Plaque It!
Sponsored by: Flash of Genius |
| 4683195 | Process for amplifying, detecting, and/or-cloning nucleic acid sequences | July, 1987 | Mullis et al. | 435/6 |
| 4683202 | Process for amplifying nucleic acid sequences | July, 1987 | Mullis | 435/91 |
| 4963663 | Genetic identification employing DNA probes of variable number tandem repeat loci | October, 1990 | White et al. | 536/27 |
| 4965188 | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme | October, 1990 | Mullis et al. | 435/6 |
| 5043272 | Amplification of nucleic acid sequences using oligonucleotides of random sequence as primers | August, 1991 | Hartley et al. | 435/91 |
| 5104792 | Method for amplifying unknown nucleic acid sequences | April, 1992 | Silver et al. | 435/6 |
| 5126239 | Process for detecting polymorphisms on the basis of nucleotide differences | June, 1992 | Livak et al. | 435/6 |
| 5262311 | Methods to clone polyA mRNA | November, 1993 | Pardee et al. | 435/91.2 |
| 5487985 | Arbitrarily primed polymerase chain reaction method for fingerprinting genomes | January, 1996 | McClelland et al. | 435/91.2 |
This is a continuation of application Ser. No. 07/633,095, filed Dec. 21, 1990, now abandoned, which is a CIP application of Ser. No. 07/598,913, filed Oct. 15, 1990, and now abandoned. the disclosure of which is hereby incorporated by reference.
(a) forming a polymerase chain reaction (PCR) admixture by combining, in a PCR buffer, genomic DNA and at least one polynucleotide primer from about 10 to about 50 nucleotide bases in length;
(b) subjecting said PCR admixture of step (a) to at least one PCR thermocycle, each of said thermocycles comprising hybridization, primer extension and denaturation phases, said hybridization phase comprising a low stringency hybridization temperature permitting the arbitrary priming of said genomic DNA, thereby producing said set of discrete DNA segments;
(c) contacting, in a PCR buffer, said set of discrete DNA segments formed in step (b) with the primer or primers used in step (a) to form a second PCR admixture;
(d) subjecting said second PCR admixture to a plurality of PCR thermocycles, each of said thermocycles including hybridization, primer extension and denaturation phases, said hybridization phase comprising a high stringency hybridization temperature which does not permit the formation of primer-template duplexes with a substantial degree of mismatching, thereby amplifying said set of discrete DNA segments.
(e) size-separating said amplified set of discrete DNA segments into bands to form a fingerprint of segments characteristic of said genome.
T-T-G-T-A-A-A-A-C-G-A-G-G-C-C-A-G-T;
G-G-A-A-A-C-A-G-C-T-A-T-G-A-C-C-A-T-G-A;
G-T-A-A-T-A-C-G-A-C-T-C-A-C-T-A-T-A-G;
G-C-A-A-T-T-A-A-C-C-C-T-C-A-C-T-A-A-A-G;
C-C-A-G-C-T-C-G-A-C-A-T-G-G-C-A-C-R-T-G-T-A-T-A-C-A-T-A-Y-G-T-A-A-C;
G-G-G-G-A-C-T-A-G-T-A-A-A-A-C-G-A-C-G-G-C-C-A-G-T;
C-C-G-G-C-A-T-C-G-A-T-R-R-R-R-R-R-C-G-A-C-G-G-C-C-A-G;
and G-A-G-A-G-G-A-G-A-A-G-G-A-G-A-G-A-G-A-A-R-R-R-R-R;
wherein R is either A or G and Y is either C or T.
(a) forming a polymerase chain reaction (PCR) admixture by combining, in a PCR buffer, genomic DNA from a sample of Staphylococcus bacteria and at least one polynucleotide primer from about 10 to about 50 nucleotide bases in length;
(b) subjecting said PCR admixture of step (a) to at least one PCR thermocycle, each of said thermocycles comprising hybridization, primer extension and denaturation phases, said hybridization phase comprising a low stringency hybridization temperature permitting the arbitrary priming of said genomic DNA, thereby producing a set of discrete DNA segments;
(c) contacting, in a PCR buffer, said set of discrete DNA segments formed in step (b) with the primer or primers used in step (a) to form a second PCR admixture;
(d) subjecting said second PCR admixture to a plurality of PCR thermocycles, each of said thermocycles including hybridization, primer extension and denaturation phases, said hybridization phase comprising a high stringency hybridization temperature which does not permit the formation of primer-template duplexes with a substantial degree of mismatching, thereby amplifying said set of discrete DNA segments;
(e) size-separating said amplified set of discrete DNA segments into bands to form a fingerprint of segments characteristic of said genome; and
(f) comparing said fingerprint of step (e) with the fingerprint for a control sample of genomic DNA from a predetermined species of Staphylococcus prepared in accordance with steps (a)-(e), thereby determining if said sample is the same species as said predetermined species.
T-T-G-T-A-A-A-A-C-G-A-G-G-C-C-A-G-T;
G-G-A-A-A-C-A-G-C-T-A-T-G-A-C-C-A-T-G-A;
G-T-A-A-T-A-C-G-A-C-T-C-A-C-T-A-T-A-G;
G-C-A-A-T-T-A-A-C-C-C-T-C-A-C-T-A-A-A-G;
C-C-A-G-C-T-C-G-A-C-A-T-G-G-C-A-C-R-T-G-T-A-T-A-C-A-T-A-Y-G-T-A-A-C;
G-G-G-G-A-C-T-A-G-T-A-A-A-A-C-G-A-C-G-G-C-C-A-G-T;
G-A-G-A-G-G-A-G-A-A-G-G-A-G-A-G-A-G-A-A-R-R-R-R-R; and
C-C-G-G-C-A-T-C-G-A-T-R-R-R-R-R-R-C-G-A-C-G-G-G-C-A-G;
wherein R is either A or G and Y is either C or T.
C-C-A-G-C-T-C-G-A-C-A-T-G-G-C-A-C-R-T-G-T-A-T-A-C-A-T-A-Y- G-T-A-A-C, wherein R is either A or G and Y is either C or T.
(a) forming a polymerase chain reaction (PCR) admixture by combining, in a PCR buffer, genomic DNA from a sample of Streptococcus bacteria and at least one polynucleotide primer from about 10 to about 50 nucleotide bases in length;
(b) subjecting said PCR admixture of step (a) to at least one PCR thermocycle, each of said thermocycles comprising hybridization, primer extension and denaturation phases, said hybridization phase comprising a low stringency hybridization temperature permitting the arbitrary priming of said genomic DNA, thereby producing a set of discrete DNA segments;
(c) contacting, in a PCR buffer, said set of discrete DNA segments formed in step (b) with the primer or primers used in step (a) to form a second PCR admixture;
(d) subjecting said second PCR admixture to a plurality of PCR thermocycles, each of said thermocycles including hybridization, primer extension and denaturation phases, said hybridization phase comprising a high stringency hybridization temperature which does not permit the formation of primer-template duplexes with a substantial degree of mismatching, thereby amplifying said set of discrete DNA segments;
(e) size-separating said amplified set of discrete DNA segments into bands to form a fingerprint of segments characteristic of said genome; and
(f) comparing said fingerprint of step (e) with the fingerprint for a control sample of genomic DNA from a predetermined species of Streptococcus prepared in accordance with steps (a)-(e), thereby determining if said sample is the same species as said predetermined species.
T-T-G-T-A-A-A-A-C-G-A-G-G-C-C-A-G-T;
G-G-A-A-A-C-A-G-C-T-A-T-G-A-C-C-A-T-G-A;
G-T-A-A-T-A-C-G-A-C-T-C-A-C-T-A-T-A-G;
G-C-A-A-T-T-A-A-C-C-C-T-C-A-C-T-A-A-A-G;
C-C-A-G-C-T-C-G-A-C-A-T-G-G-C-A-C-R-T-G-T-A-T-A-C-A-T-A-Y-G-T-A-A-C;
G-G-G-G-A-C-T-A-G-T-A-A-A-A-C-G-A-C-G-G-C-C-A-G-T;
G-A-G-A-G-G-A-G-A-A-G-G-A-G-A-G-A-G-A-A-R-R-R-R-R; and
C-C-G-G-C-A-T-C-G-A-T-R-R-R-R-R-R-C-G-A-C-G-G-G-C-A-G;
wherein R is either A or G and Y is either C or T.
(a) forming a polymerase chain reaction (PCR) admixture by combining, in a PCR buffer, genomic DNA from a sample of bacteria and at least one polynucleotide primer from about 10 to about 50 nucleotide bases in length;
(b) subjecting said PCR admixture of step (a) to at least one PCR thermocycle, each of said thermocycles comprising hybridization, primer extension and denaturation phases, said hybridization phase comprising a low stringency hybridization temperature permitting the arbitrary priming of said genomic DNA, thereby producing a set of discrete DNA segments;
(c) contacting, in a PCR buffer, said set of discrete DNA segments formed in step (b) with the primer or primers used in step (a) to form a second PCR admixture;
(d) subjecting said second PCR admixture to a plurality of PCR thermocycles, each of said thermocycles including hybridization, primer extension and denaturation phases, said hybridization phase comprising a high stringency hybridization temperature which does not permit the formation of primer-template duplexes with a substantial degree of mismatching, thereby amplifying said set of discrete DNA segments;
(e) size-separating said amplified set of discrete DNA segments into bands to form a fingerprint of segments characteristic of said genome; and
(f) comparing said fingerprint of step (e) with the fingerprints for control samples of genomic DNA from a panel of predetermined species of bacteria prepared in accordance with the steps (a)-(e), thereby determining if said sample is the same species as said predetermined species.
(a) forming a primer extension reaction admixture by combining, in a primer- extension buffer, said RNA sample and at least one polynucleotide from about 10 to about 50 nucleotide bases in length;
(b) maintaining said primer extension reaction under primer extension conditions to produce a hybrid DNA-RNA molecule;
(c) forming a polymerase chain reaction (PCR) admixture by combining, in a PCR buffer, said hybrid DNA-RNA molecule and at least one polynucleotide primer from about 10 to about 50 nucleotide bases in length;
(d) subjecting said PCR admixture of step (c) to at least one PCR thermocycle, each of said thermocycles comprising hybridization, primer extension and denaturation phases, said hybridization phase comprising a low stringency hybridization temperature permitting the arbitrary priming of said hybrid DNA-RNA molecule, thereby producing said set of discrete DNA segments;
(e) contacting, in a PCR buffer, said set of discrete DNA segments formed in step (d) with the primer or primers used in step (c) to form a second PCR admixture;
(f) subjecting said second PCR admixture to a plurality of PCR thermocycles, each of said thermocycles including hybridization, primer extension and denaturation phases, said hybridization phase comprising a high stringency hybridization temperature which does not permit the formation of primer-template duplexes with a substantial degree of mismatching, thereby amplifying said set of discrete DNA segments.
