Title:
New aminocoumarin compounds, designated novclobiocins, useful as broad-spectrum antibiotics and cytotoxic agents, prepared sing genetically modified bacterial strains
Kind Code:
A1


Abstract:
New aminocoumarin compounds (I), designated novclobiocins, consist of clorobiocin analogs containing modified N-acyl residues and/or 8-substituents. Aminocoumarin compounds of formula (I) are new. R1>mono-, di- or trisubstituted benzoyl, mono- or disubstituted phenylpropionyl, phenylacetyl or mono- or disubstituted cinnamyl; R2>OH, alkyl or halo; R3>, R4>OH or 5-(R5>)-pyrrol-2-ylcarbonyl; R5>Me, halo or halomethyl. Independent claims are included for two biotechnological methods for preparing (I). [Image] ACTIVITY : Antibiotic; Cytostatic. Novclobiocin 225 (Ia) had minimum inhibitory cconcentration values (in mu g/ml) of 16 against Staphylococcus aureus 80CR5, 0.06 or less against Staphylococcus aureus ATCC 29213 and ATCC 43300, 1 against Streptococcus pneumoniae ATCC 49619, 8 against Escherichia coli DC2 and 0.5 against Pseudomonas aeruginosa K799/61. MECHANISM OF ACTION : Bacterial gyrase inhibitor. (Ia) had IC50 45 nM for inhibition of bacterial gyrase.



Inventors:
Heide, Lutz, Prof. Dr. (Tübingen, 72074, DE)
Anderle, Christine (Wannweil, 72827, DE)
Application Number:
DE102007007644
Publication Date:
08/21/2008
Filing Date:
02/16/2007
Assignee:
Universität Tübingen (Tübingen, 72074, DE)
International Classes:
Domestic Patent References:
DE1921012A1N/A1969-11-13



Foreign References:
35479031970-12-15
Other References:
D.C. Hooper et al.: "Effects of novobiocin,
coumermycin A1, clorobiocin, and their analogs on
Escherichia coli DNA gyrase and bacterial growth",
In: Antimicrobial Agents and Chemotherapy, ISSN:
0066-4804, 1982, 22, 662-71;
Claims:
1. Verbindungen der allgemeinen Formel (1): worin die Reste R1 bis R4 unabhängig voneinander:
R1 eine mono, di- oder trisubstituierte Benzoesäure, eine mono- oder disubstituierte Phenylpropionsäure, Phenylessigsäure, eine mono- oder disubstituierte Zimtsäure ist,
R2 eine Hydroxyl-, Alkylgruppe oder ein Halogen ist;
R3 und R4 gleich oder verschieden sind und unabhängig voneinander für eine Hydroxylgruppe oder eine substituierte Pyrrol-2-carbonsäure der Formel (2) stehen: wobei R5 für eine Methylgruppe, ein Halogen oder eine Halogenmethangruppe steht.

2. Verbindungen nach Anspruch 1, dadurch gekennzeichnet, dass R1 eine substituierte 4-Hydroxybenzoesäure, R2 ein Chloratom oder eine Methylgruppe, R3 eine Hydroxylgruppe, R4 eine Pyrrol-2-carbonsäure, und R5 eine Methylgruppe ist.

3. Verfahren, nach dem Verbindungen gemäß einem der Ansprüche 1 bis 2 hergestellt oder herstellbar sind, gekennzeichnet durch folgende Schritte
– im Bakterienstamm 2 wird mindestens ein Gen inaktiviert, das an der Biosynthese der Vorstufe A beteiligt ist, wobei die Vorstufe A so gewählt wird, dass sie in einem Wildtypstamm mit einer Vorstufe B2 verknüpft wird;
– mindestens ein Gen aus einem Bakterienstamm 1 wird in den Bakterienstamm 2 eingebracht, wobei dieses Gen so gewählt wird, dass es für ein Enzym kodiert, das als Substrat ein Analogon der Vorstufe A hat und im Wildtypstamm ihre Verknüpfung an die Vorstufe B2 ausführt;
– der Bakterienstamm 2 wird mit Analoga der Vorstufe A gefüttert, wobei im Bakterienstamm 2 die Verknüpfung des Analogons der Vorstufe A mit der Vorstufe B2 erfolgt,
– die vom Bakterienstamm 2 produzierten Verbindungen werden aus seiner Kultur isoliert.

4. Verfahren nach Anspruch 3, dadurch gekennzeichnet, dass im Bakterienstamm 2 zusätzlich mindestens ein Gen inaktiviert ist, welches für ein Enzym kodiert, das die Verknüpfung der Vorstufen A und B2 ausführt.

5. Verfahren nach einem der Ansprüche 3 bis 4, dadurch gekennzeichnet, dass das einzubringende Gen des Bakterienstamms 1 für Synthetasen, Transferasen oder Ligasen, insbesondere für Amidsynthetasen oder Glycosyltransferasen kodiert.

6. Verfahren nach einem der Ansprüche 3 bis 5, dadurch gekennzeichnet, dass das zu inaktivierende Gen des Bakterienstamms 2 für ein Enzym kodiert, welches an der Biosynthese von Zuckern, Fetten, Aminosäuren oder Vorstufen von Sekundärmetaboliten beteiligt ist.

7. Verfahren nach einem der Ansprüche 3 bis 6, dadurch gekennzeichnet, dass die Analoga der Vorstufe A Benzoesäure, mono-, di- oder trisubstituierte Benzoesäuren, Phenylpropionsäure, mono- oder disubstituierte Phenylpropionsäure, Phenylessigsäuren, Zimtsäuren oder mono- oder disubstituierte Zimtsäuren sind.

8. Verfahren, nach dem Verbindungen gemäß einem der Ansprüche 1 bis 2 hergestellt oder herstellbar sind, gekennzeichnet durch folgende Schritte
– im Bakterienstamm 1 wird mindestens ein Gen inaktiviert, das an der Biosynthese der Vorstufe A beteiligt ist, wobei die Vorstufe A so gewählt wird, dass sie in einem Wildtypstamm für die Biosynthese der Vorstufe AB1 benötigt wird, die an eine weitere Vorstufe C1 geknüpft wird;
– im Bakterienstamm 2 wird mindestens ein Gen inaktiviert, das an der Biosynthese der Vorstufe A beteiligt ist, wobei die Vorstufe A so gewählt wird, dass sie in einem Wildtypstamm für die Biosynthese der Vorstufe AB2 benötigt wird, die an eine weitere Vorstufe C2 geknüpft wird, und C2 und C1 unterschiedlich sind;
– der Bakterienstamm 1 wird mit Analoga der Vorstufe A gefüttert, wobei vom Bakterienstamm 1 eine modifizierte Vorstufe mAB1 gebildet wird;
– aus dem Bakterienstamm 1 wird ein Extrakt der Kultur gewonnen und an den Bakterienstamm 2 gefüttert, wobei im Stamm 2 die Verknüpfung der modifizierten Vorstufe mAB1 mit der Vorstufe C2 erfolgt;
– die vom Bakterienstamm 2 produzierten Verbindungen aus seiner Kultur isoliert werden.

9. Verfahren nach Anspruch 8, dadurch gekennzeichnet, dass im Bakterienstamm 2 zusätzlich mindestens ein Gen inaktiviert ist, welches für ein Enzym kodiert, das die Verknüpfung des Analogons der Vorstufe A ausführt.

10. Verfahren nach einem der Ansprüche 8 bis 9, dadurch gekennzeichnet, dass das zu inaktivierende Gen des Bakterienstamms 1 für ein Enzym kodiert, welches an der Biosynthese von Zuckern, Fetten, Aminosäuren oder Vorstufen von Sekundärmetaboliten beteiligt ist.

11. Verfahren nach einem der Ansprüche 8 bis 10, dadurch gekennzeichnet, dass das zu inaktivierende Gen des Bakterienstamms 2 für ein Enzym kodiert, welches an der Biosynthese von Zuckern, Fetten, Aminosäuren oder Vorstufen von Sekundärmetaboliten beteiligt ist.

12. Verfahren nach einem der Ansprüche 8 bis 11, dadurch gekennzeichnet, dass die Analoga der Vorstufe A Benzoesäure, mono-, di- oder trisubstituierte Benzoesäuren, Phenylpropionsäure, mono- oder disubstituierte Phenylpropionsäure, Phenylessigsäuren, Zimtsäuren oder mono- oder disubstituierte Zimtsäuren sind.

13. Verwendung der Verbindung nach einem der Ansprüche 1 bis 2 als biologisch wirksamen Stoff.

14. Verwendung der Verbindung nach einem der Ansprüche 1 bis 2 als Antibiotika oder Zytostatika.

15. Verwendung der Verbindung nach einem der Ansprüche 1 bis 2 zur Bekämpfung von Krankheiten, die durch Bakterien oder Tumore hervorgerufen werden.

Description:

Die vorliegende Erfindung betrifft neue Verbindungen aus der Klasse der Aminocoumarine, das Verfahren zu ihrer Herstellung sowie ihre pharmazeutische Verwendung.

