|
Match
|
Document |
Document Title |
|
|
7297779 |
Colon cancer metastasis inhibitor
The present invention provides an agent for inhibiting metastasis of colorectal cancer and a method for inhibiting metastasis of colorectal cancer, which inhibit the function of Asef (i.e., binding...
|
|
|
7297786 |
RNA interference in respiratory epitheial cells
The present invention is directed to small interfering RNA molecules targeted against a gene of interest in respiratory epithelial cells, and methods of using these RNA molecules.
|
|
|
7297684 |
Antisense therapy for hormone-regulated tumors
A method is provided for treating hormone-regulated tumors (for example, breast and prostatic tumors) in mammals, including humans, by administration of an antisense ODN which is complementary to a...
|
|
|
7294712 |
Nucleotide sequences coding for variable regions of β chains of human T lymphocyte receptors, corresponding peptide segments and the diagnostic and therapeutic uses
The present invention relates to new nucleotide sequences coding for variable regions of β chains of human T lymphocyte receptors, corresponding peptide segments and the diagnostic and therapeutic...
|
|
|
7294713 |
Antisense IAP oligonucleotides and uses thereof
The present invention feature antisense IAP oligonucleotides and other negative regulators of the IAP anti-apoptotic pathway, and methods for using them to enhance apoptosis.
|
|
|
7291725 |
Sos1 inhibitors
Inhibitors of human Sos1, including antisense oligonucleotides, methods, and compositions specific for human Sos1, are provided. Methods of using the compositions for modulating Sos1 expression and...
|
|
|
7288530 |
Antisense modulation of survivin expression
Antisense compounds, compositions and methods are provided for modulating the expression of Survivin. The compositions comprise antisense compounds, particularly antisense oligonucleotides,...
|
|
|
7288531 |
Potent inhibition of influenza virus by specifically designed short interfering RNA
This patent application discloses siRNA sequences against the constant region of the influenza virus nucleoprotein gene comprising:
Sense strand: 5′ UGAAGGAUCUUAUUUCUUCdTdT 3′ (SEQ ID NO: 1)...
|
|
|
7285541 |
Treatment of melanoma by reduction in clusterin levels
Treatment of melanoma is achieved through reduction in the effective amount of clusterin in melanoma cells of in a mammalian subject, preferably a human. A therapeutic agent effective to reduce the...
|
|
|
7285288 |
Inhibition of Bcl-2 protein expression by liposomal antisense oligodeoxynucleotides
The present invention provides novel compositions and methods for use in the treatment of Bcl-2-associated diseases like cancer, specifically, in the treatment of follicular lymphoma (FL). The...
|
|
|
7279615 |
Floral transition genes in maize and uses thereof
The invention provides isolated floral transition nucleic acids and their encoded proteins. The present invention provides methods and compositions relating to altering floral transition in plants....
|
|
|
7279463 |
Triple-helix forming oligonucleotides for targeted mutagenesis
A high affinity, triplex-forming oligonucleotide and methods for use thereof wherein an oligonucleotide is used to form a triple-stranded nucleic acid molecule with a specific DNA segment of a...
|
|
|
7273932 |
Antisense oligonucleotides for fertility and menstrual cycle regulation and for chemopreventive and chemotherapeutic use
The invention relates to antisense oligonucleotides, in particular to antisense oligonucleotides to receptor genes, and the use of such oligonucleotides to regulate reproductive function and as...
|
|
|
7270968 |
PTH analogs for renal osteodystrophy and related uses
The invention relates to a mammalian cell lacking type-1 parathyroid hormone (PTH)/parathyroid hormone-related peptide (PTHrP) receptor (PTH1R) activity and containing carboxyl-terminal parathyroid...
|
|
|
7267977 |
Peripheral-type benzodiazepine receptor: a tool for detection, diagnosis, prognosis, and treatment of cancer
The expression and subcellular localization of peripheral-type benzodiazepine receptors (PBR) is shown in this application to correlate with the metastatic potential of cells, and increased cell...
|
|
|
7268121 |
Suppression of nuclear factor-κB dependent processes using oligonucleotides
Antisense oligonucleotides which hybridize with nuclear factor-κB(NF-κB) mRNA and methods of using these oligonucleotides.