(g) size-separating said amplified set of discrete DNA segments into bands to form a fingerprint of segments characteristic of said single stranded RNA.
This invention is directed toward a method of identifying segments of nucleic acid characteristic of a particular genome by generating a set of discrete DNA amplification products characteristic of the genome. This set of discrete DNA products can generate a fingerprint that can be used to identify the genome.
For many purposes, it is important to be able to identify the species to which an organism belongs rapidly and accurately. Such rapid identification is necessary for pathogens such as viruses, bacteria, protozoa, and multicellular parasites, and assists in diagnosis and treatment of human and animal disease, as well as studies in epidemiology and ecology. In particular, because of the rapid growth of bacteria and the necessity for immediate and accurate treatment of diseases caused by them, it is especially important to have a fast method of identification.
Traditionally, identification and classification of bacterial species has been performed by study of morphology, determination of nutritional requirements or fermentation patterns, determination of antibiotic resistance, comparison of isoenzyme patterns, or determination of sensitivity to bacteriophage strains. These methods are time-consuming, typically requiring at least 48 to 72 hours, often much more. Other more recent methods include the determination of RNA sequences (Woese, in "Evolution in Procaryotes" (Schleifer and Stackebrandt, Eds., Academic Press, London, 1986)), the use of strain-specific fluorescent oligonucleotides (DeLong et al., Science 243, 1360-1363 (1989); Amann et al., J. Bact. 172, 762-770 (1990)), and the polymerase chain reaction (PCR) technique (U.S. Pat. Nos. 4,683,195 and 4,683,202 to Mullis et al.; Mullis & Faloona, Methods Enzymol. 154, 335-350 (1987)).
In addition, DNA markers genetically linked to a selected trait can be used for diagnostic procedures. The DNA markers commonly used are restriction fragment length polymorphisms (RFLPs). Polymorphisms useful in genetic mapping are those polymorphisms that segregate in populations. Traditionally, RFLPs have been detected by hybridization methodology (e.g. Southern blot), but such techniques are time-consuming and inefficient. Alternative methods include assays for polymorphisms using PCR.
The PCR method allows amplification of a selected region of DNA by providing two DNA primers, each of which is complementary to a portion of one strand within the selected region of DNA. These primers are used to hybridize to the separated strands within the region of DNA sought to be amplified, forming DNA molecules that are partially single-stranded and partially double-stranded. The double-stranded regions are then extended by the action of DNA polymerase, forming completely double-stranded molecules. These double-stranded molecules are then denatured and the denatured single strands are rehybridized to the primers. Repetition of this process through a number of cycles results in the generation of DNA strands that correspond in sequence to the region between the originally used primers. Specific PCR primer pairs can be used to identify genes characteristic of a particular species or even strain. PCR also obviates the need for cloning in order to compare the sequences of genes from related organisms, allowing the very rapid construction of phylogenies based on DNA sequence. For epidemiological purposes, specific primers to informative pathogenic features can be used in conjunction with PCR to identify pathogenic organisms.
Although PCR is a very powerful method for amplifying DNA, conventional PCR procedures require the use of at least two separate primers complementary to specific regions of the genome to be amplified. This requirement means that primers cannot be prepared unless the target DNA sequence information is available, and the primers must be "custom built" for each location within the genome of each species or strain whose DNA is to be amplified.
Although the newer methods have advantages over previous methods for genome identification, there is still a need for a rapid, simple method that can be applied to any species for which DNA can be prepared and that does not require reagents that are specific for each species or knowledge of the molecular biology, biochemistry, or DNA sequence of that species. It is also desirable that such a method be capable of identifying a species from a relatively small quantity of biological material. Additionally, it is highly desirable that such a method is also capable of generating polymorphisms useful in genetic mapping, especially of eukaryotes.
In addition to identification of related plant, animal and bacteria species, DNA segments or "markers" may be used to construct human genetic maps for genome analysis. Goals for the present human genome project include the production of a genetic map and an ordered array of clones along the genome. Using a genetic map, inherited phenotypes such as those that cause genetic diseases, can be localized on the map and ultimately cloned. The neurofibromatosis gene is a recent example of this strategy (Xu et al., Cell 62:599-608 (1990)). The genetic map is a useful framework upon which to assemble partially completed arrays of clones. In the short term, it is likely that arrays of human genomic clones such as cosmids or yeast artifical chromosomes (YACS, Burke et al., Science 236:806-812 (1987)) will form disconnected contigs that can be oriented relative to each other with probes that are on the genetic map or the in situ map (Lichter et al., Science 24:64-69 (1990)), or both. The usefulness of the contig map will depend on its relation to interesting genes, the locations of which may only be known genetically. Similarly, the restriction maps of the human genome generated by pulsed field electrophoresis (PFE) of large DNA fragments, are unlikely to be completed without the aid of closely spaced markers to orient partially completed maps. Thus, a restriction map and an array of clones covering an entire mammalian genome, for example the mouse genome, is desirable.
Recently, RFLPs that have Variable Number Tandem Repeats (VNTRs) have become a method of choice for human mapping because such VNTRs tend to have multiple alleles and are genetically informative because polymorphisms are more likely to be segregating within a family. The production of fingerprints by Southern blotting with VNTRs (Jeffreys et al., Nature 316:76-79 (1985)) has proven useful in forensics. There are two classes of VNTRs; one having repeat units of 9 to 40 base pairs, and the other consisting of minisatellite DNA with repeats of two or three base pairs. The longer VNTRs have tended to be in the proterminal regions of autosomes. VNTR consensus sequences may be used to display a fingerprint. VNTR fingerprints have been used to assign polymorprisms in the mouse (Julier et al., Proc. Natl. Acad. Sci. USA, 87:4585-4589 (1990)), but these polymorphisms must be cloned to be of use in application to restriction mapping or contig assembly. VNTR probes are useful in the mouse because a large number of crosses are likely to be informative at a particular position.
The mouse offers the opportunity to map in interspecific crosses which have a high level of polymorphism relative to most other inbred lines. A dense genetic map of DNA markers would facilitate cloning genes that have been mapped genetically in the mouse. Cloning such genes would be aided by the identification of very closely linked DNA polymorphisms. About 3000 mapped DNA polymorphisms are needed to provide a good probability of one polymorphism being within 500 kb of the gene. To place so many DNA markers on the map it is desirable to have a fast and cost-effective genetic mapping strategy.
Accordingly, the present invention, referred to herein as arbitrarily primed polymerase chain reaction or "AP-PCR", provides a distinctive variation of the PCR technique by employing arbitrary primers. We have unexpectedly found that the use of a single primer used at low stringency hybridization conditions reproducibly generates specific discrete products that can be resolved into a manageable number of individual bands providing a species "fingerprint". The AP-PCR method is suitable for the rapid identification and classification of organisms and for the generation of polymorphisms suitable for genetic mapping of eukaryotes. Only a small sample of biological material is needed, and knowledge of the molecular biology, biochemistry, or the target DNA sequence to be identified is not required. In addition, reagents specific for a given species are not required.
In general, AP-PCR is a method for generating a set of discrete DNA products ("amplification products") characteristic of a genome by priming target nucleic acid obtained from a genome with at least one single-stranded primer to form primed nucleic acid such that a substantial degree of mismatching, preferably internal mismatching, occurs between the primer and the target nucleic acid. The primed nucleic acid is then amplified by performing at least one cycle of polymerase chain reaction (PCR) amplification to generate DNA amplification products from mismatched primed sites in the genome. A second step of amplification by PcR is then performed using at least one more cycle, and preferably at least 10 cycles, of PCR amplification to generate a set of discrete DNA amplification products characteristic of the genome.
The single-stranded DNA primer is from about 10 to about 50 nucleotide bases in length, more preferably from about 17 to about 40 nucleotide bases in length. It can be of any sequence. The primer can have sequence redundancies reducing the occurrence of mismatches.
Among the possible primers, the following can be used:
G-G-A-A-A-C-A-G-C-T-A-T-G-A-C-C-A-T-G-A (SEQ ID NO: 1);
G-T-A-A-T-A-C-G-A-C-T-C-A-C-T-A-T-A-G (SEQ ID NO: 2);
G-C-A-A-T-T-A-A-C-C-C-T-C-A-C-T-A-A-A-G (SEQ ID NO: 3);
C-C-A-G-C-T-C-G-A-C-A-T-G-G-C-A-C-R-T-G-T-A-T-A-C-A-T-A-Y-G- T-A-A-C (SEQ ID NO: 4);
G-G-G-G-A-C-T-A-G-T-A-A-A-A-C-G-A-C-G-G-C-C-A-G-T (SEQ ID NO: 5);
G-A-G-A-G-G-A-G-A-A-G-G-A-G-A-G-A-G-A-A-R-R-R-R-R (SEQ ID NO: 6); or
C-C-G-G-C-A-T-C-G-A-T-R-R-R-R-R-R-C-G-A-C-G-G-C-C-A-G (SEQ ID NO: 7),
wherein R is either A or G, and wherein Y is either C or T.
Alternatively, the arbitrarily chosen single-stranded primer can have a sequence of T-G-T-G-T-G (SEQ ID NO: 8) at its 3'-terminus, or be about 20 bases in length with a sequence of A-C-G-C-G-C-A-C (SEQ ID NO: 9) at its 3'-terminus.
The single-stranded primer can also be a mixture of at least two different or heterogeneous primer sequences. The different sequences can be of the same or different lengths.
In one embodiment of the method, the first cycle of amplification is performed under conditions in which each cycle of polymerase chain reaction amplification includes a step of incubation at a low stringency annealing temperature. The remaining cycles of polymerase chain reaction amplification, preferably at least 10 cycles, are performed under conditions in which each cycle of polymerase chain reaction amplification includes a step of incubation at a high stringency annealing temperature greater than the low stringency annealing temperature.
In an alternative embodiment, to produce a different pattern and raise the resolving power of the method, a second arbitrary primer is included in the same reaction so that amplification of the nucleic acid primed with each of the primers occurs simultaneously.
The annealing temperature in the first cycle is preferably from about 35° C. to about 55° C. The annealing temperature in the remaining cycles is about the melting temperature of the double-stranded DNA formed by annealing, about 35° C. to 65° C. for primers over 15 bases in length. Preferably this temperature is greater than about 55° C., more preferably about 60° C.
