Title:
Verfahren und Mittel zur Aktivierung von Gedächtnis-B-Lymphozyten
Kind Code:
B3


Abstract:

Die Erfindung betrifft ein Verfahren und Mittel zur Aktivierung von Gedächtnis-B-Lymphozyten, insbesondere zum Einsatz in der immunologischen Forschung und in der Medizin. Im erfindungsgemäßen Verfahren werden die Zellen mit einem Aktivierungsreagenz enthaltend Kermesbeeren-Mitogen, CpG-Oligonukleotide, IL-2 und IL-10 behandelt. Es ist überraschend, dass IL-2, IL-10 und CpG-Oligonukleotide die aktivierende Wirkung von Kermesbeeren-Mitogen verstärken. Die Erfinder haben herausgefunden, dass der Zusatz von IL-6, LPS, CD40-Ligand oder anti-CD40-Antikörper keine weitere aktivierende Wirkung auf die Gedächtnis-B-Lymphozyten hat. Dies ist überraschend, da IL-6 ein Wachstumsfaktor für B-Lymphozyten ist. Erfindungsgemäß sind im Aktivierungsreagenz daher kein IL-6, kein Lipopolysaccharid von Escherichia coli (LPS), kein Interleukin 6 (IL-6), kein CD40-Ligand und kein anti-CD40-Antikörper enthalten.




Inventors:
Jassoy, Christian, Prof. Dr. (Leipzig, 04155, DE)
Bußmann, Bianca Marina (Leipzig, 04275, DE)
Reiche, Sven (Leipzig, 04207, DE)
Application Number:
DE102008044911
Publication Date:
12/03/2009
Filing Date:
08/29/2008
Assignee:
Universität Leipzig (Leipzig, 04109, DE)
International Classes:



Other References:
AMANNA,I.J. & SLIFKA,M.K.: Quantitation of rare memory B cell populations by two independent and complementary approaches. J. Immunol. Methods. (2006) 317 (1-2) 175-85
SHOKRGOZAR,M.A., u.a.: Frequency analysis of HBsAg-specific B lymphocytes in high-responder individuals to recombinant hepatitis B vaccine: comparison of LDA and ELISPOT assays. Scand. J. Immunol. (2006) 64 (5) 536-43
Datenbank PubMed bei NCBI, Adresse www.ncbi.nlm.nih.gov, Zusammenfassung zu: BUSSMANN,B.M., u.a.: Antigenic and cellular localisation analysis of the severe acute respiratory syndrome coronavirus nucleocapsid protein using monoclonal antibodies. Virus Res. (2006) 122 (1-2) 119-26 [recherchiert am 29.04.2009] (gutachtlich)
Datenbank PubMed bei NCBI, Adresse www.ncbi.nlm.nih.gov, Zusammenfassung zu: GRUSCHKE,S., u.a.: Peptides from the SARS- associated coronavirus as tags for protein expression and purification. Protein Expr. Purif. (Oktober 2008) 61 (2) 138-41, Epub 9.5.2008 [recherchiert am 29.04.2009] (gutachtlich)
Attorney, Agent or Firm:
Kailuweit & Uhlemann, Patentanwälte (Dresden, 01187)
Claims:
1. Verfahren zur Aktivierung von Gedächtnis-B-Lymphozyten durch Inkontaktbringen der Zellen in vitro mit einem Aktivierungsreagenz enthaltend Kermesbeeren-Mitogen (pokeweed mitogen), CpG-Oligonukleotid, Interleukin 2 (IL-2) und Interleukin 10 (IL-10), wobei das Aktivierungsreagenz kein Lipopolysaccharid von Escherichia coli (LPS), kein Interleukin 6 (IL-6), keinen CD40-Liganden und keinen anti-CD40-Antikörper enthält.

2. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass das Aktivierungsreagenz zusätzlich ein bakterielles Superantigen enthält.

3. Verfahren nach Anspruch 1 oder 2, dadurch gekennzeichnet, dass das Aktivierungsreagenz zusätzlich Protein A von Staphylococcus aureus und/oder Staphylococcus aureus-Lysat enthält.

4. Verfahren nach einem der Ansprüche 1 bis 3, dadurch gekennzeichnet, dass das Kermesbeeren-Mitogen (pokeweed mitogen) in einer Konzentration von 1 ng/ml bis 100 ng/ml, bevorzugt 5 ng/ml bis 30 ng/ml, im Aktivierungsreagenz enthalten ist.

5. Verfahren nach einem der Ansprüche 1 bis 4, dadurch gekennzeichnet, dass das oder die CpG-Oligonukleotide in einer Konzentration von 0,1 μg/ml bis 50 μg/ml, bevorzugt 1 μg/ml bis 10 μg/ml, im Aktivierungsreagenz enthalten sind.

