Match Document Document Title
7504209 Method and device for integrated nucleic acid integrity assessment and analysis  
The present invention relates to methods for integrated ribonucleic acid integrity assessment and analysis comprising the steps of: (a) providing a support having immobilized thereon a set of...
7504496 Water-soluble rhodamine dye conjugates  
The present invention provides novel, water-soluble, red-emitting fluorescent rhodamine dyes and red-emitting fluorescent energy-transfer dye pairs, as well as labeled conjugates comprising the...
7504215 Nucleic acid labeling methods  
In one aspect of the invention, a method is provided for end-labeling RNA (total RNA, mRNA, cRNA or fragmented RNA). In one aspect of the present invention, T4 RNA ligase is used to attach a...
7504218 Key probe compositions and methods for polynucleotide detection  
The invention relates to compositions and methods for detection of nucleic acid sequences. The invention further relates to kit format of said compositions for detection of nucleic acid sequences....
7501506 Pentopyranosyl nucleic acid conjugates  
The invention relates to compounds including at least one pentopyranosyl nucleic acid and a biomolecule conjugated through a covalent linkage to the at least one pentopyranosyl nucleic acid. The...
7501555 Method for obtaining a plant with a lasting resistance to a pathogen  
A method for obtaining a plant, in particular a cultivated lettuce plant ( L. sativa ), with a lasting resistance to a pathogen, in particular Bremia lactucae , comprised of providing one or more...
7501253 DNA fingerprinting using a branch migration assay  
A method of determining the length of a polynucleotide target is provided. With this method, a target is first hybridized to an array of first probes having different, determined lengths, resulting...
7501266 Differentiating homozygous, heterozygous and wild-type alleles using a multiplexed hybridization-mediated assay  
Described are methods of assay design and assay image correction, useful for multiplexed genetic screening for mutations and polymorphisms, including CF-related mutants and polymorphs, using an...
7501252 Use of predetermined nucleotides having altered base pairing characteristics in the amplification of nucleic acid molecules  
The present invention provides improved methods for amplifying a nucleic acid molecule. More specifically, the invention provides methods for nucleic acid amplification which use primers having...
7501250 Blotting method for rapidly analyzing nucleic acid  
The present invention relates to a blotting method for rapidly analyzing nucleic acid comprising the steps of transferring a nucleic acid to be analyzed to the substrate and fixing the nucleic acid...
7501239 Method of detecting β3 adrenaline receptor mutant gene and nucleic acid probe and kit therefor  
A melting curve analysis is performed for a nucleic acid containing a mutation in a nucleotide sequence resulting in a mutation replacing tryptophan at position 64 in an amino acid sequence of the...
7498315 Methods and compositions for the inhibition of gene expression  
The present invention relates to methods and compositions for the inhibition of gene expression. In particular, the present invention provides oligonucleotide-based therapeutics for the inhibition...
7498137 Compositions and methods for determining the presence of Chlamydophila pneumoniae in a test sample  
The present invention relates to oligonucleotides useful for determining the presence of Chlamydophila pneumoniae in a test sample. The oligonucleotides of the present invention may be...
7495094 Detection reagent for thermostable direct hemolysin-related hemolysin gene of Vibrio parahaemolyticus  
A detection reagent for detecting thermostable direct hemolysin-related hemolysin (TRH) gene in an amplification process which specifically amplifies TRH1 and TRH2 RNA, which reagent comprises a...
7495093 Amplification and detection method  
The present invention concerns oligonucleotides containing one or more modified nucleotides which increase the binding affinity of the oligonucleotides to target nucleic acids having a...
7494817 Methods for genotype screening using magnetic particles  
This invention relates to a method of an assay of genomic nucleic acid. Additionally, this invention relates to various methods to detect or screen for designated genetic sequences or portion...
7494777 Genomic sequence of the 5-lipoxygenase-activating protein (FLAP), polymorphic markers thereof and methods for detection of asthma  
The invention concerns the genomic sequence of the FLAP gene. The invention also concerns biallelic markers of a FLAP gene and the association established between these markers and diseases...
7494773 Nucleotide sequences specific to Brucella and methods for the detection of Brucella  
Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization...
7494772 Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis  
Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and...
7494981 Inhibition of interaction of PSD93 and PSD95 with nNOS and NMDA receptors  
PSD-95/SAP90 antisense-treated animals not only experience a significant decrease in MAC for isoflurane, but also experience an attenuation in the NMDA-induced increase in isoflurane MAC....
7491818 Nucleic acid labeling compounds  
Nucleic acid labeling compounds containing heterocyclic derivatives are disclosed. The heterocyclic derivative containing compounds are synthesized by condensing a heterocyclic derivative with a...
7488816 Methods for obtaining thermostable enzymes, DNA polymerase I variants from Thermus aquaticus having new catalytic activities, methods for obtaining the same, and applications of the same  
The present invention provides a method for obtaining thermostable enzymes. The present invention also provides variants of DNA polymerase I from Thermus aquaticus . The present invention further...
7488577 Method for measuring DNA polymerization and applications of the method  
A method for measuring DNA-dependent DNA polymerisation in a biological sample, is described. The method comprises the steps of providing a primer with a single stranded short specific sequence,...
7488578 Method for detecting DNA point mutations (single nucleotide polymorphism (SNP) analysis) and associated arrangement  
The single nucleotide polymorphism analysis involves the utilization of a DNA hybridization process as well as the use of a DNA chip. A liquid DNA sample to be analyzed is guided over a DNA chip in...
