Match Document Document Title
7341719 Myoblast therapy for cosmetic treatment  
Compositions and methods of treating mammalian diseases using myoblasts, and/or their physical, genetic, chemical derivatives. Myogenic cells that are normal, or genetically or phenotypically...
7332334 Hematopoietic stem cells treated by in vitro fucosylation and methods of use  
A method of in vitro fucosylation of selectin ligands on cord blood-derived hematopoietic stem cells for bone marrow transplantation is disclosed. In this method, an effective amount of an...
7326571 Decellularized bone marrow extracellular matrix  
The invention is directed to compositions comprising decellularized bone marrow extracellular matrix and uses thereof. Methods for repairing or regenerating defective, diseased, damaged or ischemic...
7323333 Materials and methods for regulating process formation in cell culture  
The subject invention pertains to materials and methods for inhibiting process formation and extension by cells in culture. The subject invention further includes cultures of process-forming cells...
7323337 Gene transfer into primate embryonic stem cells using VSV-G pseudotyped simian immunodeficiency virus vectors  
Highly efficient gene transfer into primate-derived embryonic stem (ES) cells has successfully been achieved by using a simian immunodeficiency virus vector (SIV) pseudotyped with VSV-G protein,...
7320891 Methods and kits for isolating sperm cells  
Disclosed are methods for isolating sperm cells from an aqueous sample and kits for isolating sperm cells from an aqueous sample.
7320787 Redirection of cellular immunity by protein tyrosine kinase chimeras  
Disclosed is a method of directing a cellular response in a mammal by expressing in a cell of the mammal a chimeric receptor which causes the cells to specifically recognize and destroy an...
7319034 Modifications of apoptin  
Phosphorylated Apoptin is described. Apoptin is tumor-specifically phosphorylated and part of the Apoptin apoptotic pathway in tumor cells is elucidated. New therapeutic possibilities, for example,...
7319035 Biological scaffolding material  
The invention provides methods of generating a natural, living biological matrix that can serve as, or form a part of, a natural biological scaffold. The matrix is generated by incubating together...
7316896 Egg freezing and storing tool and method  
An egg freezing and storing instrument has an egg freezing and storing tube made of a liquid nitrogen-resistant material; and a metal cylindrical protection member for protecting the tube. The tube...
7316897 Process, device and reagent for cell separation  
A cell separation process for the isolation of pathogenic cells in a small concentration in a biological fluid specimen, including treating the biological specimen to modify in a differential...
7316927 Culture of goblet cells  
The invention encompasses isolation, culture and characterization of goblet cells in vitro from mammalian conjuctiva. Goblet cells can be cultured from conjunctiva of such mammals as, e.g., humans,...
7312065 Lawsonia intracellularis of European origin and vaccines, diagnostic agents and methods of use thereof  
The present invention relates to Lawsonia intracellularis vaccines and methods for protecting against and diagnosing L. intracellularis infection. The products and processes of the invention...
7311904 Tissue matrices comprising placental stem cells, and methods of making the same  
A method of manufacturing a tissue matrix for implantation into a patient is disclosed. The method sets forth collecting embryonic stem cells from a placenta which has been treated to remove...
7306943 Keratinocytes useful for the treatment of wounds  
The invention relates to new keratinocytes which may be cultured in vitro and the advantageous use thereof for preparing a product which can be used to treat acute and chronic wounds.
7303912 Cultures of GFAP nestin cells that differentiate to neurons  
Cultures of cells immunoreactive for glial fibrillary acidic protein (GFAP), as well as for the intermediate filament marker nestin were grown in a medium including epidermal growth factor (EGF)...
7297539 Medium for growing human embryonic stem cells  
This disclosure provides an improved system for culturing human pluripotent stem cells. Traditionally, pluripotent stem cells are cultured on a layer of feeder cells (such as mouse embryonic...
7297538 Encapsulated cell indicator system  
The invention features an encapsulated cell indicator system that includes (a) indicator cells having a signal-responsive element operably linked to a reporter gene; (b) encapsulating material; and...
7297331 Beads containing restricted cancer cells producing material suppressing cancer cell proliferation  
Compositions of matter are described which contain restricted cancer cells. When so restricted, the cells produce an unexpectedly high amount of material which suppresses cancer cell proliferation....
7294509 Pre-adipose cell lines  
This invention relates to new immortalized human pre-adipose cell lines capable of differentiating into adipose cells and methods of obtaing the immortalized cells. In particular, the present...
7294508 Isolation of inner cell mass for the establishment of human embryonic stem cell (hESC) lines  
A method for isolating an inner cell mass comprising the steps of immobilizing a blastocyst stage embryo having a zona pellucida, trophectoderm, and inner cell mass, creating an aperture in the...
7291499 Transformed cell, method of screening anti-aging agent and anti-aging agent  
This invention provides a novel transformed cell useful in constructing an anti-aging agent screening system, a screening method which uses the same and an anti-aging agent, and it relates to a...
7282366 Hepatocytes for therapy and drug screening made from embryonic stem cells  
It has been discovered that when pluripotent stem cells are cultured in the presence of a hepatocyte differentiation agent, a population of cells is derived that has a remarkably high proportion of...
7279330 Method for identifying modulating compounds of neurotransmitters  
A process for identifying compounds that can modulate the release of neuromediators is described in which, for example, at least one compound that is to be tested is brought into contact with a...
7270810 Veto cells effective in preventing graft rejection and devoid of graft versus host potential  
A method of transplanting a transplant derived from a donor into a recipient is disclosed. The method comprises the steps of (a) transplanting the transplant into the recipient; and (b)...