Die Aminocoumarine Novobiocin, Clorobiocin und Coumermycin A1 bilden eine interessante Gruppe der Antibiotika. Sie werden durch verschiedene Stämme der Gattung Streptomyces gebildet und greifen, im Gegensatz zu den Chinolonen, die an der A-Untereinheit angreifen, an der B-Untereinheit der bakteriellen Gyrase an (Maxwell und Lawson, 2003). Sie bilden damit einen neuen Ansatzpunkt in der Therapie von Infektionen. Das Aminocoumarin-Antibiotikum Novobiocin (1) ist in den USA als humantherapeutisches Antiinfektivum unter dem Handelsnamen Albamycin® (Pharmacia & Upjohn) zugelassen und ist vorwiegend gegen grampositive Keime wirksam. Wegen der Nebenwirkungen und Verträglichkeitsprobleme wird Novobiocin jedoch hauptsächlich als Reserve-Antibiotikum eingesetzt. Auch im veterinärmedizinischen Bereich wird Novobiocin zusammen mit Penicillin zur Behandlung boviner Mastitis durch Staphylokokken, Streptokokken und gramnegativen Keimen eingesetzt (Thornsberry et al., 1997).

Neben ihrer Wirkung als Antiinfektivum interferieren Aminocoumarine auch mit Prozessen in eukaryotischen Tumorzellen und stellen damit eine Möglichkeit zur Behandlung von Tumoren dar. Es konnte gezeigt werden, dass Aminocoumarine in Kombination mit den Topoisomerase-Inhibitoren Etoposid oder Teniposid deren zytotoxische Wirkung potenzieren können (Lorico et al., 1992; Rappa et al., 1992).

In den letzten Jahren kam es wegen häufiger und falscher Anwendung von Antibiotika zu einer rasanten Resistenzentwicklung bei pathogenen Bakterien. So werden Infektionen durch multiresistente gram-positive Bakterien, wie zum Beispiel Staphylococcus aureus (MRSA) oder Enterococcus faecium immer häufiger. Es besteht deswegen eine dringende Notwendigkeit, neue strukturell unterschiedliche Antibiotika zu finden bzw. herzustellen.

Die Substanzklasse von Aminocoumarinen bildet wegen ihrer Wirksamkeit gegen multiresistente gram-positive Bakterien einen guten Ansatzpunkt für die Herstellung neuer Derivate mit interessanten antimikrobiellen und zytotoxischen Eigenschaften.

Die Aufgabe der vorliegenden Erfindung ist es daher, Aminocoumarine mit neuer Struktur bereitzustellen, die ein breites Wirkungsspektrum und/oder eine antitumorale Wirkung aufweisen. Eine weitere Aufgabe der Erfindung ist es ein Verfahren zur Herstellung dieser Aminocoumarine zur Verfügung zu stellen.

Diese Aufgabe wird durch neue Verbindungen mit der allgemeinen Strukturformel (1) gelöst: worin
R1 eine mono, di- oder trisubstituierte Benzoesäure, eine mono- oder disubstituierte Phenylpropionsäure, Phenylessigsäure, eine mono- oder disubstituierte Zimtsäure ist,
R2 eine Hydroxyl-, Alkylgruppe oder ein Halogen ist;
R3 und R4 gleich oder verschieden sind und unabhängig voneinander für eine Hydroxylgruppe oder eine substituierte Pyrrol-2-carbonsäure der Formel (2) stehen: wobei R5 für eine Methylgruppe, ein Halogen oder eine Halogenmethangruppe stehen kann.

Bevorzugt sind in Formel 1:
R1 eine substituierte 4-Hydroxybenzoesäure,
R2 ein Chloratom oder eine Methylgruppe,
R3 eine Hydroxylgruppe,
R4 eine Pyrrol-2-carbonsäure,
R5 eine Methylgruppe.

Tabelle 1 umfasst einige Beispiele erfindungsgemäßer Verbindungen auf Basis der Aminocoumarinstruktur von Novobiocin, Clorobiocin und Coumermycin A1:

Tabelle 1: Strukturen der neuen Aminocoumarine

Alle Substanzen unterscheiden sich von den bisher bekannten Aminocoumarinen insbesondere durch die Reste R1 und/oder R2.

Des Weiteren sind von der Erfindung alle Stereoisomere der Substanzen mit der Strukturformel (1) eingeschlossen. Diese können sowohl reine Diastereoisomere und Enantiomere, als auch ihre Mischungen sein. Ferner sind tautomere Formen und Salze der Substanzen mit der Strukturformel (1) ebenfalls von de Erfindung umfasst.

Die erfindungsgemäßen Verbindungen weisen für die pharmazeutische Verwendung interessante Eigenschaften auf, wie die umfangreichen Aktivitätstests (s. Ausführungsbeispiel 3) zeigten. Sowohl die Leitstrukturen, die an Position R2 eine Hydroxygruppe und an Position R3 eine 5-Methylpyrrol-2-carbonsäure aufweisen, als auch ihre Isoformen (2) weisen eine Hemmung der bakteriellen Gyrase bzw. eine antibakterielle Aktivität auf, die im Bereich der bisher bekannten Aminocoumarine liegt (Tabellen 2 und 4). Zytotoxische Untersuchungen ergaben, dass die hergestellten Verbindungen teilweise eine geringere Toxizität zeigen, als das aktivste, natürliche Produkt Clorobiocin (Tabelle 3), was ihre Anwendung als Antibiotikum favorisiert. Andere Verbindungen weisen eine höhere Toxizität auf als die ursprünglichen Substanzen, was für ihre Anwendung als Zytostatikum spricht.

Weiterhin betrifft die vorliegende Erfindung die pharmazeutische Verwendung der nach dem erfindungsgemäßen Verfahren hergestellten oder herstellbaren Verbindungen oder ihrer Derivate. Insbesondere betrifft die Erfindung die Verwendung dieser Verbindungen als Antibiotika oder Zytostatika zur Bekämpfung von Krankheiten, die durch Bakterien oder Tumore hervorgerufen werden.

Die aufgeführten neuen Aminocoumarine können erfindungsgemäß im Fütterungsverfahren mit unterschiedlichen Deletionsmutanten oder/und als Nebenprodukte gewonnen werden. Diese Verfahren werden im Folgenden genauer beschrieben.

Zur Herstellung neuer Aminocoumarine wurde ein neues speziell dafür entwickeltes Fütterungsverfahren mit unterschiedlichen Deletionsmutanten eingesetzt. Dieses Verfahren basiert auf dem aus dem Stand der Technik bekannten Mutasynthese-Verfahren (Galm et al., 2004). Die bisherige Limitierung dieses Verfahrens liegt in der Substratspezifität der genutzten Stämme. Um diese Limitierung zu umgehen, wurde das bekannte Verfahren erweitert und modifiziert. Dazu wird beim (Empfänger-)Stamm 2 mindestens ein Gen, das für die Biosynthese einer bestimmten Vorstufe A zuständig ist, inaktiviert. Diese Vorstufe A wird normalerweise in einem Wildtypstamm mit einer weiteren Vorstufe B2 verknüpft. Es kann vorteilhaft sein, das Gen, welches für die Verknüpfung der beiden Vorstufen A und B2 zuständig ist, beim (Empfänger-)Stamm 2 ebenfalls zu inaktivieren. Gleichzeitig wird erfindungsgemäß in den Stamm 2 mindestens ein Gen aus einem weiteren Gencluster eines fremden Produzenten (Spender-)Stamm 1 eingebracht, das für ein Enzym kodiert, welches als Substrat ein Analogon der Vorstufe A hat und ihre Verknüpfung an die Vorstufe B2 ausführt. Der so hergestellte (Empfänger-)Stamm 2 wird zur Produktion neuer Substanzen mit Analoga der Vorstufe A gefüttert, deren Biosynthese im (Empfänger-)Stamm 2 inaktiviert wurde. Dadurch wird im Stamm 2 das Analogon der Vorstufe A an die Vorstufe B2 geknüpft. Diese wiederum kann an eine weitere Vorstufe C2 geknüpft werden, wobei ein neues Produkt entsteht, das in der Natur weder vom Empfänger- noch vom Spender-Stamm produziert wird. Das beschriebene Verfahren bildet die Basis für umfassende Modifikationsmöglichkeiten durch Fütterungsexperimente, wobei die Wahl der Empfänger- und Spender-Stämme sowie der zu inaktivierenden und neu einzubringenden Biosynthese-Gene das Endprodukt bestimmt (3).

Die einzubringenden Gene des Spender-Stamms 1 für die Verknüpfung beider Vorstufen können insbesondere für verschiedene Synthetasen, Transferasen, Ligasen o. ä. kodieren. Diese können beispielsweise Amidsynthetasen oder Glycosyltransferasen sein.

Die zu inaktivierenden Gene des (Empfänger-)Stamms 2 für die Biosynthese einer bestimmten Vorstufe können z. B. für Enzyme für die Biosynthese von Zuckern, Fetten, Aminosäuren und Vorstufen von Sekundärmetaboliten kodieren.

Die Inaktivierung der Gene erfolgt mittels aus dem Stand der Technik bekannten Methoden (PCR-Targeting, Inaktivierung durch Deletion, o. a.).

Die Einführung neuer Gene aus dem Spender-Stamm erfolgt mittels speziell dafür hergestellter Vektoren, insbesondere Plasmide, Cosmide oder BACs.