The genome to which the AP-PCR method is applied can be a viral genome; a bacterial genome, including Staphylococcus and Streptococcus; a plant genome, including rice, maize, or soybean, or an animal genome, including a human genome. It can also be a genome of a cultured cell line. The cultured cell line can be a chimeric cell line with at least one human chromosome in a non-human background.
The AP-PCR method can be used to identify an organism as a species of a genus of bacteria, for example, Staphylococcus, from a number of different species. Similarly, the method can be used to determine the strain to which an isolate of the genus Streptococcus belongs, by comparing the DNA amplification products produced by AP-PCR for the isolate to the patterns produced from known strains with the same primer.
The AP-PCR method can also be used to verify the assignment of a bacterial isolate to a species by comparing the AP-PCR fingerprint from the isolate with the AP-PCR fingerprints produced by known bacterial species with the same primer. For this application, the primer is chosen to maximize interspecific difference of the discrete DNA amplification products.
The target nucleic acid of the genome can be DNA, RNA or polynucleotide molecules. If the AP-PCR method is used to characterize RNA, the method also preferably includes the step of extending the primed RNA with an enzyme having reverse transcriptase activity-to produce a hybrid DNA-RNA molecule, and priming the DNA of the hybrid with an arbitrary single-stranded primer. In this application, the enzyme with reverse transcriptase activity can be avian myeloblastosis virus reverse transcriptase or Moloney leukemia virus reverse transcriptase.
The discrete DNA amplification products produced by the AP-PCR method can be manipulated in a number of ways. For example, they can be separated in a medium capable of separating DNA fragments by size, such as a polyacrylamide or agarose gel, in order to produce a fingerprint of the amplification products as separated bands. Additionally, at least one separated band can be isolated from the fingerprint and reamplified by conventional PCR. The isolated separated band can also be cleaved with a restriction endonuclease. The reamplified fragments can then be isolated and cloned in a bacterial host. These methods are particularly useful in the detection and isolation of DNA sequences that represent polymorphisms differing from individual to individual of a species.
The ability of the AP-PCR method to generate polymorphisms makes it useful, as well, in the mapping and characterization of eukaryotic genomes, including plant genomes, animal genomes, and the human genome. These polymorphisms are particularly useful in the generation of linkage maps and can be correlated with RFLPs and other markers.
FIG. 1 shows the variation of the AP-PCR pattern produced from Staphylococcus aureus ISP8 DNA when the annealing temperature in the first two cycles of PCR is varied, as described in Example 3, infra;
FIG. 2 shows the AP-PCR patterns produced by six strains of S. aureus at five different concentrations of DNA, as described in Example 5, infra;
FIG. 3 shows the AP-PCR patterns produced by 17 isolates representing four different species of Staphylococcus, illustrating the differences apparent between species, as described in Example 6, infra;
FIG. 4 shows the AP-PCR patterns produced by six strains of Streptococcus, illustrating the differences detectable between the strains and the general similarity of the patterns from the same species, as described in Example 7, infra;
FIG. 5 shows a dendrogram indicating the relative genetic distance between the strains on which the AP-PCR method was performed on Example 7, infra;
FIG. 6 shows the AP-PCR patterns produced by three strains of inbred rice, illustrating the existence of polymorphisms, as described in Example 8, infra;
FIG. 7 shows the AP-PCR patterns produced by several samples of human DNA from individuals of different race and sex at three different concentrations, showing several polymorphisms and possible sex differences, as described in Example 10, infra;
FIG. 8 shows the AP-PCR patterns produced by several samples of DNA from inbred mouse lines, including the lines C57BL/6J and DBA/2J, the F1 generation resulting from a cross between those lines, and 21 recombinant inbred lines, revealing several mappable polymorphisms, as described in Example 11, infra.
In order that the invention herein described may be more fully understood, the following detailed description is set forth.
This invention relates to a method for generating a set of discrete DNA amplification products characteristic of a genome. This set of discrete DNA amplification products can be resolved by techniques such as gel electrophoresis, producing a distinctive pattern, known as a "fingerprint," that can be used to identify the genome. This method uses a distinctive and novel variation of the polymerase chain reaction (PCR) technique that employs an arbitrary primer and is therefore designated the "arbitrarily primed polymerase chain reaction" ("AP-PCR") method.
In general, the method of the invention involves the following steps:
(1) rendering target nucleic acids of the genome accessible to priming;
(2) priming the target nucleic acids of the genome with an arbitrarily selected single-stranded primer to form primed nucleic acids;
(3) performing a number of cycles of PCR on the primed nucleic acids to generate a set of discrete amplification products; and
(4) if the discrete DNA amplification products are to be used for the identification of a genome, comparing the amplification products with those produced from nucleic acids obtained from genomes of known species.
Alternatively, the amplification products produced by the invention can be used to assemble genetic maps for genome analysis.
Each of these steps is discussed in detail below.
I. THE GENERAL METHOD
A. Selection of Genome
The method of the present invention is particularly well suited to the generation of discrete DNA amplification products from nucleic acids obtained from genomes of all sizes from 5×10 4 nucleotide bases (viruses) to 3×10 9 bases and greater (animals and plants).
"Nucleic acids" as that term is used herein means that class of molecules including single-stranded and double-stranded deoxyribonucleic acid (DNA), ribonucleic acid (RNA) and polynucleotides.
The AP-PCR method can be applied to such economically important plants as rice, maize, and soybean. It can also be applied to the human genome and to the genome of a cultured cell line. The cultured cell line can be chimeric with at least one human chromosome in an otherwise non-human background. The non-human background can be rodent, such as mouse or Chinese hamster.
As described in Examples 5, 6, and 7, infra, the DNA amplification products can be used to determine that an unidentified sample of an organism such as from a bacterium belongs to the genus Staphylococcus and can be used further to determine to which species and/or strain of that genus the organism belongs.
B. Rendering the Nucleic Acids of the Genome Accessible to Priming
"Genomic DNA" is used in an art recognized manner to refer to a population of DNA that comprises the complete genetic component of a species. Thus genomic DNA comprises the complete set of genes present in a preselected species. The complete set of genes in a species is also referred to as a genome. Depending on the species, genomic DNA can vary in complexity, and in number of nucleic acid molecules. In higher organisms, genomic DNA is organized into discrete nucleic acid molecules (chromosomes).
For species low in the evolutionary scale, such as bacteria, viruses, yeast, fungi and the like, a genome is significantly less complex than for a species high in the evolutionary scale. For example, whereas E. coli is estimated to contain approximately 2.4×10 9 grams per mole of haploid genome, man contains about 7.4×10 12 grams per mole of haploid genome.
Genomic DNA is typically prepared by bulk isolation of the total population of high molecular weight nucleic acid molecules present in a biological material derived from a single member of a species. Genomic DNA can be prepared from a tissue sample, from a whole organism or from a sample of cells derived form the organism.
Exemplary biological materials for preparing mammalian genomic DNA include a sample of blood, muscle or skin cells, tissue biopsy or cells cultured from tissue, methods for isolating high molecular weight DNA are well known. See, for example, Maniatis et al., in Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. (1982); and U.S. Pat. No. 4,800,159 to Mullis et al.
Rendering the nucleic acids of the genome accessible to priming requires that the nucleic acids be available for base-pairing by primers and that DNA polymerases and other enzymes that act on the primer-template complex can do so without interference. The nucleic acids must be substantially free of protein that would interfere with priming or the PCR process, especially active nuclease, as well as being substantially free of nonprotein inhibitors of polymerase action such as heavy metals.
A number of methods well-known in the art are suitable for the preparation of nucleic acids in a condition accessible to priming. Typically, such methods involve treatment of cells or other nucleic acid-containing structures, such as virus particles, with a protease such as proteinase K or pronase and a strong detergent such as sodium dodecyl sulfate ("SDS") or sodium lauryl sarcosinate ("Sarkosyl") to lyse the cells. This is followed by extraction with phenol and chloroform to yield an aqueous phase containing the nucleic acid. This nucleic acid is then precipitated with ethanol and redissolved as needed. (See Example 1, infra).
Alternatively, as where the genome is in bacteria, a small portion (.about.0.5 mm 2 ) of a single bacterial colony can be removed with a 200-μL automatic pipette tip and suspended in 5 μL of TE (0.01M Tris-HCl, pH 8.0, 1 mM EDTA) in a plastic microfuge tube and boiled for 5 minutes. After the sample is boiled, the debris is pelleted by centrifugation. The AP-PCR method can then be performed directly on the nucleic acids present in the supernatant sample after appropriate dilution.
In some applications, it is possible to introduce samples such as blood or bacteria directly into the PCR protocol as described below without any preliminary step because the first cycle at 94° C. bursts the cells and inactivates any enzymes present.
C. Priming the Target Nucleic Acids
1. The Primer Sequence
a. General Considerations
The sample of target nucleic acids is primed with a single-stranded primer. Individual single-stranded primers, pairs of single-stranded primers or a mixture of single-stranded primers can be used.
The primer is completely "arbitrary" in that it can be chosen without knowledge of the sequence of the target nucleic acids to be amplified.
Although the sequence of the primer is arbitrary in sequence with respect to the nucleic acids to be amplified, some guidelines to primer selection are found in Innis and Gelfand, "Optimization of PCRS," in PCR Protocols: A Guide to Methods and Applications (M. A. Innis, D. H. Gelfand, J. J. Sninsky and T. J. White, eds., Academic Press, New York, 1990), pp. 3-12, incorporated herein by this reference. Briefly, the primer typically has 50 to 60% G+C composition and is free of runs of three or more consecutive C's or G's at the 3'-end or of palindromic sequences, although having a (G+C)-rich region near the 3'-end may be desirable. These guidelines, however, are general and intended to be nonlimiting. Additionally, in many applications it is desirable to avoid primers with a T at the 3' end because such primers can prime relatively efficiently at mismatches, creating a degree of mismatching greater than desired, and affect the background amplification.
The AP-PCR method is based on the rationale that at a sufficiently low temperature primers can be expected to anneal to many sequences with a variety of mismatches. Some of these will be within a few hundred basepairs of each other and on opposite strands. Sequences between these positions will be PCR amplifiable. The extent to which sequences amplify will depend on the efficiency of priming at each pair of primer annealing sites. Because the sequence of the primer is arbitrarily selected with respect to the target nucleic acid sequence of the genome, a substantial degree of mismatching between the DNA strands of the primer and the target nucleic acids of the genome is expected to occur. "Substantial degree of mismatching" is defined herein such that at least 6.5% of the nucleotide bases of a primer sequence are paired with inappropriate (non-complementary) bases in the target nucleic acid, e.g. a guanine base in the primer is paired with an adenine base in the target nucleic acid.
