|
Match
|
Document |
Document Title |
|
|
6953783 |
Modulation of gene expression by combination therapy
The invention relates to the modulation of gene expression. In particular, the invention relates to compositions comprising antisense oligonucleotides which inhibit expression of a gene in operable...
|
|
|
6953575 |
Methods of treating central nervous system disorders using viral vectors
Methods of delivering viral vectors, particularly recombinant AAV virions, to the CNS are provided. Also provided are methods of treating Parkinson's Disease.
|
|
|
6953568 |
Targeting of molecules to large vessel endothelium using EPCR
Endothelial protein C receptor (EPCR) is found primarily on endothelial cells of large vessels. EPCR translocates from the plasma membrane surface to the nucleus. Molecules which bind to EPCR can...
|
|
|
6951845 |
Method for treating allergic lung disease
The invention is directed to a method for treating both the early and late phases of allergic asthma by introducing naked polynucleotides which operatively encode for the asthma-initiating antigen...
|
|
|
6951613 |
Genetic vaccination device and process for forming an injection therefor
There is disclosed a genetic vaccination device and a process for forming an injection solution therefor, the device comprising a syringe and canula coupled to a membrane adsorber having genetic...
|
|
|
6949520 |
Methods related to immunostimulatory nucleic acid-induced interferon
Methods and compositions are provided for extending the clinical utility of IFN-α in the treatment of a variety of viral and proliferative disorders. Among other aspects, the invention provides...
|
|
|
6949368 |
Compositions and methods for enhancing polynucleotide amplification reactions
Compositions and methods for enhancing PCR and other polynucleotide replication reactions are disclosed. These comprise the addition of low molecular weight organic amides, sulfones or sulfoxides...
|
|
|
6946448 |
In utero oral nucleic acid immunization
Methods of nucleic acid immunization comprising the in utero delivery of nucleic acid molecules that encode one or more selected antigens to a vertebrate fetus are disclosed.
|
|
|
6946447 |
MDM2-specific antisense oligonucleotides
The invention provides methods to activate tumor suppressors. The invention further provides antisense oligonucleotides complementary to a portion of the MDM2-encoding RNA and methods for using...
|
|
|
6943153 |
Use of recombinant gene delivery vectors for treating or preventing diseases of the eye
Gene delivery vectors, such as, for example, recombinant adeno-associated viral vectors, and methods of using such vectors are provided for use in treating or preventing diseases of the eye.
|
|
|
6943152 |
DNA vaccine-PCV
The invention relates to immunogenic preparations or vaccines comprising, on the one hand, a plasmid encoding and expressing a gene from PCV, in particular selected from the group consisting of...
|
|
|
6943027 |
Preparation of stable formulations of lipid-nucleic acid complexes for efficient in vivo delivery
The present invention provides for lipid:nucleic acid complexes that have increased shelf life and high transfection activity in vivo following intravenous injection, and methods of preparing such...
|
|
|
6939862 |
Method for transferring nucleic acid into striated muscles
The invention provides a method of transferring in vivo a molecule into a striated muscle cell. More specifically, a method of the invention comprises contacting in vivo a striated muscle cell with...
|
|
|
6939860 |
Composition and method for treatment of neoplastic diseases associated with elevated matrix metalloproteinase activities using catechin compounds
The present invention relates to a composition comprising a catechin compound, ascorbic acid, proline and lysine. The present invention also relates to a method for treating neoplastic disease...
|
|
|
6939540 |
Method of enhancing bone density
The present invention is directed to a method for enhancing bone density or formation. In accordance with the method, a nucleic acid encoding an angiogenic protein is administered to a cell in a...
|
|
|
6936595 |
Tumour-specific vector for gene therapy
The invention relates to a vector for the gene therapeutic treatment of tumours, especially in connection with radiotherapy. Said vector is provided with a therapeutic gene in the DNA sequence...
|
|
|
6936594 |
Gene therapy for cerebrovascular disorders
By introducing hepatocyte growth factor (HGF) gene and/or vascular endothelial growth factor (VEGF) gene into the subarachnoid space in humans, cerebrovascular disorders such as cerebrovascular...