Die Analoga der Vorstufe A, die zur Fütterung der wie oben beschrieben hergestellten Stamms 2 können z. B. Benzoesäure, mono-, di- oder trisubstituierte Benzoesäuren, Phenylpropionsäure, mono- oder disubstituierte Phenylpropionsäure, Phenylessigsäuren, Zimtsäuren oder mono- oder disubstituierte Zimtsäuren sein.

Die Isolierung und Charakterisierung der neuen Substanzen aus Bakterienkultur erfolgt mit aus dem Stand der Technik bekannten Methoden, z. B. HPLC, 1H-NMR, MS.

Mit dem oben beschriebenen erfindungsgemäßen Verfahren lassen sich z. B. Verbindungen herstellen, die als R2 ein Chloratom oder eine Hydroxygruppe tragen und damit Derivate des Clorobiocins darstellen (Tabelle 1, Ausführungsbeispiel 1).

Der Vorteil des oben beschriebenen erfindungsgemäßen Verfahrens besteht darin, dass durch das Ersetzen der genuinen Enzyme für bestimmte Biosynthesen durch Enzyme aus einem anderen Biosynthese-Gencluster komplett neue Verbindungen hergestellt werden können. Dies bietet die Möglichkeit, strukturell sehr unterschiedliche Derivate füttern zu können, ohne die Limitierung des genuinen Proteins beachten zu müssen.

Alternativ kann zur Herstellung neuer Verbindungen ein abgewandeltes Verfahren der zweistufigen Fütterung verwendet werden. Hierzu wird ein Stamm 1 hergestellt, bei dem mindestens ein Gen für die Herstellung einer bestimmten Vorstufe A inaktiviert ist. Die Vorstufe A wird in einem Wildtypstamm für die Biosynthese der Vorstufe AB1 benötigt, die dann an eine weitere Vorstufe C1 geknüpft wird, wobei das natürliche Produkt entsteht. Durch Downstream-Effekte sind bei diesem Stamm 1 ebenfalls weitere abhängige Biosynthese-Gene inaktiv, was dazu führt, dass im Stamm 1 das natürliche Produkt nicht gebildet wird. Der Stamm 1 wird erfindungsgemäß mit einem Analogon der Vorstufe A gefüttert, wobei eine entsprechend modifizierte Vorstufe mAB1 gebildet wird. In einem zweiten Schritt wird dann ein Extrakt der Kultur dieses so gefütterten Stamms 1 an einen weiteren Stamm 2 gefüttert, der ebenfalls in der Biosynthese der gleichen Vorstufe A defekt ist. Es kann außerdem vorteilhaft sein, wenn der Stamm 2 durch eine Inaktivierung mindestens eines Gens zusätzlich die Verknüpfung des Analogons der Vorstufe A nicht ausführen kann. Im Stamm 2 erfolgt dann die Verknüpfung der modifizierten Vorstufe mAB1 aus dem Stamm 1 mit der eigenen Vorstufe C2 des Stammes 2, die von der Vorstufe C1 des Stammes 1 abweicht. Bei der beschriebenen zweistufigen Fütterung werden somit neue Verbindungen hergestellt, die auf zweifache Weise von den natürlich vorkommenden Verbindungen abweichen: durch die Modifizierung mindestens einer der Vorstufen, und durch die Verknüpfung zweier Vorstufen aus unterschiedlichen Organismen (4).

Mit diesem alternativen Verfahren der zweistufigen Fütterung können beispielsweise Derivate hergestellt werden, die als R2 eine Methylgruppe tragen (4, Tabelle 1, Ausführungsbeispiel 2).

Zur Herstellung der Derivate, die an R2 unsubstituiert sind (Tabelle 1), können erfindungsgemäß sowohl das Fütterungsverfahren mit unterschiedlichen Deletionsmutanten als auch das Verfahren der zweistufigen Fütterung verwendet werden.

Weitere Vorteile, Merkmale und Anwendungsmöglichkeiten der Erfindung werden nachstehend anhand der Ausführungsbeispiele mit Bezug auf die Zeichnungen beschrieben. In den Zeichnungen zeigen:

1: Strukturen der Aminocoumarinantibiotika Clorobiocin, Novobiocin und Coumermycin A1;

2: Leitstruktur der Aminocoumarin-Antibiotika und ihre Isoform;

3: Ein Beispiel des erfindungsgemäßen Verfahrens der einstufigen Fütterung, wobei das in den Empfänger-Stamm eingebrachte Gen aus dem Spender-Stamm eine Amidsynthetase ist;

4: Ein Beispiel des erfindungsgemäßen Verfahrens der zweistufigen Fütterung.

AusführungsbeispieleAllgemeine Methoden:Chemikalien

Ring A-Analoga wurden von Aldrich, Fluka, Lancaster Merck und Sigma gekauft. Zusätzlich wurden substituierte Benzoesäure-Derivate verwendet, die von M. A. Dessoy synthetisiert wurden (Dessoy, 2003).

Genetische Methoden

Escherichia coli XL1Blue MRF' (Stratagene, Heidelberg, Deutschland), BW25113 (Datsenko und Wanner, 2000) und ET12567 (MacNeil et al., 1992) wurden für die Klonierungen benutzt.

Das REDIRECT Technology Kit für das PCR Targeting wurde von Plant Bioscience Limited (Norwich, UK) erhalten.

Standardmethoden für DNA Isolation und Manipulation wurden ausgeführt wie von Sambrook et al. (Sambrook und Russell, 2001) und Kieser et al. (Kieser et al., 2000) beschrieben. Die Isolation von Cosmiden und Plasmiden wurde mit Ionenaustauschersäulen (Nucleobond AX Kit; Macherey-Nagel) durchgeführt. Genomische DNA wurde von Streptomyces Stämmen durch Lysozymebehandlung und Phenol/Chloroform Extraktion isoliert wie von Kieser et al. (Kieser et al., 2000) beschrieben.

Southern Blot Analyse wurde auf Hybond-N Nylon Membran (Amersham, Braunschweig, Deutschland) ausgeführt mit Digoxigenin-gelabelten Sonden, die durch das DIG High Prime DNA Labelling Kit (Roche Molecular Biochemicals) erhalten wurden.

Konstruktion der Plasmide pMS91 und pSH2

Der E. coli-Streptomyces Shuttlevektor pUWL201, der den ermE* Promoter trägt, wurde für die Konstruktion der Expressionsplasmide pMS91 und pSH2 verwendet.

pMS91

Für die Konstruktion von pMS91 wurde couL durch PCR amplifiziert. Eine HindIII-Schnittstelle wurde vor dem Startcodon eingebracht. Der Primer cumG1 (5'-CCGCTGCCCAAGCTTGAGTGCCTC-3') wurde hierfür genutzt. Am C-Terimnus wurde eine XbaI-Schnittstelle nach dem Stopcodon eingebracht, indem der Primer cumG2 (5'-CGGGCAGGCTCTAGAACAGCACTC-3') benutzt wurde. Die hervorgehobenen Buchstaben kennzeichnen die Schnittstellen. Das resultierende PCR-Fragment wurde mit HindIII und XbaI verdaut und in pUWL201 einkloniert, resultierend im Plasmid pMS91.

pSH2

Das Gen simL wurde durch einen NotI-Verdau des Cosmides VII-8g, das aus S. antibioticus Tü 6040 (Galm et al., 2002) isoliert wurde, erhalten und in pcDNA2.1 (Invitrogene, La Jolla, California, USA) einkloniert. Nachdem das resultierende Plasmid pTLsimLfori auf die richtige Orientierung überprüft wurde, wurde das Plasmid mit XbaI und HindIII verdaut und in pUWL201 einkloniert, resultierend im Plasmid pSH2.

Produktion und Isolation von neuen Aminocoumarinen

Um neue Aminocoumarine zu produzieren wurden die verschiedenen Stämme kultiviert wie beschrieben (Galm et al., 2004).

Für Fütterungexperimente wurde 1 mg des Analogons A oder des Analogons B2 in 200 μl Ethanol gelöst und zu 80 ml der Kultur mit den entsprechenden Antibiotika zum Punkt der Inokulation ins Produktionsmedium gegeben, gefolgt von einer Kultivierung für 7–10 Tage bei 33°C und 210 rpm.

Isolierung und Analytik

Für analytische Zwecke wurde 1 ml Bakterienkultur mit HCl auf pH 4 eingestellt und zweimal mit Ethylacetat extrahiert. Nach dem Eindampfen des Lösungsmittels wurde der Rückstand in 100 μl Methanol aufgenommen. Nach Zentrifugation wurden 80 μl des Überstandes per HPLC analysiert. Dafür wurde eine Agilent Eclipse XDB-C18 Säule (5 μm, 150 × 4,6 mm) mit einer Flussrate von 1 ml min–1 verwendet.

Für den Nachweis der Clorobiocin-Derivate wird ein linearer Gradient von 60% zu 100% Fließmittel B (Fließmittel A = MeOH/H2O/HCOOH 20:79:1; Fließmittel B = MeOH/HCOOH 99:1) über 28 min wurde zur Trennung verwendet, gefolgt von der Elution mit 100% Fließmittel B für 3 min und Equilibration mit 60% Fließmittel B für 6 min; die UV-Detektion wurde bei 340 nm durchgeführt. Clorobiocin (Aventis) wurde als Standard benutzt.

