| 4546769 | Suture thread | October, 1985 | Planck et al. | 128/335.5 |
| 4727028 | Recombinant DNA cloning vectors and the eukaryotic and prokaryotic transformants thereof | February, 1988 | Santerre et al. | 435/240.2 |
| 4818291 | Silk-fibroin and human-fibrinogen adhesive composition | April, 1989 | Iwatsuki et al. | 106/124 |
| 4820418 | Water-alcohol separating membrane and method for separation of water and alcohol by the use thereof | April, 1989 | Hirotsu et al. | 210/640 |
| 4999295 | Biocatalyst entrapped in a silk fibroin membrane | March, 1991 | Asakura et al. | 435/177 |
| 5041497 | Process for preparing co-poly(amides/peptides) | August, 1991 | Bhattacharjee et al. | 525/54.11 |
| 5245012 | Method to achieve solubilization of spider silk proteins | September, 1993 | Lombari et al. | 530/353 |
| EP0294979 | May, 1988 | Improvements in or relating to structural proteins. | ||
| GB2162190 | January, 1986 | |||
| WO/1991/016351 | October, 1991 | RECOMBINANT SPIDER SILK PROTEINS THROUGH GENETIC ENGINEERING |
This application is a divisional of application Ser. No. 08/317,844, filed on Oct. 4, 1994, which is a continuation of application Ser. No. 07/684,819, filed on Apr. 15, 1991, now abandoned, which is a continuation-in-part of application Ser. No. 07/511,792, filed on Apr. 20, 1990, now abandoned, the entire contents of which are hereby incorporated by reference.
a polypeptide having the amino acid sequence of SEQ. ID. NO.:2;
a polypeptide having the amino acid sequence of SEQ. ID. NO.:4;
a polypeptide comprising tandem repeats of the amino acid sequence of SEQ. ID. NO.:5;
a polypeptide comprising tandem repeats of the amino acid sequence of SEQ. ID. NO.:6;
a polypeptide comprising tandem repeats of the amino acid sequence of SEQ. ID. NO.:7;
a polypeptide comprising tandem repeats of the amino acid sequence of SEQ. ID. NO.:12 linked by a peptide bond to the amino terminus of the amino acid sequence of SEQ. ID. NO.:13;
a polypeptide comprising tandem repeats of the amino acid sequence of SEQ. ID. NO.:8 linked by a peptide bond to the amino terminus of the amino acid sequence of SEQ. ID. NO.:12 in turn linked by a peptide bond to the amino acid sequence of SEQ. ID. NO.:9;
a polypeptide comprising tandem repeats of the amino acid sequence of SEQ. ID. NO.:8 linked by a peptide bond to the amino terminus of the amino acid sequence of SEQ. ID. NO.:12 in turn linked by a peptide bond to the amino acid sequence of SEQ. ID. NO.:10.
wherein m is 4 to 10, n is 10 to 20, p is an integer of 1 to 100 and each X, which may be the same or different, is selected from the group consisting of G, A, Q, Y and L, wherein at least 50% of the X's are G, wherein said protein has a molecular weight of at least 16,000 daltons.
wherein;
v is a polypeptide of consensus sequence (A or G or S)GRGGL(A or G)GQ, SEQ. ID. NO.:63;
α is a polypeptide of consensus sequence GAGA(A or S or V) (A)m, where m is 4 to 6, SEQ. ID. NO.:64;
β is a polypeptide of consensus sequence GGAGQ(G or R or E)GY(G or R)GL(G or V) (G or S or N)QG, SEQ. ID. NO.:65.
wherein:
β is a polypeptide of consensus sequence GP(G or R)QQGPG(G or R)Y(G or A) PGQQG(P or L)SG(P or A) GS, SEQ. ID. NO.:66;
α is a polypeptide of consensus sequence A(A or S)AA(A or S)AA(A or S)A, SEQ. ID. NO.:67; and
v is a polypeptide of consensus sequence GPGQQG(P or L)GGY, SEQ. ID. NO.:68.
The present invention relates to the preparation of spider silk protein by recombinant DNA techniques.
