Matches 1 - 50 out of 305 1 2 3 4 5 6 7 >
Match Document Document Title
7601872 Transfection reagents  
Disclosed are compounds capable of facilitating transport of biologically active agents or substances into cells having the general structure: wherein Q is selected from the group consisting...
7601367 Compositions and processes using siRNA, amphipathic compounds and polycations  
Described is a deliverable composition with low toxicity comprising an amphipathic compound, a polycation, and a siRNA. The composition may be used in the process of delivering a siRNA to an animal...
7598421 Materials for the delivery of biologically-active material to cells  
The invention provides a lipid of general formula (I) or (II): wherein X 1 , X 2 and R 1 to R 5 are as defined herein. Such lipids are used to form complexes with a biologically-active...
7585675 Inhibition of HIV and SHIV replication with antisense interleukin-4  
A method of treating or preventing SHIV or HIV infection in a subject comprising administering a therapeutically effective amount of a antisense IL-4. The antisense IL-4 inhibits viral replication...
7531522 Antibodies, recombinant antibodies, recombinant antibody fragments and fusions mediated plant disease resistance against fungi  
A method for the production of fungus resistant transgenic plants, plant cells or plant tissue comprising the introduction of an Ab, rAb, rAb fragment or fusion or vector of the invention or the...
7524680 Polyampholytes for delivering polyions to a cell  
An polyampholyte is utilized in a condensed polynucleotide complex for purposes of nucleic acid delivery to a cell. The complex can be formed with an appropriate amount of positive and/or negative...
7514098 Use of targeted cross-linked nanoparticles for in vivo gene delivery  
The in vivo delivery of nucleic acids is targeted by delivery of the nucleic acid in a complex with cross-linked nanoparticles; where the nanoparticles comprise cross-linked neutral amphipathic...
7491538 Gene expression with covalently modified polynucleotides  
A process and compound wherein nucleic acids can be modified with a host of molecules and maintain their ability to be expressed. A modifying chemical attachment of polyions to polynucleotides can...
7482160 Process of making a compound by forming a polymer from a template drug  
A method of forming polymers in the presence of nucleic acid using template polymerization. These methods can be used for the delivery of nucleic acids, for condensing the nucleic acid, for forming...
7476401 Protein and peptide delivery to mammalian cells in vitro  
Compositions and methods for delivery of proteins and peptides to mammalian cells in vitro are described. Specifically, polypeptide-surfactant complexes formed from noncovalent hydrophobation of...
7470817 Transfection reagents  
Disclosed are compounds capable of facilitating transport of biologically active agents or substances into cells having the general structure: wherein Q is selected from the group consisting...
7470781 Formulation of stabilized cationic transfection agent(s)/nucleic acid particles  
The invention concerns a composition containing stabilised particles of cationic transfection agent(s)/nucleic acid complexes characterised in that it includes besides said transfection agent and...
7470539 Formation of polyampholytes in the presence of a polyion  
Polyampholyte are able to condense nucleic acid to form small complexes which can be utilized in the delivery of nucleic acid to mammalian cells. The polyampholytes can be formed prior to...
7455856 Lipid-derivatized bisphosphonic acid  
A bisphosphonic acid of the general formula (I) wherein R 1 is H, OH, C 1 -C 6 alkyl C 1 -C 6 alkoxy, C 1 -C 6 hydroxyalkyl, C 1 -C 6 aminoalkyl, C 1 -C 6 halogen alkyl X is a...
7439066 Methods for producing and using in vivo pseudotyped retroviruses using envelope glycoproteins from lymphocytic choriomeningitis virus (LCMV)  
The present invention provides novel pseudotyped retroviral vectors that can transduce human and other cells. Vectors are provided that are packaged efficiently in packaging cells and cell lines to...
7435595 Method for transfer of molecular substances with prokaryotic nucleic acid-binding proteins  
The invention relates to a method for the transfer of molecular substances, for example proteins or nucleic acids in cells, in the case of using DNA combined with a possible gene expression. A...