Für den Nachweis der Analoge B2 wurden 100 μl des klaren, abzentrifugierten Kulturüberstandes mit HPLC analysiert. Dafür wurde eine Agilent Eclipse XDB-C18 Säule (5 μm, 150 × 4,6 mm) mit einer Flussrate von 1 ml min–1 verwendet. Ein linearer Gradient von 60% zu 100% Fließmittel B (Fließmittel A = H2O/HCOOH 99:1; Fließmittel B = MeOH/HCOOH 99:1) über 37 min wurde hierbei für die Trennung benutzt, gefolgt von der Elution mit 100% Fließmittel B für 5 min und anschließender Equilibration mit 60% Fließmittel B für 5 min; die UV-Detektion bei 305 nm durchgeführt. Novobiocinsäure wurde als Standard benutzt.

Für die präparative Isolation der Produkte wurde die Isolierung wie beschrieben in (Galm et al., 2004) durchgeführt.

Im Fall der zweistufigen Fütterungen wurde die Extraktion mit Petrolether und die Passage über die Sephadex LH-20 (Amersham, Braunschweig, Deutschland) Säule nicht durchgeführt.

Strukturaufklärung und Charakterisierung

Die Produkte wurden mit 1H-NMR Spektroskopie und LC-MS/MS Analyse identifiziert. Positive electrospray ionisation (ESI) Massenspektren wurden von einem Finnigan TSQ Quantum Gerät (Electrospray-Spannung 3 kV; Kapillartemperatur 320°C; Schutz- und Hilfsgas: Stickstoff) ausgerüstet mit einer Nucleosil 120 RP ODS Säule (8 μm, 2 × 250 mm, Macherey-Nagel) erhalten.

Zur Trennung wurde ein Gradient genutzt, der die Fließmittel Actonitril und Wasser (jeweils mit 0,1% HCOOH) nutzt. Der Gradient flutet von 0% Acetonitril zu 50% Acetonitril über 20 min an, gefolgt von der Elution mit 100% Acetonitril für 5 min und Equilibration mit 100% Wasser (mit 0,1% HCOOH) für 4 min; Flußrate 0,2 ml min–1; Die collision-induced dissociation (CID) Spektren während des HPLC-Laufs wurden mit der Kollisionsenergie +25 eV, Kollisionsgas Argon, und Kollisionsdruck 1,0 × 10–3 torr (133 mPa) aufgenommen.
1H-NMR Spektren wurden an einem Avance 400 Spektrometer (Bruker, Karlsruhe, Deutschland) mit CD3OD als Lösungsmittel aufgenommen (400 MHz; br, breit).

Beispiel 1: Herstellung von Derivaten mit R2 = Cl (Grundstruktur des Clorobiocins)

Zur Herstellung dieser Derivate wurde eine Mutante des Clorobiocinproduzenten Streptomyces roseochromogenes varietas oscitans DS 12.976 angefertigt. Dazu wurde ein Cosmid benutzt, das das gesamte Biosynthesegenecluster enthält. In diesem Cosmid wurden die Gene der Amidsynthetase cloL und der Prenyltransferase cloQ inaktiviert und das Cosmid anschließend heterolog in Streptomyces coelicolor M512 exprimiert. Diese Mutante ist defekt in der Biosynthese der prenylierten Benzoesäure-Einheit. Außerdem ist auch eine Verknüpfung eines Analogons dieser Einheit nicht mehr möglich (Stamm 2).

Herstellung des Stamms 2:Inaktivierung von cloL und cloQ im Cosmid clo-BG1 und heterologe Expression in S. coelicolor M512

Im Cosmid clo-BG1 (Eustáquio et al., 2005) wurden cloL und cloQ nacheinander durch die Apramycin-Resistenzkassette (aac(3)IV), die durch XbaI und SpeI flankiert wird, durch die λ RED-vermittelte Rekombination ersetzt. Die Apramycin-Resistenzkassette zum Ersetzten von cloL wurde durch PCR Amplifikation hergestellt, in dem die Primer cloL_for (5'-AGCGGAAGTACCTCTACTTCGCGAAAGGTAGTCACTGGTGATTCCGGGGATC TCTAGATC-3') und cloL_rev (5'-CATCGAATGACTCACCTCACCTGTCCACCAGCACGTCCGGACTAGTCTGGAGC TGCTTC-3') verwendet wurden. Die hervorgehobenen Buchstaben kennzeichnen die homologen Bereiche zur DNA-Region upstream und downstream von cloL. Die kursiven Buchstaben kennzeichnen die XbaI- und SpeI-Schnittstelle. Die PCR-Amplifikation wurde in 50 μl Volumen mit 50 ng Template, 0,2 mM dNTPs, 50 pmol jedes Primers und 5% (v/v) DMSO mit dem Expand High Fidelity PCR System (Roche Molecular Biochemicals) durchgeführt: Denaturierung bei 94°C für 2 min, dann 10 Zyklen mit Denaturierung bei 94°C für 45 s, Annealing bei 50°C für 45 s und Elongation bei 72°C für 90 s, gefolgt von 15 Zyklen mit Annealing bei 55°C für 45 s, und dem letzten Elongationsschritt bei 72°C für 5 min. Das PCR-Produkt wurde durch Elektroporation in E. coli BW25113/pIJ790 eingebracht, der das Cosmid clo-BG1 (Gust et al., 2003) beinhaltete. Das modifizierte Cosmid wurde isoliert und zur Entfernung der Apramycin-Resistenzkassette in E. coli ET12567 eingebracht. Nach anschließender Isolation wurde es mit XbaI und SpeI verdaut und religiert, resultierend im Cosmid clo-CA3.

Zur Inaktivierung von cloQ wurde die Apramycin-Resistenzkassette mit den Primern cloQ_for (5'-GGCGCGCCCATTGCTCACCGTCTTACCGACACCGTCCTTATTCCGGGGATCTCTAGATC-3') und cloQ_rev (5'-CCCATGGTCGATTCCGTGTGTTGGTGAAGTGCGCGCAGACTAGTCTGGAGCT GCTTC-3') amplifiziert. Die PCR wurde ausgeführt wie bei der Inaktivierung von cloL beschrieben ausgeführt. Das PCR-Produkt wurde durch Elektroporation in E. coli BW25113/pIJ790 eingebracht, der schon das Cosmid clo-CA3 trägt. Auch diesmal wurde, wie oben beschrieben, die Apramycin-Resistenzkassette wieder entfernt. Das resultierende Cosmid tragt den Namen clo-CA5.

Das Cosmid clo-CA5, das aus E. coli ET12567 isoliert wurde, wurde in S. coelicolor M512 durch PEG-vermittelte Protoplastentransformation (Kieser et al., 2000) eingebracht. Es resultiert Stamm 2.

Die Amidsynthetasegene simL (pSH2) aus dem Gencluster des Stammes Streptomyces antibioticus Tü6040 bzw. couL (pMS91) aus dem Gencluster des Stammes Streptomyces rishiriensis DSM 40489 wurden darauf hin durch PEG-vermittelte Protoplastentransformation (Kieser et al., 2000) in den Stamm 2 eingebracht.

Aufgrund erfolgreich durchgeführter Amidsynthetase-Assays (Galm et al., 2004; Luft et al., 2005) wurden an die Mutante mit der entsprechenden Amidsynthetase verschiedenen Analoga der prenylierten Benzoesäure-Einheit gefüttert, die zu neuen Strukturen auf Basis des Clorobiocins führten (3).

Beispiel der Fütterung von 3,5-Dimethyl-4-hydroxybenzoesäure zum Stamm 2 mit pMS91

Stamm 2 mit pMS91 wurde aus einer Dauerkultur in 50 ml YMG-Medium mit 12,5 μg/ml Kanamycin und 12,5 μg/ml Thiostrepton in einem 300 ml Erlenmeyerkolben mit 2 Schikanen und Spirale angeimpft. Die Kultur wurde 2 Tage bei 30°C und 180 rpm kultiviert. 1 ml der ersten Vorkultur wurde in 50 ml Cornstarch-Medium mit 12,5 μg/ml Kanamycin und 12,5 μg/ml Thiostrepton in einem 300 ml Erlenmeyerkolben mit 2 Schikanen und Spirale umgeimpft und erneut bei 2 Tage bei 30°C und 180 rpm kultiviert. 5 ml dieser Vorkultur wurden dann in 80 ml Distillers solubles-Medium mit 12,5 μg/ml Kanamycin in 500 ml Erlenmeyerkolben mit 2 Schikanen und Spirale umgeimpft und je Kolben mit 1 mg 3,5-Dimethyl-4-hydroxybenzoesäure, gelöst in 200 μl Ethanol, gefüttert und 8 Tage bei 33°C und 180 rpm kultiviert. Insgesamt wurden 10 Kolben mit Produktionskultur kultiviert und anschließend die Produkte Novclobiocin 201, 202 und 203 isoliert und identifiziert.

Ebenso wurden die neuen Novclobiocine 371, 372, 601, 602, 603, 701, 702, 731, 741 und 742 hergestellt. Produkte 741 und 742 sind nicht durch eine Fütterung des entsprechenden Analogons gebildet worden sondern als Nebenprodukte natürlicherweise von der Mutante produziert worden.

