Match Document Document Title
7501506 Pentopyranosyl nucleic acid conjugates  
The invention relates to compounds including at least one pentopyranosyl nucleic acid and a biomolecule conjugated through a covalent linkage to the at least one pentopyranosyl nucleic acid. The...
7501254 Methods and compositions for amplification and capture of nucleic acid sequences  
Methods for amplification and capture of nucleic acid sequences include annealing a forward primer to a DNA or RNA template in a first reaction vessel including fewer than four different dNTPs;...
7501266 Differentiating homozygous, heterozygous and wild-type alleles using a multiplexed hybridization-mediated assay  
Described are methods of assay design and assay image correction, useful for multiplexed genetic screening for mutations and polymorphisms, including CF-related mutants and polymorphs, using an...
7501244 Determining prognosis of colon or breast cancer by measuring TTK expression  
The present invention provides methods for identification of cancerous cells by detection of expression levels of TTK, as well as diagnostic, prognostic and therapeutic methods that take advantage...
7501237 Polymerases for analyzing or typing polymorphic nucleic acid fragments and uses thereof  
The present invention provides methods for use in identifying, analyzing and typing polymorphic DNA fragments, particularly minisatellite, microsatellite or STR DNA fragments. In particular, the...
7501243 Detection of colon or breast cancer by measuring TTK polypeptide expression  
The present invention provides methods for identification of cancerous cells by detection of expression levels of TTK, as well as diagnostic, prognostic and therapeutic methods that take advantage...
7501129 Vectors comprising guinea pig CMV regulatory elements  
The invention comprises novel polynucleotides, and related vectors, host cells, methods, and compositions, containing transcriptional enhancers providing very high levels of expression of...
7498135 Method for preparing gene expression profile  
The present invention provides a method for preparing a gene expression profile with a high precision, by carrying out the annealing of primers to templates in the temperature range of TmMAX+6° C....
7498036 Optimized expression of HPV 58 L1 in yeast  
Synthetic DNA molecules encoding the HPV58 L1 protein are provided. Specifically, the present invention provides polynucleotides encoding HPV58 L1 protein, wherein said polynucleotides are...
7494791 Nano-PCR: methods and devices for nucleic acid amplification and detection  
Methods, devices, and compositions are described that provide for amplification of nucleic acid sequences without reliance upon temperature cycling, thus freeing the methods from conventional...
7494789 Methods for amplification of nucleic acid sequences using staggered ligation  
Methods and kits are provided for producing sense RNA molecules. The sense RNA molecules are prepared by: providing a single stranded cDNA molecule having 5′ and 3′ ends; attaching an...
7494775 Compositions, kits, and methods for identification, assessment, prevention and therapy of breast and ovarian cancer  
The invention relates to newly discovered nucleic acid molecules and proteins associated with breast or ovarian cancer. Compositions, kits, and methods for detecting, characterizing, preventing,...
7494777 Genomic sequence of the 5-lipoxygenase-activating protein (FLAP), polymorphic markers thereof and methods for detection of asthma  
The invention concerns the genomic sequence of the FLAP gene. The invention also concerns biallelic markers of a FLAP gene and the association established between these markers and diseases...
7491706 Artificial cpg single-stranded oligodeoxynucleotide and antiviral use thereof  
The present invention provides a series of artificial CpG-containing single-stranded oligodeoxynucleotides (ODNs), each of which is consisted of single-stranded oligodeoxynucleotide DNA molecule...
7491807 Gene encoding a DNA repair enzyme and methods of use thereof  
An isolated nucleic acid molecule encoding a human DNA repair enzyme, MED1, is disclosed. Like other mismatch repair genes which are mutated in certain cancers, MED1, encoding nucleic acids,...
7488595 Method and apparatus for amplification of nucleic acid sequences using immobilized DNA polymerase  
The present invention generally relates to methods and apparatuses for amplifying nucleic acid sequences using immobilized DNA polymerase. More particularly, it relates to methods and apparatuses...
7488577 Method for measuring DNA polymerization and applications of the method  
A method for measuring DNA-dependent DNA polymerisation in a biological sample, is described. The method comprises the steps of providing a primer with a single stranded short specific sequence,...
7488576 Methods for diagnosis and treatment of psychiatric disorders  
The present invention provides methods for the diagnosis and treatment of psychiatric disorders. In particular, the present invention provides convergent functional genomics methods for the...
7485711 CYP19A1 polymorphisms  
Isolated CYP19A1 nucleic acid molecules that include a nucleotide sequence variant and nucleotides flanking the sequence variant are described, as well as CYP19A1 allozymes. Methods for determining...
7485424 Labeled nucleotide phosphate (NP) probes  
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the...
7485423 Ladder assembly and system for generating diversity  
The present invention provides novel methods of generating a nucleic acid molecule. In certain embodiments, a double stranded nucleic acid chunk is generated from a ladder complex comprising...
7485417 Post-termination labeling of nucleic acid fragments and uses thereof  
This invention provides novel processes for amplifying nucleic acid sequences of interest, including linear and non-linear amplification. In linear amplification, a single initial primer or nucleic...
7485426 Method and kits for preparing multicomponent nucleic acid constructs  
The invention provides a highly efficient, rapid, and cost effective method of linking nucleic acid components in a predetermined order to produce a nucleic acid multicomponent construct. The...
7485442 Real-time linear detection probes: sensitive 5'-minor groove binder-containing probes for PCR analysis  
Oligonucleotide probes/conjugates are provided along with method for their use in assays to monitor amplification wherein the signal produced does not rely on 5′ nuclease digestion.
