Title:
Microarray for detecting viruses is divided into fields, each bearing a nucleic acid probe capable of detecting a specific herpes virus
Kind Code:
A1


Abstract:
Microarray for detecting viruses is divided into fields, each bearing a nucleic acid probe capable of detecting a specific virus, namely a herpes simplex virus probe, a varicella zoster virus probe, an Epstein-Barr virus probe, a cytomegalovirus probe and a human herpes virus 6 probe. Microarray for detecting viruses is divided into fields, each bearing a nucleic acid probe capable of detecting a specific virus, namely a herpes simplex virus probe with SEQ ID NO:1 or 2, a varicella zoster virus probe with SEQ ID NO:3 or 4, an Epstein-Barr virus probe with SEQ ID NO:5 or 6, a cytomegalovirus probe with SEQ ID NO:7 or 8 and a human herpes virus 6 probe with SEQ ID NO:9 or 10 (all defined sequences given in the specification). Independent claims are also included for: (1) oligonucleotide with SEQ ID NO:2, 4, 6, 8, 10, 12, 13, 14, 15, 16 or 17 (all defined sequences given in the specification); (2) detecting viruses by extracting viral DNA from a sample, amplifying the DNA while incorporating a label, hybridizing the amplified DNA with a microarray as above, and detecting the label.



Inventors:
Rohayem, Jacques, Dr. (Dresden, 01309, DE)
Jacobs, Enno, Prof. Dr.med. (Dresden, 01309, DE)
Ehricht, Ralf, Dr. (Jena, 07749, DE)
Application Number:
DE102006059095
Publication Date:
06/12/2008
Filing Date:
12/08/2006
Assignee:
Technische Universität Dresden (Dresden, 01069, DE)
International Classes:



Foreign References:
WO2004020085A12004-03-11
Other References:
NCBI Sequenzabgleich AN AB231460;;
NCBI Sequenzabgleich AN AF325440;;
NCBI Sequenzabgleich AN AJ251096;
NCBI Sequenzabgleich AN AF161564;;
NCBI Sequenzabgleich AN AY628148;;
NCBI Sequenzabgleich AN AF542122;;
NCBI Sequenzabgleich AN AY337247;;
WATZINGER,F.,et.al.:Real-Time Quantitative PCR
Assays for Detection and Monitoring of Pathogenic
Human Viruses in Immunosuppressed Pediatric
Patients. In:Journal of Clinical
Microbiology,2004,42(11),5189-5198;;
WANG,D.,et.al.:Microarray-based detection and
genotyping of viral pathogens.In:PNAS,2002,
99(24),15687-15692;;
Attorney, Agent or Firm:
Kailuweit & Uhlemann, Patentanwälte (Dresden, 01187)
Claims:
1. Ein Microarray der in mehrere Felder unterteilt ist und mehrere Virus-spezifische Nukleinsäureproben enthält, wobei jede unterschiedliche Sequenz in einem anderen Feld des Microarrays aufgetragen ist, wobei der Microarray mindestens je ein Feld:
a) mit einer Nukleinsäuresequenz, die fähig ist Herpes simplex Virus (HSV), insbesondere die Subtypen 1 und 2, nachzuweisen, ausgewählt aus SEQ ID No. 1 und 2;
b) mit einer Nukleinsäuresequenz, die fähig ist Varizella zoster Virus (VZV, HHV3) nachzuweisen, ausgewählt aus SEQ ID No. 3 und 4;
c) mit einer Nukleinsäuresequenz, die fähig ist Epstein-Barr-Virus (EBV, HHV4) nachzuweisen, ausgewählt aus SEQ ID No. 5 und 6;
d) mit einer Nukleinsäuresequenz, die fähig ist Cytomegalievirus (CMV, HHV5) nachzuweisen, ausgewählt aus SEQ ID No. 7 und 8;
e) mit einer Nukleinsäuresequenz, die fähig ist das Humane Herpesvirus 6 (HHV6), insbesondere die Subtypen A und B, nachzuweisen, ausgewählt aus SEQ ID No. 9 und 10;
enthält.

2. Microarray nach Anspruch 2, dadurch gekennzeichnet, dass er mindestens je ein Feld mit jeweils einer Nukleinsäuresequenz gemäß SEQ ID No. 1 bis 10 enthält, wobei jede unterschiedliche Sequenz in einem anderen Feld des Microarrays aufgetragen ist.

3. Microarray nach Anspruch 1 oder 2, dadurch gekennzeichnet, dass er mindestens ein weiteres Feld, mit einer Nukleinsäuresequenz, die fähig ist Adenoviren, insbesondere die Subtypen A bis F, nachzuweisen, ausgewählt aus SEQ ID No. 11 bis 17, enthält.

4. Microarray nach Anspruch 3, dadurch gekennzeichnet, dass er mindestens je ein Feld mit jeweils einer Nukleinsäuresequenz gemäß SEQ ID No. 1 bis 17 enthält, wobei jede unterschiedliche Sequenz in einem anderen Feld des Miroarrays aufgetragen ist.

5. Microarray nach einem der vorgenannten Ansprüche, in denen mindestens einer der Nukleinsäuren gemäß SEQ ID No. 1 bis 17 im Rückgrat modifiziert ist oder mindestens ein T (Thymin) durch Uracil (U) ersetzt ist.

6. Oligonukleotid gemäß einer der folgenden SEQ ID No. 2, 4, 6, 8, 10, 12, 13, 14, 15, 16 und 17.

7. Ein Verfahren zum Nachweis von Viren mit den folgenden Schritten:
a) Extraktion viraler DNA aus einer isolierten Probe,
b) Amplifizierung der extrahierten viralen DNA mit Einbau eines Markers in die amplifizierte DNA,
c) Hybridisierung der amplifizierten DNA mit einem Microarray nach einem der Ansprüche 1 bis 5,
d) Detektion des Markers.

