|
Match
|
Document |
Document Title |
|
|
7504209 |
Method and device for integrated nucleic acid integrity assessment and analysis
The present invention relates to methods for integrated ribonucleic acid integrity assessment and analysis comprising the steps of: (a) providing a support having immobilized thereon a set of...
|
|
|
7504496 |
Water-soluble rhodamine dye conjugates
The present invention provides novel, water-soluble, red-emitting fluorescent rhodamine dyes and red-emitting fluorescent energy-transfer dye pairs, as well as labeled conjugates comprising the...
|
|
|
7504215 |
Nucleic acid labeling methods
In one aspect of the invention, a method is provided for end-labeling RNA (total RNA, mRNA, cRNA or fragmented RNA). In one aspect of the present invention, T4 RNA ligase is used to attach a...
|
|
|
7504218 |
Key probe compositions and methods for polynucleotide detection
The invention relates to compositions and methods for detection of nucleic acid sequences. The invention further relates to kit format of said compositions for detection of nucleic acid sequences....
|
|
|
7501506 |
Pentopyranosyl nucleic acid conjugates
The invention relates to compounds including at least one pentopyranosyl nucleic acid and a biomolecule conjugated through a covalent linkage to the at least one pentopyranosyl nucleic acid. The...
|
|
|
7501555 |
Method for obtaining a plant with a lasting resistance to a pathogen
A method for obtaining a plant, in particular a cultivated lettuce plant ( L. sativa ), with a lasting resistance to a pathogen, in particular Bremia lactucae , comprised of providing one or more...
|
|
|
7501253 |
DNA fingerprinting using a branch migration assay
A method of determining the length of a polynucleotide target is provided. With this method, a target is first hybridized to an array of first probes having different, determined lengths, resulting...
|
|
|
7501266 |
Differentiating homozygous, heterozygous and wild-type alleles using a multiplexed hybridization-mediated assay
Described are methods of assay design and assay image correction, useful for multiplexed genetic screening for mutations and polymorphisms, including CF-related mutants and polymorphs, using an...
|
|
|
7501252 |
Use of predetermined nucleotides having altered base pairing characteristics in the amplification of nucleic acid molecules
The present invention provides improved methods for amplifying a nucleic acid molecule. More specifically, the invention provides methods for nucleic acid amplification which use primers having...
|
|
|
7501250 |
Blotting method for rapidly analyzing nucleic acid
The present invention relates to a blotting method for rapidly analyzing nucleic acid comprising the steps of transferring a nucleic acid to be analyzed to the substrate and fixing the nucleic acid...
|
|
|
7501239 |
Method of detecting β3 adrenaline receptor mutant gene and nucleic acid probe and kit therefor
A melting curve analysis is performed for a nucleic acid containing a mutation in a nucleotide sequence resulting in a mutation replacing tryptophan at position 64 in an amino acid sequence of the...
|
|
|
7498315 |
Methods and compositions for the inhibition of gene expression
The present invention relates to methods and compositions for the inhibition of gene expression. In particular, the present invention provides oligonucleotide-based therapeutics for the inhibition...
|
|
|
7498137 |
Compositions and methods for determining the presence of Chlamydophila pneumoniae in a test sample
The present invention relates to oligonucleotides useful for determining the presence of Chlamydophila pneumoniae in a test sample. The oligonucleotides of the present invention may be...
|
|
|
7495094 |
Detection reagent for thermostable direct hemolysin-related hemolysin gene of Vibrio parahaemolyticus
A detection reagent for detecting thermostable direct hemolysin-related hemolysin (TRH) gene in an amplification process which specifically amplifies TRH1 and TRH2 RNA, which reagent comprises a...
|
|
|
7495093 |
Amplification and detection method
The present invention concerns oligonucleotides containing one or more modified nucleotides which increase the binding affinity of the oligonucleotides to target nucleic acids having a...
|
|
|
7494817 |
Methods for genotype screening using magnetic particles
This invention relates to a method of an assay of genomic nucleic acid. Additionally, this invention relates to various methods to detect or screen for designated genetic sequences or portion...