|
|
|
7265214 |
Germinal center kinase proteins, compositions and methods of use
The present invention provides compositions and methods for modulating cell proliferation, survival, morphology, and migration. Nucleic acids encoding proteins and proteins so encoded which are...
|
|
|
7262175 |
Synthetic oligonucleotides as inducers of erythroid differentiation
The invention refers to a synthetic double-stranded oligonucleotide having a length comprised between 10 and 50 bases and a nucleic acid sequence selected from the group consisting of: (a)...
|
|
|
7262173 |
Chemosensitizing with liposomes containing oligonucleotides
The invention relates to the use of oligonucleotide containing cationic liposomal formulations to enhance the efficacy of chemotherapy and/or radiotherapy, particularly as a means to sensitize...
|
|
|
7259150 |
Modulation of apolipoprotein (a) expression
Compounds, compositions and methods are provided for modulating the expression of apolipoprotein(a). The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein(a)....
|
|
|
7256284 |
Inhibitory oligonucleotides targeted to Bcl-2
Inhibitory oligonucleotides are disclosed which are targeted to three specific target regions and subsequences of the target regions found on nucleic acids encoding Bcl-2. These inhibitory...
|
|
|
7250507 |
Inhibitory Pellino nucleic acids
There are disclosed novel polypeptides referred to as Pellino polypeptides, as well as fragments thereof, including immunogenic peptides. DNAs encoding such polypeptides as well as methods of using...
|
|
|
7250406 |
Compositions and methods for the acceleration of protein secretion dynamics
The present invention provides compositions and methods for modulating the secretion of transcriptionally regulated proteins from recombinant cells. More particularly, the present invention...
|
|
|
7247770 |
Regulating metabolism by modifying the level of trehalose-6-phosphate
Method for the inhibition of carbon flow in the glycolytic direction in a cell by increasing the intracellular availability of trehalose-6-phosphate.
|
|
|
7247618 |
Methods for inhibiting macrophage colony stimulating factor and c-FMS-dependent cell signaling
Described herein are methods of inhibiting M-CSF activity, and, in particular, M-CSF/c-fms dependent cell signaling. In a first embodiment of the invention, one administers to a mammal viral...
|
|
|
7241618 |
Expression system
The present invention provides a polynucleotide comprising a RNA polymerase III promoter, a region encoding a siRNA, and a transcriptional termination element comprising five consecutive thymine...
|
|
|
7238673 |
Treatment of diseases by site-specific instillation of cells or site-specific transformation of cells and kits therefor
A method for the direct in vivo transformation of cells in and surrounding a solid tumor is disclosed. This method is based on the site-specific delivery of proteins to solid tumors and to tissue...
|
|
|
7238675 |
Antisense antibacterial method and composition
The invention relates to compositions comprising oligomers antisense to bacterial 16S or 23S rRNA and capable of selectively modulating the biological activity thereof, and methods for their use....
|
|
|
7235654 |
Methods for modulating IKKα activity
A method for modulating NF-κB dependent gene transcription in a cell comprised of modulating IKKα protein activity in the cell. The present invention also provides siRNA compositions and methods...
|
|
|
7235653 |
Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
Compositions and methods for the treatment of asthma with oligonucleotides which specifically hybridize with nucleic acids encoding B7 proteins.
|
|
|
7235534 |
Antisense strategy to modulate estrogen receptor response (ER α and/or ER β )
The present invention provides novel antisense oligonucleotides that target the genes and mRNAs encoding mammalian Estrogen Receptors (ER) alpha and/or beta and modulate the receptors' responses....
|
|
|
7232806 |
MicroRNA molecules
In Caenorhabditis elegans , lin-4 and let-7 encode 22- and 21-nucleotide RNAs, respectively, that function as key regulators of developmental timing. Because the appearance of these short RNAs is...
|
|
|
7232808 |
Methods of inhibiting manganese-containing superoxide dismutase 2 (MnSOD)
The present invention provides RNA molecules (e.g., antisense, RNAi, or siRNA) specific for MnSOD, and further provides methods of reducing expression of MnSOD in cells (e.g., cancer cells).