7422902 Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer  
Novel lipid-nucleic acid particulate complexes which are useful for in vitro or in vivo gene transfer are described. The particles can be formed using either detergent dialysis methods or methods...
7405205 Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase  
Compounds and methods for modulating cell proliferation, preferably inhibiting the proliferation of tumor cells are described. Compounds that may be used to modulate cell proliferation include...
7361640 Stable lipid-comprising drug delivery complexes and methods for their production  
Novel stable, concentrated, biologically active and ready-to-use lipid-comprising drug delivery complexes and methods for their production are described. The biological activity of the complexes...
7345025 Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells  
Described are compositions and methods relating to gene therapy, particularly as applied to hematopoietic progenitor (HP) cells, to transduced cells and methods of obtaining them, and to methods of...
7341738 Lipid-encapsulated polyanionic nucleic acid  
Methods for the preparation of a lipid-nucleic acid composition are provided. According to the methods, a mixture of lipids containing a protonatable or deprotonatable lipid, for example an amino...
7294511 Methods for delivering nucleic acid molecules into cells and assessment thereof  
Methods for delivering nucleic acid molecules into cells and methods for measuring nucleic acid delivery into cells and the expression of the nucleic acids are provided. The methods are designed...
7285542 Hyperthermic inducible expression vectors for gene therapy and methods of use thereof  
Methods and compositions are provided for transgene expression in target cells. Expression constructs using an inducible amplification system to drive expression of a therapeutic gene or other gene...
7279322 Electrospraying apparatus and method for coating particles  
An electrospraying apparatus and/or method is used to coat particles. For example, a flow including at least one liquid suspension may be provided through at least one opening at a spray dispenser...
7264969 Carrier system for specific artery wall gene delivery  
An artery wall binding peptide (AWBP) based on the artery wall cell-binding domain of apolipoprotein B-100 was conjugated to a cationic backbone configured for forming a complex with a nucleic acid...
7262173 Chemosensitizing with liposomes containing oligonucleotides  
The invention relates to the use of oligonucleotide containing cationic liposomal formulations to enhance the efficacy of chemotherapy and/or radiotherapy, particularly as a means to sensitize...
7256043 Transfection complexes  
The invention provides a peptide having at least 3 amino acids comprising an amino acid sequence selected from a) X 1 SM [SEQ.ID.NO.:1] b) LX 2 HK [SEQ.ID.NO.:2] c) PSGX 3 ARA [SEQ.ID.NO.:9] d) SX...
7250403 Biodegradable immunomodulatory formulations and methods for use thereof  
The invention provides new compositions and methods for immunomodulation of individuals. Immunomodulation is accomplished by administration of immunomodulatory polynucleotide/microcarrier (IMP/MC)...
7238673 Treatment of diseases by site-specific instillation of cells or site-specific transformation of cells and kits therefor  
A method for the direct in vivo transformation of cells in and surrounding a solid tumor is disclosed. This method is based on the site-specific delivery of proteins to solid tumors and to tissue...
7223856 Antisense compounds which prevent cell death and uses thereof  
The present invention provides for an antisense oligonucleotide having the sequence 5′GCTCGGCGCCGCCATTTCCAG3′. The invention also provides for an antisense oligonucleotide having the sequence...
7217572 Modulation of HIF1α and HIF2α expression  
Compounds, compositions and methods are provided for modulating the expression of HIF1α and/or HIF2α. The compositions comprise oligonucleotides, targeted to nucleic acid encoding HIF1α and...
7208314 Compositions and methods for drug delivery using pH sensitive molecules  
A system relating to the delivery of desired compounds (e.g., drugs and nucleic acids) into cells using pH-sensitive delivery systems. The system provides compositions and methods for the delivery...
7192605 Nucleic acid transfer complexes  
The present invention relates to compositions and methods for transferring nucleic acids into cells in vitro and in vivo. The compositions comprise a transfection reagent and one or more...