|
|
|
6936593 |
Method of down-regulating gene expression
Disclosed is a method of down-regulating the expression of a gene in an animal, wherein a pharmacological formulation comprising a chimeric oligonucleotide complementary to the gene is orally...
|
|
|
6936464 |
Immune responses to fusion proteins
The invention relates to a nucleic acid construct for delivery into living cells in vivo for inducing an immune response in a patient to an idiotypic determinant present on a malignant B cell in...
|
|
|
6936243 |
Adeno-associated viral vector-mediated delivery of DNA to cells of the liver
The instant invention provides methods of expressing polynucleotides in the cells of the liver comprising administering viral particles comprising a recombinant AAV vector into a mammal, preferably...
|
|
|
6934639 |
Methods for designing agents that interact with MMP-13
The present invention relates to the three dimensional structure of human collagenase 3 (MMP-13), as well as to (i) methods of using the MMP-13 structure to rationally design or identify compounds...
|
|
|
6933286 |
Therapeutic delivery compositions and methods of use thereof
The present invention relates to compositions and methods for treating infectious diseases and genetic disorders through gene therapy and intracellular delivery of antisense oligonucleotides or...
|
|
|
6933284 |
Methods and tools for identifying compounds which modulate atherosclerosis by impacting LDL-proteoglycan binding
The present invention relates to the study and control of atherosclerosis through the modulation of LDL-proteoglycan binding at Site B (amino acids 3359-3369) of the apo-B100 protein in LDL. The...
|
|
|
6933133 |
Treatment of diabetes with synthetic beta cells
Disclosed is a method for obtaining glucose-regulated expression of active insulin in the cells of a mammalian subject. The method involves delivering into the subject a genetic construct...
|
|
|
6930095 |
Hepatitis C virus constructs characterized by high efficiency replication
The present invention relates to recombinant hepatitis C virus (HCV)-derived nucleic acids and to stable rapidly growing cell clones derived from human hepatoma Huh-7 cell line and supporting high...
|
|
|
6930094 |
Tissue factor for influencing blood vessel formation
The present invention relates to the use of tissue factor for influencing blood vessel formation, particularly for activating blood vessel formation, above all for wound healing.
|
|
|
6929913 |
Compositions and methods for regulating autolytic processes in bacteria
A nucleic acid sequence required for regulating the autolytic activity of bacteria is provided. Also provided are polypeptides encoded by the gene or mutant gene as well as vector and host cells...
|
|
|
6929792 |
Modified dendritic cells and use therefor
The invention provides isolated dendritic cells genetically modified to express a selectin polypeptide, optionally treated with activated platelets or membrane microparticles thereof. The invention...
|
|
|
6923958 |
DNA vaccines encoding CEA and a CD40 ligand and methods of use thereof
A DNA vaccine effective for eliciting an immune response against cells that present a carcinoembryonic antigen (CEA) comprises a DNA operably encoding a CEA and a DNA operably encoding a CD40...
|
|
|
6921542 |
Preparation of a therapeutic composition
Product R, a novel therapeutic composition for treating viral infections and stimulating the immune system, comprises a unique peptide having 31 amino acids and another unique peptide having 21...
|
|
|
6921534 |
Hepatitis B virus treatment
The invention relates to HBV antigen-containing compositions that are useful in treating or preventing HBV infection. The content of the compositions can vary, as described herein, but the...
|
|
|
6919319 |
Immuno-modulating effects of chemokines in DNA vaccination
The present invention relates to a composition and method for enhancing the efficacy of a vaccine in a subject treated with the vaccine by administering to the subject an antigen in conjunction...
|
|
|
6919318 |
Enhancing immune responses to genetic immunization by using a chemokine
The immune response to a DNA immunogen in a mammal can be enhanced by administration of a chemokine or a polynucleotide encoding the chemokine. This method can be used, for example, to immunize or...