|
|
|
7494777 |
Genomic sequence of the 5-lipoxygenase-activating protein (FLAP), polymorphic markers thereof and methods for detection of asthma
The invention concerns the genomic sequence of the FLAP gene. The invention also concerns biallelic markers of a FLAP gene and the association established between these markers and diseases...
|
|
|
7494773 |
Nucleotide sequences specific to Brucella and methods for the detection of Brucella
Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization...
|
|
|
7494772 |
Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis
Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and...
|
|
|
7494981 |
Inhibition of interaction of PSD93 and PSD95 with nNOS and NMDA receptors
PSD-95/SAP90 antisense-treated animals not only experience a significant decrease in MAC for isoflurane, but also experience an attenuation in the NMDA-induced increase in isoflurane MAC....
|
|
|
7491818 |
Nucleic acid labeling compounds
Nucleic acid labeling compounds containing heterocyclic derivatives are disclosed. The heterocyclic derivative containing compounds are synthesized by condensing a heterocyclic derivative with a...
|
|
|
7488816 |
Methods for obtaining thermostable enzymes, DNA polymerase I variants from Thermus aquaticus having new catalytic activities, methods for obtaining the same, and applications of the same
The present invention provides a method for obtaining thermostable enzymes. The present invention also provides variants of DNA polymerase I from Thermus aquaticus . The present invention further...
|
|
|
7488577 |
Method for measuring DNA polymerization and applications of the method
A method for measuring DNA-dependent DNA polymerisation in a biological sample, is described. The method comprises the steps of providing a primer with a single stranded short specific sequence,...
|
|
|
7488578 |
Method for detecting DNA point mutations (single nucleotide polymorphism (SNP) analysis) and associated arrangement
The single nucleotide polymorphism analysis involves the utilization of a DNA hybridization process as well as the use of a DNA chip. A liquid DNA sample to be analyzed is guided over a DNA chip in...
|
|
|
7488815 |
Gene imprinting and methylated CpG islands
Genomic imprinting is a parent of origin-dependent gene silencing that involves marking of alleles in the germline and differential expression in somatic cells of the offspring. Imprinted genes and...
|
|
|
7488576 |
Methods for diagnosis and treatment of psychiatric disorders
The present invention provides methods for the diagnosis and treatment of psychiatric disorders. In particular, the present invention provides convergent functional genomics methods for the...
|
|
|
7488813 |
Diagnostic markers, especially for in vivo imaging, and assays and methods of use thereof
Novel splice variants as diagnostic markers, preferably membrane-bound. The novel variants according to the present invention may optionally be used for diagnosis of Marker-detectable disease as...
|
|
|
7485709 |
Identification of a novel BHD gene
The present disclosure relates to Birt-Hogg-Dubé syndrome, nucleic acids encoding the BHD gene, and methods of using the nucleic acids and proteins encoded thereby. In particular, the present...
|
|
|
7485426 |
Method and kits for preparing multicomponent nucleic acid constructs
The invention provides a highly efficient, rapid, and cost effective method of linking nucleic acid components in a predetermined order to produce a nucleic acid multicomponent construct. The...
|
|
|
7485442 |
Real-time linear detection probes: sensitive 5'-minor groove binder-containing probes for PCR analysis
Oligonucleotide probes/conjugates are provided along with method for their use in assays to monitor amplification wherein the signal produced does not rely on 5′ nuclease digestion.
|
|
|
7482444 |
Terminating substrates for DNA polymerases
This invention concerns novel terminating substrates for DNA polymerases. The substrates are nucleoside triphosphates labeled with lanthanide chelates.
|
|
|
7482443 |
Systems and methods to quantify and amplify both signaling probes for cDNA chips and genes expression microarrays
The invention provides a series of reagent compositions and methods for making and amplifying novel cDNA based probe sets from RNA samples to improve analysis with gene expression arrays. The...
|
|
|
7482127 |
Nucleic acid detection assays employing blocker oligonucleotides
The present invention provides methods, compositions, and kits for detecting the presence or absence of target sequences in a sample, where the sample also contains interfering sequences that are...