8. Verfahren nach Anspruch 7, dadurch gekennzeichnet, dass anschließend die in Schritt a) extrahierte virale DNA in eine quantitativen PCR analysiert wird, in der die gleichen Reagenzien verwendet werden wie im Schritt b) und mindestens eine der Sequenzen ausgewählt aus SEQ ID No. 1 bis 17 als Sonde eingesetzt wird.

9. Ein Kit zum Nachweis von Viren enthaltend einen Microarray nach einem der Ansprüche 1 bis 5.

10. Kit nach Anspruch 9 mindestens einen der weiteren Bestandteile enthaltend:
– Reagenzien für die Extraktion viraler DNA,
– Reagenzien für die Amplifizierung viraler DNA, einschließlich markierter Oligonukleotide,
– Waschpuffer und Hybridisierungspuffer,
– Reagenzien für die Detektion des Markers.

11. Kit nach Anspruch 9 oder 10 enthaltend Kit nach Anspruch 9 der zusätzlich mindestens eine der SEQ ID No. 1 bis 17 als Sonde für eine quantitative Real-Time PCR enthält.

Description:

Die Erfindung betrifft einen Microarray, ein Verfahren und einen Kit zum gleichzeitigen Nachweis mehrerer Herpesviren und gegebenenfalls von Adenoviren in einer Probe.

Infektionen mit Herpesviren und Adenoviren sind insbesondere in Transplantationspatienten eine häufige Ursache von Krankheiten und Todesfällen. In diesen Patienten erfolgt die Diagnose einer Virusinfektion in der Klinik bisher durch den Nachweis einzelner Viruse oder das Auftreten klinischer Symptome. Aus diesem Grunde bleiben bisher Mehrfachinfektionen (durch mehrere Viren) und subklinische Infektionen meist undiagnostiziert. Die Häufigkeit derartiger Mehrfachinfektionen und subklinische Infektionen und die damit verbundene Morbiditäts- und Mortalitätsrate ist aus diesem Grund bisher nicht bekannt.

Der Nachweis dieser Viren erfolgt bisher in einer einfachen oder multiplex PCR und anschließendem Nachweis der amplifizierten DNA mit Ethidiumbromid in einem Agarosegel oder Hybridiserung einer Oligonukleotid-Sonde wie z. B in einem Microwell-ELISA oder eine Real-Time-PCR mit einer Virus-spezifischen DNA-Sonde. In diesem Fall erfolgt der Nachweis durch die Detektion eines Flurophores, welches durch die 5'-Exonukleaseaktivität der DNA-Polymerase freigesetzt wird.

Der Nachteil der genannten Methoden liegt darin, dass für jedes Virus eine getrennte, spezifische PCR-Amplifizierung erfolgen muss, wodurch Zeit und Kosten erhöht werden. Die Detektion mit Ethidiumbromid kann zudem zu falsch-positiven Ergebnissen führen, da ein Nachweis nicht über Hybridisierung erfolgt. Eine Real-Time-PCR für alle Viren einem Schritt durchzuführen ist kostenaufwendig und technisch schwierig. In Multiplex-Assays sind die Cross-Reaktivität der Primer untereinander und unspezifische Reaktionen mit der nachzuweisenden DNA problematisch und führen zu falsch-positiven Nachweisen. Wird die Sensivität der Primer zu gering gewählt, erhält man falsch-negative Resultate. Das richtige Gleichgewicht zwischen ausreichender Sensivität und Spezifität zu finden ist daher in einem Multiplex-Assay technisch sehr schwierig.

Aufgabe der Erfindung ist es einen Microarray, ein Verfahren und einen Kit anzugeben, die es erlauben, mehrere Herpesviren und Adenoviren parallel nachzuweisen.

Die Aufgabe wird gelöst durch einen Microarray der in mehrere Felder unterteilt ist und mehrere Virus-spezifische Nukleinsäureproben enthält, wobei jede unterschiedliche Sequenz in einem anderen Feld des Microarrays aufgetragen ist.

Der erfindungsgemäße Microarray enthält mindestens je ein Feld:

  • a) mit mindestens einer Nukleinsäuresequenz, die fähig ist Herpes simplex Virus (HSV), insbesondere die Typen 1 und 2 (HHV1 und HHV2) nachzuweisen, ausgewählt aus SEQ ID No. 1 und 2;
  • b) mit mindestens einer Nukleinsäuresequenz, die fähig ist Varizella zoster Virus (VZV, HHV3) nachzuweisen, ausgewählt aus SEQ ID No. 3 und 4;
  • c) mit mindestens einer Nukleinsäuresequenz, die fähig ist Epstein-Barr-Virus (EBV, HHV4) nachzuweisen, ausgewählt aus SEQ ID No. 5 und 6;
  • d) mit mindestens einer Nukleinsäuresequenz, die fähig ist Cytomegalievirus (CMV, HHV5) nachzuweisen, ausgewählt aus SEQ ID No. 7 und 8;
  • e) mit mindestens einer Nukleinsäuresequenz, die fähig ist das Humane Herpesvirus 6 (HHV6), insbesondere die Typen A und B, nachzuweisen, ausgewählt aus SEQ ID No. 9 und 10.

Bevorzugt enthält der erfindungsgemäße Microarray mindestens ein weiteres Feld des Typs f), mit einer Nukleinsäuresequenz, die fähig ist Adenoviren, insbesondere die Subtypen A bis F, nachzuweisen, ausgewählt aus SEQ ID No. 11 bis 17.

Bevorzugt enthält der Microarray jeweils 5 bis 100 Felder, vorzugsweise 10 bis 30 Felder, der Typen a) bis e) zum Nachweis der unterschiedlichen Herpesviren und gegebenenfalls des Typs f) zum Nachweis der Adenoviren.