7189705 Methods of enhancing SPLP-mediated transfection using endosomal membrane destabilizers  
The present invention provides novel and surprisingly effective methods for delivering nucleic acids to cells. These methods are based upon the discovery that the presence of endosomal membrane...
7179796 Antisense modulation of PTP1B expression  
Compounds, compositions and methods are provided for modulating the expression of PTP1B. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic...
7179593 Estrogen receptor site-specific ribozymes and uses thereof for estrogen dependent tumors  
Highly specific hammerhead ribozymes are provided that human target estrogen receptor mRNA. These ribozymes, designated RZ1 through RZ7 provide predictable mRNA cleavage products. Methods for...
7166302 Complexing agents for compositions containing inclusion complexes  
The invention provides a composition containing particulate composite of a polymer and a therapeutic agent. The composition also contains a complexing agent. The polymer interacts with the...
7166298 Genetic immunization with cationic lipids  
A method for immunization using genetic material is disclosed. Compositions for genetic immunization comprising cationic lipids and polynucleotides are also disclosed. Methods for using genetic...
7163695 Histidine copolymer and methods for using same  
The invention provides a pharmaceutical agent delivery composition comprising: (i) a transport polymer comprising a linear or branched peptide having from about 10 to about 300 amino acid residues,...
7157098 Gene therapy of tumors using non-viral delivery system  
The present invention provides a pharmaceutical composition, comprising: (a) cationic lipids, wherein said lipids are a liposomal mixture of a diacyl-ethyl-phosphocholine and...
7145039 Transfection reagents  
Disclosed are compounds capable of facilitating transport of biologically active agents or substances into cells having the general structure: wherein Q is selected from the group...
7141375 Methods and compositions for treatment of tumors using nucleic acid ligands to platelet-derived growth factor  
A method is provided for treating solid tumors comprising administering a composition comprising a PDGF aptamer and a cytotoxic agent. In a preferred embodiment the PDGF aptamer is identified using...
7132529 Antisense modulation of stearoyl-CoA desaturase expression  
Antisense compounds, compositions and methods are provided for modulating the expression of stearoyl-CoA desaturase. The compositions comprise antisense compounds, particularly antisense...
7132404 Compositions for receptor/liposome mediated transfection and methods of using same  
The present invention provides a composition of matter for introducing an exogenous nucleic acid molecule into a target cell, comprising a liposome, a ligand polymeric scaffold, wherein the ligand...
7132289 Method for introducing foreign matters into living cells  
A method for introducing a foreign matter into a cell, includes the steps of placing a small particle carrying a foreign matter at a part of a cell surface of a living cell, boring a hole in a cell...
7129222 Immunomodulatory formulations and methods for use thereof  
The invention provides new compositions and methods for immunomodulation of individuals. Immunomodulation is accomplished by administration of immunomodulatory polynucleotide/microcarrier (IMP/MC)...
7129087 Oligonucleotide-facilitated coalescence  
Coalescence of cells or other membrane-bound entities is facilitated by anchoring an outwardly projecting first oligonucleotide in one member and an outwardly projecting second oligonucleotide,...
7125718 Method for introducing and expressing genes in animal cells, and bacterial blebs for use in same  
A method for introducing and expressing genes in animal cells, in which the animal cells are transfected with bacterial blebs containing a eukaryotic expression cassette encoding the gene....
7119078 Technology of intracellular delivery of DNA oligonucleotides to improve drug activity  
The present invention relates to methods of intracellular delivery of oligonucleotides. More particularly, the present invention relates to the use of the delivery system to deliver G-quartet...
7105157 Methods for treating cancers and pathogen infections using antigen-presenting cells loaded with RNA  
The present invention relates to cells and methods for treating or preventing tumor formation or infections with pathogens in a patient. The cells of the invention are antigen-presenting cells...
Matches 1 - 50 out of 305 1 2 3 4 5 6 7 >