Beispiel 2: Herstellung von Derivaten mit R2 = CH3

Ausgangspunkt für diese Fütterung bildet der Stamm 1, eine Mutante des Novobiocin-Produzenten, in der die Prenyltransferase novQ inaktiviert wurde. Die Biosynthese der prenylierten-Benzoesäure-Einheit fällt aus und damit die Produktion von Novobiocin. Durch Downstream-Effekte sind ebenfalls die Zuckerbiosynthese-Gene inaktiv. Nach Zufütterung eines Analogons der prenylierten Benzoesäure-Einheit kann eine Bildung des entsprechenden Aglykons beobachtet werden. In einem zweiten Schritt wurde dann ein Extrakt dieser Kultur an den Stamm 1, eine Mutante des Clorobiocin-Produzenten, gefüttert. Diese Mutante ist ebenfalls defekt in der Biosynthese der prenylierten Benzoesäure-Einheit. Außerdem kann diese Mutante keine Verknüpfung eines Analogons dieser Einheit ausführen. Diese Mutante produziert dann das entsprechende Endprodukt (4).

Herstellung von Stamm 1.Inaktivierung von novQ im Cosmid nov-BG1 und heterologe Expression in S. coelicolor M512

Im Cosmid nov-BG1 (Eustáquio et al., 2005) wurde novQ mittels λ RED-vermittelte Rekombination durch die Apramycin-Resistenzkassette (aac(3)IV), die durch XbaI und SpeI Schnittstellen flankiert ist ersetzt. Diese Kassette wurde deshalb mit den Primern novQ_P01f (5'-A CCGGTAATTCACTGTGAGTTGATCACGGAGGAATTCATGATTCCGGGGATCTCTAGATC-3') und novQ_P01rev (5'-AGTCGTCTCCGGGCATGTTCGCCAGAGCCTCGCTCATCGACTAGTCTGGAGCT GCTTC-3') amplifiziert. Die hervorgehobenen Buchstaben kennzeichnen die homologen Bereiche zur DNA-Region upstream und downstream von novQ. Die kursiven Buchstaben kennzeichnen die XbaI- und SpeI-Schnittstelle. Die PCR-Amplifikation wurde durchgeführt wie bei der Inaktivierung von cloQ und cloL in clo-BG1 beschrieben. Das PCR-Produkt wurde durch Elektroporation in E. coli BW25113/pIJ790 eingebracht, der das Cosmid nov-BG1 (Gust et al., 2003) beinhaltet. Im modifizierten Cosmid wurde wieder die Kassette wie oben beschrieben entfernt. Das neue Cosmid trägt die Bezeichnung nov-CA7.

Nachdem das Cosmid nov-CA7 aus E. coli ET12567 isoliert wurde, wurde es in S. coelicolor M512 durch PEG-vermittelte Protoplastentransformation (Kieser et al., 2000) eingebracht (Stamm 1).

Beispiel der Fütterung von Zimtsäure

Zur Herstellung der Analoge B2 der Zimtsäure wurde in den Stamm 1, S. coel. (nov-CA7), das Plasmid pSH2 durch PEG-vermittelte Protoplastentransformation (Kieser et al., 2000) eingebracht. Er wurde daraufhin in 50 ml TSB Flüssigmedium (Kieser et al., 2000) mit 12,5 μg/ml Kanamycin und 12,5 μg/ml Thiostrepton in einem 300 ml Erlenmeyerkolben mit 2 Schikanen und Spirale angeimpft bei 30°C und 180 rpm für 3 Tage kultiviert. Zellen davon (1 ml Kultur) wurden dann in 50 ml CDM Medium (Kominek, 1972) mit den 12,5 μg/ml Kanamycin und 12,5 μg/ml Thiostrepton überführt und bei 30°C und 180 rpm für 4 Tage kultiviert. 5 ml von dieser Vorkultur wurden in 50 ml CDM Produktionsmedium mit 12,5 μg/ml Kanamycin und 12,5 μg/ml Thiostrepton umgeimpft mit 1 mg Zimtsäure gefüttert, die in 200 μl Ethanol gelöst wurde. Die Kultivierung wurde für 8 Tage bei 30°C und 180 rpm durchgeführt. Nach Extraktion der Kultur wurde der zweite Schritt der Fütterung durchgeführt.

Dazu wurde der Stamm 2 wurde aus einer Dauerkultur in 50 ml YMG-Medium mit 12,5 μg/ml Kanamycin in einem 300 ml Erlenmeyerkolben mit 2 Schikanen und Spirale angeimpft. Die Kultur wurde 2 Tage bei 30°C und 180 rpm kultiviert. 1 ml der ersten Vorkultur wurde in 50 ml Cornstarch-Medium mit 12,5 μg/ml Kanamycin in einem 300 ml Erlenmeyerkolben mit 2 Schikanen und Spirale umgeimpft und erneut bei 2 Tage bei 30°C und 180 rpm kultiviert. 5 ml dieser Vorkultur wurden dann in 80 ml Distillers solubles-Medium mit 12,5 μg/ml Kanamycin in 500 ml Erlenmeyerkolben mit 2 Schikanen und Spirale umgeimpft und je Kolben mit Extrakt mit etwa 1 mg der Vorstufe mAB1, gelöst in 200 μl Ethanol, gefüttert und 8 Tage bei 33°C und 180 rpm kultiviert. Anschließend wurden die Produkte Novclobiocin 704 und Novclobiocinsäure 705 isoliert und identifiziert.

Ebenso wurden die neuen Novclobiocin 204, 205, 217, 218, 219, 219A, 225, 226, 227, 228, 314, 315, 384, 385, 606 und 607 hergestellt.

Beipiel 3: Testung der DerivateTestung der gyrasehemmenden Aktivität (Triplex-Assay)

Der Triplex-Formation-Assay wurde wie in (Maxwell et al., 2006) beschrieben durchgeführt. Er setzt sich zusammen aus 1 μg relaxed pNO1, 35 mM Tris-HCl (pH 7,5), 24 mM KCl, 4 mM MgCl2, 2 mM DTT, 1,8 mM Spermidin, 1 mM ATP, 6,5% (w/v) Glycerol und 0,1 mg mL–1 BSA in einem Volumen von 30 μl und wurde in schwarzen Streptavidin-beschichteten 96 Well Microtiterplatten (Pierce) durchgeführt. Die Inhibitoren wurden zu den Reaktionen in Konzentrationen zwischen 0,01 und 100 μM zugegeben mit einer Endkonzentration von Dimethylsulfoxide (DMSO) von 1% (v/v). Die Reaktionen wurden mit der Zugabe von 10 nM GyrA und 9,3 nM GyrB gestartet und die Assays bei 37°C für 30 min inkubiert. SigmaPlot Version 10 wurde zur Auswertung benutzt. Die Ergebnisse dieser Testung sind in der Tabelle 2 zusammengefasst.

Bestimmung der zytotoxischen Aktivität

Die Bestimmung wurde mit Namalwa-Zellen mit einer 48 h Inkubation durchgeführt. Die Ergebnisse dieser Testung sind in der Tabelle 3 zusammengefasst.

Bestimmung der antimikrobiellen Eigenschaften

Die antimikrobiellen Eigenschaften wurden nach den US Laborstandard–Methoden des Nationalen Komitee für klinische Laborstandards (NCCLS) geprüft (National Committee for Clinical Laboratory Standards, 2003). Die Ergebnisse dieser Testung sind in der Tabelle 4 zusammengefasst. Anhang 1:MS-Daten der neuen Produkte

DerivatMW[M+H]+[M-RingC]+[RingA]+[RingC]+[Pyrrol-Einheit]+Novclobiocin 201656.2657.3n. d.149.0282.2108.0Novclobiocin 202656.2657.3n. d.149.0282.1108.0Novclobiocin 203622.2623.6n. d.149.0282.2108.0Novclobiocin 204529.2530.3356.1149.0--Novclobiocinsäure 206341.1342.2-149.0--Novclobiocin 217650.2651.4370.1163.0282.1108.0Novclobiocin 218650.3651.8370.2163.0282.1n. d.Novclobiocin 219543.2544.3370.2163.0--Novclobiocinsäure 219A369.1370.1-163.1--Novclobiocin 225648.2649.4368.1161.0282.1108.0Novclobiocin 226648.2649.6368.2161.0282.2108.0Novclobiocin 227541.2542.5368.2161.0282.1-Novclobiocinsäure 228367.1368.2-161.0--Novclobiocin 314638.2639.3358.1151.0282.1108.0Novclobiocin 315531.2532,2358.1151.0--Novclobiocin 371658.1659.3n. d.151.0282.2108.0Novclobiocin 372658.1659.5n. d.n. d.n. d.n. d.Novclobiocin 384621.2622.3341.1134.0282.1108.0Novclobiocin 385621.2622.6341.1134.0282.1108.0Novclobiocin 601612.2613.2332.0105.0282.1108.0Novclobiocin 602612.2613.2n. d.105.0282.2108.0Novclobiocin 603578.2579.2n. d.105.0282.1108.0Novclobiocin 606485.2486.6312.1105.0--Novclobiocinsäure 607311.1312.1-105.0--Novclobiocin 701638.2639.2357.9131.0282.0108.0Novclobiocin 702638.2639.4n. d.131.1282.2108.1Novclobiocin 704511.2512.6338.1131.0--Novclobiocinsäure 705323.1324.1-131.2--Novclobiocin 731684.2685.3404.1177.0282.1108.0Novclobiocin 741688.2689.2-181.1281.6108.0Novclobiocin 742654.2655.3-181.0282.2108.0
  • n. d. nicht detektierbar

1H-NMR-Daten der neuen Produkte

  • 1H-NMR Daten (400 MHz; CD3OD; br, breit) folgen.