6. Verfahren nach einem der Ansprüche 1 bis 5, dadurch gekennzeichnet, dass Interleukin-2 in einer Konzentration von 10 ng/ml bis 1000 ng/ml, bevorzugt 50 ng/ml bis 200 ng/ml im Aktivierungsreagenz, enthalten ist.

7. Verfahren nach einem der Ansprüche 1 bis 6, dadurch gekennzeichnet, dass Interleukin-10 in einer Konzentration von 5 ng/ml bis 200 ng/ml, bevorzugt 10 ng/ml bis 50 ng/ml im Aktivierungsreagenz enthalten ist.

8. Verfahren nach einem der Ansprüche 3 bis 7, dadurch gekennzeichnet, dass das Protein A von Staphylococcus aureus in einer Konzentration von 1 ng/ml bis 100 ng/ml oder das Staphylococcus-aureus-Lysat in einer Verdünnung mit einer Bindekapazität für humanes IgG von 0,03 μg/ml bis 0,24 μg/ml im Aktivierungsreagenz enthalten ist.

9. Verfahren nach einem der Ansprüche 1 bis 8, dadurch gekennzeichnet, dass zur Aktivierung die Zellen 2 bis 10 Tage in Gegenwart des Aktivierungsreagenz inkubiert werden.

10. Verfahren nach einem der Ansprüche 1 bis 9, dadurch gekennzeichnet, dass für die Aktivierung zunächst B-Lymphozyten nach bekannten Methoden in einer Probe isoliert und angereichert werden.

11. Aktivierungsreagenz enthaltend Kermesbeeren-Mitogen (pokeweed mitogen), CpG-Oligonukleotid, Interleukin 2 (IL-2) und Interleukin 10 (IL-10), dadurch gekennzeichnet, dass das Aktivierungsreagenz kein Lipopolysaccharid von Escherichia coli (LPS), kein Interleukin 6 (IL-6), keinen CD40-Liganden und keinen anti-CD40-Antikörper enthält.

12. Aktivierungsreagenz nach Anspruch 11, dadurch gekennzeichnet, dass es zusätzlich ein bakterielles Superantigen enthält.

13. Aktivierungsreagenz nach Anspruch 11 oder 12, dadurch gekennzeichnet, dass es zusätzlich Protein A von Staphylococcus aureus und/oder Staphylococcus-aureus-Lysat enthält.

14. Aktivierungsreagenz nach einem der Ansprüche 11 bis 13, dadurch gekennzeichnet, dass das Kermesbeeren-Mitogen (pokeweed mitogen) in einer Konzentration von 1 ng/ml bis 100 ng/ml, bevorzugt 5 ng/ml bis 30 ng/ml, im Aktivierungsreagenz enthaltend ist.

15. Aktivierungsreagenz nach einem der Ansprüche 11 bis 14, dadurch gekennzeichnet, dass das oder die CpG-Oligonukleotide in einer Konzentration von 0,1 μg/ml bis 50 μg/ml, bevorzugt 1 μg/ml bis 10 μg/ml, im Aktivierungsreagenz enthalten sind.

16. Aktivierungsreagenz nach einem der Ansprüche 11 bis 15, dadurch gekennzeichnet, dass Interleukin 2 in einer Konzentration von 10 ng/ml bis 1000 ng/ml, bevorzugt 50 ng/ml bis 200 ng/ml im Aktivierungsreagenz enthalten ist.

17. Aktivierungsreagenz nach einem der Ansprüche 11 bis 16, dadurch gekennzeichnet, dass Interleukin 10 in einer Konzentration von 5 ng/ml bis 200 ng/ml, bevorzugt 10 ng/ml bis 50 ng/ml im Aktivierungsreagenz enthalten ist.

18. Aktivierungsreagenz nach einem der Ansprüche 13 bis 17, dadurch gekennzeichnet, dass das Protein A von Staphylococcus aureus in einer Konzentration von 1 ng/ml bis 100 ng/ml oder das Staphylococcus-aureus-Lysat in einer Verdünnung mit einer Bindekapazität für humanes IgG von 0,03 μg/ml bis 0,24 μg/ml im Aktivierungsreagenz enthalten ist.

19. Kit enthaltend ein Aktivierungsreagenz nach einem der Ansprüche 11 bis 18, sowie Reagenzien zur Isolierung und Anreicherung und zum Nachweis von spezifischen Gedächtnis-B-Lymphozyten.

20. Verwendung eines Aktivierungsreagenz oder Kits nach einem der Ansprüche 11 bis 19 zur Aktivierung von Gedächtnis-B-Lymphozyten und/oder Nachweis von spezifischen Gedächtnis-B-Lymphozyten.

Description:

Die Erfindung betrifft ein Verfahren und Mittel zur Aktivierung von Gedächtnis-B-Lymphozyten, insbesondere zum Einsatz in der immunologischen Forschung und in der Medizin.