Bevorzugt enthält der Microarray mindestens je ein Feld mit einer Nukleinsäuresequenz gemäß SEQ ID No. 1 bis 10 und gegebenenfalls SEQ ID No. 11 bis 17, wobei jede unterschiedliche Sequenz in einem anderen Feld des Microarrays aufgetragen ist. Bevorzugt enthält der Array jeweils 3 bis 10 Felder, bevorzugt 4 bis 6, Felder für jede der genannten Sequenzen.

Der Array enthält vorzugsweise weitere Felder, die als negative und positive Kontrollen dienen. Als positive Kontrolle wird bevorzugt der Marker, wie z. B. Biotin, direkt aufgetragen. Alternativ verwendete Marker sind Dioxygenin, radioaktive Marker oder Fluoreszenzfarbstoffe (wie z. B. Fluorescein). Als negative Kontrolle (für den so genannten „Background") wird mindestens ein Felder verwendet, das keine virusspezifische Nukleinsäure enthält. Darüber hinaus ist eine Kontrolle vorgesehen, die eine mögliche Inhibierung, der für die Amplifizierung verwendeten DNA-Polymerase (z. B. taq-Polymerase) durch Substanzen in der Reaktionsmischung nachweist. Diese Kontrolle besteht aus einer vorgegebenen Menge an DNA, die in die Reaktion vor Amplifikation zugegeben wird. Diese zu amplifizierende Kontrollsequenz kann eukaryontischer oder prokaryontischer Herkunft sein.

Der erfindungsgemäße Microarray eignet sich vorteilhaft für den gleichzeitigen Nachweis mehrerer Herpesviren, insbesondere Humanem Herpesvirus 6 (HHV6 Typen A und B), Cytomegalovirus (CMV), Epstein-Barr virus (EBV), Varicella-Zoster-Virus (VZV, HHV3) und Herpes simplex virus (Typen 1 und 2) und gegebenenfalls von Adenoviren, insbesondere Adenovirus (Typen A bis F) in einer Probe.

Der Nachweis ist sehr sensitiv, so können noch 10 Genomäquivalente eines Viruses sicher nachgewiesen werden.

Unter Genomäquivalent im Sinne der vorliegenden Erfindung wird dabei die zur gesamten viralen Genom korrespondierende Menge an DNA, die in der Reaktion amplifiziert wird, verstanden. Ein Beispiel dafür ist ein Fragment von 92 Nukleotiden, das in der PCR-Reaktion amplifiziert wird. Dieses Fragment spiegelt in der PCR Reaktion das gesamte Genom des Herpesvirus Typ 1 wieder. Die Menge an Genomequivalenten wird durch das Molekulargewicht des Fragments und die OD260/280 der Plasmid-Lösung ermittelt.

Der erfindungsgemäße Microarray erlaubt vorteilhaft die frühzeitige Erkennung und die Überwachung (monitoring) mehrerer Virusinfektionen in hoher Effizienz und Wirtschaftlichkeit. Eine direkte praktische Konsequenz ist das sich mit dem erfindungsgemäßen Microarray die Diagnose und damit auch die Therapie von Viren in Transplantationspatienten optimieren lässt. Mit dem Microarray kann durch die frühe Viruserkennung und Behandlung virus-assozierte Endorganerkrankungen vorgebeugt werden. Durch das damit verbundene verbesserte Disease-Management werden auch Behandlungskosten reduziert.

Folgende viralen Gensequenzen werden von dem erfindungsgemäßen Microarray spezifisch erkannt:

locusID (Genbank No.)geneSymbolorganismsdescriptionX04495UL30HSV1DNA-polvmeraseM16321UL30HSV2DNA-polvmeraseAB097933ORF62VZVtransactivatorM33515U56HHV6major capsid proteinAY327256UL54CMVDNA-polvmeraseAJ251097rpms1EBVDNA-polvmeraseAJ854486Adenovirushexon proteinAdenovirushexon protein

Auf dem erfindungsgemäßen Array sind bevorzugt folgende Nukleinsäuresequenzen immobilisiert:

Gegenstand der Erfindung sind auch die Nukleinsäuresequenzen gemäß der SEQ ID No. 2, 4, 6, 8, 10, 12, 13, 14, 15, 16 und 17.

Der Begriff Nukleinsäuren im Sinne der Erfindung umfasst neben Desoyribonukleinsäuren (DNA) und Ribonukleinsäuren (RNA) auch alle anderen linearen Polymeren in denen die Basen Adenin (A), Cytosin (C), Guanin (G) und Thymin (T) oder Uracil (U) in entsprechender Abfolge angeordnet sind, insbesondere Nukleinsäuren mit verändertem Rückgrat, wie z. B. einem Phosphothioat, Phosphoramidat- oder O-Methyl-derivatisierten Rückgrat, Peptid-Nukleinsäuren (PNA), und locked nucleic acids (LNA). Die Erfindung umfasst insbesondere auch Microarrays bzw. Sequenzen, in denen mindestens ein T (Thymin) einer der in den SEQ ID No. 1 bis 17 genannten Sequenzen durch Uracil (U) ersetzt ist. In den Sequenzprotokollen und im Text sind alle Sequenzen, wenn nicht anders angegeben in 5'->3' Richtung enthalten.

Die Nukleinsäuren liegen auf dem erfindungsgemäßen Microarray vorzugsweise als Einzelstrang vor und sind bevorzugt nur mit dem 3' oder 5'-Ende auf der Array-Oberfläche fixiert.

