Match Document Document Title
6953783 Modulation of gene expression by combination therapy  
The invention relates to the modulation of gene expression. In particular, the invention relates to compositions comprising antisense oligonucleotides which inhibit expression of a gene in operable...
6953575 Methods of treating central nervous system disorders using viral vectors  
Methods of delivering viral vectors, particularly recombinant AAV virions, to the CNS are provided. Also provided are methods of treating Parkinson's Disease.
6953568 Targeting of molecules to large vessel endothelium using EPCR  
Endothelial protein C receptor (EPCR) is found primarily on endothelial cells of large vessels. EPCR translocates from the plasma membrane surface to the nucleus. Molecules which bind to EPCR can...
6951845 Method for treating allergic lung disease  
The invention is directed to a method for treating both the early and late phases of allergic asthma by introducing naked polynucleotides which operatively encode for the asthma-initiating antigen...
6951613 Genetic vaccination device and process for forming an injection therefor  
There is disclosed a genetic vaccination device and a process for forming an injection solution therefor, the device comprising a syringe and canula coupled to a membrane adsorber having genetic...
6949520 Methods related to immunostimulatory nucleic acid-induced interferon  
Methods and compositions are provided for extending the clinical utility of IFN-α in the treatment of a variety of viral and proliferative disorders. Among other aspects, the invention provides...
6949368 Compositions and methods for enhancing polynucleotide amplification reactions  
Compositions and methods for enhancing PCR and other polynucleotide replication reactions are disclosed. These comprise the addition of low molecular weight organic amides, sulfones or sulfoxides...
6946448 In utero oral nucleic acid immunization  
Methods of nucleic acid immunization comprising the in utero delivery of nucleic acid molecules that encode one or more selected antigens to a vertebrate fetus are disclosed.
6946447 MDM2-specific antisense oligonucleotides  
The invention provides methods to activate tumor suppressors. The invention further provides antisense oligonucleotides complementary to a portion of the MDM2-encoding RNA and methods for using...
6943153 Use of recombinant gene delivery vectors for treating or preventing diseases of the eye  
Gene delivery vectors, such as, for example, recombinant adeno-associated viral vectors, and methods of using such vectors are provided for use in treating or preventing diseases of the eye.
6943152 DNA vaccine-PCV  
The invention relates to immunogenic preparations or vaccines comprising, on the one hand, a plasmid encoding and expressing a gene from PCV, in particular selected from the group consisting of...
6943027 Preparation of stable formulations of lipid-nucleic acid complexes for efficient in vivo delivery  
The present invention provides for lipid:nucleic acid complexes that have increased shelf life and high transfection activity in vivo following intravenous injection, and methods of preparing such...
6939862 Method for transferring nucleic acid into striated muscles  
The invention provides a method of transferring in vivo a molecule into a striated muscle cell. More specifically, a method of the invention comprises contacting in vivo a striated muscle cell with...
6939860 Composition and method for treatment of neoplastic diseases associated with elevated matrix metalloproteinase activities using catechin compounds  
The present invention relates to a composition comprising a catechin compound, ascorbic acid, proline and lysine. The present invention also relates to a method for treating neoplastic disease...
6939540 Method of enhancing bone density  
The present invention is directed to a method for enhancing bone density or formation. In accordance with the method, a nucleic acid encoding an angiogenic protein is administered to a cell in a...
6936595 Tumour-specific vector for gene therapy  
The invention relates to a vector for the gene therapeutic treatment of tumours, especially in connection with radiotherapy. Said vector is provided with a therapeutic gene in the DNA sequence...
6936594 Gene therapy for cerebrovascular disorders  
By introducing hepatocyte growth factor (HGF) gene and/or vascular endothelial growth factor (VEGF) gene into the subarachnoid space in humans, cerebrovascular disorders such as cerebrovascular...
6936593 Method of down-regulating gene expression  
Disclosed is a method of down-regulating the expression of a gene in an animal, wherein a pharmacological formulation comprising a chimeric oligonucleotide complementary to the gene is orally...
6936464 Immune responses to fusion proteins  
The invention relates to a nucleic acid construct for delivery into living cells in vivo for inducing an immune response in a patient to an idiotypic determinant present on a malignant B cell in...
6936243 Adeno-associated viral vector-mediated delivery of DNA to cells of the liver  
The instant invention provides methods of expressing polynucleotides in the cells of the liver comprising administering viral particles comprising a recombinant AAV vector into a mammal, preferably...
6934639 Methods for designing agents that interact with MMP-13  
The present invention relates to the three dimensional structure of human collagenase 3 (MMP-13), as well as to (i) methods of using the MMP-13 structure to rationally design or identify compounds...
6933286 Therapeutic delivery compositions and methods of use thereof  
The present invention relates to compositions and methods for treating infectious diseases and genetic disorders through gene therapy and intracellular delivery of antisense oligonucleotides or...
6933284 Methods and tools for identifying compounds which modulate atherosclerosis by impacting LDL-proteoglycan binding  
The present invention relates to the study and control of atherosclerosis through the modulation of LDL-proteoglycan binding at Site B (amino acids 3359-3369) of the apo-B100 protein in LDL. The...
6933133 Treatment of diabetes with synthetic beta cells  
Disclosed is a method for obtaining glucose-regulated expression of active insulin in the cells of a mammalian subject. The method involves delivering into the subject a genetic construct...
6930095 Hepatitis C virus constructs characterized by high efficiency replication  
The present invention relates to recombinant hepatitis C virus (HCV)-derived nucleic acids and to stable rapidly growing cell clones derived from human hepatoma Huh-7 cell line and supporting high...