Novclobiocin 201

  • δ 1.20 (s, 3H-6''), 1.37 (s, 3H-7''), 2.27 (s, 3H-7 und 3H-8), 2.29 (s, 3H-6'''), 3.51 (s, 3H-8''), 3.69 (d, J = 9.9 Hz, H-4''), 4.24 (br s, H-2''), 5.50 (dd, J1 = 9.9 Hz, J2 = 2.2 Hz, H-3''), 5.63 (br s, H-1''), 5.94 (d, J = 3.5 Hz, H-4'''), 6.90 (d, J = 3.5 Hz, H-3'''), 7.07 (br s, überlappende Signale, J nicht bestimmbar, H-8' und H-6'), 7.63 (s, H-2 und H-6), 7.90 (d, J = 6.8 Hz, H-5').

Novclobiocin 202

  • δ 1.18 (s, 3H-6''), 1.35 (s, 3H-7''), 2.26 (s, 3H-7 und 3H-8), 2.29 (s, 3H-6'''), 3.52 (s, 3H-8''), 3.72 (d, J = 10.3 Hz, H-4''), 4.34 (br s, H-2''), 5.70 (dd, J1 = 10.3 Hz, J2 = 3.3 Hz, H-3''), 5.72 (br s, H-1''), 5.93 (d, J = 3.6 Hz, H-4'''), 6.90 (d, J = 3.6 Hz, H-3'''), 7.31 (d, J = 8.8 Hz, H-6'), 7.63 (s, H-2 und H-6), 7.88 (d, J = 8.8 Hz, H-5').

Novclobiocin 203

  • δ 1.17 (s, 3H-6''), 1.38 (s, 3H-7''), 2.26 (s, 3H-7 und 3H-8), 2.30 (s, 3H-6'''), 3.65 (s, 3H-8''), 3.56 (d, J = 9.6 Hz, H-4''), 4.44 (dd, J1 = 9.6 Hz, J2 = 2.8 Hz, H-3''), 5.41 (br s, H-2''), 5.82 (br s, H-1''), 5.95 (d, J = 3.4 Hz, H-4'''), 6.90 (d, J = 3.4 Hz, H-3'''), 7.30 (d, J = 5.6 Hz, H-6'), 7.62 (s, H-2 und H-6), 7.85 (d, J = 6.4 Hz, H-5').

Novclobiocin 204

  • δ 1.10 (s, 3H-6''), 1.32 (s, 3H-7''), 2.27 (s, 3H-7, 3H-8 und 3H-8'), 3.59 (s, 3H-8''), 3.39 (d, J = 9.6 Hz, H-4''), 4.07 (t, J = 3.4 Hz, H-2''), 4.16 (dd, J1 = 9.6 Hz, J2 = 3.4 Hz, H-3''), 5.55 (d, J = 1.2 Hz, H-1''), 7.17 (d, J = 9.0 Hz, H-6'), 7.65 (s, H-2 und H-6), 7.82 (d, J = 9.0 Hz, H-5').

Novclobiocinsäure 206

  • δ 2.27 (s, 3H-7 und 3H-8), 6.69 (s, H-8'), 7.63 (s, H-2 und H-6), 6.79 (d, J = 7.8 Hz, H-6'), 7.81 (d, J = 7.8 Hz, H-5').

Novclobiocin 217

  • δ 0.97 (t, J = 7.4 Hz, 3H-9), 1.19 (s, 3H-6''), 1.37 (s, 3H-7''), 1.66 (sext., J = 7.4 Hz, 2H-8), 2.29 (s, 3H-6'''), 2.34 (s, 3H-8'), 2.63 (t, J = 7.4 Hz, 2H-7), 3.53 (s, 3H-8''), 3.71 (d, J = 10.0 Hz, H-4''), 4.28 (br s, H-2''), 5.62 (d, J = 2.0 Hz, H-1''), 5.67 (dd, J1 = 10.0 Hz, J2 = 3.2 Hz, H-3''), 5.94 (d, J = 3.8 Hz, H-4'''), 6.83 (d, J = 8.6 Hz, H-5), 6.90 (d, J = 3.8 Hz, H-3'''), 7.21 (d, J = 8.8 Hz, H-6'), 7.73 (d, J = 8.6 Hz, H-6), 7.79 (s, H-2), 7.83 (d, J = 8.8 Hz, H-5').

Novclobiocin 218

  • δ 0.96 (t, J = 7.4 Hz, 3H-9), 1.19 (s, 3H-6''), 1.42 (s, 3H-7''), 1.65 (sext., komplexes und breites Signal, J nicht bestimmbar, 2H-8), 2.29 (s, 3H-6'''), 2.28 (s, 3H-8'), 2.62 (t, J = 7.4 Hz, 2H-7), 3.63 (s, 3H-8''), 3.51 (d, J = 9.2 Hz, H-4''), 4.41 (dd, J1 = 9.2 Hz, J2 = 3.2 Hz, H-3''), 5.37 (t, J = 2.6 Hz, H-2''), 5.69 (d, J = 2.6 Hz, H-1''), 5.94 (d, J = 3.8 Hz, H-4'''), 6.81 (d, J = 8.4 Hz, H-5), 6.88 (d, J = 3.8 Hz, H-3'''), 7.15 (d, J = 8.8 Hz, H-6'), 7.72 (d, J = 8.4 Hz, H-6), 7.78 (s, H-2), 7.81 (d, J = 8.8 Hz, H-5').

Novclobiocin 219

  • δ 0.96 (t, J = 7.4 Hz, 3H-9), 1.10 (s, 3H-6''), 1.32 (s, 3H-7''), 1.65 (sext., J = 7.4 Hz, 2H-8), 2.22 (s, 3H-8'), 2.62 (t, J = 7.4 Hz, 2H-7), 3.59 (s, 3H-8''), 3.39 (d, J = 9.6 Hz, H-4''), 4.07 (br s, H-2''), 4.12 (dd, J1 = 9.6 Hz, J2 = 3.6 Hz, H-3''), 5.55 (d, J = 1.6 Hz, H-1''), 6.82 (d, J = 8.6 Hz, H-5), 7.17 (d, J = 9.0 Hz, H-6'), 7.72 (d, J = 8.6 Hz, H-6), 7.79 (s, H-2), 7.81 (d, J = 9.0 Hz, H-5').

Novclobiocinsäure 219A

  • δ 0.97 (t, J = 7.8 Hz, 3H-9), 1.66 (sext., J = 7.8 Hz, 2H-8), 2.26 (s, 3H-8'), 2.63 (t, J = 7.8 Hz, 2H-7), 6.82 (d, J = 8.6 Hz, H-5), 6.84 (d, J = 8.8 Hz, H-6'), 7.72 (dd, J1 = 8.6 Hz, J2 = 1.6 Hz, H-6), 7.78 (d, J = 1.6 Hz, H-2), 7.65 (d, J = 8.8 Hz, H-5').

Novclobiocin 225

  • δ 1.19 (s, 3H-6''), 1.36 (s, 3H-7''), 2.29 (s, 3H-6'''), 2.34 (s, 3H-8'), 3.40 (d, J = 6.4 Hz, 2H-7), 3.52 (s, 3H-8''), 3.71 (d, J = 10.0 Hz, H-4''), 4.28 (br s, H-2''), 5.03 (d, J = 10.0 Hz, H-9a trans), 5.07 (dd, J1 = 18.8 Hz, J2 = 1.2 Hz, H-9a cis), 5.62 (d, J = 1.6 Hz, H-1''), 5.67 (dd, J1 = 10.0 Hz, J2 = 3.2 Hz, H-3''), 5.94 (d, J = 3.6 Hz, H-4'''), 6.05 (m, H-8), 6.85 (d, J = 8.4 Hz, H-5), 6.90 (d, J = 3.6 Hz, H-3'''), 7.20 (d, J = 8.8 Hz, H-6'), 7.76 (d, J = 8.4 Hz, H-6), 7.79 (s, H-2), 7.82 (d, J = 8.8 Hz, H-5').

Novclobiocin 226

  • δ 1.19 (s, 3H-6''), 1.42 (s, 3H-7''), 2.28 (s, 3H-8'), 2.29 (s, 3H-6'''), 3.40 (d, J = 6.8 Hz, 2H-7), 3.51 (d, J = 9.0 Hz, H-4''), 3.63 (s, 3H-8''), 4.41 (dd, J1 = 9.0 Hz, J2 = 3.2 Hz, H-3''), 5.02 (d, J = 10.4 Hz, H-9a trans), 5.06 (dd, J1 = 17.2 Hz, J2 = 2.0 Hz, H-9a cis), 5.37 (t, J = 2.6 Hz, H-2''), 5.69 (d, J = 2.6 Hz, H-1''), 5.94 (d, J = 3.6 Hz, H-4'''), 6.03 (m, H-8), 6.84 (d, J = 8.4 Hz, H-5), 6.88 (d, J = 3.6 Hz, H-3'''), 7.16 (d, J = 8.8 Hz, H-6'), 7.75 (d, J = 8.4 Hz, H-6), 7.79 (s, H-2), 7.81 (d, überlappendes Signal, J nicht bestimmbar, H-5').

