|
Match
|
Document |
Document Title |
|
|
7501506 |
Pentopyranosyl nucleic acid conjugates
The invention relates to compounds including at least one pentopyranosyl nucleic acid and a biomolecule conjugated through a covalent linkage to the at least one pentopyranosyl nucleic acid. The...
|
|
|
7501254 |
Methods and compositions for amplification and capture of nucleic acid sequences
Methods for amplification and capture of nucleic acid sequences include annealing a forward primer to a DNA or RNA template in a first reaction vessel including fewer than four different dNTPs;...
|
|
|
7501266 |
Differentiating homozygous, heterozygous and wild-type alleles using a multiplexed hybridization-mediated assay
Described are methods of assay design and assay image correction, useful for multiplexed genetic screening for mutations and polymorphisms, including CF-related mutants and polymorphs, using an...
|
|
|
7501244 |
Determining prognosis of colon or breast cancer by measuring TTK expression
The present invention provides methods for identification of cancerous cells by detection of expression levels of TTK, as well as diagnostic, prognostic and therapeutic methods that take advantage...
|
|
|
7501237 |
Polymerases for analyzing or typing polymorphic nucleic acid fragments and uses thereof
The present invention provides methods for use in identifying, analyzing and typing polymorphic DNA fragments, particularly minisatellite, microsatellite or STR DNA fragments. In particular, the...
|
|
|
7501243 |
Detection of colon or breast cancer by measuring TTK polypeptide expression
The present invention provides methods for identification of cancerous cells by detection of expression levels of TTK, as well as diagnostic, prognostic and therapeutic methods that take advantage...
|
|
|
7501129 |
Vectors comprising guinea pig CMV regulatory elements
The invention comprises novel polynucleotides, and related vectors, host cells, methods, and compositions, containing transcriptional enhancers providing very high levels of expression of...
|
|
|
7498135 |
Method for preparing gene expression profile
The present invention provides a method for preparing a gene expression profile with a high precision, by carrying out the annealing of primers to templates in the temperature range of TmMAX+6° C....
|
|
|
7498036 |
Optimized expression of HPV 58 L1 in yeast
Synthetic DNA molecules encoding the HPV58 L1 protein are provided. Specifically, the present invention provides polynucleotides encoding HPV58 L1 protein, wherein said polynucleotides are...
|
|
|
7494791 |
Nano-PCR: methods and devices for nucleic acid amplification and detection
Methods, devices, and compositions are described that provide for amplification of nucleic acid sequences without reliance upon temperature cycling, thus freeing the methods from conventional...
|
|
|
7494789 |
Methods for amplification of nucleic acid sequences using staggered ligation
Methods and kits are provided for producing sense RNA molecules. The sense RNA molecules are prepared by:
providing a single stranded cDNA molecule having 5′ and 3′ ends; attaching an...
|
|
|
7494775 |
Compositions, kits, and methods for identification, assessment, prevention and therapy of breast and ovarian cancer
The invention relates to newly discovered nucleic acid molecules and proteins associated with breast or ovarian cancer. Compositions, kits, and methods for detecting, characterizing, preventing,...
|
|
|
7494777 |
Genomic sequence of the 5-lipoxygenase-activating protein (FLAP), polymorphic markers thereof and methods for detection of asthma
The invention concerns the genomic sequence of the FLAP gene. The invention also concerns biallelic markers of a FLAP gene and the association established between these markers and diseases...
|
|
|
7491706 |
Artificial cpg single-stranded oligodeoxynucleotide and antiviral use thereof
The present invention provides a series of artificial CpG-containing single-stranded oligodeoxynucleotides (ODNs), each of which is consisted of single-stranded oligodeoxynucleotide DNA molecule...
|
|
|
7491807 |
Gene encoding a DNA repair enzyme and methods of use thereof
An isolated nucleic acid molecule encoding a human DNA repair enzyme, MED1, is disclosed. Like other mismatch repair genes which are mutated in certain cancers, MED1, encoding nucleic acids,...