7485468 Molecular targets and compounds, and methods to identify the same, useful in the treatment of joint degenerative and inflammatory diseases  
The application discloses methods for identifying and using compounds that inhibit extra-cellular matrix (ECM) degradation and inflammation, using a polypeptide sequence including SEQ ID NO: 17-127...
7482142 High-risk human papillomavirus detection  
This invention provides compositions and methods for detecting HPV in a sample. This invention also provides related kits, systems, and computers.
7482444 Terminating substrates for DNA polymerases  
This invention concerns novel terminating substrates for DNA polymerases. The substrates are nucleoside triphosphates labeled with lanthanide chelates.
7482443 Systems and methods to quantify and amplify both signaling probes for cDNA chips and genes expression microarrays  
The invention provides a series of reagent compositions and methods for making and amplifying novel cDNA based probe sets from RNA samples to improve analysis with gene expression arrays. The...
7482125 Renaturation, reassociation, association and hybridization of nucleic acid molecules  
The present invention features methods and compositions for the renaturation, hybridization, association, or reassociation of nucleic acids that combines both acceleration of the reaction rate and...
7482116 Compositions and methods for obtaining nucleic acids from sputum  
The present invention relates to compositions and methods for preserving and extracting nucleic acids from saliva. The compositions include a chelating agent, a denaturing agent, buffers to...
7479370 Detection of 13q14 chromosomal alterations  
The present invention relates to methods for detection of chromosomal alterations which are associated with the presence of various leukemias and lymphomas. The method comprises the steps of...
7479369 Use of eukaryotic genes affecting spindle formation or microtubule function during cell division for diagnosis and treatment of proliferative diseases  
The present invention relates to the significant functional role of several C. elegans genes and of their corresponding gene products in spindle formation or microtubule function during cell...
7476520 Primers for use in detecting beta-lactamases  
Oliognucleotide primers are provided that are specific for nucleic acid characteristic of certain beta-lactamases. The primers can be employed in methods to identify nucleic acid characteristic of...
7476853 Ion fragmentation by reaction with neutral particles  
The invention relates to a method and apparatus for the fragmentation of large molecules, especially biopolymers. The invention consists in reacting analyte ions with excited or radical neutral...
7476504 Use of reversible extension terminator in nucleic acid sequencing  
The present invention relates to the uses of reversible extension terminator in conjunction with optical confinements in nucleic acid sequencing. The apparatus and methods embodied in the present...
7476519 Strategies for gene expression analysis  
The invention provides methods for screening compound or chemical libraries by analyzing expressed RNA samples from biological samples treated with members of a compound library in a high...
7473768 Primers and a screening method for identification of artemisinin producing plants  
The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of...
7473775 Abortive promoter cassettes  
The present invention provides methods for detecting the presence of a target molecule by generating multiple detectable oligonucleotides through reiterative enzymatic oligonucleotide synthesis...
7473525 Compositions and methods for inhibiting expression of anti-apoptotic genes  
The present invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of an anti-apoptotic gene, comprising a complementary RNA strand having a nucleotide...
7473528 Method for the detection of Chagas disease related gene transcripts in blood  
The present invention is directed to detection and measurement of gene transcripts and their equivalent nucleic acid products in blood. Specifically provided is analysis performed on a drop of...
7473774 Kit for diagnosing and prognosticating matrix metalloproteinase-1 related disease via a matrix metalloproteinase-1 single nucleotide polymorphism  
Methods and kits for diagnosing and prognosticating matrix metalloproteinase-1 related disease by detecting a single nucleotide polymorphism in the promoter of the gene are provided. Also provided...
7470508 Method of screening for melanoma by detecting an increase in cyclin D1  
The present invention provides methods of screening for the presence of premalignant melanocytes in a sample from a patient. The methods comprise contacting a nucleic acid sample from a biological...
7470516 Cross reactive arrays of three-way junction sensors for steroid determination  
This invention provides analyte sensitive oligonucleotide compositions for detecting and analyzing analytes in solution, including complex solutions using cross reactive arrays of analyte sensitive...
7470512 Oligonucleotides for use in determining the presence of human papilloma virus in a test sample  
The present invention describes oligonucleotides targeted to HPV Type 16 and/or Type 18 nucleic acid sequences which are particularly useful to aid in detecting HPV type 16 and or 18. The...
7470511 Methods for determining nucleic acid methylation  
The present invention provides methods for detecting the presence of a target molecule by generating multiple detectable oligonucleotides through reiterative enzymatic oligonucleotide synthesis...
7468244 Polymorphism detection and separation  
Methods and compositions for polymorphism detection and separation. The methods are readily multiplexed, can be adapted to a variety of existing detection systems, and permit target amplification...
7468266 Isolated genomic polynucleotide fragments that encode human lipoprotein-associated phospholipase A2  
The invention is directed to isolated genomic polynucleotide fragments that encode human lipoprotein-associated phospholipase A2, vectors and hosts containing the fragment and fragments hybridizing...
7468245 Methods for detecting nucleic acid sequences  
This invention provides novel processes for amplifying nucleic acid sequences of interest, including linear and non-linear amplification. In linear amplification, a single initial primer or nucleic...
7465542 Methods and compositions for determining risk of treatment toxicity  
Methods are provided for determining whether a patient treated with an anti-proliferative agent is susceptible to toxicity. In practicing the subject methods, an expression profile for the...
7465571 Endoglucanases  
In one aspect, the invention provides a purified thermostable enzyme derived from the archael bacterium AEPII 1a. In one aspect, the enzyme has a molecular weight of about 60.9 kilodaltons and has...