Novclobiocin 227

  • δ 1.10 (s, 3H-6''), 1.32 (s, 3H-7''), 2.27 (s, 3H-8'), 3.38 (d, J = 9.2 Hz, 2H-7), 3.59 (s, 3H-8''), 3.40 (d, überlappendes Signal, J nicht bestimmbar, H-4''), 4.07 (br s, H-2''), 4.16 (dd, J1 = 9.6 Hz, J2 = 3.2 Hz, H-3''), 5.02 (d, J = 10.0 Hz, H-9a trans), 5.06 (d, J1 = 17.6 Hz, H-9a cis), 5.55 (d, J = 2.0 Hz, H-1''), 6.03 (m, H-8), 6.84 (d, J = 8.4 Hz, H-5), 7.17 (d, J = 8.8 Hz, H-6'), 7.75 (d, J = 8.4 Hz, H-6), 7.79 (s, H-2), 7.81 (d, überlappendes Signal, J nicht bestimmbar, H-5').

Novclobiocinsäure 228

  • δ 2.26 (s, 3H-8'), 3.40 (d, J = 6.4 Hz, 2H-7), 5.02 (d, J = 10.8 Hz, H-9a trans), 5.07 (d, J1 = 18.0 Hz, H-9a cis), 6.03 (m, H-8), 6.78 (d, J = 8.8 Hz, H-5), 6.85 (d, J = 8.2 Hz, H-6'), 7.67 (d, J = 8.8 Hz, H-6), 7.78 (s, H-2), 7.75 (d, J = 8.2 Hz, H-5').

Novclobiocin 314

  • δ 1.20 (s, 3H-6''), 1.36 (s, 3H-7''), 2.29 (s, 3H-6'''), 2.33 (s, 3H-8'), 3.52 (s, 3H-8''), 3.70 (d, J = 9.9 Hz, H-4''), 3.92 (s, 3H-7), 4.28 (t, J = 2.8 Hz, H-2''), 5.68 (dd, J1 = 9.9 Hz, J2 = 3.0 Hz, H-3''), 5.60 (d, J = 2.8 Hz, H-1''), 5.94 (d, J = 4.1 Hz, H-4'''), 6.84 (d, J = 8.1 Hz, H-5), 6.90 (d, J = 4.1 Hz, H-3'''), 7.13 (d, J = 9.1 Hz, H-6'), 7.54 (dd, J1 = 8.1 Hz, J2 = 2.0 Hz, H-6), 7.64 (d, J = 2.0 Hz, H-2), 7.13 (d, J = 9.1 Hz, H-5').

Novclobiocin 315

  • δ 1.11 (s, 3H-6''), 1.32 (s, 3H-7''), 2.37 (s, 3H-8'), 3.59 (s, 3H-8''), 3.38 (d, J = 9.4 Hz, H-4''), 3.92 (s, 3H-7), 4.07 (t, J = 2.4 Hz, H-2''), 4.16 (dd, J1 = 9.4 Hz, J2 = 3.0 Hz, H-3''), 5.53 (br s, H-1''), 6.84 (d, J = 8.4 Hz, H-5), 7.11 (d, J = 8.5 Hz, H-6'), 7.54 (dd, J1 = 8.4 Hz, J2 = 1.8 Hz, H-6), 7.64 (d, J = 2.3 Hz, H-2), 7.86 (d, J = 8.5 Hz, H-5').

Novclobiocin 371

  • δ 1.20 (s, 3H-6''), 1.35 (s, 3H-7''), 2.30 (s, 3H-6'''), 3.51 (s, 3H-8''), 3.71 (d, J = 10.0 Hz, H-4''), 2.51 (s, 3H-7), 4.34 (br s, H-2''), 5.69 (br s, H-1''), 5.72 (dd, J1 = 10.0 Hz, J2 = 3.0 Hz, H-3''), 5.94 (d, J = 3.8 Hz, H-4'''), 6.91 (d, J = 3.8 Hz, H-3'''), 7.20 (d, J = 8.4 Hz, H-6'), 7.28 (d, J = 8.0 Hz, H-2 und H-6), 7.89 (d, J = 8.4 Hz, H-5'), 7.92 (d, J = 8.1 Hz, H-3 und H-5).

Novclobiocin 372

  • δ 1.18 (s, 3H-6''), 1.36 (s, 3H-7''), 2.30 (s, 3H-6'''), 3.55 (d, J = 9.7 Hz, H-4''), 3.64 (s, 3H-8''), 2.52 (s, 3H-7), 4.45 (dd, J1 = 9.7 Hz, J2 = 3.3 Hz, H-3''), 5.39 (br s, H-2''), 5.78 (br s, H-1''), 5.95 (d, J = 3.4 Hz, H-4'''), 6.89 (d, J = 3.4 Hz, H-3'''), 7.19 (d, J = 8.8 Hz, H-6'), 7.31 (d, J = 8.3 Hz, H-2 und H-6), 7.89 (d, J = 8.8 Hz, H-5'), 7.93 (d, J = 8.3 Hz, H-3 und H-5).

Novclobiocin 384

  • δ 1.18 (s, 3H-6''), 1.36 (s, 3H-7''), 2.19 (s, 3H-7), 2.29 (s, 3H-6'''), 2.34 (s, 3H-8'), 3.52 (s, 3H-8''), 3.71 (d, J = 9.8 Hz, H-4''), 4.29 (t, J = 1.4 Hz, H-2''), 5.62 (d, J = 1.4 Hz, H-1''), 5.67 (dd, J1 = 9.8 Hz, J2 = 2.8 Hz, H-3''), 5.94 (d, J = 3.4 Hz, H-4'''), 6.72 (d, J = 9.2 Hz, H-5), 6.90 (d, J = 3.4 Hz, H-3'''), 7.22 (d, J = 9.4 Hz, H-6'), 7.67 (d, J = 9.2 Hz, H-6), 7.70 (s, H-2), 7.83 (d, J = 9.4 Hz, H-5').

Novclobiocin 385

  • δ 1.19 (s, 3H-6''), 1.41 (s, 3H-7''), 2.19 (s, 3H-7), 2.28 (s, 3H-8'), 2.29 (s, 3H-6'''), 3.63 (s, 3H-8''), 3.51 (d, J = 8.8 Hz, H-4''), 5.37 (t, J = 3.2 Hz, H-2''), 5.69 (d, J = 2.4 Hz, H-1''), 4.41 (dd, J1 = 8.8 Hz, J2 = 2.8 Hz, H-3''), 5.94 (d, J = 3.8 Hz, H-4'''), 6.71 (d, J = 8.4 Hz, H-5), 6.88 (d, J = 3.8 Hz, H-3'''), 7.16 (d, J = 8.8 Hz, H-6'), 7.66 (d, J = 8.4 Hz, H-6), 7.70 (s, H-2), 7.81 (d, J = 8.8 Hz, H-5').

Novclobiocin 601

  • δ 1.20 (s, 3H-6''), 1.35 (s, 3H-7''), 2.29 (s, 3H-6'''), 3.52 (s, 3H-8''), 3.72 (d, J = 10.0 Hz, H-4''), 4.33 (br s, H-2''), 5.71 (br s, H-1'' und H-3''), 5.94 (d, J = 3.4 Hz, H-4'''), 6.90 (d, J = 3.4 Hz, H-3'''), 7.28 (d, J = 8.8 Hz, H-6'), 7.48 (t, J = 7.0 Hz, H-3 und H-5), 7.57 (t, J = 7.0 Hz, H-4), 7.91 (d, J = 8.8 Hz, H-5'), 8.02 (d, J = 7.0 Hz, H-2 und H-6).

Novclobiocin 602

  • δ 1.18 (s, 3H-6''), 1.38 (s, 3H-7''), 2.30 (s, 3H-6'''), 3.56 (d, J = 9.4 Hz, H-4''), 3.64 (s, 3H-8''), 4.44 (dd, J1 = 9.4 Hz, J2 = 3.2 Hz, H-3''), 5.40 (t, J = 2.4 Hz, H-2''), 5.81 (d, J = 1.6, H-1''), 5.95 (d, J = 3.4 Hz, H-4'''), 6.89 (d, J = 3.4 Hz, H-3'''), 7.30 (d, J = 9.0 Hz, H-6'), 7.51 (t, J = 7.4 Hz, H-3 und H-5), 7.58 (t, J = 7.4 Hz, H-4), 7.89 (d, J = 9.0 Hz, H-5'), 8.02 (d, J = 7.4 Hz, H-2 und H-6).