|
|
|
7488595 |
Method and apparatus for amplification of nucleic acid sequences using immobilized DNA polymerase
The present invention generally relates to methods and apparatuses for amplifying nucleic acid sequences using immobilized DNA polymerase. More particularly, it relates to methods and apparatuses...
|
|
|
7488577 |
Method for measuring DNA polymerization and applications of the method
A method for measuring DNA-dependent DNA polymerisation in a biological sample, is described. The method comprises the steps of providing a primer with a single stranded short specific sequence,...
|
|
|
7488576 |
Methods for diagnosis and treatment of psychiatric disorders
The present invention provides methods for the diagnosis and treatment of psychiatric disorders. In particular, the present invention provides convergent functional genomics methods for the...
|
|
|
7485711 |
CYP19A1 polymorphisms
Isolated CYP19A1 nucleic acid molecules that include a nucleotide sequence variant and nucleotides flanking the sequence variant are described, as well as CYP19A1 allozymes. Methods for determining...
|
|
|
7485424 |
Labeled nucleotide phosphate (NP) probes
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the...
|
|
|
7485423 |
Ladder assembly and system for generating diversity
The present invention provides novel methods of generating a nucleic acid molecule. In certain embodiments, a double stranded nucleic acid chunk is generated from a ladder complex comprising...
|
|
|
7485417 |
Post-termination labeling of nucleic acid fragments and uses thereof
This invention provides novel processes for amplifying nucleic acid sequences of interest, including linear and non-linear amplification. In linear amplification, a single initial primer or nucleic...
|
|
|
7485426 |
Method and kits for preparing multicomponent nucleic acid constructs
The invention provides a highly efficient, rapid, and cost effective method of linking nucleic acid components in a predetermined order to produce a nucleic acid multicomponent construct. The...
|
|
|
7485442 |
Real-time linear detection probes: sensitive 5'-minor groove binder-containing probes for PCR analysis
Oligonucleotide probes/conjugates are provided along with method for their use in assays to monitor amplification wherein the signal produced does not rely on 5′ nuclease digestion.
|
|
|
7485468 |
Molecular targets and compounds, and methods to identify the same, useful in the treatment of joint degenerative and inflammatory diseases
The application discloses methods for identifying and using compounds that inhibit extra-cellular matrix (ECM) degradation and inflammation, using a polypeptide sequence including SEQ ID NO: 17-127...
|
|
|
7482142 |
High-risk human papillomavirus detection
This invention provides compositions and methods for detecting HPV in a sample. This invention also provides related kits, systems, and computers.
|
|
|
7482444 |
Terminating substrates for DNA polymerases
This invention concerns novel terminating substrates for DNA polymerases. The substrates are nucleoside triphosphates labeled with lanthanide chelates.
|
|
|
7482443 |
Systems and methods to quantify and amplify both signaling probes for cDNA chips and genes expression microarrays
The invention provides a series of reagent compositions and methods for making and amplifying novel cDNA based probe sets from RNA samples to improve analysis with gene expression arrays. The...
|
|
|
7482125 |
Renaturation, reassociation, association and hybridization of nucleic acid molecules
The present invention features methods and compositions for the renaturation, hybridization, association, or reassociation of nucleic acids that combines both acceleration of the reaction rate and...
|
|
|
7482116 |
Compositions and methods for obtaining nucleic acids from sputum
The present invention relates to compositions and methods for preserving and extracting nucleic acids from saliva. The compositions include a chelating agent, a denaturing agent, buffers to...
|
|
|
7479370 |
Detection of 13q14 chromosomal alterations
The present invention relates to methods for detection of chromosomal alterations which are associated with the presence of various leukemias and lymphomas. The method comprises the steps of...
|
|
|
7479369 |
Use of eukaryotic genes affecting spindle formation or microtubule function during cell division for diagnosis and treatment of proliferative diseases
The present invention relates to the significant functional role of several C. elegans genes and of their corresponding gene products in spindle formation or microtubule function during cell...
|
|
|
7476520 |
Primers for use in detecting beta-lactamases
Oliognucleotide primers are provided that are specific for nucleic acid characteristic of certain beta-lactamases. The primers can be employed in methods to identify nucleic acid characteristic of...