Unter einem Microarray wird im Sinne der Erfindung eine Anordnung von molekularen Sonden, hier virus-spezifische Nukleinsäuren, auf einem Träger verstanden. Die einzelnen Sonden sind in definierten Feldern in einem vorher festgelegten Muster aufgetragen, wobei jedes Feld üblicherweise nur eine definierte Sonde, hier Nukleinsäuresequenz enthält. Die Anordnung der Nukleinsäuren bzw. Sonden auf dem Träger wird dabei durch kovalente oder nicht-kovalente Wechselwirkungen erzeugt. Ein Feld innerhalb der Anordnung, d. h. des Arrays, wird üblicherweise als Spot bezeichnet. Der Array bildet somit die Detektionsfläche. Derartige Nukleinsäure-Microarrays (häufig auch DNA-Chips genannt) werden beispielsweise von den Firmen Affymetrix (Santa Clara, Kalifornien, USA) und Clondiag (Jena, Deutschland) hergestellt, wobei die Sequenzen der Nukleinsäuren, die als Sonden auf dem Array aufgetragen werden, durch den Auftraggeber bestimmt werden können.

Der Array hat bevorzugt eine rechteckige Grundfläche mit vorzugsweise einer Gesamtfläche von 1 mm bis 4 mm × 1 mm bis 4 mm, vorzugsweise von 2 mm × 2 mm, und ist vorzugsweise in 50 bis 200 Felder gleicher Größe aufgeteilt.

Die Herstellung von Nukleinsäure-Microarrays (mit anderen Sequenzen), der Aufbau des Trägermaterials und die Methoden zur Fixierung der Nukleinsäure-Proben auf der Oberfläche des Trägermaterials (Array-Oberfläche) sind grundsätzlich bekannt und ist beispielsweise in WO 01/02094 und WO 03/031063 beschrieben. Auf die in diesen Dokumenten enthaltene Offenbarung bezüglich der den Aufbau eines Microarrays und die Anordnung des Microarrays in einer Vorrichtung wird hiermit ausdrücklich Bezug genommen.

Bevorzugt ist der erfindungsgemäße Microarray in den Boden eines Laborreaktionsgefäss eingefügt. Unter Laborreaktionsgefäßen mit einer typischen Form und Grösse werden im Rahmen der vorliegenden Erfindung insbesondere Reaktionsgefäße aus Kunststoff (wie z. B. Polyethylen oder Polypropylen oder Polycarbonat) verstanden. Derartige Reaktionsgefäße sind bevorzugt Einweg-Reaktionsgefässe mit 0,5 ml bis 2 ml Volumen, auch Tubes oder "Eppis" genannt, wie sie insbesondere in biologischen bzw. molekularbiologischen Laboratorien üblicherweise verwendet werden und fassen

Besonders bevorzugt ist der erfindungsgemäße Microarray in einer Vorrichtung angeordnet, wie sie in der internationalen Patentanmeldung WO 03/059516 beschrieben ist. Auf die in diesem Dokument enthaltene Offenbarung bezüglich einer Vorrichtung zur Durchführung von Array-Verfahren wird hiermit ebenfalls ausdrücklich Bezug genommen.

In einer bevorzugten Ausführungsform der Erfindung sind die unterschiedlichen SEQ ID No. 1 bis 17, auf einem Array mit 11 × 10 Feldern, wie folgt, angeordnet:

191717171718181818181915151516161616161719131314141414141515191911121212121213131319101010101011111111198888999991966677777819445555566192333334441911111222219

Die Felder 19 enthalten den Marker, bevorzugt Biotin als positive Kontrolle. Die Felder ohne Zahlen und die Felder 18 (Spottingpuffer) dienen als negative Kontrolle für den Background.

Die Erfindung umfasst auch ein Verfahren zum parallelen Nachweis der oben genannten Viren mit dem erfindungsgemäßen MIcroarray.

Das Verfahren umfasst bevorzugt folgende Schritte:

  • a) Extraktion viraler DNA aus einer isolierten Probe,
  • b) Amplifizierung der extrahierten viralen DNA mit Einbau eines Markers in die amplifizierte DNA,
  • c) Hybridisierung der amplifizierten DNA mit einem Microarray nach einem der Ansprüche 1 bis 5,
  • d) Detektion des Markers.

In den Schritten a) und b) des Verfahrens wird aus einer Probe, wie z. B. Liquor, Blut, Serum, Speichel, Urin, Stuhl, in bekannter weise virale DNA isoliert und amplifiziert.

Die Amplifizierung der DNA erfolgt bevorzugt per PCR (polymerase chain reaction). Während der Amplifikation wird durch die Verwendung eines entsprechend markierten Primers bevorzugt ein Marker in die DNA eingebaut. Ein bevorzugter Marker ist Biotin. Alternativ verwendete Marker sind Dioxygenin, radioaktive Marker oder Fluoreszenzfarbstoffe (wie z. B. Fluorescein).

Die so erhaltene amplifizierte DNA wird in einem geeigneten Hybridisierungspuffer aufgenommen und mit dem Microarray kontaktiert und zur Hybridisierung inkubiert.

Nach 2 bis 3 Waschschritten erfolgt die Detektion des Markers.

Im Falle des Biotins erfolgt die Detektion mit einem Biotin-binden Protein, welches spezifisch und hoch affin Biotin erkennt, bevorzugt Steptavidin oder Avidin, und an ein Enzym, wie z. B. Horsh radish Peroxidase oder Alkalische Phosphatase, gekoppelt ist und einem Substrat, welches durch das Enzym in einer Farbreaktion umgesetzt wird.

Mit dem erfindungsgemäßen Microarray und Verfahren wird vorteilhaft der parallele qualitative Nachweis des Adenovirus und den wichtigsten Herpesviren möglich.