As used herein, the phrase "internal mismatching" in its various grammatical forms refers to non-complementary nucleotide bases in the primer, relative to a template to which it is hybridized, that occur between the 5'-terminal most and 3'-terminal most bases of the primer that are complementary to the template. Thus, 5'-terminal and/or 3'-terminal non-complementary bases are not "internally mismatched" bases. A "substantial degree of "internal mismatching" is such that at least 6.5% of the nucleotide bases of the primer sequence are paired with inappropriate bases in the target nucleic acid.
In the AP-PCR method of the invention the genome may be primed with a single arbitrary primer, a combination of two or more primers or a mixture of heterogeneous primers, each individual primer in the mixture having a different, but related sequence. When a mixture of primers is used, some, but not all, of the primers can match more efficiently. An example of use of a mixture of primers is provided in Example 11, infra using the primer Kpn-R.
Preferably, the arbitrary primer is about 10 to about 50 nucleotide bases long, and more preferably, about 17 to about 40 bases long. In principle, the shorter the oligonucleotide, the more perfect a match must be in order to permit priming.
Preferably, both the template and the primer are DNA. The template can also be single-stranded RNA molecules, for example messenger RNA, in which case an enzyme with reverse transcriptase activity, such as avian myeloblastosis virus (AMV) reverse transcriptase or Moloney murine leukemia virus (Mo-MLV) reverse transcriptase, is used to generate a hybrid DNA-RNA molecule with an arbitrary primer or a poly T primer. The DNA strand of this hybrid DNA-RNA molecule is then used as the starting material for AP-PCR. Alternatively, the primer can also be a single-stranded ribonucleotide of the appropriate length, which is extended at its 3'-hydroxyl terminus by reverse transcriptase, forming a double-stranded molecule in which one strand is partially DNA and partially RNA.
b. Particular Primer Sequences
Among suitable primers for use in the AP-PCR method of the invention are the primer Kpn-R with the sequence of C-C-A-G-C-T-C-G-A-C-A-T-G-G-C-A-C-R-T-G-T-A-T-A-C-A-T-A-Y- G-T-A-A-C (SEQ ID NO: 4) (34 bases), in which R is a purine nucleotide, either A or G, and Y is a pyrimidine nucleotide, either C or T; universal M13, with the sequence of G-G-A-A-A-C-A-G-C-T-A-T-G-A-C-C-A-T-G-A (SEQ ID NO: 1) (20 bases); a second M13 sequencing primer, with the sequence of G-G-G-G-A-C-T-A-G-T-A-A-A-A-C-G-A-C-G-G-C-C-A-G-T (SEQ ID NO: 5) (25 bases), and primers based on this sequence but progressively truncated at the 5' end; M13 reverse sequencing primer, with the sequence of G-T-A-A-T-A-C-G-A-C-T-C-A-C-T-A-T-A-G (SEQ ID NO: 2) (20 bases); a bacteriophage T7 sequencing primer, with the sequence of G-C-A-A-T-T-A-A-C-C-C-T-C-A-C-T-A-A-A-G (SEQ ID NO: 3) (19 bases); a T3 sequencing primer, with the sequence of T-T-G-T-A-A-A-A-C-G-A-G-G-C-C-A-G-T (SEQ ID NO: 5) (20 bases); and more highly degenerate primers such as a pUC sequencing primer with a sequence of C-C-G-G-C-A-T-C-G-A-T-R-R-R-R-R-R-C-G-A-C-G-G-G-C-A-G SEQ ID NO: 11) (27 bases) and a primer with a sequence of G-A-G-A-G-G-A-G-A-A-G-G-A-G-A-G-A-G-A-A-R-R-R-R-R (SEQ ID NO: 6) (25 bases). These primers are generally of universal application except for Kpn-R, which is not suitable for use with human DNA because it hybridizes with a commonly-occurring dispersed repeating sequence in human DNA. Some of these primers are already commercially available and are in extensive use for other purposes. In addition, these primers may be produced by known techniques, for example by chemical synthesis.
Still other examples of suitable primers include a primer of about 20 bases in length with a sequence of A-C-G-C-G-C-A-C (SEQ ID NO: 9) at its 3'-terminus, which may be especially desirable in generating fingerprints that reveal polymorphisms because of the mutability of the CpG dinucleotide. Another primer useful for revealing polymorphisms is a primer with a sequence of T-G-T-G-T-G (SEQ ID NO: 8) at its 3'-terminus. This primer should prime at microsatellite repeats such as the dispersed simple repeat (GT:CA) n .
c. Use of Mixtures of Primers
As discussed above, mixtures of heterogeneous primers can also be used, with each primer in the mixture having a different, but related sequence. An example of such a primer is the Kpn-R primer with two degenerate positions. Another example is: G-A-G-A-G-G-A-G-A-A-G-G-A-G-A-G-G-G-A-A-R-R-R-R-R-R (SEQ ID NO: 6), where R is either A or G. The individual primers in the mixture can all be the same length. Preferably, primers are constructed to avoid self-priming internally and the creation of artifacts.
A heterogeneous mixture of primers may contain some primers that match better with the target nucleic acids than can be expected for a single arbitrary primer. The use of such primers may allow the initial arbitrary priming steps to be performed at a higher temperature (higher stringency) or might allow a consistency of pattern over a wider range of template concentrations.
Combinations of two or more individual primers can also be used. When such combinations of primers are used, the primers are used simultaneously in the same AP-PCR reaction. These combinations provide a very different pattern from that produced by each primer alone. Surprisingly, the patterns are not more complex. When a number of primers are used in combinations, the number of different patterns resulting is approximately equal to the square of the number of separate primers used divided by two. Therefore, a combination of primers provides more fingerprints than could be generated by using each individual primer alone. When primers are used in such combinations, only primer pairs that do not produce a primer artifact can be used.
2. Concentration of Primer and Template
The quantity of the nucleic acid genome used in the AP-PCR amplification depends on the complexity of the particular genome used. Simple genomes, such as bacterial genomes have a genome size of less than about 5 million base pairs (5 megabases). Complex genomes, such as sativa species (rice) have a gehome size of about 700-1000 megabases. Other complex genomes such as maize or humans have a genome size of about 3000 megabases.
The amount of simple genome nucleic acid used as template is from about 10 pg to about 250 ng, preferably from about 30 pg to about 7.5 ng. Most preferred is an amount of simple genome nucleic acid template of about 1 ng.
The amount of nucleic acid of a complex genome used as a template is from about 250 ng to about 0.8 ng. More preferably, the amount of nucleic acid of a complex genome used as template is from about 51 ng to about 0.8 ng. Most preferred, are amounts complex genome nucleic acid template of about 50 ng to about 10 ng.
The priming step is carried out as part of the PCR amplification process, and the conditions under which it is performed are discussed below under "Performance of PCR."
D. Performance of PCR
In one embodiment, the present invention utilizes an amplification method where the single-stranded template is hybridized with a primer or primers to form a primer-template hybridization product or products. A hybridization reaction admixture is prepared by admixing effective amounts of a primer, a template nucleic acid and other components compatible with a hybridization reaction. Templates of the present methods can be present in any form, with respect to purity and concentration, compatible with the hybridization reaction.
The hybridization reaction mixture is maintained under hybridizing conditions for a time period sufficient for the primer(s) to hybridize to the templates to form a hybridization product, i.e., a complex containing primer and template nucleic acid strands.
The phrase "hybridizing conditions" and its grammatical equivalents, when used with a maintenance time period, indicates subjecting the hybridization reaction admixture, in the context of the concentrations of reactants and accompanying reagents in the admixture, to time, temperature and pH conditions sufficient to allow the primer(s) to anneal with the template, typically to form a nucleic acid duplex. Such time, temperature and pH conditions required to accomplish hybridization depend, as is well known in the art, on the length of the primer to be hybridized, the degree of complementarity between the primer and the template, the guanidine and cytosine content of the polynucleotide the stringency of hybridization desired, and the presence of salts or additional reagents in the hybridization reaction admixture as may affect the kinetics of hybridization. Methods for optimizing hybridization conditions for a given hybridization reaction admixture are well known in the art.
The term "primer" as used herein refers to a polynucleotide, whether purified from a nucleic acid restriction digest or produced synthetically which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a template is induced, i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase, reverse transcriptase and the like, and at a suitable temperature and pH.
The primer must be sufficiently long to prime the synthesis of extension products in the presence of the agents for polymerization. The exact lengths of the primers will depend on many factors, including temperature and the source of primer. For example, depending on the complexity of the template sequence, a polynucleotide primer typically contains from about 8 to about 30 or more nucleotides, although it can contain fewer nucleotides. As few as 8 nucleotides in a polynucleotide primer have been reported as effective for use. Studier et al., Proc. Natl. Acad Sci. USA. 86:6917-21 (1989). Short primer molecules generally require lower temperatures to form sufficiently stable hybridization complexes with template to initiate primer extension.
In some cases, the primers used herein are selected to be "substantially" complementary to the different strands of each specific sequence to be synthesized or amplified. This means that the primer must contain at its 3' terminus a nucleotide sequence sufficiently complementary to nonrandomly hybridize with its respective template. Therefore, the primer sequence may not reflect the exact sequence of the template. For example, a non-complementary polynucleotide can be attached to the 5' end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. Such noncomplementary polynucleotides might code for an endonuclease restriction site or a site for protein binding. Alternatively, noncomplementarity bases or longer sequences can be interspersed into the primer, provided the primer sequence has sufficient complementarity with the sequence of the strand to be synthesized or amplified to non-randomly hybridize therewith and thereby form an extension product under polynucleotide synthesizing conditions.
Sommer et al., Nuc. Acid Res., 17:6749 (1989), reports that primers having as little a 3 nucleotide exact match at the 3' end of the primer were capable of specifically initiating primer extension products, although less nonspecific hybridization occurs when the primer contains more nucleotides at the 3' end having exact complementarity with the template sequence. Therefore, a substantially complementary primer as used herein must contain at its 3' end at least 3 nucleotides having exact complementarity to the template sequence. A substantially complementary primer preferably contains at least 8 nucleotides, more preferably at least 18 nucleotides, and still more preferably at least 24 nucleotides, at its 3 ' end having the aforementioned complementarity. Still more preferred are primers whose entire nucleotide sequence has exact complementarity with the template sequence.