7488815 Gene imprinting and methylated CpG islands  
Genomic imprinting is a parent of origin-dependent gene silencing that involves marking of alleles in the germline and differential expression in somatic cells of the offspring. Imprinted genes and...
7488576 Methods for diagnosis and treatment of psychiatric disorders  
The present invention provides methods for the diagnosis and treatment of psychiatric disorders. In particular, the present invention provides convergent functional genomics methods for the...
7488813 Diagnostic markers, especially for in vivo imaging, and assays and methods of use thereof  
Novel splice variants as diagnostic markers, preferably membrane-bound. The novel variants according to the present invention may optionally be used for diagnosis of Marker-detectable disease as...
7485709 Identification of a novel BHD gene  
The present disclosure relates to Birt-Hogg-Dubé syndrome, nucleic acids encoding the BHD gene, and methods of using the nucleic acids and proteins encoded thereby. In particular, the present...
7485426 Method and kits for preparing multicomponent nucleic acid constructs  
The invention provides a highly efficient, rapid, and cost effective method of linking nucleic acid components in a predetermined order to produce a nucleic acid multicomponent construct. The...
7485442 Real-time linear detection probes: sensitive 5'-minor groove binder-containing probes for PCR analysis  
Oligonucleotide probes/conjugates are provided along with method for their use in assays to monitor amplification wherein the signal produced does not rely on 5′ nuclease digestion.
7482444 Terminating substrates for DNA polymerases  
This invention concerns novel terminating substrates for DNA polymerases. The substrates are nucleoside triphosphates labeled with lanthanide chelates.
7482443 Systems and methods to quantify and amplify both signaling probes for cDNA chips and genes expression microarrays  
The invention provides a series of reagent compositions and methods for making and amplifying novel cDNA based probe sets from RNA samples to improve analysis with gene expression arrays. The...
7482127 Nucleic acid detection assays employing blocker oligonucleotides  
The present invention provides methods, compositions, and kits for detecting the presence or absence of target sequences in a sample, where the sample also contains interfering sequences that are...
7482123 Biomarkers for prostate cancer metastasis  
The present invention provides genomic markers for determining the predisposition of prostate cancer to become metastasized.
7479548 Nucleic acid based ladder copolymers  
The present invention relates to a copolymer termed a ladder copolymer because it has two backbones that serve as legs/sides of a ladder structure. These two backbones, one of which is a nucleic...
7476520 Primers for use in detecting beta-lactamases  
Oliognucleotide primers are provided that are specific for nucleic acid characteristic of certain beta-lactamases. The primers can be employed in methods to identify nucleic acid characteristic of...
7476853 Ion fragmentation by reaction with neutral particles  
The invention relates to a method and apparatus for the fragmentation of large molecules, especially biopolymers. The invention consists in reacting analyte ions with excited or radical neutral...
7476786 Controlled alignment of nano-barcodes encoding specific information for scanning probe microscopy (SPM) reading  
The methods, apparatus and compositions disclosed herein concern the detection, identification and/or sequencing of biomolecules, such as nucleic acids or proteins. In certain embodiments of the...
7476733 Development of a real-time PCR assay for detection of pneumococcal DNA and diagnosis of pneumococccal disease  
Disclosed are compositions and methods for detecting a specific sequence of the psaA gene using real-time PCR for diagnosis of Pneumococcal Disease.
7473768 Primers and a screening method for identification of artemisinin producing plants  
The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of...
7473775 Abortive promoter cassettes  
The present invention provides methods for detecting the presence of a target molecule by generating multiple detectable oligonucleotides through reiterative enzymatic oligonucleotide synthesis...
7473525 Compositions and methods for inhibiting expression of anti-apoptotic genes  
The present invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of an anti-apoptotic gene, comprising a complementary RNA strand having a nucleotide...
7473774 Kit for diagnosing and prognosticating matrix metalloproteinase-1 related disease via a matrix metalloproteinase-1 single nucleotide polymorphism  
Methods and kits for diagnosing and prognosticating matrix metalloproteinase-1 related disease by detecting a single nucleotide polymorphism in the promoter of the gene are provided. Also provided...
7473773 Determination of hepatitis C virus genotype  
The present invention provides compositions and methods for the detection and characterization of HCV sequences. More particularly, the present invention provides compositions, methods and kits for...
7470514 Method of diagnosing, monitoring, and staging prostate cancer  
The present invention provides a new method for detecting, diagnosing, monitoring, staging and prognosticating prostate cancer.
7470508 Method of screening for melanoma by detecting an increase in cyclin D1  
The present invention provides methods of screening for the presence of premalignant melanocytes in a sample from a patient. The methods comprise contacting a nucleic acid sample from a biological...
7470534 Mutated AQP, method for detecting cancer using the same, DNA chip having oligonucleotides of said mutated AQP sequence  
The present invention relates to mutation genes of the AQP(aquaporin), a method for detecting cancer using mutations and expressions of the AQP and a DNA chip possessing oligonucleotides of mutated...
7470512 Oligonucleotides for use in determining the presence of human papilloma virus in a test sample  
The present invention describes oligonucleotides targeted to HPV Type 16 and/or Type 18 nucleic acid sequences which are particularly useful to aid in detecting HPV type 16 and or 18. The...
7468251 Compositions for detection of A target nucleic acid sequence  
The invention relates to compositions for generating a signal indicative of the presence of a target nucleic acid in a sample, where the compositions include an RNA polymerase, a FEN nuclease, and...
7468244 Polymorphism detection and separation  
Methods and compositions for polymorphism detection and separation. The methods are readily multiplexed, can be adapted to a variety of existing detection systems, and permit target amplification...