|
|
|
6919207 |
Method for regulating genes with electromagnetic response elements
A non-invasive method for gene regulation during gene therapy comprises the steps of introducing electromagnetic field response elements into a gene promoter not having any electromagnetic field...
|
|
|
6919203 |
Peptides for inducing cytotoxic T lymphocyte responses to hepatitis B virus
Peptides are used to define epitopes that stimulate HLA-restricted cytotoxic T lymphocyte activity against hepatitis B virus antigens. The peptides are derived from regions of HBV envelope, and are...
|
|
|
6919187 |
Compounds and methods for treatment and diagnosis of chlamydial infection
Compounds and methods for the diagnosis and treatment of Chlamydial infection are disclosed. The compounds provided include polypeptides that contain at least one antigenic portion of a Chlamydia ...
|
|
|
6919083 |
Nucleic acid and amino acid sequences of infectious salmon anaemia virus and their uses as vaccines
The present invention provides the use of nucleic acid sequences and/or amino acid sequences in the preparation of a vaccine for the protection of fish against infectious salmon anaemia virus....
|
|
|
6916793 |
Selenium-containing pro-drugs for cancer therapy
Methods for inhibiting the growth of tumor cells by combination treatment with a selenium-containing prodrug and an enzyme for which it is a substrate are described. The treatment also enhances the...
|
|
|
6916654 |
Universal donor cells
Genetically engineered cells are provided which can serve as universal donor cells in such applications as reconstruction of vascular linings or the administration of therapeutic agents. The cells...
|
|
|
6916470 |
Methods for use of mpl ligands with primitive human stem cells
Myeloproliferative leukemia receptor (mpl) ligands, such as thrombopoietin, act on a primitive subpopulation of human stem cells having the characteristics of self-renewal and ability to give rise...
|
|
|
6914054 |
Methods and compositions for treating hepatitis C virus
A method and composition for treating a host infected with hepatitis C comprising administering an effective hepatitis C treatment amount of a described 1′, 2′ or 3′-modified nucleoside or a...
|
|
|
6911424 |
2′-fluoronucleosides
A class of 2′-fluoro-nucleoside compounds are disclosed which are useful in the treatment of hepatitis B infection, hepatitis C infection, HIV and abnormal cellular proliferation, including...
|
|
|
6908618 |
Production of novel bovine respiratory syncytial viruses from cDNAs
A method of producing an attenuated bovine respiratory syncytial virus (BRSV) having increased or decreased transcription and/or replication, as compared to a wild-type BRSV, including the steps of...
|
|
|
6906041 |
Treatment of immune diseases
The invention concerns the use of a nucleic acid capable of expressing beta-interferon for the preparation of a pharmaceutical composition for the treatment of an immune disease.
|
|
|
6906026 |
Methods for treating conditions associated with the accumulation of excess extracellular matrix
The present invention is methods and compositions for reducing and preventing the excess accumulation of extracellular matrix in a tissue and/or organ or at a wound site using a combination of...
|
|
|
6905678 |
Gene delivery vectors with cell type specificity for mesenchymal stem cells
Methods and associated materials for transducing mesenchymal stem cells with a desired nucleic acid. Mesenchymal stem cells are a recently discovered kind of stem cell for which suitable transfer...
|
|
|
6903078 |
Combination PDGF, KGF, IGF, and IGFBP for wound healing
The invention provides a therapeutic composition for epithelial wound repair that is a combination of PDGF and KGF. Further, the invention provides a composition for epithelial wound repair that is...
|
|
|
6903077 |
Methods and products for delivering nucleic acids
The invention relates to products and methods for delivering nucleic acids of various sizes and preferably greater than 50 kilobases into cells. The nucleic acids are delivered as part of a nucleic...
|
|
|
6902731 |
Methods of treating hyperproliferative disorders using retinoblastoma fusion proteins
Fusions of the transcription factor E2F and the retinoblastoma protein RB are provided, along with methods of treatment of hyperproliferative diseases.
|
|
|
6900187 |
TRPM-2 antisense therapy using an oligonucleotide having 2′-O-(2-methoxy)ethyl modifications
A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21...
|