Das Abwehrsystem des menschlichen Organismus reagiert in der Auseinandersetzung mit Fremdstoffen (Antigenen) einschließlich Infektionserregern mit der Prägung, Aktivierung und Reifung von B-Lymphozyten. Durch den Kontakt mit den Fremdstoffen entwickelt sich ein Teil der B-Lymphozyten zu Effektorzellen (Plasmazellen), die Antikörper sezernieren, ein anderer Teil reift zu Gedächtniszellen. Gedächtniszellen bleiben lebenslang im Organismus. Das Vorhandensein der Gedächtniszellen ist auf der einen Seite ein biologischer Marker für die vorausgegangene Auseinandersetzung des Organismus mit einem Fremdstoff. Auf der anderen Seite stellen sie ein Zellreservoir dar, aus dem rasch auf einen neuen Kontakt mit dem Fremdstoff reagiert werden kann. Ist der Fremdstoff ein Infektionserreger, führt die Mobilisierung der Gedächtniszellen zur beschleunigten Bildung von Plasmazellen und zur Abwehr schädlicher Wirkungen der Infektionserreger. Sie schützen damit vor Krankheitsentstehung.

B-Lymphozyten befinden sich im Blut und in zahlreichen Organen, insbesondere im lymphatischen Gewebe einschließlich der Milz. Außerdem finden sie sich in Lymphflüssigkeit und in geringer Zahl im Liquor cerebrospinalis. Bei Entzündungen finden sie sich in Exsudat, Synovialflüssigkeit, bronchoalveolar und an anderen Orten des Entzündungsgeschehens.

Antigenspezifisch bedeutet, dass ein Antikörper gegen genau eine Molekülstruktur eines Fremdstoffs, z. B. eines Infektionserregers, gerichtet ist. Um antigenspezifische Gedächtnis-B-Zellen nachzuweisen und zu quantifizieren, müssen sie aktiviert werden. Es sind mehrere Substanzen bekannt, die B-Lymphozyten aktivieren. Es ist auch bekannt, dass eine Kombination mehrerer Substanzen synergistisch oder antagonistisch wirken kann. Der Effekt einer Wirkstoffkombination auf die B-Lymphozyten lässt sich nicht aus der Wirkung der Einzelkomponenten vorhersagen.

Zur Aktivierung von Gedächtnis-B-Lymphozyten in vitro werden nach dem Stand der Technik u. a. die folgenden Substanzkombinationen und Verfahren eingesetzt:

  • 1. Ko-Kultivierung mit CD40-Ligand-exprimierenden murinen Zellen plus Interleukin (IL)-2 und IL-10 (Tuaillon et al. 2006, Tuaillon et al. AIDS 2007, Fondere et al. 2003, 2004),
  • 2. Anti-CD40-Antikörper, CpG-Oligonukleotide, IL-2 und IL-10 (Titanji et al. 2005),
  • 3. Kermesbeeren (Pokeweed)-Mitogen (Shokrgozar et al. 2006),
  • 4. CpG-Oligonukleotide plus Interleukin (IL)-2 (Giannini et al. 2006),
  • 5. Staphylococcus aureus-Lysat und CpG-Oligonukleotide (Malaspina et al. 2005),
  • 6. Staphylococcus aureus-Lysat, CpG-Oligonukleotide und Kermesbeeren-Mitogen (Crotty et al. 2004),
  • 7. Staphylococcus aureus-Lysat, CpG-Oligonukleotide, Kermesbeeren-Mitogen, Lipopolysaccharid, IL-2, IL-6 und IL-10 (Amanna et al. 2006).

Bei den Substanzkombinationen und Verfahren wird allerdings nur eine schwache Aktivierung der Gedächtniszellen erreicht.

Für den Nachweis von antigenspezifischen Gedächtnis-B-Lymphozyten und die Quantifizierung der Zellen ist die Aktivierung der Zellen in vitro erforderlich. Dabei soll eine Reifung der Gedächtniszellen zu Plasmazellen erzeugt werden. Plasmazellen lassen sich insbesondere durch den Nachweis freigesetzter Immunglobuline nachweisen.

Der Erfindung liegt das Problem zugrunde, ein Verfahren zu entwickeln, mit dem in vitro eine verbesserte Aktivierung der Zellen erreicht werden kann.

Die Aufgabe wird erfindungsgemäß gelöst durch ein Verfahren zur Aktivierung von Gedächtnis-B-Lymphozyten durch Inkontaktbringen der Zellen mit einem Aktivierungsreagenz enthaltend Kermesbeeren-Mitogen (pokeweed mitogen), CpG-Oligonukleotide, Interleukin 2 (IL-2) und Interleukin 10 (IL-10), wobei das Aktivierungsreagenz kein Lipopolysaccharid von Escherichia coli (LPS), kein Interleukin 6 (IL-6), keinen CD40-Liganden und keinen anti-CD40-Antikörper enthält.

