Patents in Class 435/91.3

Matches 1 - 50 out of 201

1 2 3 4 5 >

Match	Document	Document Title
1	8101385	Materials and methods for the generation of transcripts comprising modified nucleotides Materials and methods are provided for producing aptamer therapeutics having modified nucleotide triphosphates incorporated into their sequence.
2	8097418	Methods and kits for sense RNA synthesis Methods and kits are provided for performing multiple rounds of sense RNA synthesis. The sense RNA molecules can be used in various research and diagnostic applications, such as gene expression...
3	7989184	Endoribonuclease A polypeptide having a novel endoribonuclease activity; a nucleic acid encoding the polypeptide; recombinant DNA having the nucleic acid therein; a transformant transformed with the recombinant...
4	7932062	Vector constructs Improved vector constructs useful in the expression of double-stranded RNA are provided. The constructs are particularly useful for expression of double-stranded RNA in vitro and in vivo.
5	7919239	Increasing hybridization efficiencies Aspects of the disclosure are generally directed to probes and probe compositions for detecting or quantifying a target. One aspect provides a method for selectively hybridizing a probe to a...
6	7833987	Small synthetic RNA, a method of preparing the same and uses thereof Translation of the hepatitis C virus (HCV) RNA is mediated by the interaction of ribosomes and cellular proteins with an internal ribosome entry site (IRES) located within the 5′untranslated r...
7	7785843	Target-specific compomers and methods of use Provided herein are libraries of nucleic acid species each comprising a transcription unit having a promoter region operatively linked to a coding sequence. The coding sequence of each nucleic acid...
8	7709253	Ligand-regulable transactivation systems, methods of use thereof, methods of detecting estrogen receptor ligands, and methods of differentiating estrogen receptor ligand agonists and antagonists Briefly described, embodiments of this disclosure include ligand-regulable transactivation systems, methods of producing ligand-regulable transactivation systems, methods of using ligand-regulable...
9	7556944	Methods and compositions for use in preparing siRNAs Methods and compositions for producing siRNAs, e.g., in the form of a d-siRNA composition, from dsRNAs are provided. In the subject methods, a dsRNA is contacted with a composition that includes an...
10	7550264	Methods and kits for sense RNA synthesis Methods and kits are provided for performing multiple rounds of sense RNA synthesis. The sense RNA molecules can be used in various research and diagnostic applications, such as gene expression...
11	7538095	Genetic inhibition by double-stranded RNA A process is provided of introducing an RNA into a living cell to inhibit gene expression of a target gene in that cell. The process may be practiced ex vivo or in vivo. The RNA has a region with...
12	7514545	Inducible eukaryotic expression system Compositions and methods for the inducible expression of genes in eukaryotic cells. Expression of a nucleotide sequence of interest is controlled by a regulatory fusion protein that consists of a...
13	7488600	Compositions and methods for the identification and selection of nucleic acids and polypeptides This invention relates generally to systems and methods for identifying and selecting, desired proteins or nucleic acid molecules by linking mRNA, with known or unknown sequences, to its translated...
14	7435539	Typing of human enteroviruses The present invention discloses a method for detecting the presence of an enterovirus in a clinical sample. The invention additionally discloses a method for typing an enterovirus in a clinical...
15	7432084	Methods for preparing nucleic acid samples In one aspect the present invention provides methods of synthesizing a preparation of nucleic acid molecules, the methods comprising the steps of: (a) utilizing an RNA template to enzymatically...
16	7399753	Trans-splicing mediated photodynamic therapy The present invention provides methods and compositions for conferring selective death on cells expressing a specific target precursor messenger RNA (selective target pre-mRNA). The compositions of...
17	7399605	Method for identifying a HCV RNA-dependent RNA polymerase inhibitor The present invention relates to the molecular biology and virology of the hepatitis C virus (HCV). An object of the present invention is a method to reproduce in vitro the RNA-dependent RNA...