Major ampullate (dragline) silk of orb web spiders possesses unique physical properties, combining high tensile strength and substantial elasticity, Denny, M. W. J. Exp. Biol., 65, 483-506 (1976); Lucas, F. Discovery, 25, 20-26 (1964). Previous investigations suggest that spider silk is composed of a single large protein, primarily containing pseudo-crystalline regions of stack β-pleated sheet alternating with amorphous domains, Warwicker, J. O., J.Mol. Biol., 2, 350-362 (1960); Lucase, F. et al, J.Text Inst., 46, T440-T452 (1985); Hepburn, H. R. et al., Insect Biochem., 69-71 (1979). The molecular basis for spider silk elasticity is presently unknown, although it has been suggested that an entropy driven process like that found in rubber is involved, Gosline, J. M., et al., Nature, 309, 551-552 (1984). It has also been speculated that the amorphous regions contribute substantially to the elastic properties of the fiber, Hepburn, H. R., et al., Insect Biochem., 9, 69-77 (1979).
It is an object of the present invention to produce spider silk protein by recombinant DNA techniques.
It is also an object of the present invention to provide, for the first time, a spider silk protein in purified form. Specifically, the inventors have discovered that spider silk protein from Nephila clavipes naturally occurs as a mixture of at least two spider silk proteins. The inventors have cloned portions of the genes for both of these proteins and have named these proteins Silk Protein 1 and Silk Protein 2. Because these two genes have been independently cloned, these two proteins can be independently prepared by recombinant techniques. The silk proteins can then be purified, i.e., separated from contaminating materials in the expression system, to produce purified or homogeneous Silk Protein 1 or purified or homogeneous Silk Protein 2. The spider Silk Protein 1 is therefore free from spider Silk Protein 2 and the spider Silk Protein 2 is free from spider Silk Protein 1. These proteins can be used in a pure form or they can be mixed with each other in order to approximate the properties of natural spider silk. The Silk Protein 1 and Silk Protein 2 can be mixed in an amount of 100:1 to 1:100, preferably 10:1 to 1:2, more preferably 5:1 to 1:1.
The isolated cDNA of the invention preferably codes for spider silk protein containing the sequence shown in FIGS. 6A-6D or FIGS. 7A-7D or a fragment or variant thereof.
The amino acid composition of the fragment or variant thereof may match that of the native spider silk protein. The structure, via Fourier transform infrared spectroscopy (FTIR), may show predominantly a β-sheet structure. The fragment of variant, like the native protein, should be soluble only in highly chaotropic solvents such LiSCN, Li perchlorate or formic acid.
The spider silk protein can be characterized by repeating α and β regions and optional variable regions. The full cDNAs encoding spider Silk Protein 1 and spider Silk Protein 2 have not been cloned or sequenced. However, it can be expected that spider Silk Protein 1 and spider Silk Protein 2 each may have a molecular weight less than 300,000 daltons, probably greater than 100,000 but less than 300,000 daltons, preferably 120,000 to 300,000 daltons. Spider Silk Protein 1 and spider Silk Protein 2 may each have 900 to 2700 amino acids with 25 to 100, preferably 30 to 90 repeats. For example, the spider silk protein may be represented by the formula (α)(β)! p
wherein α is an amorphous region which can form an α-helix when stretched, β is a region which can form β-sheets (when in a folded conformation) and p is an integer of 1 to 100, preferably 15 to 50, more preferably 18 to 22 for fragments or p is an integer of 25 to 100, preferably 30 to 90 for the full length spider silk protein. The sequence may also contain optional variable regions interspersed between the α and/or β regions.
A useful protein or fragment should be (1) insoluble inside the cell in which it is expressed or (2) capable of being formed into an insoluble fiber under normal conditions by which fibers are made. Preferably, the protein is insoluble under conditions (1) and (2). Specifically, the protein or fragment should be insoluble in a solvent such as water, alcohol (methanol, ethanol, etc.), acetone and/or organic acids, etc. The protein or fragment should be capable of being formed into a fiber having high tensile strength, e.g., a tensile strength of 0.5x to 2x wherein x is the tensile strength of a fiber formed from the corresponding natural silk or the whole protein. The protein or fragment should also be capable of being formed into a fiber possessing an elasticity of at least 15%, more preferably about 25%.