Für die Aktivierung werden bevorzugt zunächst B-Lymphozyten nach bekannten Methoden in einer Probe isoliert und angereichert. Diese Probe ist bevorzugt eine Blutprobe, Lymphe oder eine Gewebeprobe, z. B. aus Lymphknoten oder auch der Milz. Zur Isolierung werden bevorzugt zunächst mononukleäre Zellen angereichert, z. B. durch Dichtegradientenzentrifugation. Die Anreicherung von B-Lymphozyten geschieht bevorzugt mittels an einen festen Träger gebundener Antikörper, die spezifisch B-Lymphozyten erkennen. Beispiele für solche Antikörper sind anti-CD19, anti-CD20, anti-CD21, anti-CD27, anti-CD38 und anti-IgD. Die bei der Anreicherung nicht als B-Lymphozyten isolierten Zellen werden bevorzugt an der Vermehrung gehindert, z. B. durch Behandlung mit Mitomycin oder durch Gamma-Bestrahlung, und zu den angereicherten B-Lymphozyten gegeben.

Die Isolierung, die Anreicherung und die Aktivierung werden bevorzugt in vitro, d. h. außerhalb eines lebenden Organismus, durchgeführt.

Die Erfindung lehrt ein Verfahren zur Aktivierung von Gedächtnis-B-Lymphozyten. Dabei werden die Zellen mit Lösungen enthaltend Kermesbeeren-Mitogen, CpG-Oligonukleotide, IL-2 und IL-10 behandelt. Es ist überraschend, dass IL-2, IL-10 und CpG-Oligonukleotide die aktivierende Wirkung von Kermesbeeren-Mitogen verstärken.

Die Erfinder haben dabei herausgefunden, dass der Zusatz von IL-6 keine weitere aktivierende Wirkung auf die Gedächtnis-B-Lymphozyten hat. Dies ist überraschend, da IL-6 ein Wachstumsfaktor für B-Lymphozyten ist.

Auch der Zusatz von LPS, CD40-Ligand oder anti-CD40-Antikörper führt zu keiner weiteren aktivierenden Wirkung auf die Gedächtnis-B-Lymphozyten.

In einer Variante enthält das Aktivierungsreagenz allein Kermesbeeren-Mitogen (pokeweed mitogen), CpG-Oligonukleotid, Interleukin 2 (IL-2) und Interleukin 10 (IL-10).

In einer bevorzugten Variante ist im Aktivierungsreagenz mindestens ein bakterielles Superartigen enthalten, welches bevorzugt aus der Gruppe Staphylococcus aureus Protein A, Staphylococcus aureus Entertoxin D, Peptostreptococcus magnus Protein L ausgewählt ist. In einer besonderen Ausführungsform enthält das Aktivierungsreagenz Protein A von Staphylococcus aureus. Dieses kann in Form von Staphylococcus-aureus-Lysat oder des isolierten oder rekombinant hergestellten Protein A zugesetzt werden.

Da Protein A von Staphylococcus aureus bzw. Staphylococcus-aureus-Lysat die Aktivierung von B-Lymphozyten durch Kermesbeeren-Mitogen hemmt, ist es besonders überraschend, dass es in der Gegenwart von IL-2, IL-10 und CpG die stimulierende Wirkung von Kermesbeeren-Mitogen verstärkt.

Das erfindungsgemäße Verfahren eignet sich insbesondere zur Quantifizierung antigenspezifischer Gedächtnis-B-Lymphozyten in Organen und Körperflüssigkeiten.

Bevorzugt werden dazu zunächst durch Dichtegradientenzentrifugation (bevorzugt über ein Ficoll-Kissen) periphere mononukleäre Zellen (PBMC) aus antikoaguliertem Vollblut isoliert. Anschließend werden die B-Zellen bevorzugt mittels magnetischer Kügelchen (engl. Beads), die beispielsweise an den B-Zellmarker CD19 binden und mittels eines Magneten fixiert werden können, angereichert. Die B-Lymphozyten werden bevorzugt anschließend mit Fütterzellen kultiviert. Die Fütterzellen können beispielsweise mononukleäre Zellen sein, beispielsweise vom gleichen Spender, etwa B-Zell-depletierte Zellen nach der Anreicherung. Unerwünschte Proliferation der Fütterzellen kann beispielsweise durch Zugabe von Zytostatika, bevorzugt Mitomycin C, oder durch Gamma-Bestrahlung gehemmt werden. Zur Aktivierung der Gedächtnis-B-Zellen wird das erfindungsgemäße Aktivierungsreagenz verwendet.