18	7358069	Vector constructs Improved vector constructs useful in the expression of double-stranded RNA are provided. The constructs are particularly useful for expression of double-stranded RNA in vitro and in vivo.
19	7354718	Molecular dissection method using trans-splicing to designed spliced leader sequences, genes, and constructs thereof The presently disclosed subject matter generally relates to a method for detectably labeling ribonucleic acid molecules expressed in cells of interest. Also provided are methods for isolating...
20	7341852	Methods of decoupling reaction scale and protein synthesis yield in batch mode Biological macromolecules are synthesized in vitro in a thin film that provides for high surface area/volume ratio, allowing improved yield in scaled up reactions.
21	7338789	Methods of in vitro protein synthesis Biological macromolecules are synthesized in vitro under conditions and in a reaction composition wherein oxidative phosphorylation is activated and protein folding is improved.
22	7335471	Polypeptides derived from RNA polymerases and use thereof Mutant RNA polymerases of phagic origin in which the peptide chain is modified by substitution, deletion or addition of at least one amino acid, the modification having the effect of reducing the...
23	7323319	RNA containing coenzymes, biotin, or fluorophores, and methods for their preparation and use Materials and methods for incorporating adenosine derivatives into the 5′ end of transcribed RNA are disclosed. Adenosine derivatives include naturally occurring compounds such as Coenzyme A, N...
24	7319024	C. elegans p21-activated kinase (PAK) gene and associated loss-of-function phenotypes that facilitate screening for small molecule modulators of PAK activity in the nematode, caenorhabditis elegans The invention refers to a novel C. elegans p21-activated kinase gene, the pak-3 gene, and associated loss-of-function phenotypes. These phenotypes can be used to elucidate PAK signaling pathways in...
25	7217517	Nucleic acids, polypeptides, and methods for modulating apoptosis The present invention provides methods of identifying an incidence of ischemia in mammalian tissue, particularly mammalian heart tissue. Further, a method of reducing apoptosis in mammalian tissue,...
26	7198923	Method for the preparation of purified HCV RNA by exosome separation The invention relates to a method for the isolation of hepatitis C virus. The method comprises the separation of particles termed exosomes from the blood plasma of an individual infected with...
27	7179457	Modified nodavirus RNA for gene delivery The invention provides a nodavirus RNA1 molecule modified to include a heterologous insertion which is downstream of its replicase ORF and, preferably, its B2 ORF. The insertion preferably...
28	7148343	Compositions and methods for using a solid support to purify RNA Reagents, methods and kits for the purification of RNA from biological materials are provided.
29	7119194	Nucleic acid-bondable magnetic carrier and method for isolating nucleic acid using the same A nucleic acid-bondable magnetic carrier of the present invention is a magnetic silica particle comprising a superparamagnetic metal oxide, wherein the magnetic silica particle has a specific...
30	7026301	Method of orally treating inflammatory skin conditions with prodrugs of 5-fluorouracil The present invention relates to the treatment of inflammatory skin conditions, including psoriasis, with a prodrug of 5-fluorouracil. The invention relates to methods for treatment of psoriasis...
31	RE39031	RNA amplification method requiring only one manipulation step An RNA amplification method is particularly useful for diagnosing bacterial or viral infections or genetic disorders and for cell typing. The method includes the steps of denaturing a solution...
32	6995258	Nucleolar targeting of therapeutics against HIV The HIV regulatory proteins Tat and Rev accumulate in nucleoli of human cells. No functional role has been attributed to this localization. Recently it was demonstrated that expression of Rev...
33	6887707	Induction of viral mutation by incorporation of miscoding ribonucleoside analogs into viral RNA The present invention is directed to the identification and use of ribonucleoside analogs to induce the mutation of an RNA virus, including BVDV, HIV and HCV, or a virus which otherwise replicates...
34	6872818	Ammonium sulfate for neutralization of inhibitory effects The present invention provides RNA purification and/or analysis methods that use ammonium sulfate to mitigate or neutralize inhibitory effects of certain molecules. Exemplary inhibitory molecules...