The choice of a primer's nucleotide sequence depends on factors such as the distance from the region coding for the desired specific nucleic acid sequence present in a nucleic acid of interest and its hybridization site on the nucleic acid relative to any second primer to be used.
The primer is preferably provided in single-stranded form for maximum efficiency, but may alternatively be double-stranded. If double-stranded, the primer is first treated to separate its strands before being used to prepare extension products. preferably, the primer is a oligodeoxyribonucleotide.
Primers can be prepared by a variety of methods including de novo chemical synthesis and derivation of nucleic acid fragments from native nucleic acid sequences existing as genes, or parts of genes, in a genome, plasmid, or other vector, such as by restriction endonuclease digest of larger double-stranded nucleic acids and strand separation or by enzymatic synthesis using a nucleic acid template.
De novo chemical synthesis of a primer can be conducted using any suitable method, such as, for example, the phosphotriester or phosphodiester methods. See Narang et al., Meth. Enzymol., 68:90 (1979); U.S. Pat. No. 4,356,270; Itakura et al., Ann. Rev. Biochem., 53:323-56 (1989); and Brown et al., Meth. Enzymol., 68:109 (1979).
Derivation of a primer from nucleic acids involves the cloning of a nucleic acid into an appropriate host by means of a cloning vector, replication of the vector and therefore multiplication of the amount of the cloned nucleic acid, and then the isolation of subfragments of the cloned nucleic acids. For a description of subcloning nucleic acid fragments, see Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, pp 390-401 (1982); and see U.S. Pat. Nos. 4,416,988 and No. 4,403,036.
The primed template is used to produce a strand of nucleic acid having a nucleotide sequence complementary to the template, i.e., a template-complement.
The template is subjected to a first primer extension reaction by treating (contacting) the template with a (first) primer. The primer is capable of initiating a primer extension reaction by non-randomly hybridizing to a template nucleotide sequence, preferably at least. about 8 nucleotides in length and more preferably at least about 20 nucleotide in length. This is accomplished by mixing an effective amount of the primer with the template and an effective amount of nucleic acid synthesis inducing agent to form a primer extension reaction admixture. The admixture is maintained under polynucleotide synthesizing conditions for a time period, which is typically predetermined, sufficient for the formation of a primer extension reaction product.
The primer extension reaction is performed using any suitable method. Generally polynucleotide synthesizing conditions are those wherein the reaction occurs in a buffered aqueous solution, preferably at a pH of 7-9, most preferably about 8. Preferably, a molar excess (for genomic nucleic acid, usually about 10 6 :1 primer:template) of the primer is admixed to the buffer containing the template strand. A large molar excess is preferred to improve the efficiency of the process. For polynucleotide primers of about 20 to 25 nucleotides in length, a typical ratio is in the range of 50 ng to 1 ug, preferably 250 ng, of primer per 100 ng to 500 ng of mammalian genomic DNA.
The deoxyribonucleotide triphosphates (dNTPs) DATP, dCTP, dGTP, and dTTP are also admixed to the primer extension reaction admixture in amounts adequate to support the synthesis of primer extension products, and depends on the size and number of products to be synthesized. The resulting solution is heated to about 90° C.-100° C. for about 1 to 10 minutes, preferably from 1 to 4 minutes. After this heating period the solution is allowed to cool to room temperature, which is preferable for primer hybridization. To the cooled mixture is added an appropriate agent for inducing or catalyzing the primer extension reaction, and the reaction is allowed to occur under conditions known in the art. The synthesis reaction may occur at from room temperature up to a temperature above which the inducing agent no longer functions efficiently. For example, if DNA polymerase is used as inducing agent, the temperature is generally no greater than about 40° C. unless the polymerase is heat-stable.
The inducing agent may be any compound or system which will function to accomplish the synthesis of primer extension products, including enzymes. Suitable enzymes for this purpose include, for example, E. coli. DNA polymerase I, Klenow fragment of E. coli DNA polymerase I, T4 DNA polymerase, T7 DNA polymerase, recombinant modified T7 DNA polymerase described by Tabor et al., U.S. Pat. Nos. 4,942,130 and 4,946,786, other available DNA polymerases, reverse transcriptase, and other enzymes, including heat-stable enzymes, which will facilitate combination of the nucleotides in the proper manner to form the primer extension products which are complementary to each nucleic acid strand.
Heat-stable DNA polymerases are particularly preferred as they are stable in a most preferred embodiment in which PCR is conducted in a single solution in which the temperature is cycled. Representative heat-stable polymerases are the DNA polymerases isolated from Bacillus stearothermophilus (Bio-Rad), Thermus thermophilous (FINZYME, ATCC #27634), Thermus species (ATCC #31674), Thermus aquaticus strain TV 11518 (ATCC #25105), Sulfolobus acidocaldarius, described by Bukhrashuili et al, Biochem. Biophys. Acta. 1008: 102-7 (1909) and by Elie et al, Biochem. Biophys. Actz, 951:261-7 (1988), and Thermus filiformis (ATCC #43280). Particularly preferred is Taq DNA polymerase available from a variety of sources including Perkin-Elmer-Cetus, (Norwalk, Conn.), Promega (Madison, Wis.) and Stratagene (La Jolla, Calif.), and AmpliTaq™ DNA polymerase, a recombinant Thermus aquaticus Taq DNA polymerase available from Perkin-Elmer-Cetus and described in U.S. Pat. No. 4,889,818.
Generally, the synthesis will be initiated at the 3' end of each primer and proceed in the 5' direction along the template strand, until synthesis terminates, producing molecules of different lengths. There may be inducing agents, however, which initiate synthesis at the 5' end and proceed in the above direction, using the same process as described above.
The primer extension reaction product is then be subjected to a second primer extension reaction by treating it with a second polynucleotide primer having a preselected nucleotide sequence. The second primer is capable of initiating the second reaction by hybridizing to a nucleotide sequence, preferably at least about 8 nucleotides in length and more preferably at least about 20 nucleotides in length, found in the first product. This is accomplished by mixing the second primer, preferably a predetermined amount thereof, with the first reaction product, preferably a predetermined amount thereof, to form a second primer extension reaction admixture. The admixture is maintained under polynucleotide synthesizing conditions for a time period, which is typically predetermined, sufficient for the formation of a second primer extension reaction product.
In preferred strategies, the first and second primer extension reactions are the first and second primer extension reactions in a polymerase chain reaction (PCR).
PCR is carried out by simultaneously cycling, i.e., performing in one admixture, the above described first and second primer extension reactions, each cycle comprising polynucleotide synthesis followed by separation of the double-stranded polynucleotides formed.
PCR is preferably performed using a distinguishable variation of the standard protocol as described in U.S. Pat. Nos. 4,683,195 and No. 4,683,202 to Mullis et al., and No. 4,889,818 to Gelfand et al., and in the Innis & Gelfand reference described above, employing only one primer. The principles of the PCR process have been described under "Background of the Invention," supra. Typically, the DNA polymerase used in AP-PCR is the thermostable DNA polymerase purified from Thermus aquaticus and known as Taq I. However, other DNA polymerases can be used.
A PCR thermocycle is the changing of a PCR admixture from a first temperature to another temperature and then back. to the first temperature. That is, it is cycling the temperature of the PCR admixture within (up and down through) a range of temperatures. Typically, the change in temperature is not linear with time, but contains periods of slow or no temperature change and periods of rapid temperature change, the former corresponding to, depending on the temperature, a hybridization (annealing), primer extension or denaturation phase, and the later to temperature transition phases. Thus, PCR amplification is performed by repeatedly subjecting the PCR admixture to a PCR temperature gradient where the gradient includes temperatures where the hybridization, primer extension and denaturation reactions occur. Preferred PCR temperature gradients are from about 35° C. to about 94° C., from about 40° C. to about 94° C., and from about 48° C. to about 94° C.
In one embodiment, at least one initial cycle of PCR is performed, starting with the arbitrary primer and the genomic nucleic acids to be amplified. Using Taq I polymerase, the initial cycle(s) of PCR are performed under "low stringency annealing conditions". The term "stringency" refers to the degree of mismatch tolerated during hybridization of the primer and template; the higher the stringency, the less mismatch is tolerated. Preferably, one to five cycles of amplification are performed under these conditions. These cycles are generally performed so as to have the following phases: 94° C. for 5 minutes to denature, 5 minutes at the low stringency annealing temperature, and 72° C. for 5 minutes for extension. More preferably, one to four or one to three low stringency amplification cycles are performed. Most preferred, are one or two low stringency amplification cycles. The low stringency annealing temperature can be from about 30° C. to about 55° C., preferably from about 35° C. to about 55° C., and more preferably from about 40° C. to about 48° C. If mixtures of primers that have considerable sequence degeneracy are used, higher temperatures for annealing in the initial cycle(s) can be tolerated, presumably because some of the sequences in the mixtures inevitably anneal quite well to any complex genome and efficiently generate amplification products.
Subsequently, in a second step, at least about 10, preferably about 10 to 40, cycles. of PCR are performed under high stringency conditions. With Taq I polymerase, these cycles are generally performed so as to have the following phases: 94° C. for 1 minute for denaturation, the high stringency annealing temperature for 1 minute, and 72° C. for 2 minutes for extension. (See Example 2, infra.) Alternatively, other thermostable DNA polymerases can be used, in which case the denaturation, high stringency annealing, and extension temperatures are adjusted according to the thermostability of the particular DNA polymerase. The high stringency annealing temperature is about the melting temperature of the double-stranded DNA formed by annealing, about 35° C. to about 65° C., generally greater than about 55° C., and preferably about 60° C. Preferably, the annealing temperature in the second step is greater than the annealing temperature in the first step. The annealing temperature in the second step is lower for shorter primers, because the melting temperature of short double-stranded helices is decreased. Conversely, it is higher for longer primers.
The reaction is performed in a buffer optimized for activity of the particular thermostable DNA polymerase employed. A number of thermostable DNA polymerases have been isolated. See U.S. Pat. No. 4,889,818 describing the thermostable DNA polymerase of Thermus aquaticus. In addition, the thermostable DNA polymerases present in any of the thermophilic bacteria is well known and described in U.S. Pat. No. 4,889,818.
The particular AP-PCR conditions employed will depend upon the particular thermostable DNA polymerase used for the amplification reaction and are typically optimized for that particular thermostable DNA polymerase. Effective amounts of the primer(s) and target nucleic acid are admixed in an aqueous PCR buffer that includes an effective amount of an inducing agent, an effective amount of each dNTP. For Taq DNA polymerase, the buffer typically contains an effective amount of Taq, 50 mM KCl, 10 mM Tris-HCl, pH 8.4, 4 mM MgCl 2 , and 100 μg/ml gelatin. Each deoxyribonucleotide triphosphate (i.e., A, T, G and C) is typically present at about 0.2 mM concentration when Taq DNA polymerase is used.