6930094 Tissue factor for influencing blood vessel formation  
The present invention relates to the use of tissue factor for influencing blood vessel formation, particularly for activating blood vessel formation, above all for wound healing.
6929913 Compositions and methods for regulating autolytic processes in bacteria  
A nucleic acid sequence required for regulating the autolytic activity of bacteria is provided. Also provided are polypeptides encoded by the gene or mutant gene as well as vector and host cells...
6929792 Modified dendritic cells and use therefor  
The invention provides isolated dendritic cells genetically modified to express a selectin polypeptide, optionally treated with activated platelets or membrane microparticles thereof. The invention...
6923958 DNA vaccines encoding CEA and a CD40 ligand and methods of use thereof  
A DNA vaccine effective for eliciting an immune response against cells that present a carcinoembryonic antigen (CEA) comprises a DNA operably encoding a CEA and a DNA operably encoding a CD40...
6921542 Preparation of a therapeutic composition  
Product R, a novel therapeutic composition for treating viral infections and stimulating the immune system, comprises a unique peptide having 31 amino acids and another unique peptide having 21...
6921534 Hepatitis B virus treatment  
The invention relates to HBV antigen-containing compositions that are useful in treating or preventing HBV infection. The content of the compositions can vary, as described herein, but the...
6919319 Immuno-modulating effects of chemokines in DNA vaccination  
The present invention relates to a composition and method for enhancing the efficacy of a vaccine in a subject treated with the vaccine by administering to the subject an antigen in conjunction...
6919318 Enhancing immune responses to genetic immunization by using a chemokine  
The immune response to a DNA immunogen in a mammal can be enhanced by administration of a chemokine or a polynucleotide encoding the chemokine. This method can be used, for example, to immunize or...
6919207 Method for regulating genes with electromagnetic response elements  
A non-invasive method for gene regulation during gene therapy comprises the steps of introducing electromagnetic field response elements into a gene promoter not having any electromagnetic field...
6919203 Peptides for inducing cytotoxic T lymphocyte responses to hepatitis B virus  
Peptides are used to define epitopes that stimulate HLA-restricted cytotoxic T lymphocyte activity against hepatitis B virus antigens. The peptides are derived from regions of HBV envelope, and are...
6919187 Compounds and methods for treatment and diagnosis of chlamydial infection  
Compounds and methods for the diagnosis and treatment of Chlamydial infection are disclosed. The compounds provided include polypeptides that contain at least one antigenic portion of a Chlamydia ...
6919083 Nucleic acid and amino acid sequences of infectious salmon anaemia virus and their uses as vaccines  
The present invention provides the use of nucleic acid sequences and/or amino acid sequences in the preparation of a vaccine for the protection of fish against infectious salmon anaemia virus....
6916793 Selenium-containing pro-drugs for cancer therapy  
Methods for inhibiting the growth of tumor cells by combination treatment with a selenium-containing prodrug and an enzyme for which it is a substrate are described. The treatment also enhances the...
6916654 Universal donor cells  
Genetically engineered cells are provided which can serve as universal donor cells in such applications as reconstruction of vascular linings or the administration of therapeutic agents. The cells...
6916470 Methods for use of mpl ligands with primitive human stem cells  
Myeloproliferative leukemia receptor (mpl) ligands, such as thrombopoietin, act on a primitive subpopulation of human stem cells having the characteristics of self-renewal and ability to give rise...
6914054 Methods and compositions for treating hepatitis C virus  
A method and composition for treating a host infected with hepatitis C comprising administering an effective hepatitis C treatment amount of a described 1′, 2′ or 3′-modified nucleoside or a...
6911424 2′-fluoronucleosides  
A class of 2′-fluoro-nucleoside compounds are disclosed which are useful in the treatment of hepatitis B infection, hepatitis C infection, HIV and abnormal cellular proliferation, including...
6908618 Production of novel bovine respiratory syncytial viruses from cDNAs  
A method of producing an attenuated bovine respiratory syncytial virus (BRSV) having increased or decreased transcription and/or replication, as compared to a wild-type BRSV, including the steps of...
6906041 Treatment of immune diseases  
The invention concerns the use of a nucleic acid capable of expressing beta-interferon for the preparation of a pharmaceutical composition for the treatment of an immune disease.
6906026 Methods for treating conditions associated with the accumulation of excess extracellular matrix  
The present invention is methods and compositions for reducing and preventing the excess accumulation of extracellular matrix in a tissue and/or organ or at a wound site using a combination of...
6905678 Gene delivery vectors with cell type specificity for mesenchymal stem cells  
Methods and associated materials for transducing mesenchymal stem cells with a desired nucleic acid. Mesenchymal stem cells are a recently discovered kind of stem cell for which suitable transfer...
6903078 Combination PDGF, KGF, IGF, and IGFBP for wound healing  
The invention provides a therapeutic composition for epithelial wound repair that is a combination of PDGF and KGF. Further, the invention provides a composition for epithelial wound repair that is...
6903077 Methods and products for delivering nucleic acids  
The invention relates to products and methods for delivering nucleic acids of various sizes and preferably greater than 50 kilobases into cells. The nucleic acids are delivered as part of a nucleic...
6902731 Methods of treating hyperproliferative disorders using retinoblastoma fusion proteins  
Fusions of the transcription factor E2F and the retinoblastoma protein RB are provided, along with methods of treatment of hyperproliferative diseases.
6900187 TRPM-2 antisense therapy using an oligonucleotide having 2′-O-(2-methoxy)ethyl modifications  
A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21...