35	6869780	Nodavirus-like DNA expression vector and uses therefor The present invention describes the production of a nodavirus-based DNA vector that drives abundant expression of foreign genes in a wide variety of cell types. The DNA plasmid is initially...
36	6855520	Cell volume-regulated human kinase h-sgk The present invention relates to the cloning and characterization of a human serine/threonine kinase (h-sgk: serum and glucocorticoid dependent kinase). The invention furthermore relates to...
37	6828127	Method of amplifying an RNA target sequence using an RNA polymerase functioning preferably on RNA template Disclosed is a process for transcribing RNA using a nucleotide reagent as the promoter. Such a reagent enables any type of RNA to be transcribed without sequence specification and without protein...
38	6790642	Method for reducing the amount of nucleic acid adhering to a hydrophobic surface The present invention provides a method for isolating nucleic acid from a sample, preferably from a biological sample. This method involves applying the biological sample to a hydrophobic organic...
39	6787133	Using purified telomerase to identify telomerase activators and inhibitors This invention provides purified telomerase and methods of purifying it. The methods involve the use of several sequential steps, including the use of matrices that bind molecules bearing negative...
40	6770633	Ribozyme therapy for the treatment of proliferative skin and eye diseases As an effective therapy for proliferative skin and eye diseases such as psoriasis and proliferative diabetic retinopathy, this invention provides ribozymes and ribozyme delivery systems which...
41	6740750	Expression systems for functional nucleic acid expression A ribozyme comprising the following base sequence (I) or (II): base sequence (I)(SEQ ID No. 1): 5′-ACCGUUGGUUUCCGUAGUGUAGU GGUUAUCACGUUCGCCUAACACGCGAAAGGUCCCCGGUUCGAAACCGGGCACU A...
42	6716627	Antisense modulation of mucin 1, transmembrane expression Antisense compounds, compositions and methods are provided for modulating the expression of mucin 1, transmembrane. The compositions comprise antisense compounds, particularly antisense...
43	6706498	Method for isolating DNA The invention describes a method for the isolation of components from samples, particularly large molecular weight DNA from biological samples. The method involves the application of controlled...
44	6699987	Formulations and method for isolating nucleic acids from optional complex starting material and subsequent complex gene analytics The subject of the invention are formulations not containing chaotropic components for isolating nucleic acids with binding to a solid phase, in particular of DNA, from optional complex starting...
45	6692959	Antisense modulation of IL-1 receptor-associated kinase-4 expression Antisense compounds, compositions and methods are provided for modulating the expression of IL-1 receptor-associated kinase-4. The compositions comprise antisense compounds, particularly antisense...
46	6680301	Transfer of molecules into the cytosol of cells The present invention relates to a method for introducing molecules in cells by disrupting endosomal and lysosomal membranes using photodynamic treatment, without killing the majority of the cells...
47	6653133	Antisense modulation of Fas mediated signaling Compounds, compositions and methods are provided for inhibiting Fas mediated signaling. The compositions comprise antisense compounds targeted to nucleic acids encoding Fas, FasL and Fap-1. Methods...
48	6646117	Polyribozyme capable of conferring on plants resistance to viruses and resistant plants producing this polyribozyme The invention relates to a nucleic acid sequence, called “polyribozyme”, which has an endoribonuclease activity and is capable of inactivating the gene for the capsid protein of a virus, cha...
49	6635423	Informative nucleic acid arrays and methods for making same The present invention is directed to methods for making and using informative nucleic acid arrays (e.g., DNA including cDNA, RNA, PNA) for research and other applications in various disciplines or...
50	6633818	Method for simultaneous identification of differentially expressed mRNAs and measurement of relative concentrations An improved method for the simultaneous sequence-specific identification of mRNAs in a mRNA population allows the visualization of nearly every mRNA expressed by a tissue as a distinct band on a...

Matches 1 - 50 out of 201

1 2 3 4 5 >