|
|
|
7229974 |
G cap-stabilized oligonucleotides
Oligonucleotides of the formula
5′-(CAP)-(Oligo)-(CAP)-3′
are disclosed...
|
|
|
7230094 |
Neutral sphingomyelinase antisense ribozyme and uses thereof
The present invention provides novel antisense ribozymes useful for inhibiting the activity of neutral sphingomyelinase. Also provided are methods for reducing the activity of neutral...
|
|
|
7229976 |
Modulation of forkhead box O1A expression
Antisense compounds, compositions and methods are provided for modulating the expression of forkhead box O1A. The compositions comprise antisense compounds, particularly antisense oligonucleotides,...
|
|
|
7223856 |
Antisense compounds which prevent cell death and uses thereof
The present invention provides for an antisense oligonucleotide having the sequence 5′GCTCGGCGCCGCCATTTCCAG3′. The invention also provides for an antisense oligonucleotide having the sequence...
|
|
|
7217572 |
Modulation of HIF1α and HIF2α expression
Compounds, compositions and methods are provided for modulating the expression of HIF1α and/or HIF2α. The compositions comprise oligonucleotides, targeted to nucleic acid encoding HIF1α and...
|
|
|
7214851 |
Bzip type transcription factors regulating the expression of rice storage protein
cDNAs (RISBZ1, RISBZ4, and RISBZ5) encoding bZIP transcription factors were isolated from a cDNA library originating in rice plant seed. The cDNAs encode novel proteins and have binding activity to...
|
|
|
7214790 |
Genes and proteins encoded thereby
The present invention encompasses novel mammalian cell cycle checkpoint genes/DNA repair genes, cDNA or genomic DNA, isolated nucleic acids corresponding thereto, expression vectors comprising said...
|
|
|
7211661 |
Trans-excision-splicing ribozyme and methods of use
A group I intron-derived ribozyme which binds RNA in trans, excises an internal segment from within the RNA, and splices the remaining 5′ and 3′ ends of the RNA back together (the...
|
|
|
7205283 |
Antisense oligonucleotides that inhibit expression of HIF-1
New antisense oligonucleotide compounds, RX-0047 and RX-0149, inhibit expression of HIF-1 and also induce cytotoxicity in several cancer cell lines.
|
|
|
7202225 |
Therapeutic delivery compositions and methods of use thereof
The present invention relates to compositions and methods for delivery of antisense oligonucleotides or other nucleic acid sequences. The present invention comprises a delivery composition...
|
|
|
7202025 |
Control of gene expression
A method of suppressing the expression of a selected gene in a eukaryotic cell the method comprising introducing into the cell (a) a polypeptide comprising a DNA binding portion which binds to a...
|
|
|
7199228 |
Oligonucleotide compositions and their use to induce apoptosis
The present invention provides novel synthetic oligonucleotide sequences (hereinafter sequence) of 3 to 9 bases in length comprising one or more non-DNA bases wherein the bases are nebularine,...
|
|
|
7198949 |
Compositions and methods for altering the biodistribution of biological agents
The invention relates to a new and improved pharmaceutical composition and method for delivery of therapeutic agents. The methods and composition of the invention can be used with several...
|
|
|
7195916 |
Method for expression of small antiviral RNA molecules within a cell
In one aspect, the invention provides methods and compositions for the expression of small RNA molecules within a cell using a retroviral vector. The methods can be used to express double stranded...
|
|
|
7196067 |
Antisense insulin-like growth factor binding protein (IGFBP)-2-oligodeoxynucleotides for prostate and other endocrine tumor therapy
Compositions and a method are provided for the treatment of prostate and other endocrine tumors in mammals, including humans, by administration of an antisense oligodeoxynucleotide (ODN) which is...
|
|
|
7196069 |
High affinity RNA ligands of basic fibroblast growth factor
Methods are described for the identification and preparation of nucleic acid ligand solutions to basic fibroblast growth factor (bFGF). Included in the invention are nucleic acid ligands to bFGF...
|
|
|
7192708 |
Nucleic acid enzyme biosensors for ions
A method of detecting the presence of an ion includes contacting a nucleic acid enzyme with a sample suspected of containing the ion, where the enzyme contains a ribonucleotide and is dependent on...
|