Der erfindungemäße Microarray und das zugehörige Nachweisverfahren kombinieren vorteilhaft die leistungsfähige Vervielfältigung von viraler DNA aus Patientenproben durch PCR mit einem preiswerten DNA-Microarray-Nachweissystem, welches den gleichzeitigen Nachweis von bis zu 10 Virusen mit hoher Sensivität und hoher Spezifität in einer Probe erlaubt. Durch die Erfindung wird es möglich die Häufigkeit von Mehrfachinfektionen und subklinischen viralen Infektionen zu bestimmen. Darüber hinaus lässt sich die Relevanz von viralen Mehrfachinfektionen (Co-Infektionen mit mehreren Viren) für das Auftreten von Organschädigungen (end-organ diseases) bestimmen.

Soll neben einem qualitativen Nachweis ein quantitativer Nachweis der Virusmenge eines oder mehrerer Viren erfolgen, wird dazu bevorzugt eine quantitative PCR durchgeführt, in der die gleichen Virus-spezifischen Sequenzen, wie im Microarray, als Sonden zur Anwendung kommen.

Die Erfindung umfasst daher auch ein Verfahren in der nach der Analyse von viraler DNA mit dem erfindungsgemäßen Microarray anschließend die in Schritt a) extrahierte virale DNA in eine quantitativen PCR analysiert wird, in der die gleichen Reagenzien verwendet werden wie im Schritt b) und mindestens eine der Sequenzen ausgewählt aus SEQ ID No. 1 bis 17 als Sonde eingesetzt wird. Die SEQ ID No. 1 bis 17 werden dazu bevorzugt als so genannte FRET-Sonden (Fluoreszenz-Resonanz-Energie-Transfer) eingesetzt und sind an ihrem 3' bzw. 5'-Ende entsprechend modifiziert. Derartige modifizierte DNA-Sonden sind als TaqManTM oder Light-CyclerTM-Sonden bekannt.

Da die quantitative PCR, wenn überhaupt, nur für die im Microarray als positive getesteten Viren durchgeführt werden braucht, werden Kosten gespart.

Ein Problem der molekularen Diagnostik von viralen Erregern ist die mangelnde Standardisierung und Vergleichbarkeit unterschiedlicher Nachweismethoden. Verursacht wird dies vorwiegend durch eine fehlende Standardisierung der Schritte der DNA-Extraktion, DNA-Amplifizierung und der Detektion.

In der vorliegende Erfindung werden für eine nachfolgende quantitative Real-Time PCR, die gleichen Reagenzien, DNA-Sonden und Prozessbedingungen für die Schritte der DNA-Extraktion und DNA-Amplifizierung verwendet. Die Resultate der Microarray-Analyse und der gegebenenfalls ergänzend durchgeführten quantitativen Real-Time PCR lassen sich daher sehr zuverlässig vergleichen.

Gegenstand der Erfindung ist auch ein Kit zum Nachweis von Viren, welches den erfindungsgemäßen Microarray enthält.

Der Kit enthält bevorzugt mindestens einen der weiteren Bestandteile:

  • – Reagenzien für die Extraktion viraler DNA, wie z. B. Zell-Lyse-Puffer, chromatographische Säulen und Elutionspuffer,
  • – Reagenzien für die Amplifizierung viraler DNA, wie z. B. Primer (Oligonukleotide, teilweise biotinyliert), dNTPS, DNA-Polymerase, Puffer, Hybridisierungssonden
  • – Waschpuffer und Hybridisierungspuffer,
  • – Reagentien für die Detektion, wie biotin-bindende enzymkunjugierte Proteine (z. B. Streptavidin-Peroxidase oder Avidin-Alkalische Phoshatase) und entsprehende Substrate (wie z. B. Tetramethylbenzidin),
  • – Reaktionsgefäße (z. B. Kapillaren, Tubes) und ggf. Vorrichtungen, wie Pipettierroboter, PCR-Cycler und Array-Reader (wie z. B. den Array-Tube-Reader).

Gegebenfalls enthält der Kit als weitere Bestandteil die Reagenzien für eine quantitative Real-Time PCR, wie z. B. die SEQ ID No. 1 bis 17 als FREI Sonden (z. B. LightCyclerTM oder TaqmanTM-Sonden) und unbiotinylierte Primer.

Ausführungsbeispiele:

Die Erfindung wird durch die nachfolgenden Figuren und Ausführungsbeispiele näher erläutert, ohne die Erfindung auf diese zu beschränken:

1 zeigt den Aufbau des erfindungsgemäßen Microarrays, der wie oben links zu sehen in den Boden eines Mikroreagenzgefäß integriert ist. Die Sequenzen spezifisch für Adenovirus (Typen A bis F), Humanes Herpesvirus 6 (HHV6 Typen A und B), Cytomegalovirus (CMV), Epstein-Barr virus (EBV), Varicella-Zoster-Virus (VZV) und Herpes simplex virus (Typen 1 und 2) sind in verschiedenen Bereichen des Arrays mit jeweils einem Ende an der Oberfläche fixiert, so dass die Sequenzen für Hybridisierungsreaktionen frei zugänglich sind. Näheres siehe Ausführungsbeispiel 1.

2 und 3 veranschaulichen schematisch den Ablauf des Nachweises von Viren mit dem erfindungsgemäßen Microarray. Nach der Extraktion von viraler DNA erfolgt ein Amplifizierungsschritt in einer PCR mit zwei Primer, wobei einer der Primer an seinem 5'-Ende biotinyliert ist. Die so amplifizierte DNA wird denaturiert und zur Hybridiserung auf die Oberfläche des Microarrays gegeben. Im letzten Schritt erfolgt die Detektion gebundener DNA mittels Avidin-Peroxidase (HRP) und Tetramethylbenzidin (TMB) als Substrat. Näheres siehe Ausführungsbeispiel 2.