|
|
|
7476853 |
Ion fragmentation by reaction with neutral particles
The invention relates to a method and apparatus for the fragmentation of large molecules, especially biopolymers. The invention consists in reacting analyte ions with excited or radical neutral...
|
|
|
7476504 |
Use of reversible extension terminator in nucleic acid sequencing
The present invention relates to the uses of reversible extension terminator in conjunction with optical confinements in nucleic acid sequencing. The apparatus and methods embodied in the present...
|
|
|
7476519 |
Strategies for gene expression analysis
The invention provides methods for screening compound or chemical libraries by analyzing expressed RNA samples from biological samples treated with members of a compound library in a high...
|
|
|
7473768 |
Primers and a screening method for identification of artemisinin producing plants
The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of...
|
|
|
7473775 |
Abortive promoter cassettes
The present invention provides methods for detecting the presence of a target molecule by generating multiple detectable oligonucleotides through reiterative enzymatic oligonucleotide synthesis...
|
|
|
7473525 |
Compositions and methods for inhibiting expression of anti-apoptotic genes
The present invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of an anti-apoptotic gene, comprising a complementary RNA strand having a nucleotide...
|
|
|
7473528 |
Method for the detection of Chagas disease related gene transcripts in blood
The present invention is directed to detection and measurement of gene transcripts and their equivalent nucleic acid products in blood. Specifically provided is analysis performed on a drop of...
|
|
|
7473774 |
Kit for diagnosing and prognosticating matrix metalloproteinase-1 related disease via a matrix metalloproteinase-1 single nucleotide polymorphism
Methods and kits for diagnosing and prognosticating matrix metalloproteinase-1 related disease by detecting a single nucleotide polymorphism in the promoter of the gene are provided. Also provided...
|
|
|
7470508 |
Method of screening for melanoma by detecting an increase in cyclin D1
The present invention provides methods of screening for the presence of premalignant melanocytes in a sample from a patient. The methods comprise contacting a nucleic acid sample from a biological...
|
|
|
7470516 |
Cross reactive arrays of three-way junction sensors for steroid determination
This invention provides analyte sensitive oligonucleotide compositions for detecting and analyzing analytes in solution, including complex solutions using cross reactive arrays of analyte sensitive...
|
|
|
7470512 |
Oligonucleotides for use in determining the presence of human papilloma virus in a test sample
The present invention describes oligonucleotides targeted to HPV Type 16 and/or Type 18 nucleic acid sequences which are particularly useful to aid in detecting HPV type 16 and or 18. The...
|
|
|
7470511 |
Methods for determining nucleic acid methylation
The present invention provides methods for detecting the presence of a target molecule by generating multiple detectable oligonucleotides through reiterative enzymatic oligonucleotide synthesis...
|
|
|
7468244 |
Polymorphism detection and separation
Methods and compositions for polymorphism detection and separation. The methods are readily multiplexed, can be adapted to a variety of existing detection systems, and permit target amplification...
|
|
|
7468266 |
Isolated genomic polynucleotide fragments that encode human lipoprotein-associated phospholipase A2
The invention is directed to isolated genomic polynucleotide fragments that encode human lipoprotein-associated phospholipase A2, vectors and hosts containing the fragment and fragments hybridizing...
|
|
|
7468245 |
Methods for detecting nucleic acid sequences
This invention provides novel processes for amplifying nucleic acid sequences of interest, including linear and non-linear amplification. In linear amplification, a single initial primer or nucleic...
|
|
|
7465542 |
Methods and compositions for determining risk of treatment toxicity
Methods are provided for determining whether a patient treated with an anti-proliferative agent is susceptible to toxicity. In practicing the subject methods, an expression profile for the...
|
|
|
7465571 |
Endoglucanases
In one aspect, the invention provides a purified thermostable enzyme derived from the archael bacterium AEPII 1a. In one aspect, the enzyme has a molecular weight of about 60.9 kilodaltons and has...
|