The extent to which any particular sequence can be amplified by AP-PCR depends on three general factors: (1) the frequency of priming at flanking sites; (2) the ability of the DNA polymerase used, typically Taq polymerase from Thermus aquaticus, to extend the template completely; and (3) the total number of productive cycles.
E. Comparison of the DNA Amplification Products With Those Produced From Known Genomes
If the object of the performance of the AP-PCR method is to identify the genome from which the discrete products were produced, the DNA amplification products obtained from a sample are compared with the amplification products resulting from the performance of AP-PCR on nucleic acids isolated from known genera, species, subspecies and/or strains using the same primer or mixture of primers, in separate reactions.
The samples selected for comparison depend on the expected identification of the test organism of unknown genome. In many clinical situations, identification of an organism of an unknown bacterial genome can be narrowed down by means of the site of infection or other clinical factors. For example, the presence of a wound infection may suggest that the test organism is a member of the genus Staphylococcus. If the unknown organism might be Staphylococcus, various species of Staphylococcus, such as S. haemolyticus, S. hominis, S. aureus, S. warneri and S. cohnii, are used; multiple strains can be used for each species. Similarly, if the unknown organism might be a strain of Streptococcus, the samples selected for comparison are various identified strains of Streptococcus. If the unknown organism is a bacterium of enteric origin, various strains of Escherichia, Klebsiella, Enterobacter, Serratia, Salmonella, Shigella, Proteus and Providencia are used.
Because the most substantial differences in the AP-PCR amplification products from different bacterial isolates represent differences between species, AP-PCR can be used effectively to reveal a prior misassignment of a strain. Strains that have been assigned to the wrong species are very rapidly uncovered by the AP-PCR method. Typically, when AP-PCR is used to verify the assignment of a bacterial isolate to a species, the primer is chosen to maximize interspecific difference of the discrete DNA amplification products generated by AP-PCR. Primers for this application typically exclude regions substantially complementary to regions of DNA highly conserved between the species being studied.
The comparison between the AP-PCR products of the organism of unknown genome and those produced from known genomes is typically performed by separating the discrete DNA amplification products in an apparatus containing a medium capable of separating DNA fragments by size in order to produce a "fingerprint" of the amplification products as separated bands, and then comparing the fingerprint patterns. The fingerprint patterns are diagnostic of the genus, species, and/or strain to which the test organism of unknown genome belongs. Generally, such separation is carried out by electrophoresis, for example, using gel electrophoresis on agarose or polyacrylamide gels to display the resulting DNA products for visual examination. Many protocols for electrophoresis are known in the art; see U.S. Pat. No. 4,729,947 and B. Perbal, "A Practical Guide to Molecular Cloning," Ch. 9, "Separation of DNA Fragments by Electrophoresis," pp. 340-362, (2d ed., John Wiley & Sons, New York (1988)), incorporated herein by this reference.
One such representative technique is electrophoresis through 5% polyacrylamide containing 50% urea. The concentration of acrylamide is varied according to the size of the products to be resolved. Commercially available size markers typically derived from the digestion of a plasmid or phage of known sequence with a restriction enzyme are added to the gel.
The individual bands present in the fingerprint are detected by various techniques, such as ethidium bromide staining. At least one of the deoxyribonucleotide triphosphate monomers used in the second stage of the reaction can be radioactive, allowing detection of the bands of the fingerprint by autoradiography, or the primer itself can be radioactively labeled by treatment with an appropriate kinase. Alternatively, fluorescent nucleotides can be incorporated and detection carried out by means of fluorescence.
F. Further Manipulation of Fragments Produced bv AP-PCR
Isolated separated fragments can be cleaved with a restriction endonuclease capable of generating polymorphisms, such as TaqI or MspI. Separated fragments produced by AP-PCR and resolved on gels can also be isolated from the gel and reamplified in a conventional PCR procedure to increase the quantity of the isolated band. Isolated fragments can, if desired, be cloned in a bacterial host, typically a strain of Escherichia coli, capable of preserving the integrity of any genetically unstable DNA structures such as long, direct and inverted repeats. Such cloned bands then can be sequenced by well-known, conventional techniques, such as the Sanger dideoxynucleotide sequencing technique or the Maxam-Gilbert chemical cleavage sequencing technique.
For many procedures, such as the preparation of DNA probes, it is not necessary either to clone or recut the DNA fragments amplified by AP-PCR and isolated from the gel. Such fragments can be used as probes after further amplification by conventional PCR during which radioactive nucleotides are incorporated in the amplified fragments.
II. APPLICATION TO IDENTIFICATION OF STAPHYLOCOCCUS SPECIES
One significant application of the general method of the present invention is the identification of the species to which an isolate of Staphylococcus belongs. Staphylococcus is a human pathogen and frequently responsible for serious infections occurring in surgical patients. Accordingly, rapid identification of Staphylococcus species is particularly important in a clinical setting.
In the identification of Staphylococcus species by AP-PCR, the discrete DNA amplification products produced from the sample of DNA from the test organism are compared with the DNA amplification products produced. from known Staphylococcus species when the same primer is used. We have found between three and twenty products predominate in the AP-PCR products obtained from Staphylococcus genomes. These products are species-specific and can be used to distinguish between S. haemolyticus, S. hominis, S. aureus, S. warneri and S. cohnii. In some cases, subspecies and/or strains of these species are also distinguished. (See Example 6, infra).
III. APPLICATION TO IDENTIFICATION OF STREPTOCOCCUS STRAINS
In a similar manner, AP-PCR can be used to identify particular strains of Streptococcus. In the identification of Streptococcus strains by AP-PCR, the discrete DNA amplification products produced from the test organism of unknown strain are compared with the DNA amplification products produced from DNA of known Streptococcus strains when the same primer is used. Streptococcus is also an important human pathogen, causing potentially severe infections of the skin and mucous membranes, and its rapid identification is clinically important.
As shown below in Example 7, AP-PCR performed on a number of strains of Streptococcus reveals a fingerprint of amplified bands with some species-specific features, as well as some isolate-specific differences. One can clearly group almost all members of a species based on common bands and group subsets of strains within species based on shared bands that are not present in other strains.
IV. APPLICATION OF AP-PCR TO GENETICS OF EUKARYOTES
The DNA sequences that represent polymorphisms differing from individual to individual of a species obtained from application of the AP-PCR method of the invention are useful in genetic mapping of eukaryotes, including plants such as maize and soybeans, animals, and humans. In particular, AP-PCR can be used to reveal polymorphisms based on the AP-PCR fingerprint. Such polymorphisms are particularly useful for genetic mapping. The polymorphisms generated can be correlated with other markers such as restriction fragment length polymorphisms (RFLPs), which in turn have been linked to genetic markers of known function. A RFLP is a detectable difference in the cleavage pattern of DNA from different individuals of a particular species when that DNA is cleaved with a particular restriction endonuclease. Such differences arises when a mutation affects the sequence cut by the enzyme, removing a site previously present or adding a new site.
AP-PCR can be used to track genetic differences in rice, with a 600-megabase haploid genome (Example 8) and in maize, with a. 3000-megabase haploid genome (Example 9). Maize has a genomic complexity comparable to that of the human genome. Similar results are expected with soybeans.
The heterozygosity of the maize genome has been estimated to be about 0.05. Each primer used in the AP-PCR method can probably detect more than one polymorphism between strains at that level of heterozygosity.
Such approaches should allow determination of the linkage distance between polymorphisms and various phenotypes. Phenotypes can be scored in a number of ways, including morphological features and molecular features, such as electrophoretic mobility on proteins and variations in intensity of proteins on two-dimensional gels (Higginbotham et al., "The Genetic Characterization of Inbred Lines of Maize (Zea mays L.) Using Two Dimensional Protein Profiles," Symposium, 1990). It is interesting to note that when protein abundance or state of modification is followed as a phenotype, linkage is to the genetic element that causes that variation and often not to the protein being observed. Such genetic element can be a regulator or other control element, or a gene for a modifying enzyme. It is possible, however, to link many protein electrophoretic mobility variants to the AP-PCR map.
A polymorphism can be correlated with a phenotypic character through repeated backcrossing. This introgression method simplifies the background. Comparing the backcrosses with the parents detects polymorphisms linked to the gene of interest.
Another application of the AP-PCR method is in creating a physical AP-PCR map by correlating the recombination frequencies between AP-PCR fragments. By choosing the crosses used in the development of the physical map judiciously, the AP-PCR map will automatically orient itself with respect to the genetic map. Such physical linkage can be studies by pulsed field electrophoresis (PFE). By applying restriction endonucleases making rare cuts, PFE, and Southern blotting to maize or soybean DNA and probing with genetically linked AP-PCR probes, the size of the physical region for large fragments of chromosomes isolated by PFE can be compared with the rate of recombination. Analogous techniques can be employed for mapping the mouse or human genome. This is of interest because recombination is not equal throughout the genome. The AP-PCR method is particularly suitable for this purpose because a great many markers can, in principle, be identified for an area of interest.
The number of individual progeny from crosses that can be inspected and the amount of polymorphism in each marker determines the accuracy with which markers can be mapped. The segregation of polymorphisms revealed by the AP-PCR method in the context of the RFLPs that are already mapped improves the ability to measure genetic distance between them. Computer programs are available for genetic linkage analysis including LIPED (Ott, Amer. J. Human Genet. 28:528:529 (1976) for two point linkage analysis, ILINK and CILINK from the LINKAGE package (Lathrop et al., Proc. Natl. Acad. Sci. USA, 81:3443-3446 (1984); Lathrop et al., Amer. J. Human Genet. 37:482-498 (1985)), GMS. (Lathrop et al., Genomics 2:157-164 (1988)), and MAPMAKER (Lander et al., Genomics 1:174-181 (1987)) for multipoint analysis. Additionally, quantitation of the bands allows distinction between homozygotes and heterozygotes for a particular band in the AP-PCR fingerprint.
The use of such linkage analysis techniques allows determination of linkage distance between the polymorphisms and various phenotypes. RFLPs that have been linked to interesting genetic markers can be correlated with the AP-PCR map. For example, tightly linked flanking RFLP markers have been found for the Mdm1 gene on chromosome 6S in maize. This gene is involved in resistance to Maize Dwarf Mosaic Virus (MDMV) (McMullen & Louie, Mol. Plant-Microbe Interactions 2, 309 (1989)). Similarly, a RFLP marker less than 1 centiMorgan (cM) from the Htl1 gene, which confers resistance to the fungal pathogen Helminthosporum turcicum, has been found (Bentolila et al., Symposium, 1990).