Variants of the spider silk protein may be formed into a fiber having a tensile strength and/or elasticity which is greater than that of the natural spider silk or natural protein. The elasticity could possibly be increased up to 100%. The variants may also possess the properties of the above described fragments.
The fragment or variant may have substantially the same characteristics as the natural spider silk. The natural protein is particularly insoluble when in the fiber form and is resistant to degradation by most enzymes.
In the present invention, the isolated cDNA may code for spider silk proteins such as Nephila clavipes major ampullate (dragline) silk protein, Nephila clavipes minor ampullate silk protein, Nephila clavipes cocoon silk protein, Areneus gemmoides major ampullate silk protein, and Areneus gemmoides cocoon silk protein.
The invention is further directed to a replicable vector containing cDNA which codes for spider silk protein and which is capable of expressing spider silk protein.
The invention further relates to a transformed cell or microorganism containing cDNA or a vector which codes for spider silk protein or a fragment or variant thereof and which is capable of expressing spider silk protein.
The present invention is also directed to a new spider silk protein and a method for producing the protein which comprises culturing the transformed cell or microorganism described above under conditions which allow expression of the spider silk protein, optionally recovering the thus expressed spider silk protein and optionally purifying the recovered spider silk protein. The spider silk protein produced in this manner may be different from natural spider silk protein in that it may be free of other proteins or materials which occur in natural spider silk. The spider silk protein produced by recombinant techniques may also contain some small amounts of contaminating materials from the microorganism, cells and/or fermentation system in which it was produced. Thus, the present invention is also directed to these new or isolated proteins which are produced by recombinant DNA techniques.
The invention also relates to products such as fibers containing the recombinant protein of the invention either alone or in combination with other materials.
The present invention will become more fully understood from the detailed description given hereinbelow, and the accompanying drawings which are given by way of illustration only, and thus are not limitative of the present invention, and wherein;
FIG. 1 shows the FTIR Spectra of dragline silk fiber from the major ampullate gland of Nephila clavipes as a function of applied force with fiber axis perpendicular (C and D) and parallel (A and B) to the polarized radiation; A) and C): original spectra; B) and D): partially deconvoluted spectra of A) and C), respectively;
FIG. 2 shows the FTIR Spectra of dragline silk fiber from the major ampullate gland of Nephila clavipes with fiber axis parallel (A) and perpendicular (B) to the polarized radiation; (i): 0 gram axial tension; (ii): 2.0 gram axial tension; (iii): 29 min after release of the axial tension; (iv): 12 hrs after release of the axial tension;
FIG. 3 shows the FTIR Spectra of dragline silk from the major ampullate gland of Araneus gemmoides as a function of applied force with fiber axis perpendicular (C and D) and parallel (A and B) to the polarized radiation; A) and C): original spectra; B) and D): partially deconvoluted spectra of A) and C), respectively;
FIG. 4 shows the FTIR Spectra of 3 strands of dragline silk from the major ampullate gland of Nephila clavipes being oriented randomly on the sample plate and detected without polarizer; Solid line: original spectrum; Dashed line: partially deconvoluted spectrum;
FIG. 5 shows the deconvoluted FTIR spectra of silk fiber from the minor ampullate gland of Nephila clavipes; A): fiber axis perpendicular to the polarized incident radiation; B): fiber axis parallel to the polarized incident radiation;
FIGS. 6A-6D shows the entire cDNA sequence and the corresponding amino acid sequence for spider Silk Protein 1 from the major ampullate gland of Nephila clavipes. The spider silk protein is encoded by the DNA through position 2154. Thus, the last amino acid is the Ser (amino acid 718) at positions 2152-2154. The cDNA sequence and the corresponding amino sequence are shown in SEQ. ID. NO. 1. The END codon TAG at positions 2155-2157 is not translated nor are the remaining codons; and
FIGS. 7A-7D shows the entire cDNA sequence and the corresponding amino acid sequence for spider Silk Protein 2 from the major ampullate gland of Nephila clavipes. The spider silk protein is encoded by the DNA through position 1785. The cDNA sequence and the corresponding amino acid sequence are shown in SEQ. ID. NO. 3.