Zur Quantifizierung der antigenspezifischen Zellen wird vorzugsweise ein ELISpot-Assay durchgeführt, vorzugsweise mit den folgenden Verfahrensschritten:

  • 1. Die Zellen werden in Kulturplatten inkubiert, deren Boden durch eine proteinbindende Membran dargestellt wird. Diese Membran wird mit Antigenen (Bestimmung der Anzahl antigenspezifischer Zellen) oder anti-Immunglobulinen (Bestimmung der Gesamtanzahl antikörpersezernierender Zellen) beschichtet.
  • 2. Nach der Inkubation kann die Position, an der während einer Inkubationsphase eine antikörpersezernierende B-Zelle lag, durch die Verwendung enzymgekoppelter Sekundärantikörper und eine entsprechende Substratreaktion definiert werden.
    Die Bestimmung der prozentualen Verteilung der für die untersuchten Antigene spezifischen Gedächtnis-B-Zellen erfolgt vorzugsweise durch die Bildung von Verhältnissen aus der Gesamtzahl Immunglobulin-sezernierender Zellen und der Menge antigenspezifischer Zellen.

Das Kermesbeeren-Mitogen (pokeweed mitogen) ist im erfindungsgemäßen Aktivierungsreagenz vorzugsweise in einer Konzentration von 1 ng/ml bis 100 ng/ml, bevorzugt 5 ng/ml bis 30 ng/ml, besonders bevorzugt 8 ng/ml bis 15 ng/ml, im Aktivierungsreagenz enthalten.

CpG bedeutet Cytosin-phosphatidyl-Guanosin. Der Begriff CpG-Oligonukleotid steht somit für ein Oligonukleotid, welches die Sequenz CG mindestens einmal enthält, d. h. in dem mindestens ein Cytosin (C) direkt über eine Phosphatgruppe (p) mit einem Guanosin (G) verbunden ist, wobei das Cytosin bevorzugt unmethyliert ist. Das Oligonukleotid ist eine kurze Nukleinsäuresequenz mit einer Länge von bevorzugt bis zu 50 Nukleotiden, besonders bevorzugt 15 bis 35 Nukleotiden. Bevorzugt ist die Sequenz CG in dem Oligonukleotid 3- bis 8-mal enthalten. Besonders bevorzugt ist die Sequenz 5'...GACGTT...3' oder 5'...GTCGTT...3' in dem Oligonukleotid 3- bis 8-mal enthalten.

Die CpG-Oligonukleotide haben bevorzugt folgende allgemeine Formel: Xm-CG-Xn-CG-Xo wobei m und n ganze Zahlen von 1 bis 6 darstellen und o eine ganze Zahl von 1 bis 14 darstellt und wobei die X unabhängig voneinander ausgewählt sind aus den Nukleotiden A, T, G und C. Bevorzugt sind über 50%, besonders bevorzugt über 70%, der X ausgewählt aus A, T und C.

Bevorzugte Sequenzen für CpG-Oligonukleotide sind ausgewählt aus:
TCGTCGTTTTGTCGTTTTGTCGT (SEQ ID No. 1)
TCGTTTTGTCGTTTTGTCGTT (SEQ ID No. 2)
ACGTCGTTTTGTCGTTTTGTCGTT (SEQ ID No. 3)
ACGTTTTGTCGTTTTGTCGTT (SEQ ID No. 4)
ATCGACCTACGTGCGTTCTC (SEQ ID No. 5)
TCCATAACGTTCCTGATGCT (SEQ ID No. 6)
GAGAACGTCGACCTTCGAT (SEQ ID No. 7)
GCTAGACGTTAGCGT (SEQ ID No. 8)
ATCGACTCTCGAGCGTTCTC (SEQ ID No. 9)
TCGACTCTCGAGCGTTCTC (SEQ ID No. 10)
GAGAACGCTCGACCTTYGAT (SEQ ID No. 11)
CTCCCAGCGTGCGCCAT (SEQ ID No. 12)

Der Begriff Oligonukleotide im Sinne der Erfindung umfasst neben Desoxyribonukleinsäuren (DNA) und Ribonukleinsäuren (RNA) auch alle anderen linearen Polymere, in denen die Basen Adenin (A), Cytosin (C), Guanin (G) und Thymin (T) oder Uracil (U) in entsprechender Abfolge angeordnet sind, insbesondere Oligonukleotide mit verändertem Rückgrat, wie z. B. einem Phosphothioat-, Phosphoramidat- oder O-Methyl-derivatisierten Rückgrat, Peptid-Nukleinsäuren (PNA), und locked nucleic acids (LNA).

Bevorzugt sind einzelne oder alle Phosphorestergruppen in den Oligonukleotiden durch eine Phosphorthioat-Gruppe ersetzt.