Another approach to mapping makes use of the fact that RFLPs themselves can be generated from AP-PCR fingerprints. For instance, TaqI restriction endonuclease, which recognizes the site TCGA, will cleave AP-PCR products in which there is at least one TaqI site. If a TaqI site is present in one of the AP-PCR fingerprint products in some individuals but not in others, there will be a difference in the fingerprint of TaqI digested DNA from these individuals. This allows the detection of TaqI RFLPs from AP-PCR patterns. Such TaqI RFLPs are among the most common RFLPs known in the genome because the TaqI recognition site contains the hypermutable dinucleotide CpG. Similarly, MspI digests, cut at the recognition site of CCGG, can be used to detect the relatively abundant MspI polymorphisms. Such RFLPs can be either mapped directly in families by genetic mapping or cut out of gels and amplified with radioactively labeled deoxyribonucleoside triphosphates, such as α-labeled triphosphates, in conventional PCR to use them to probe Southern blots of the appropriately cleaved human DNAs. To ensure purity, the extracted fragments can be recut with the same enzyme following extraction. Alternatively, the bands isolated from AP-PCR fingerprints can be cloned and sequenced. Preferably, such bands should be cloned in Sure E. coli (Stratagene Cloning Systems, San Diego, Calif.) to preserve the integrity of terminal repeats.
One type of polymorphism that is expected to be revealed by the AP-PCR method is the variable number tandem repeats (VNTRs). VNTRs have been shown to be associated with highly repetitive regions in the genome, including minisatellite repeats such as the dispersed simple repeat (GT:CA) n (Litt & Luty, Am. J. Hum. Genet. 44, 397-401 (1989)) and VNTR repeats of 9 to 40 bases (Jeffreys et al., supra). The dispersed simple repeat (GT:CA) n should be primed by primers with TGTGTG (SEQ ID NO: 8) at the 3'-end. The repeats of 9 to 40 bases may have the sequences GGGCAGGAXG (SEQ ID NO: 12) or GXXXXTGGG (SEQ ID NO 13). Primers containing these sequences at the 3'-end should prime these repeats of 9 to 40 bases. These primers are "arbitrary" in the sense that the location of the particular repetitive sequence in the genome need not be known, nor must the primer have a perfect match with any particular occurrences of the repeat in the genome.
Yet another source for the generation of polymorphisms by the AP-PCR method is associated with the sequence CpG. This dinucleotide is more polymorphic than other dinucleotides in certain animal and plant genomes, because it is a target for methylation. Primers with CpG located near the 3'-end are expected to be effective in generating polymorphisms because of this variability. In particular, a primer with a sequence of ACGCGAC at the 3'-end that combines a RY repeat, similar to the GT repeat, with two CG dinucleotides, is expected to be an effective generator of polymorphisms when used as a primer in AP-PCR. Similarly, primers with alternating purine and pyrimidine residues near their 3'-ends are also expected to be effective in generating polymorphisms.
These techniques can also be employed to analyze animal genomes, including the genomes of mice, as well as the human genome. They are particularly useful for filling in the genetic map by linking known markers more precisely. An example of the detection by AP-PCR of polymorphisms resulting from the crossing of inbred mouse strains is shown in Example 11.
The AP-PCR method of the invention permits genetic mapping of DNA polymorphisms in mammals without having to first identify RFLP probes. Each polymorphic band in the fingerprint produced by the method represents a heritable characteristic. No clones must be made or plasmids purified. Polymorphisms can be generated by almost any primer selected. The technique requires less than 1/100 of the amount of genomic DNA per lane compared to that needed to prepare a Southern blot for conventional RFLP analysis. The method can use ethidium detection, fluorescent detection or only small amounts of labeled bases relative to Southern hybridization. Moreover, AP-PCR generated DNA polymorphisms can be isolated directly from gels and reamplified to use as probes in "genome walking" or restriction mapping strategies without cloning. Sequencing of some of these polymorphisms will also not require cloning.
One approach for using the AP-PCR method in human genetics can produce products assignable to the human fragment in a somatic cell hybrid. As long as the recipient is the same for a set of hybrids, the products that will be different from a non-hybrid control AP-PCR will be the human fragments. Such bands would assign the human fragment on the genetic map if the band was already genetically assigned. Also, such bands can be isolated from the gel and used to make a DNA probe. An example of the AP-PCR method using somatic cell hybrids is shown in Example 10.
In order that the invention described herein may be more fully understood, the following examples are set forth. It should be understood that the following examples are for illustrative purposes only and are not to be construed as limiting the invention.
Strains of Staphylococcus listed in Table 1 were grown overnight at 37° C. in 2-5 ml of brain heart infusion media. The cells were pelleted, resuspended in 0.2 ml of TE (0.01 M Tris-HCl, pH 8.0, 1 mM EDTA) with 0.2 mg/ml lysostaphin and incubated at 37° C. for one hour. Following this incubation, 0.2 ml proteinase K solution (containing 0.5 mg/ml proteinase K, 1% Sarkosyl, 200 mM EDTA, and 1 mM calcium chloride) was added to each sample. The samples were then digested at 50° C. for one hour. The clear lysates were extracted with phenol and then chloroform; the DNA was then precipitated with ethanol. The precipitated DNA was dissolved in TE, and its final concentration was estimated by agarose gel electrophoresis and ethidium bromide staining.
| TABLE 1 |
| ______________________________________ |
| STAPHYLOCOCCUS STRAINS Species Strain Designation Origin |
| ______________________________________ |
| S. haemolyticus AW 263 Human ATCC 29970 Human PAY 9F2 Chimpanzee MID 563 Mouse lemur CC 12J2 Mangabey S. hominis ATCC 27844 Human ATCC 27846 Human S. aureus ISP 8 Human ATCC 8432 Bird ATCC 15564 Human ATCC 6538 Human Sau 3A Human ATCC 12600 Human S. warneri GAD 473H Bush-baby MCY 3E6 Rhesus monkey CPB 10E2 Cercopithecus LED 355 Lemur PBNZP 4D3 Langur S. cohnii JL 143 Human LED 3104 Lemur CM 89 Human SS 521 Squirrel monkey |
| ______________________________________ |
Strains designated as ATCC are deposited with the American Type Culture Collection. Other abbreviations are arbitrary designations for laboratory strains.
Reactions, with a volume of 10 μL, were prepared containing 1×Taq polymerase buffer (Stratagene Cloning Systems, San Diego) adjusted to 4 mM with MgCl 2 , 0.2 mM of each deoxyribonucleotide triphosphate, 10 μM Kpn-R primer, and DNA at various quantities from 7.5 ng to 0.12 pg as indicated. The reactions were overlaid with oil and cycled through the following temperature profile: 94° C. for five minutes for denaturation, 40° C. for five minutes for low stringency annealing and 72° C. for five minutes for extension. This temperature profile was followed for two cycles. Then 10 high stringency cycles were performed with the following temperature profile: 94° C. at one minute, 60° C. for one minute, and 72° C. for ten minutes. At this point, 90 μL of a solution containing 1×Taq polymerase buffer, 0.2 mM of each deoxyribonucleoside triphosphate, and 50 μCi α- 32 P! dCTP was added and 30 additional high stringency cycles were performed. This protocol was designed to provide high primer concentration during the low stringency steps to maximize the priming efficiency during the initial cycles of PCR, before the sequences had been greatly amplified.
AP-PCR was performed as in Example 2, above, using 1 ng of DNA from S. aureus ISP 8 DNA, except that the temperature for low stringency annealing in the first two PCR cycles was varied. The results are shown in FIG. 1. Lane 1 of FIG. 1 was performed at 60° C., typical for conventional PCR; Lane 2, 36° C.; Lane 3, 40° C.; Lane 4, 44° C.; Lane 5, 48° C.; and Lane 6, 52° C. Lane M is Hind III-digested bacteriophage DNA.
As shown in FIG. 1, the pattern of bands changes only slightly as the temperature is raised, until, at some point, the temperature is too high for efficient annealing by the arbitrarily chosen primer. These results indicate that AP-PCR can use a relatively broad range of temperatures for low stringency annealing.
AP-PCR was performed as in Example 2, above, using DNA from S. aureus strain ISP 8, except that the concentration of DNA used as template was varied. Each series of five different concentrations was from three independent. dilutions.
Template concentrations used were 7500 pg, 1900 pg, 470 pg, 120 pg, 30 pg, 7.5 pg, 1.9 pg, 0.48 pg and 0.12 pg. The pattern generated by AP-PCR using a 34-base primer (Kpn-R) is very consistent for template concentrations between 7.5 ng and 10 pg. Below 10 pg the production of discrete fragments is more sporadic, but the products produced are almost all represented at higher concentrations. For a genome of 3×10 6 bp, 10 pg of template DNA is equivalent to 3000 complete molecules.
One interpretation of this data is that even the best priming events are quite inefficient and at this low template concentration each AP-PCR event has about a 1 in 55 (square root of 3000) probability of initiating during each of the two low temperature cycles. Thus, at a template concentration of 3000 molecules of DNA, each possible AP-PCR event is likely to initiate. However, at lower template concentrations, such calculations suggest that some potential initiations are missed, so that, for maximum coverage of the genome, it is desirable to use at least a quantity of DNA corresponding to 3000 complete Staphylococcus genomes.
We compared the pattern of AP-PCR products from six S. aureus strains, using varying quantities of template DNA. The strains were fingerprinted by AP-PCR using the standard protocol of Example 2 except that five different quantities of template were used: 7.5 ng, 1.9 ng, 470 pg, 120 pg and 30 pg of DNA per reaction. The strains used were strains ISP-8 (A), ATCC 8432 (B), ATCC 15564 (C), ATCC 6538 (D), Sau 3A (E), and ATCC 12600 (F). The resulting amplified material was resolved by electrophoresis through a 5% polyacrylamide gel containing 50% urea.
The results are shown in FIG. 2. Size markers shown in FIG. 3 are the 1-kb ladder from BRL/Gibco (Gaithersburg, Md.). Over this range of DNA concentration, the patterns are highly reproducible and also very similar between strains. The differences between strains is diagnostic of similar strains in their relationships. Primers of similar size but different sequence gave a different pattern, but similar intra-specific variations. These results show that AP-PCR can identify and categorize bacterial strains.