|
|
|
7482123 |
Biomarkers for prostate cancer metastasis
The present invention provides genomic markers for determining the predisposition of prostate cancer to become metastasized.
|
|
|
7479548 |
Nucleic acid based ladder copolymers
The present invention relates to a copolymer termed a ladder copolymer because it has two backbones that serve as legs/sides of a ladder structure. These two backbones, one of which is a nucleic...
|
|
|
7476520 |
Primers for use in detecting beta-lactamases
Oliognucleotide primers are provided that are specific for nucleic acid characteristic of certain beta-lactamases. The primers can be employed in methods to identify nucleic acid characteristic of...
|
|
|
7476853 |
Ion fragmentation by reaction with neutral particles
The invention relates to a method and apparatus for the fragmentation of large molecules, especially biopolymers. The invention consists in reacting analyte ions with excited or radical neutral...
|
|
|
7476786 |
Controlled alignment of nano-barcodes encoding specific information for scanning probe microscopy (SPM) reading
The methods, apparatus and compositions disclosed herein concern the detection, identification and/or sequencing of biomolecules, such as nucleic acids or proteins. In certain embodiments of the...
|
|
|
7476733 |
Development of a real-time PCR assay for detection of pneumococcal DNA and diagnosis of pneumococccal disease
Disclosed are compositions and methods for detecting a specific sequence of the psaA gene using real-time PCR for diagnosis of Pneumococcal Disease.
|
|
|
7473768 |
Primers and a screening method for identification of artemisinin producing plants
The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of...
|
|
|
7473775 |
Abortive promoter cassettes
The present invention provides methods for detecting the presence of a target molecule by generating multiple detectable oligonucleotides through reiterative enzymatic oligonucleotide synthesis...
|
|
|
7473525 |
Compositions and methods for inhibiting expression of anti-apoptotic genes
The present invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of an anti-apoptotic gene, comprising a complementary RNA strand having a nucleotide...
|
|
|
7473774 |
Kit for diagnosing and prognosticating matrix metalloproteinase-1 related disease via a matrix metalloproteinase-1 single nucleotide polymorphism
Methods and kits for diagnosing and prognosticating matrix metalloproteinase-1 related disease by detecting a single nucleotide polymorphism in the promoter of the gene are provided. Also provided...
|
|
|
7473773 |
Determination of hepatitis C virus genotype
The present invention provides compositions and methods for the detection and characterization of HCV sequences. More particularly, the present invention provides compositions, methods and kits for...
|
|
|
7470514 |
Method of diagnosing, monitoring, and staging prostate cancer
The present invention provides a new method for detecting, diagnosing, monitoring, staging and prognosticating prostate cancer.
|
|
|
7470508 |
Method of screening for melanoma by detecting an increase in cyclin D1
The present invention provides methods of screening for the presence of premalignant melanocytes in a sample from a patient. The methods comprise contacting a nucleic acid sample from a biological...
|
|
|
7470534 |
Mutated AQP, method for detecting cancer using the same, DNA chip having oligonucleotides of said mutated AQP sequence
The present invention relates to mutation genes of the AQP(aquaporin), a method for detecting cancer using mutations and expressions of the AQP and a DNA chip possessing oligonucleotides of mutated...
|
|
|
7470512 |
Oligonucleotides for use in determining the presence of human papilloma virus in a test sample
The present invention describes oligonucleotides targeted to HPV Type 16 and/or Type 18 nucleic acid sequences which are particularly useful to aid in detecting HPV type 16 and or 18. The...
|
|
|
7468251 |
Compositions for detection of A target nucleic acid sequence
The invention relates to compositions for generating a signal indicative of the presence of a target nucleic acid in a sample, where the compositions include an RNA polymerase, a FEN nuclease, and...
|
|
|
7468244 |
Polymorphism detection and separation
Methods and compositions for polymorphism detection and separation. The methods are readily multiplexed, can be adapted to a variety of existing detection systems, and permit target amplification...
|