Besonders bevorzugte Sequenzen für CpG-Oligonukleotide sind ausgewählt aus den folgenden Sequenzen, wobei bevorzugt alle Nukleotidbausteine über Phosphorthioatgruppen verknüpft sind:
TCGTCGTTTTGTCGTTTTGTCGT (SEQ ID NO. 1)
TCGTCGTTCCCCCCCCCCCC (SEQ ID NO. 13)

Weiter besonders bevorzugte Sequenzen für CpG-Oligonukleotide sind ausgewählt aus den folgenden Sequenzen, wobei bevorzugt alle Nukleotidbausteine über Phosphordiestergruppen verknüpft sind:
TCGTCGTTTTGTCGTTTTGTCGT (SEQ ID NO. 14)
TCGTCGTTCCCCCCCCCCCC (SEQ ID NO. 15)
TCGCCGTTCCCCCCCCCCCC (SEQ ID NO. 16)
TCGGCGTTCCCCCCCCCCCC (SEQ ID NO. 17)
GCGTCGTTCCCCCCCCCCCC (SEQ ID NO. 18)
ACGTCGTTCCCCCCCCCCCC (SEQ ID NO. 19)

Mindestens ein CpG-Oligonukleotid ist im Aktivierungsreagenz bevorzugt in einer Konzentration von 0,1 μg/ml bis 50 μg/ml, besonders bevorzugt 1 μg/ml bis 10 μg/ml, enthalten.

Interleukin-2 ist bevorzugt in einer Konzentration von 10 ng/ml bis 1000 ng/ml, besonders bevorzugt 50 ng/ml bis 200 ng/ml, im Aktivierungsreagenz enthalten.

Interleukin-10 ist im erfindungsgemäßen Aktivierungsreagenz bevorzugt in einer Konzentration von 5 ng/ml bis 200 ng/ml, besonders bevorzugt 10 ng/ml bis 50 ng/ml im Aktivierungsreagenz enthalten.

Staphylococcus aureus-Lysat ist bevorzugt in einer Verdünnung von 1:1.000 bis 1:100.000, besonders bevorzugt in einer Verdünnung von 1:5.000 bis 1:40.000, einer Ausgangslösung im Aktivierungsreagenz enthalten, wobei bei dieser Verdünnungsspanne die Ausgangslösung 1,2 mg/ml Bindekapazität für humanes IgG aufweist. Das im Aktivierungsreagenz enthaltene verdünnte Staphylococcus aureus-Lysat weist dementsprechend bevorzugt eine Bindekapazität für humanes IgG von 0,03 μg/ml bis 0,24 μg/ml auf.

Alternativ zum Staphylococcus aureus-Lysat ist im Aktivierungsreagenz isoliertes oder rekombinant hergestelltes Protein A von Staphylococcus aureus in einer Konzentration von 1 ng/ml bis 100 ng/ml enthalten.

Die Erfindung betrifft neben dem Verfahren auch das erfindungsgemäße Aktivierungsreagenz selbst.

Ein weiterer Gegenstand der Erfindung ist ein Kit zur Durchführung des erfindungsgemäßen Verfahrens. Dieser enthält ein erfindungsgemäßes Aktivierungsreagenz, sowie Reagenzien zur Isolierung und Anreicherung von B-Lymphozyten, bevorzugt ausgewählt aus:

  • a.) Materialien für die Dichtegradientenzentrifugation,
  • b.) Antikörper, die spezifisch B-Lymphozyten erkennen, bevorzugt an einen festen Träger, z. B. magnetische Partikel oder ein Säulenchromatographiematerial, gebunden,
  • c.) Waschpuffer,
  • d.) Zellkulturmedien,
  • e.) Antibiotika, bevorzugt Mitomycin, oder vorzugsweise Zytostatika, bevorzugt Mitomycin C
  • f.) Aktivierungsreagenzien,
  • g.) Anti-Immunglobulin-Antikörper.
  • h.) Kontrollantigene,
  • i.) Testantigene,
  • j.) Sekundärantikörper (bevorzugt enzymgekoppelt),
  • k.) Reagenzien zur Substratreaktion,
  • l.) Mikrotiterplatten oder ELISpot-Platten.

Die Erfindung betrifft auch die Verwendung des erfindungsgemäßen Aktivierungsreagenz oder erfindungsgemäßen Kits zur Aktivierung von Gedächtnis-B-Lymphozyten, insbesondere zur Quantifizierung antigenspezifischer Gedächtnis-B-Lymphozyten in Organen und Körperflüssigkeiten.

Die Erfindung wird nachfolgend anhand von Ausführungsbeispielen und Vergleichsbeispielen erläutert ohne die Erfindung auf diese zu beschränken:
Aus dem peripheren, venösen Blut eines Patienten werden durch Dichtegradientenzentrifugation mononukleäre Zellen gewonnen und daraus durch ein immunmagnetisches Verfahren B-Lymphozyten angereichert. Die übrigen mononukleären Zellen wurden mit Mitomycin C behandelt und die beiden Zellpopulationen wieder zusammengefügt.