Fingerprints of 17 isolates representing four different species of Staphylococcus were obtained by AP-PCR. The protocol of Example 2 was used with 16 ng of template DNA per reaction. The species and strains fingerprinted were: (1) S. haemolyticus, strains CC 12J2 (lane 1), PAY 9F2 (lane 2), AW 263 (lane 3), MID 563 (lane 4), and ATCC 29970 (lane 5); (2) S. warneri, strains CPB 10E2 (lane 6), GAD 473 (lane 7), MCY 3E6 (lane 8), PBNZP 4D3 (lane 9), and LED 355 (lane 10); (3) S. hominis, strains ATCC 27844 (lane 11), ATCC 27846 (lane 12), and Ful (lane 13); (4) S. cohnii, strains JL 143 (lane 14), CM 89 (lane 15), and SS 521 (lane 16); and (5) S. aureus, strains ISP-8 (lane 17), ATCC 8432 (lane 18), ATCC 15564 (lane 19), ATCC 6538 (lane 20), Sau 3A (lane 21), and ATCC 12600 (lane 22). (The lane designations refer to the gel shown in FIG. 3.) The resulting amplified material was resolved by electrophoresis through 5% polyacrylamide containing 50% urea; size markers were as in Examples 4 and 5.
The results are shown in FIG. 3. In general, there is a species-specific pattern of AP-PCR products, observed, for example, in amplification of DNA from S. warneri strains. A further interesting observation is that the haemolvticus group of species yield two distinct patterns. These patterns share only one AP-PCR product but have at least three prominent products that are not shared. The differences in products were dramatic and are presumably the result of a considerable difference in DNA sequence between these strains. The most likely possibility is that S. haemolyticus has two distinct "subspecies." It is interesting to note that one "subspecies" AP-PCR pattern is produced by haemolyticus strains AW 263, ATCC 29970, and PAY 9F2, strains that live on higher primates such as humans and chimpanzees, while the other strains of haemolyticus with the other AP-PCR pattern, MID 563 and CC 12J2, are from lower primates such as mangabey and lemur. Similarly, the three S. cohnii strains were quite divergent, but recognizably related.
The AP-PCR products are species or subspecies specific and are not preserved even between relatively closely related species, such as the haemolyticus-warneri-hominis group. A few AP-PCR products may be shared between species. For instance, the product of about 400 base pairs in S. warneri may be the same as a product seen in the haemolyticus strains PAY 9F2, AW 263, and ATCC 29970, although coincident migration of fragments of different sequence might explain these results.
Twelve strains of Streptococcus were fingerprinted by AP-PCR with the standard protocol, as used in Example 6, with M13 reverse sequencing primer as the arbitrarily chosen primer and two different amounts of template: 18.8 and 4.7 ng per reaction. The resulting amplified material was resolved by electrophoresis through 5% polyacrylamide gels containing 50% urea. Size markers were the same as those used in Examples 4-6.
The results are shown in FIG. 4. The strains shown are as follows: Group 1, D471; Group 2, TI/195/2; Group 3, 40 RS 1; Group 4, 2 RS 15; Group 5, 47 RS 15; Group 6, 55 RS 15; Group 7, 1/E9; Group 8, T28/51/4; Group 9, K58 Hg; Group 10; SM6; Group 11, OGI X; and Group 12, UAB 092. Each group consists of two lanes in the gel; in the first lane, 18.8 ng of DNA was used, while in the second lane, 4.7 ng of DNA was used.
The results show that subsets of strains within species can be grouped, based on shared bands. Further work with AP-PCR on Streptococcus, with the M13 reverse sequencing primer and a second primer, Kpn-R, resulted in a dendrogram developed by a distance matrix method to show the relationships of the strains. This dendrogram, which depicts the relative genetic distance of the Streptococcus strains tested, is shown as FIG. 5.
Three independent inbred strains of rice, designated Gl, G2, and G3, were fingerprinted using the standard AP-PCR protocol as used in Examples 5, 6, and 7, with M13 reverse sequencing primer, at four concentrations of template DNA: 51 ng, 12 ng, 3 ng, and 0.8 ng per reaction.
The results are shown in FIG. 6. The three strains, G1, G2, and G3, are shown left to right on the gel. These three strains can be distinguished from each other. In particular, several polymorphisms (bands that differ from one strain to another) are visible. These polymorphisms are marked with arrows in FIG. 7.
These results demonstrate that plant varieties can be identified and categorized by the AP-PCR method.
AP-PCR fragments were obtained from several inbred strains of maize and from the F1 progeny of these strains. DNA from these strains was subjected to AP-PCR using the standard protocol, as used in Examples 5, 6, and 7, with three different quantities of template DNA: 64 ng, 16 ng, and 4 ng per reaction, using the modified M13 reverse sequencing primer with an extra G residue at its 3'-end.
On the gel, Groups 1-6 represent individual inbred strains, while Groups 7-9 represent the F1 generation from crosses of such individual inbred strains. The individual strains are as follows: Group 1, B73; Group 2, Mo17; Group 3, DE811; Group 4, Oh43; Group 5, FR16; Group 6, H99. The crosses are as follows: Group 7, B73×Mo17; Group 8, B73×De811; Group 9, B73×Oh43. The parents of the progeny from crosses can be ascertained by comparison of the polymorphisms indicated by dots. These results show that AP-PCR can distinguish strains of maize and that the patterns are heritable.
AP-PCR was performed on human DNA and DNA from somatic cell hybrids between human cells and mouse or Chinese hamster cells. AP-PCR was performed according to the standard protocol with a 20-base primer. In some cases, as shown in FIG. 7, 127, 32, and 8 ng of DNA were used per reaction; in other cases, only 32 ng of DNA was used.
The results are shown in FIGS. 7. FIG. 7 shows the results when human DNA from: Group 1, Black female; Group 2, Caucasian female; Group 3; Black male; and Group 4; Caucasian male was used at three different DNA concentrations. Several polymorphisms are indicated; also indicated are possible sex-linked differences. Additional experients were performed in which 32 ng of template DNA from one Black female, five Caucasian females, five Black males, and five Caucasian males. Several polymorphisms are indicated. The last two lanes are AP-PCR of DNA from somatic cell hybrids, one mouse hybrid with human chromosome 21 and one CHO hybrid with human chromosome 11.
These data show that some AP-PCR products will be from the human genome and that these products can be mapped to a particular human chromosome.
AP-PCR can be used to detect polymorphisms in mouse inbred lines. Most primers gave at least one polymorphism between most strains. Recombinant inbred lines of C57BL/6J×DBA/2J were obtained from Jackson Laboratories. AP-PCR was performed on genomic DNA from the parental strains, the Fl generation, and 26 recombinant inbred strains, using the standard protocol of Example 3 above, with the primer Kpn-R and 40° C. initial low stringency steps. The resulting products were resolved by electrophoresis in 1×TBE (0.09M Tris-borate, 0.002M EDTA) through a 5% polyacrylamide gel containing 50% urea.
The results are shown in FIG. 8. Each lane consists of two concentrations of template, 50 ng on the right and 25 ng on the left. Lanes V and X are the two parental strains C57BL/6J and DBA/2J; lanes A and W are the F1 generation; and lanes B to U and Y are 21 recombinant inbred strains. Polymorphisms were seen at 360, 310, 235, 185, 175, and 115 bases. The polymorphisms at 185 and 175 bases were mutually exclusive and, thus, a length polymorphism. Four of these polymorphisms were mappable; three scored as the presence or absence of a band, designated K310, K235, and K115, and the length polymorphism designated as K185/175. Polymorphism K310 mapped to chromosome 10, K235 mapped to distal ch2 near Psp, K185/175 mapped to ch10 near CR39, and K115 mapped to distal ch12 near the Ig variable gene cluster. The remaining polymorphism, K360, was not closely linked to previously mapped loci; about 10% of all polymorphisms fall in this class. The polymorphisms are removed from the gel and amplified by PCR. These genetic markers can be used to screen a library of mouse genomic clones or as in situ probes.
The present invention provides a method with several advantages for identification of bacteria and other biological materials. The method is simple to perform and rapid; results can be obtained in as little as 36 hours when the template nucleic acids are isolated by boiling. Only small samples of material, e.g., nanogram amounts, are needed. The method yields information that allows the differentiation of even closely related species and can be extended to differentiate between subspecies or strains of the same species. The method requires no prior knowledge of any biochemical characteristics, including the nucleotide sequence of the target nucleic acids, of the organism to be identified. Initially, it requires the use of no species-specific or sequence-specific reagents, because the primer used is completely arbitrarily chosen. Mismatching between the primer DNA and the target nucleic acids is characteristic of the method and is associated with the use of low stringency hybridization during its initial amplification steps. It is advantageous to be able to initiate amplification in the presence of a substantial degree of mismatching because this widens the variety of primers able to initiate amplification on a particular genome.
Additionally, the method possesses the important advantage of requiring only one primer sequence for amplification. This reduces the number of reagents required and eliminates the possibility of false results caused by primer artifacts resulting from the hybridization of two separate primers.
The AP-PCR method of the invention can be used to provide identification of other types of organisms, including viruses, fungi, mammals and plants. The method also provides an efficient way of generating polymorphisms for use in genetic mapping, especially of eukaryotes, including animals, particularly mice and humans. This method has many applications in mammalian population genetics, pathology, epidemiology and forensics.
Although the present invention has been described in considerable detail with regard to certain preferred versions thereof, other versions are possible. Therefore, the spirit and scope of the appended claims should not be limited to the descriptions of the preferred version contained herein.
| ________________________________________________________ __________________ |
| SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 13 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: GGAAACAGCTATGACCATGA20 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: GTAATACGACTCACTATAG19 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: GCAATTAACCCTCACTAAAG20 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: CCAGCTCGACATGGCACRTGTATACATAYGTAAC34 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: GGGGACTAGTAAAACGACGGCCAGT25 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: GAGAGGAGAAGGAGAGAGAARRRRR25 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: CCGGCATCGATRRRRRRCGACGGCCAG27 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: TGTGTG6 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: ACGCGCAC8 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: TTGTAAAACGAGGCCAGT18 (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: CCGGCATCGATRRRRRRCGACGGGCAG27 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 10 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: misc feature (B) LOCATION: 9..10 (D) OTHER INFORMATION: /note= "Where N = X" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: GGGCAGGANG10 (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: misc feature (B) LOCATION: 2..5 (D) OTHER INFORMATION: /note= "Where N = X" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: GNNNNTGGG9 |
| ________________________________________________________ __________________ |