seine potentiellen Effekte auf andere ABC-Transporter zu untersuchen, wurde die Anhäufung von Rhodamin 123, das ein Substrat von P-gp und MRP-1 ist, in MDCKII Zellen, die P-gp (MDCKII MDR1) oder MRP-1 (MDCKII MRP1) stabil überexprimieren, jeweils mit oder ohne Nutlin Behandlung gemessen. Die Ergebnisse zeigten ein Fehlen der Rhodamin Ansammlung in MDCKII MDR1 Zellen. Darüber hinaus verursachte Nutlin-3 eine starke Ansammlung von Rhodamin 123 in MDCKII MDR1 Zellen, erhöhte die Rhodamin 123 Ansammlung in MDCKII MRP1 Zellen jedoch nur in einem geringeren Ausmaß (3B, C, D). Die Nutlin-3 (20 μM) Behandlung erhöhte die Rhodamin 123 Fluoreszenz in MDCKII MDR1 Zellen 66 ± 21-fach, in MDCKII Zellen 6,3 ± 0,6-fach, in MDCKII MRP1 Zellen 3,8 ± 0,4-fach und in MDCKII MRP3 Zellen 4,6 ± 1,4-fach. Ähnliche Ergebnisse wurden bei der Verwendung des Fluoreszenzfarbstoffs Calcein-AM in MDCKII MDR1, MDCKII MRP1, oder MDCKII MRP3 Zellen erhalten.

Zitierte Literatur

  • Ambrosini G, Sambol EB, Carvajal D, Vassilev LT, Singer S, Schwartz GK. Mouse double minute antagonist Nutlin-3a enhances chemotherapy-induced apoptosis in cancer cells with mutant p53 by activating E2F1. Oncogene. 2007 May 24; 26 (24): 3473–81.
  • Bakos B, Evers R, Szakács G, Tusnády GE, Welker E, Szabó K, de Haas M, van Deemter L, Borst P, Váradi A, Sarkadi B. Functional multidrug resistance protein (MRP1) lacking the N-terminal transmembrane domain. J Biol Chem. 1998 Nov 27; 273 (48): 32167–75.
  • Barbieri E, Mehta P, Chen Z, Zhang L, Slack A, Berg S, Shohet JM. MDM2 inhibition sensitizes neuroblastoma to chemotherapy-induced apoptotic cell death. Mol Cancer Ther. 2006 Sep; 5 (9): 2358–65.
  • Breitfeld PP, Meyer WH. Rhabdomyosarcoma: new windows of opportunity. Oncologist. 2005 Aug; 10 (7): 518–27.
  • Calcagno AM, Kim IW, Wu CP, Shukla S, Ambudkar SV. ABC drug transporters as molecular targets for the prevention of multidrug resistance and drug-drug interactions. Curr Drug Deliv. 2007 Oct; 4 (4): 324–33.
  • Cinatl J Jr, Cinatl J, Kotchetkov R, Vogel JU, Woodcock BG, Matousek J, Pouckova P, Kornhuber B. Bovine seminal ribonuclease selectively kills human multidrug-resistant neuroblastoma cells via induction of apoptosis. Int J Oncol. 1999 Nov; 15 (5): 1001–9.
  • Kool M, van der Linden M, de Haas M, Scheffer GL, de Vree JM, Smith AJ, Jansen G, Peters GJ, Ponne N, Scheper RJ, Elferink RP, Baas F, Borst P. MRP3, an organic anion transporter able to transport anti-cancer drugs. Proc Natl Acad Sci USA. 1999 Jun 8; 96 (12): 6914–9.
  • Kotchetkov R, Cinatl J, Blaheta R, Vogel JU, Karaskova J, Squire J, Hernáiz Driever P, Klingebiel T, Cinatl J Jr. Development of resistance to vincristine and doxorubicin in neuroblastoma alters malignant properties and induces additional karyotype changes: a preclinical model. Int J Cancer. 2003 Mar 10; 104 (1): 36–43.
  • Kotchetkov R, Driever PH, Cinatl J, Michaelis M, Karaskova J, Blaheta R, Squire JA, Von Deimling A, Moog J, Cinatl J Jr. Increased malignant behavior in neuroblastoma cells with acquired multi-drug resistance does not depend on P-gp expression. Int J Oncol. 2005 Oct; 27 (4): 1029–37.
  • Maris JM, Hogarty MD, Bagatell R, Cohn SL. Neuroblastoma. Lancet. 2007 Jun 23; 369 (9579): 2106–20.
  • Michaelis M, Suhan T, Cinatl J, Driever PH, Cinatl J Jr. Valproic acid and interferon-alpha synergistically inhibit neuroblastoma cell growth in vitro und in vivo. Int J Oncol. 2004 Dec; 25 (6): 1795–9.
  • Michaelis M, Cinatl J, Anand P, Rothweiler F, Kotchetkov R, Deimling A, Doerr HW, Shogen K, Cinatl J Jr. Onconase induces caspase-independent cell death in chemoresistant neuroblastoma cells. Cancer Lett. 2007 May 18; 250 (1): 107–16.
  • Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods. 1983 Dec 16; 65 (1–2): 55–63.
  • Secchiero P, Corallini F, Gonelli A, Dell’Eva R, Vitale M, Capitani S, Albini A, Zauli G. Antiangiogenic activity of the MDM2 antagonist nutlin-3. Circ Res. 2007a Jan 5; 100 (1): 61–9.
  • Secchiero P, Zerbinati C, Melloni B, Milani D, Campioni D, Fadda R, Tiribelli M, Zauli G. The MDM-2 antagonist nutlin-3 promotes the maturation of acute myeloid leukemic blasts. Neoplasia. 2007b Oct; 9 (10): 853–61.
  • Szakács G, Paterson JK, Ludwig JA, Booth-Genthe C, Gottesman MM. Targeting multidrug resistance in cancer. Nat Rev Drug Discov. 2006 Mar; 5 (3): 219–34.
  • Van Maerken T, Speleman F, Vermeulen J, Lambertz I, De Clercq S, De Smet E, Yigit N, Coppens V, Philippé J, De Paepe A, Marine JC, Vandesompele J. Small-molecule MDM2 antagonists as a new therapy concept for neuroblastoma. Cancer Res. 2006 Oct 1; 66 (19): 9646–55.
  • Vassilev LT. MDM2 inhibitors for cancer therapy. Trends Mol Med. 2007 Jan; 13 (1): 23–31.