Zu den Zellen wurden verschiedene Aktivierungsreagenzien zugegeben und die Zellen 6 Tage bei 37°C unter Standardbedingungen kultiviert.

Abnahme und Aufarbeitung von Blutproben

Aus 30–35 ml mit Antikoagulanzien behandeltem Vollblut werden mononukleäre Zellen (PBMCs) durch Dichtegradientenzentrifugation über ein Ficoll-Kissen isoliert. Die Isolation der Zellen erfolgt durch 20minütige Zentrifugation bei 1.000 × g. Die isolierten Zellen werden in PBS (Phosphat-gepufferte Salzlösung, 137 mmol/1 Natriumchlorid, 2,7 mmol/1 Kaliumchlorid und 12 mmol/1 Phosphat, pH 7,4) resuspendiert und durch 10minütige Zentrifugation bei 350 × g pelletiert. Der Überstand wird abgegossen und die Zellen in frischem PBS resuspendiert. Zur Entfernung der Thrombozyten werden die PBMC zweimal jeweils 10 min bei 160 × g mit PBS gewaschen.

Die Anreicherung von B-Lymphozyten erfolgt mittels Antikörper-beladener magnetischer Kügelchen (Anti-CD19-Dynabeads, Dynal, Invitrogen, Oslo, Norwegen). Die isolierten B-Zellen werden einmal mit RPMI-1640-Medium gewaschen, in 1 ml Medium resuspendiert und gezählt.

Aus den B-Zell-depletierten PBMCs werden Futterzellen wie folgt hergestellt: 5 × 10 B-Zelldepletierte Zellen werden in RPMI-Medium resuspendiert und Mitomycin C in einer Endkonzentration von 50 μg/ml zugegeben und 20 Minuten bei 37°C inkubiert. Die Zellen werden mit Medium gewaschen. Zur Aktivierung der Gedächtnis-B-Zellen werden je 2 × 105 isolierte B-Zellen mit 1,8 × 106 Futterzellen gemischt und dem jeweiligen Aktivierungsreagenz zugesetzt. Die Aktivierungskultur der Zellen erfolgt über 6 Tage bei 37°C, 5% CO2 und 98% Luftfeuchtigkeit.

Zur Bestimmung der Anzahl antigenspezifischer Zellen werden die aktivierten Zellen im ELISpot analysiert. Zur Bestimmung der Gesamtanzahl antikörpersezernierender Zellen werden Vertiefungen der Platte mit in PBS gelösten Anti-Ig-Fab-Antikörpern über Nacht beschichtet. Anschließend werden die Platten mit FKS(Fötalem Kalbserum)-haltigem Medium 1 h bei 37°C inkubiert. Die aktivierten B-Zellen werden gezählt und je 100 Zellen pro Vertiefung ausplattiert und 20 Stunden bei 37°C, 5% CO2 und gesättigtem Wasserdampf inkubiert. Anschließend wird die Platte gewaschen und ein enzymkonjugierter Anti-Ig-Fc-Sekundärantikörper für 2 Stunden bei 37°C zugegeben. Die Platten werden gewaschen und eine geeignete Substratlösung zugegeben. Nach ca. 20 Minuten wird die Farbreaktion gestoppt, die Platte an der Luft getrocknet und die Spots mittels ELISpot-Readers ausgezählt. Der Anteil antikörpersezernierender B-Lymphozyten in Prozent ist die Anzahl der gezählten Spots/100.

Die dazu verwendeten Aktivierungsreagenzien haben die folgenden Inhaltsstoffe:

  • A: Kontrolle, kein Aktivierungsreagenz,
  • B: Kermesbeeren-Mitogen (10 ng/ml),
  • C: Kermesbeeren-Mitogen (10 ng/ml), Staphylococcus aureus-Lysat (1:10.000-Verdünnung),
  • D: Kermesbeeren-Mitogen (10 ng/ml), IL-2 (100 ng/ml), IL-10 (25 ng/ml),
  • E: Kermesbeeren-Mitogen (10 ng/ml), IL-2 (100 ng/ml), IL-10 (25 ng/ml), Staphylococcus aureus-Lysat (1:10.000-Verdünnung),
  • F: Kermesbeeren-Mitogen (10 ng/ml), IL-2 (100 ng/ml), IL-10 (25 ng/ml), CpG-Oligonukleotid (10 μg/ml),
  • G: Kermesbeeren-Mitogen (10 ng/ml), IL-2 (100 ng/ml), IL-10 (25 ng/ml), CpG-Oligonukleotid (10 μg/ml), Staphylococcus aureus-Lysat (1:10.000-Verdünnung),
  • H: IL-2 (100 ng/ml), CpG-Oligonukleotide (10 μg/ml),
  • I: Kermesbeeren-Mitogen (10 ng/ml), IL-2 (100 ng/ml), CpG-Oligonukleotid (10 μg/ml).