4 zeigt den ersten Schritt – die Amplifizierung viraler DNA – in einer Multiplex-PCR mit der LightCyclerTM-Technology. Die Amplifizierung erfolgt in zwei Kapillaren mit den gleichen Reagenzien (Primer, Mastermix), wie in einer gewöhnlichen quantitativen Realtime PCR. Die Amplifizierung erfolgt jedoch für die anschließende Hybridisierung auf dem Microarray ohne Zusatz einer speziellen FRET-Oligonukleotid-Sonde (LightCyclerTM oder TaqManTM-Sonde). Der Inhalt der beiden Kapillaren wir dann gemischt und zur Hybridisierung auf den Microarray gegeben. Näheres siehe Ausführungsbeispiel 2.

5 fast die Vorteile des Virus-Nachweises per Microarray zusammen.

6 veranschaulicht die Sensivität des Nachweises von Viren mit dem erfindungsgemäßen Microarray. Die oberste Zeile ist der Nachweis von Herpes simplex virus (HSV – Typen 1 und 2), gefolgt von Varicella-Zoster-Virus (VZV) in Zeile 2, Epstein-Barr virus (EBV) in Zeile 3, Cytomegalovirus (CMV) in Zeile 4, und Humanem Herpesvirus 6 (HHV6 – Typen A und B) in der untersten Zeile. Die Ziffern unter den Spalten stehen für die Anzahl Genomäquivalente (GE). Der Aufbau des Microarrays entspricht der aus 1 und Ausführungsbeispiel 1. Der Nachweis erfolgte wie in Ausführungsbeispiel 2 beschrieben. Die Ergebnisse aus 6 zeigen, dass jedes Virus mit einer Sensivität von 10 Genomäquivalenten nachgewiesen werden kann.

7 zeigt die analytische Spezifität des Microarrays. In einer Probe, die jeweils 10,000 Genomäquivalente von HSV-1, HSV-2, VZV, EBV, CMV und HHV-6 enthielt, ist jeweils nur ein Signal auf den Feldern, welche die virus-spezifischen Sequenzen enthalten zu beobachten. Der Aufbau des Microarrays entspricht der aus 1 und Ausführungsbeispiel 1. Der Nachweis erfolgte wie in Ausführungsbeispiel 2 beschrieben. Trotz der hohen DNA-Menge (10,000 GE) der einzelnen Viruse, ist vorteilhaft keine Kreuzreaktivität zu beobachten.

8 zeigt den gleichzeitigen Nachweis von 3 Viren mit dem erfindungsgemäßen Microarray der möglich wird. Der Aufbau des Microarrays entspricht der aus 1 und Ausführungsbeispiel 1. Der Nachweis erfolgte wie in Ausführungsbeispiel 2 beschrieben. Mit dem Microarray ist vorteilhaft ein simultaner Nachweis von bis zu 10,000 Genomäquivalenten jedes Virus möglich.

9 zeigt den gleichzeitigen Nachweis mehrerer Viren auf dem erfindungsgemäßen Microarray in klinischen Proben. Die Viren werden in der Figur genannt. Der Aufbau des Microarrays entspricht der aus 1 und Ausführungsbeispiel 1. Der Nachweis erfolgte wie in Ausführungsbeispiel 2 beschrieben.

10 bis 12 zeigen die klinische Validierung des erfindungsgemäßen Microarrays. 615 Proben (Plasma) von 35 Patienten mit Stammzelltransplantationen wurden mit dem in 1 und Ausführungsbeispiel 1 beschriebenen Microarrays wie in Ausführungsbeispiel 2 beschrieben untersucht.

In 10 wird die Anzahl der Proben, in denen 1, 2 und 3 verschiedene Viruse nachgewiesen wurden gezeigt.

In 11 wird die Anzahl der Proben, in denen 2 verschiedene Viruse nachgewiesen wurden und deren Kombination gezeigt.

In 12 wird die Anzahl der Proben, in denen 3 verschiedene Viruse nachgewiesen wurden und deren Kombination gezeigt.

In 13 werden die Ergebnsisse des Virus-Nachweises mit dem erfindungsgemäßen Microarray (gemäß 1 und Ausführungsbeispiel 1) mit denen einer quantitativen Realtime PCR verglichen. Der Nachweis mit dem Microarray erfolgte in 144 Proben wie in Ausführungsbeispiel 2 beschrieben. Zum Vergleich wurden dieselben Proben mittels Realtime PCR wie in Vergleichsversuch 1 beschrieben untersucht.

Die Ergebnisse zeigen eine 100%ige Übereinstimmung in den Ergebnissen. Der Nachweis mit dem Microarray führt daher vorteilhaft zu den gleichen Ergebnissen, wie die Real-time PCR, ist jedoch deutlich einfacher, preiswerter und schneller durchzuführen.

Ausführungsbeispiel 1:

In dem beispielhaften Array sind die unterschiedliche Viren erkennenden Sequenzen SEQ ID No. 1 bis 17 auf einem Array mit 11 × 10 Feldern und die Kontrollfelder 18 und 19, wie folgt, angeordnet:

191717171718181818181915151516161616161719131314141414141515191911121212121213131319101010101011111111198888999991966677777819445555566192333334441911111222219
  • 11 × 10 0,20 mm Spot-Abstand

Die Bedeutung der Feldnummern sind in der folgenden Tabelle erläutert:

Der Array mit dieser Anordnung wurde von der Firma CLONDIAG chip technologies (Jena, Germany) hergestellt. Die Herstellung des Arrays durch Spotten der oben genannten Nukleinsäuren in der oben aufgelisteten Anordnung, wie zuvor beschrieben (WO 03/059516 A1) auf der „ArrayTube"-Platform. Die Bindung der Nukleinsäureproben an die Arrayoberfläche erfolgt über die Aminogruppe am 3'-Ende.

Jede spezifische Nukleinsäuresequenz wurde in fünf verschiedenen Feldern aufgetragen.