7267981 Human foreskin fibroblasts for culturing ES cells  
A cell culture comprising human foreskin cells, the human foreskin cells being capable of maintaining stem cells in an undifferentiated state when co-cultured therewith.
7259011 Pluripotent adult stem cells  
The invention relates to isolated human pluripotent adult stem cells which express CD13, CD34, CD56 and CD117, and which do not express CD1O, which are capable of differentiating in all three germ...
7256042 Process for making hepatocytes from pluripotent stem cells  
It has been discovered that when pluripotent stem cells are cultured in the presence of a hepatocyte differentiation agent, a population of cells is derived that has a remarkably high proportion of...
7250293 Complementing cell lines  
A packaging cell line capable of complementing recombinant adenoviruses based on serotypes from subgroup B, preferably adenovirus type 35. The cell line is preferably derived from primary diploid...
7247480 Method for producing dendritic cells  
Disclosed are embryonic stem cell-derived dendritic cells, genetically modified immature dendritic cells capable of maturation, as well as methods for the production of such cells. In one...
7247481 Process for culturing cells sampled for biopsy  
The present invention provide: a novel process for culturing animal cells and a kit for culturing animal cells, in which, even if the number of cells as sampled for biopsy is extremely small, the...
7247427 Leptin assay  
The invention provides a method for determining the presence of leptin in a sample.
7247477 Methods for the in-vitro identification, isolation and differentiation of vasculogenic progenitor cells  
There is provided a simplified and inexpensive method for the in-vitro identification, isolation and culture of human vasculogenic progenitor cells. The method and the progenitor cells isolated...
7244616 Use of molecular chaperones for the enhanced production of secreted, recombinant proteins in mammalian cells  
The present invention relates to a method for increased production of a secreted, recombinant protein product through the introduction of molecular chaperones in a mammalian host cell. The present...
7244552 Artificial dermis and production method therefor  
Artificial dermis ( 1 ) obtained from plasma with platelets ( 2 ) and human fibroblasts. The plasma with platelets ( 2 ) is obtained from the fractionating of total blood ( 4 ) from the patient ( 8...
7238526 Methods and cell line useful for production of recombinant adeno-associated viruses  
Methods for efficient production of recombinant AAV employ a host cell which comprising AAV rep and cap genes stably integrated within the cell's chromosomes, wherein the AAV rep and cap genes are...
7238360 Alteration of cell membrane with B7  
Methods and compositions are provided for the persistent modification of cell membranes with exogenous proteins so as to alter the function of the cell to achieve effects similar to those of gene...
7238524 Prostate cancer cell lines  
Novel human prostate cancer-associated neuroendocrine (NE)-like cell lines are provided that were derived via a process that resembles clinical androgen ablation therapy for advanced prostate cancer.
7235401 Method for determining cell cycle position  
The invention provides a novel, non-destructive and dynamic process for determining the cell cycle position of living cells. The invention also provides DNA constructs, and cell lines containing...
7235393 Method for direct rescue and amplification of integrated viruses from cellular DNA of tissues  
A method for isolating AAV viruses from cellular DNA of non-human primate (NHP) tissues by transfecting the DNA of NHP into 293 cells, rescuing the virus and amplifying it through serial passages...
7232683 Extracellular matrix signaling molecules  
Polynucleotides encoding mammalian ECM signaling molecules affecting the cell adhesion, migration, and proliferation activities characterizing such complex biological processes as angiogenesis,...
RE39696 Human cyclooxygenase-2 cDNA and assays for evaluating cyclooxygenase-2 activity  
The invention discloses a human cyclooxygenase-2 cDNA, a human cyclooxygenase-2 and assays for preferentially and independently measuring cyclogenase-2 or cyclooxygenase-1 activity present in a...
7223856 Antisense compounds which prevent cell death and uses thereof  
The present invention provides for an antisense oligonucleotide having the sequence 5′GCTCGGCGCCGCCATTTCCAG3′. The invention also provides for an antisense oligonucleotide having the sequence...
7223556 Targeted proteolysis by recruitment to ubiquitin protein ligases  
The present invention relates to methods and reagents for targeting proteolysis of a polypeptide by cis or trans association with a ubiquitin protein ligase, and further provides methods and...
7217569 Clonal cultures of primate embryonic stem cells  
Disclosed herein are methods for culturing primate embryonic stem cells. These cells are cultured on a prolonged and stable basis in the presence of exogenously supplied fibroblast growth factor...
7217566 Attached cell lines  
The present invention provides novel cell lines that may have improved adhesive qualities, transgene expression level, growth rate, and/or growth rate in serum free medium or even chemically...
7214371 Tissue engineered biografts for repair of damaged myocardium  
The invention is directed to tissue-engineered biografts, methods for preparing the biografts of the invention, and methods for repairing a damaged myocardium in a mammal. The methods of the...
7211404 Liver engrafting cells, assays, and uses thereof  
A substantially enriched mammalian hepatic liver engrafting cell population is provided. Methods are provided for the isolation and culture of this liver engrafting cell. The progenitor cells are...
7208317 In Vitro mutagenesis, phenotyping, and gene mapping  
Cellular libraries useful for in vitro phenotyping and gene mapping. In a representative approach, a method for preparing a homozygous cellular library includes the steps of providing a...
7208481 Aminodiphosphonate apolipoprotein E modulators  
The present invention relates to methods of use of aminodiphosphonate to modulate apolipoprotein E levels and the use of such compounds in therapy, including cardiovascular and neurological disease...