Die Ausgangslösung zur Herstellung des verdünnten Staphylococcus aureus-Lysat enthält 1,2 mg/ml Bindekapazität für humanes IgG. Abs CpG-Oligonukleotid wurde jeweils die Sequenz: TCGTCGTTTTGTCGTTTTGTCGT (SEQ ID No. 1) gewählt.

Die Verdünnungen erfolgten jeweils in Medium (RPMI).

Die Aktivierung von Gedächtnis-B-Lymphozyten zur Sekretion von Immunglobulinen durch die unterschiedlichen Aktivierungsreagenzien A bis I ist in 1 dargestellt.

Weitere Experimente zeigen, dass in Kombination mit dem erfindungsgemäßen Aktivierungsreagens LPS und IL-6 keine weitere aktivierende Wirkung auf die B-Lymphozyten haben.

Die in diesen Experimenten verwendeten Aktivierungsreagenzien haben die folgenden Inhaltsstoffe:

  • A: Kontrolle, kein Aktivierungsreagenz,
  • G: Kermesbeeren-Mitogen (10 ng/ml), IL-2 (100 ng/ml), IL-10 (25 ng/ml), CpG-Oligonukleotide (10 μg/ml), Staphylococcus aureus-Lysat (1:10.000-Verdünnung),
  • M: Kermesbeeren-Mitogen (10 ng/ml), IL-2 (100 ng/ml), IL-10 (25 ng/ml), CpG-Oligonukleotide (10 μg/ml), Staphylococcus aureus-Lysat (1:10.000-Verdünnung) plus IL-6 (10 ng/ml),
  • N: Kermesbeeren-Mitogen (10 ng/ml), IL-2 (100 ng/ml), IL-10 (25 ng/ml), CpG-Oligonukleotide (10 μg/ml), Staphylococcus aureus-Lysat (1:10.000-Verdünnung) plus LPS (10 μg/ml),
  • O: Kermesbeeren-Mitogen (10 ng/ml), IL-2 (100 ng/ml), IL-10 (25 ng/ml), CpG-Oligonukleotide (10 μg/ml), Staphylococcus aureus-Lysat (1:10.000-Verdünnung) plus IL-6 (10 ng/ml) und LPS (10 μg/ml).

Die Aktivierung von Gedächtnis-B-Lymphozyten zur Sekretion von Immunglobulinen durch die unterschiedlichen Aktivierungsreagenzien A, G und M bis O ist in 2 dargestellt.

Durch die Zugabe von LPS wird die Aktivierung der B-Lymphozyten sogar reduziert (2).

Die Aktivierungsreagenzien F und G sind bevorzugte Ausführungsformen der Erfindung. Die restlichen Aktivierungsreagenzien sind Vergleichsbeispiele.

Beispielhafte Kits zur Durchführung des erfindungsgemäßen Verfahrens haben folgende Bestandteile:

Beispiel 1:

  • Aktivierungsreagenz bestehend aus Kermesbeeren-Mitogen (10 ng/ml), IL-2 (100 ng/ml), IL-10 (25 ng/ml), CpG-Oligonukleotide (10 μg/ml), Staphylococcus aureus-Lysat (1:10.000-Verdünnung einer Ausganglösung mit 1,2 mg/ml Bindekapazität für humanes IgG).

Beispiel 2:

  • wie Beispiel 1 plus Zytostatikum zur Fütterzellpräparation

  • – Mitomycin C.

Beispiel 3:

  • wie Beispiel 1 oder 2 plus ELISpot-Platte, sowie Materialien zu ihrer Beschichtung:

  • – anti-Immunglobulin-Antikörper,
  • – Kontrollantigene, beispielsweise Influenza Nukleoprotein, Tetanus-Toxoid o. ä.,
  • – optional Testantigen, beispielsweise HIV-Gag-Protein,
  • – Beschichtungspuffer,

  • oder eine entsprechend vorbeschichtete Platte;
  • plus zum Nachweis sezernierter Antikörper:

  • – enzymkonjugierter Sekundärantikörper,
  • – Blockierlösung, Waschpuffer,
  • – Substrat und ggf. Stopplösung.

Beispiel 4:

  • wie Beispiel 1, 2 oder 3 plus für die Dichtegradientenzentrifugation:

  • – Ficoll

  • zur B-Zellisolation:

  • – immunomagnetische Beads (anti-CD19 oder CD20),
  • – Reaktions- und Waschpuffer,
  • – Bead-Abspaltreagenz,
  • – Magnet.

Beispiel 5:

  • wie Beispiele 1, 2, 3 oder 4 plus anti-CD19 Beads oder anti-CD20 Beads.

Es folgt ein Sequenzprotokoll nach WIPO St. 25.Dieses kann von der amtlichen Veröffentlichungsplattform des DPMA heruntergeladen werden.