Der Array ist, wie in oben genannter Publikation näher beschrieben und wie in 1 oben links dargestellt, in den Boden eines 1,5 ml Laborreaktionsgefäß („Tube") aus Kunststoff integriert.

Ausführungsbeispiel 2:

Zum Nachweis viraler DNA mit dem, wie in Ausführungsbeispiel 1 aufgebauten Microarray wird beispielsweise, wie folgt Verfahren:

Extraktion viraler DNA:

Virale DNA wurde aus 250 μl plasma mit dem EZ1 virus DNA tissue Kit (Qiagen, Hilden, DE) gemäß Herstellervorschrift extrahiert. Die extrahierte virale DNA wurde in 50 μl RNAse-DNAse-freiem Wasser aufgenommen und bei –20°C bis zur weiteren Verwendung gelagert.

Amplifizierung viraler DNA durch multiplex PCR für Microarray Hybridisierung:

Die Amplifizierung von viraler DNA erfolgte mittels multiplex PCR mit folgendem Reaktionsansatz:

20 μl Gesamtvolumen mit:

  • – 2,2 μl H2O,
  • – 4,8 μl MgCl2 (25 mMol/L)
  • – 2 μl von jedem Primer (5 pmol/μl),
  • – 2 μl Roche HotStart reaction mix.
  • – 5 μl wie oben beschrieben extrahierte virale DNA.

Die Amplifizierung von HSV1 and 2, VZV (HHV3) und EBV (HHV4) erfolgte parallel in einem Ansatz (Ansatz 1) mit folgenden Primern:

SEQ ID No.NameSequenz18HSV1/2-forwardCAT CAC CGA CCC GGA GAG GGA C19HSV1/2-reverseGGG CCA GGC GCT TGT TGG TGT A20VZV-forwardTCT TGT CGA GGA GGC TTC TG21VZV-reverseTGT GTG TCC ACC GGA TGA T22EBV-forward-50CGGAAGCCCTCTGGACTTC23EBV-reverse-51CCCTGTTTATCCGATGGAATG

Die Amplifizierung von viraler DNA von CMV (HHV-5), HHV-6 und Adenovirus erfolgte parallel in einem zweiten Ansatz (Ansatz 2) mit folgenden Primern:

SEQ ID No.NameSequenz24HHV5-forwardGGCCGTTACTGTCTGCAGGA25HHV5-reverseGGCCTCGTAGTGAAAATTAATGGT26HHV6AB56 forwardAAAGACCTAAATTGCCGCTACCT27HHV6AB56 reverseGCAAGCTCATGAACATCGTCA28Adeno forwardGCCACGGTGGGGTTTCTAAACTT29Adeno reverseGCCCCAGTGGTCTTACATGCACATC

Alle eingesetzten Reverse-Primer sind am 5'-Ende biotinyliert. Die Zugabe einer FRET-Sonde (TaqManTM oder Light-CyclerTM) ist hier nicht notwendig.

Beide Ansätze wurden jeweils in einer LightCycler-Kapillare in einem Roche LightCycler 1.5 (Roche diagnostics) unter folgenden Bedingungen amplifiziert:

  • • 10 Minuten Preinkubation bei 95°C,
  • • 55 Cyclen mit je
    – Annealing für 5 Sek. bei 61°C,
    – Extension für 5 Sek. bei 72°C,
  • • Kühlen bei 40°C für 10 min.

Die beiden Reaktionsmischungen wurden aus den LightCycler-Kapillaren bei 1000 rpm herauszentrifugiert und gemischt und anschließend für die Hybridisierung auf dem Microarray verwendet.

Hybridisierung auf dem Microarray:

Die Array-Tubes, welche den Microarray enthalten (s. Ausführungsbeispiel 1) wurden in einem Thermomixer (Eppendorf AG, Hamburg, DE) erst mit 500 μl deionisiertem Wasser bei 35°C und 550 rpm und dann mit 500 μl Hybridisierungspuffer A (1 mMol/L EDTA, 250 mMol/L NaH2PO4, 2 % SSC (v/v), 4.5 % SDS (w/v)) bei 30°C und 550 rpm gewaschen.

Jeweils 10 μl der wie oben beschrieben amplifizierten DNA-Proben werden in 90 μl Hybridisierungspuffer A verdünnt und bei 95°C für 5 Minuten denaturiert, 1 Minute auf Eis gekühlt und in ein wie oben vorbereitetes Array-Tube gegeben. Die Hybridisierung erfolgt für 1 Stunde bei 35°C und 550 rpm. Die Array-Tubes werden dann in einem Thermomixer (Eppendorf AG, Hamburg, DE) mit 500 μl Lösung B (2 % SSC-Puffer (v/v), 0,01 % (v/v) Triton X100) 5 Minuten bei Raumtemperatur und 550 rpm, dann mit 500 μl Lösung C (2 % SSC-Puffer (v/v)), und abschließend mit 500 μl Lösung D (0,2 % SSC-Puffer (v/v)) gewaschen. Danach wurden die Array-Tubes mit einer Blockierungslösung (2 % Milchpulver in 6X SSPE (w/v), 0,005 % Triton X100) für 15 Minuten bei 30°C und 550 rpm inkubiert.

Ein Poly-Horseradish Peroxidase-Streptavidin-Konjugat (100 μg/ml) wurde in 100 μl of 6X SSPE und 0,005 % -Triton verdünnt und zu dem Array-Tube gegeben und dieser für 15 Minuten bei 30°C und 550 rpm inkubiert. Die Array-Tubes wurden 2 Minuten bei 30°C mit Lösung B, 2 Minuten bei 20°C mit Lösung C und abschließend 2 Minuten bei 20°C mit Lösung D gewaschen. Während aller Wachschritte wurden die Tubes bei 550 rpm geschüttelt.