ZITATE ENTHALTEN IN DER BESCHREIBUNG

Diese Liste der vom Anmelder aufgeführten Dokumente wurde automatisiert erzeugt und ist ausschließlich zur besseren Information des Lesers aufgenommen. Die Liste ist nicht Bestandteil der deutschen Patent- bzw. Gebrauchsmusteranmeldung. Das DPMA übernimmt keinerlei Haftung für etwaige Fehler oder Auslassungen.

Zitierte Patentliteratur

  • - US 7358335 [0009]
  • - US 2005-0288287 [0013, 0018]
  • - DE 19636889 [0019]
  • - DE 19636889 A1 [0019]

Zitierte Nicht-Patentliteratur

  • - El-Deiry, W. S. The p53 pathway und cancer therapy. Cancer Journal 11 229–236 (1998) [0002]
  • - Lane, D. P., Hupp, T. R. Drug discovery und p53. Drug Discovery Today 8 (8) 347–355 (2003) [0002]
  • - Vassilev, L. T., Vu, B. T., Graves, B., et al. In vivo activation of the p53 pathway by small-molecule antagonists of MDM2. Science 303 844–848 (2004) [0002]
  • - Vassilev, 2007 [0003]
  • - Secchiero et al., 2007a [0003]
  • - Vassilev, 2007 [0004]
  • - Ambrosini et al., 2007 [0004]
  • - Secchiero, 2007b [0004]
  • - van Maerken et al., 2006 [0005]
  • - Barbieri et al., 2006 [0005]
  • - Maris et al., 2007 [0005]
  • - Breitfeld und Meyer, 2005 [0006]
  • - Cheok et al. (in Cheok CF, Dey A, Lane DP. Cyclin-dependent kinase inhibitors sensitize tumor cells to nutlin-induced apoptosis: a potent drug combination. Mol Cancer Res. 2007 Nov; 5 (11): 1133–45) [0008]
  • - Mack et al. (in Mack JT, Brown CB, Tew KD. ABCA2 as a therapeutic target in cancer and nervous system disorders. Expert Opin Ther Targets. 2008 Apr; 12(4): 491–504.) [0010]
  • - Calcagno AM, Kim IW, Wu CP, Shukla S, Ambudkar SV. ABC drug transporters as molecular targets for the prevention of multidrug resistance and drug-drug interactions. Curr Drug Deliv. 2007 Oct; 4(4): 324–33 [0022]
  • - Vassilev, 2007 [0036]
  • - Kotchetkov et al., 2005 [0042]
  • - Michaelis et al., 2007 [0042]
  • - Kotchetkov et al., 2005 [0042]
  • - Michaelis et al., 2007 [0042]
  • - Bakos et al., 1998 [0043]
  • - Kool et al., 1999 [0043]
  • - Mosmann, 1983 [0049]
  • - Michaelis et al., 2004 [0049]
  • - Vassilev et al., 2007 [0056]
  • - Szakacs et al., 2006 [0059]
  • - Calcagno et al., 2007 [0059]
  • - Szakacs et al., 2006 [0059]
  • - Calcagno et al., 2007 [0059]