Novclobiocin 603

  • δ 1.20 (s, 3H-6''), 1.37 (s, 3H-7''), 2.29 (s, 3H-6'''), 3.51 (s, 3H-8''), 3.69 (d, J = 9.6 Hz, H-4''), 4.24 (br s, H-2''), 5.59 (dd, J1 = 9.6 Hz, J2 = 2.8 Hz, H-3''), 5.64 (br s, H-1''), 5.94 (d, J = 3.0 Hz, H-4'''), 6.90 (d, J = 3.0 Hz, H-3'''), 7.07 (br s, H-6' und H-8'), 7.51 (t, J = 7.0 Hz, H-3 und H-5), 7.59 (t, J = 7.0 Hz, H-4), 7.93 (d, J = 9.2 Hz, H-5'), 8.02 (d, J = 7.0 Hz, H-2 und H-6).

Novclobiocin 606

  • δ 1.11 (s, 3H-6''), 1.32 (s, 3H-7''), 2.27 (s, 3H-8'), 3.59 (s, 3H-8''), 3.39 (d, J = 9.5 Hz, H-4''), 4.07 (t, J = 2.2 Hz, H-2''), 5.55 (d, J = 2.2 Hz, H-1''), 4.16 (dd, J1 = 9.5 Hz, J2 = 3.3 Hz, H-3''), 7.15 (d, J = 8.3 Hz, H-6'), 7.51 (t, J = 7.2 Hz, H-3 und H-5), 7.53 (t, J = 7.2 Hz, H-4), 7.82 (d, J = 8.3 Hz, H-5'), 8.02 (d, J = 7.2 Hz, H-2 und H-6).

Novclobiocinsäure 607

  • δ 2.26 (s, 3H-8'), 6.77 (d, J = 8.8 Hz, H-6'), 7.46 (t, J = 7.2 Hz, H-3 und H-5), 7.53 (t, J = 7.2 Hz, H-4), 7.69 (d, J = 8.8 Hz, H-5'), 8.02 (d, J = 7.2 Hz, H-2 und H-6).

Novclobiocin 701

  • δ 1.17 (s, 3H-6''), 1.36 (s, 3H-7''), 2.29 (s, 3H-6'''), 3.51 (s, 3H-8''), 3.72 (d, J = 9.8 Hz, H-4''), 4.34 (br s, H-2''), 5.68 (dd, J1 = 9.8 Hz, J2 = 2.4 Hz, H-3''), 5.71 (br s, H-1''), 5.94 (d, J = 3.4 Hz, H-4'''), 6.90 (d, J = 3.4 Hz, H-3'''), 7.01 (d, J = 15.3 Hz, H-1), 7.29 (d, J = 8.2 Hz, H-6'), 7.39 (br s, H-5, H-6 und H-7), 7.60 (br d, J = 3.6 Hz, H-4 und H-8), 7.71 (d, J = 15.3 Hz, H-2), 7.89 (d, J = 8.2 Hz, H-5').

Novclobiocin 702

  • δ 1.17 (s, 3H-6''), 1.38 (s, 3H-7''), 2.30 (s, 3H-6'''), 3.64 (s, 3H-8''), 3.56 (d, J = 9.6 Hz, H-4''), 5.39 (br s, H-2''), 4.44 (dd, J1 = 9.6 Hz, J2 = 3.3 Hz, H-3''), 5.79 (br s, H-1''), 5.95 (d, J = 3.5 Hz, H-4'''), 6.89 (d, J = 3.5 Hz, H-3'''), 6.98 (d, J = 16.4 Hz, H-1), 7.28 (br s, H-6'), 7.39 (d, J = 7.1 Hz, H-5, H-6 und H-7), 7.62 (br d, J = 7.1 Hz, H-4 und H-8), 7.69 (dd, J1 = 16.4 Hz, J2 = 1.3 Hz,, H-2), 7.89 (d, J = 8.3 Hz, H-5').

Novclobiocin 704

  • δ 1.10 (s, 3H-6''), 1.32 (s, 3H-7''), 2.26 (s, 3H-8'), 3.59 (s, 3H-8''), 3.39 (d, J = 9.6 Hz, H-4''), 4.07 (t, J = 2.0 Hz, H-2''), 4.15 (dd, J1 = 9.6 Hz, J2 = 3.6 Hz, H-3''), 5.55 (d, J = 2.0 Hz, H-1''), 6.96 (d, J = 15.6 Hz, H-1), 7.16 (d, J = 9.0 Hz, H-6'), 7.39 (d, J = 7.4 Hz, H-5, H-6 und H-7), 7.61 (d, J = 7.4 Hz, H-4 und H-8), 7.67 (d, J = 15.6 Hz, H-2), 7.81 (d, J = 9.0 Hz, H-5').

Novclobiocinsäure 705

  • δ 6.63 (s, H-8'), 6.73 (dd, J1 = 8.9 Hz, J2 = 2.0 Hz, H-6'), 6.92 (d, J = 14.7 Hz, H-1), 7.39 (d, J = 6.8 Hz, H-5, H-6 und H-7), 7.61 (d, J = 6.8 Hz, H-4 und H-8), 7.63 (d, J = 14.7 Hz, H-2), 7.81 (d, J = 8.9 Hz, H-5').

Novclobiocin 731

  • δ 1.19 (s, 3H-6''), 1.35 (s, 3H-7''), 2.29 (s, 3H-6'''), 3.51 (s, 3H-8''), 3.71 (d, J = 11.6 Hz, H-4''), 3.90 (s, 3H-9), 4.33 (br s, H-2''), 5.69 (br s, H-1''), 5.71 (dd, J1 = 11.6 Hz, J2 = 2.0 Hz, H-3''), 5.94 (d, J = 3.6 Hz, H-4'''), 6.75 (d, J = 15.8 Hz, H-1), 6.80 (d, J = 8.2 Hz, H-7), 6.90 (d, J = 3.6 Hz, H-3'''), 7.07 (d, J = 8.2 Hz, H-8), 7.19 (s, H-4), 7.23 (d, J = 8.8 Hz, H-6'), 7.57 (d, J = 15.8 Hz, H-2), 7.90 (d, J = 8.8 Hz, H-5').

Novclobiocin 741

  • δ 1.19 (s, 3H-6''), 1.34 (s, 3H-7''), 2.29 (s, 3H-6'''), 3.51 (s, 3H-8''), 3.71 (d, J = 11.0 Hz, H-4''), 4.33 (br s, H-2''), 5.68 (br s, H-1''), 5.71 (dd, J1 = 11.0 Hz, J2 = 4.8 Hz, H-3''), 5.94 (d, J = 2.4 Hz, H-4'''), 6.71 (d, J = 15.6 Hz, H-1), 6.90 (br s, H-3'''), 6.92 (überlappendes Signal, J nicht bestimmbar, H-7), 7.19 (d, J = 8.8 Hz, H-6'), 7.36 (d, J = 8.8 Hz, H-8), 7.49 (d, J = 15.6 Hz, H-2), 7.56 (s, H-4), 7.89 (d, J = 8.6 Hz, H-5').

Novclobiocin 742

  • δ 1.20 (s, 3H-6''), 1.37 (s, 3H-7''), 2.29 (s, 3H-6'''), 3.51 (s, 3H-8''), 3.68 (d, J = 9.6 Hz, H-4''), 4.33 (br s, H-2''), 5.59 (dd, überlappendes Signal, J nicht bestimmbar, H-3''), 5.61 (d, J 1.6 Hz, H-1''), 5.94 (d, J = 3.4 Hz, H-4'''), 6.80 (d, J = 14.4 Hz, H-1), 6.90 (d, J = 3.4 Hz, H-3'''), 6.91 (d, J = 8.2 Hz H-7), 7.03 (s, H-6'), 7.03 (s, H-8'), 7.41 (d, J = 8.2 Hz, H-8), 7.54 (d, J = 14.4 Hz, H-2), 7.61 (s, H-4), 7.92 (d, J = 8.0 Hz, H-5').

ZITATE ENTHALTEN IN DER BESCHREIBUNG

Diese Liste der vom Anmelder aufgeführten Dokumente wurde automatisiert erzeugt und ist ausschließlich zur besseren Information des Lesers aufgenommen. Die Liste ist nicht Bestandteil der deutschen Patent- bzw. Gebrauchsmusteranmeldung. Das DPMA übernimmt keinerlei Haftung für etwaige Fehler oder Auslassungen.

Zitierte Nicht-Patentliteratur

  • - Maxwell und Lawson, 2003 [0002]
  • - Thornsberry et al., 1997 [0002]
  • - Lorico et al., 1992; Rappa et al., 1992 [0003]
  • - Galm et al., 2004 [0015]
  • - Dessoy, 2003 [0032]
  • - Datsenko und Wanner, 2000 [0033]
  • - MacNeil et al., 1992 [0033]
  • - Sambrook und Russell, 2001 [0035]
  • - Kieser et al., 2000 [0035]
  • - Kieser et al., 2000 [0035]
  • - Galm et al., 2002 [0039]
  • - Galm et al., 2004 [0040]
  • - Eustáquio et al., 2005 [0050]
  • - Kieser et al., 2000 [0052]
  • - Kieser et al., 2000 [0053]
  • - Galm et al., 2004; Luft et al., 2005 [0054]
  • - Eustáquio et al., 2005 [0058]
  • - Gust et al., 2003 [0058]
  • - Kieser et al., 2000 [0059]
  • - Kieser et al., 2000 [0060]
  • - Kieser et al., 2000 [0060]
  • - Kominek, 1972 [0060]