Durch Zugabe von 100 μl des Peroxidase-Substrats Tetramethylbenzidin (TMB) wurde die Farbreaktion ausgelöst. Nach 10 Minuten Inkubation bei 25°C erfolgte die Detektion der Färbung in einem Array-Tube-Reader (ATR01, CLONDIAG Chip Technologies, Jena, DE).

Die Analyse der Ergebnisse erfolgte mit der IconoClust software (CLONDIAG) nach Herstellerangaben. Die Signal-Intensität und der lokale Hintergund jedes Feldes wurden mittels Messung der Transmission bestimmt.

Der Wert NI = 1 – (M/BG)mit

NI
= normalisierte Intensität;
M
= Durchschnittliche Intensität des Feldes (Spots) und
BG
= Background (Hintergund)
wurde für jedes Feld (Spot) berechnet. Dies gibt Werte für NI zwischen 0,0 (schwaches Signal/negativ) und 1,0 (starkes Signal/postiv).

Die durchschnittliche NI für die Biotin-Kontrollfelder (Feld Nr. 19) wurde als Detektionskontrolle berechnet, um die Resultate zu validieren. Falls der durchschnittliche Wert für die Kontrollfelder unter einem vordefinierten Wert von NI = 0,4 lag, wurde der Test als ungültig erklärt.

Vergleichsbeispiel 1:

Der Nachweis viraler DNA in der Real-Time-PCR erfolgt in den gleich Proben extrahierter viraler DNA, wie der Nachweis mittels Microarray (vgl. Ausführungsbeispiel 2 – DNA-Extraktion siehe dort).

Die Amplifizierung von viraler DNA erfolgt prinzipiell, wie in Ausführungsbeispiel 2 beschrieben, wobei jedoch für jeden Virus ein gesonderte Reaktion (Ansatz) durchgeführt wird und die Ansätze zusätzlich je 2 μl der folgenden Light-CyclerTM-Sonden (2 pmol/μl) enthalten und die Reverse-Primer nicht biotyliniert sind. Die Light-CyclerTM-Sonden sind jeweils am 5'-Ende FAM (6'-Carboxy-Fluorescein) und am 3'-Ende TAMRA (5-Carboxytetramethylrhodamin) markiert.

Ansatz 1

  • HSV1 und HSV2 (Bereich: UL 30, DNA-Polymerase; HSV1 Pos. 65866-65957 Genbank Nr. X14112; HSV2 Pos. 66339-66430 Genbank Nr. Z86099)

Primer und Sonde:

SEQ ID No.NameSequenz18HSV1/2-forwardCAT CAC CGA CCC GGA GAG GGA C19HSV1/2-reverseGGG CCA GGC GCT TGT TGG TGT A1Sonde HSV1/2-TMCCG CCG AAC TGA GCA GAC ACC CGC GC

Ansatz 2

  • VZV (HHV3, ORF 62, Genbereich ID wie für den Array

Primer und Sonde:

SEQ ID No.NameSequenz20VZV-forwardTCT TGT CGA GGA GGC TTC TG21VZV-reverseTGT GTG TCC ACC GGA TGA T3Sonde VZV-TMTOT CGA CTG GCT GGG ACT TGC G

Ansatz 3

  • EBV (HHV4, Genbereich ID wie für den Array)

Primer und Sonde:

SEQ ID No.NameSequenz22EBV-forward-50CGGAAGCCCTCTGGACTTC23EBV-reverse-51CCCTGTTTATCCGATGGAATG5Sonde EBV-TMTGTACACGCACGAGAAATGCGCC

Ansatz 4

  • CMV (HHV5, Polymerase-Gen, Genbereich ID wie für den Array)

Primer und Sonde:

SEQ ID No.NameSequenz24HHV5-forwardGGC CGT TAC TGT CTG CAG GA25HHV5-reverseGGC CTC GTA GTG AAA ATT AAT GGT7Sonde HHV5-PRCCG TAT TGG TGC GCG ATC TGT TCA A

Ansatz 5

  • HHV6 (U56, 91162-90275, Capsid Protein, Genbereich ID wie für den Array)

Primer und Sonde:

SEQ ID No.NameSequenz26HHV6AB56 forwardAAAGACCTAAATTGCCGCTACCT27HHV6AB56 reverseGCAAGCTCATGAACATCGTCA9Sonde HHV6AB56-TMTTAGATGGTGGTGAGCTGGGATCGGT

Ansatz 6

  • Adenovirus (Bereich: konservierte Region des Hexon-Gens; Genbereich ID wie für den Array, Quelle: Heim A, Ebnet C, Rarste G, Pring-Akerblom P.; J. Med. Virol. 2003 Jun; 70(2):228-39)

Primer und Sonde:

SEQ ID No.NameSequenz28Adeno-forwardGCGACGGTGGGGTTTCTAAACTT29Adeno-reverseGCCCCAGTGGTCTTACATGCACATC11Sonde Adeno-TMTGCACCAGACCCGGGCTCAGGTACTCCGA

Am Ende jedes Extensionsschrittes wurde für jeden Ansatz die Floureszenz-Intensität bei 560 und 640 nm (F1/F2) gemessen. Für die Quantifizierung der viralen DNA (viral load) in den klinischen Proben wurde als Standardreihe eine 10-fache Verdünnung von den jeweiligen Plasmid DNA von 1012 bis 101 Genomäquivalenten (GE) hergestellt, wie in Sassenscheidt et al. (J Virol Methods, Dec;138(1-2):40-8) beschrieben. Eine Standardkurve wurde erstellt, in dem jeder „crossing-point" des Standards gegen seine Konzentration aufgetragen wurde.

Es folgt ein Sequenzprotokoll nach WIPO St. 25.Dieses kann von der amtlichen Veröffentlichungsplattform des DPMA heruntergeladen werden.