The genes for two different spider silk proteins, e.g., spider Silk Protein 1 and spider Silk Protein 2, have been cloned.
SILK PROTEIN 1
The cDNA codes for a spider silk protein comprising repeating units which contain a sequence which can be represented by the following general formula (α)(β)! p (I)
wherein α is an amorphous region which can form an α-helix when stretched, β is a β-crystalline region and p is an integer of 1 to 100, preferably 15 to 50, more preferably 18 to 22 for fragments and 25 to 100, preferably 30 to 90 for the full length protein.
The α region is preferably an alanine rich region which contains 4 to 10 A's, preferably 5 to 8 A's and more preferably 6 or 7 A's. The α region contains at least 50% alanine, preferably at least 60% alanine, more preferably about 70-80% alanine and comprises about 35 to 50%, preferably 30 to 40% of the total protein based on the total number of amino acids. The α region may contain other amino acids such as glycine and/or serine.
The β region is any sequence which forms a β-crystalline structure or which forms β-pleated sheets. The α-region preferably comprises 40-70% of the total protein, more preferably 50-60% of the total protein. The above percentages (%) refer to % of amino acids. For each repeat "p" in the above formula, the α and β regions may be the same or different.
The cDNA codes for spider silk protein which comprises repeating units which can also be represented by the following general formula (v)(α)(β)! p (II)
wherein α, β and p are as defined above, v is a variable region and wherein the variable region (v), if present, is a region containing 0 to about 12 amino acids which usually begins with the sequence AGR. A majority of the repeating units in the spider silk protein may contain these units as defined in this paragraph. Representative sequences falling within this formula are shown in Table 1 below (SEQ. ID. NO. 2, amino acids 1-644).
| TABLE 1 |
| ______________________________________ |
| │---v-----│----α-----│-------β------ -│ --------QGAGAAAAAA-GGAGQGGYGGLGGQG ---------------------AGQGGYGGLGGQG ------AGQGAGAAAAAAAGGAGQGGYGGLGSQG AGR---GGQGAGAAAAAA-GGAGQGGYGGLGSQG AGRGGLGGQGAGAAAAAAAGGAGQGGYGGLGNQG AGR---GGQ--GAAAAAA-GGAGQGGYGGLGSQG AGRGGLGGQGAGAAAAAA-GGAGQGGYGGLGGQG ---------------------AGQGGYGGLGSQG AGRGGLGGQGAGAAAAAAAGGAGQ---GGLGGQG ------AGQGAGASAAAA-GGAGQGGYGGLGSQG AGR---GGEGAGAAAAAA-GGAGQGGYGGLGGQG ---------------------AGQGGYGGLGSQG AGRGGLGGQGAGAAAA---GGAGQ---GGLGGQG ------AGQGAGAAAAAA-GGAGQGGYGGLGSQG AGRGGLGGQGAGAVAAAAAAGGAGQGGYGGLGSQG AGR---GGQGAGAAAAAA-GGAGQRGYGGLGNQG AGRGGLGGQGAGAAAAAAAGGAGQGGYGGLGNQG AGR---GGQ--GAAAAA--GGAGQGGYGGLGSQG AGR---GGQGAGAAAAAA-VGAGQEGIR---GQG ---------------------AGQGGYGGLGSQG SGRGGLGGQGAGAAAAAA-GGAGQ---GGLGGQG ------AGQGAGAAAAAA-GGVRQGGYGGLGSQG AGR---GGQGAGAAAAAA-GGAGQGGYGGLGGQG VGRGGLGGQGAGAAAA---GGAGQGGYGGV-GSG ----------ASAASAAASRLSS |
| ______________________________________ |
The isolated cDNA of the invention may code for a protein comprising repeating units which contain a sequence which can be represented by the following general formula (A) m (X) n ! p (III)
wherein m is 4 to 10, preferably 5 to 8 and more preferably 6 or 7, n is 10 to 20, preferably 12 to 18 and more preferably 14 to 16, p is as defined above and each X, which may be the same or different, is selected from the group consisting of G, A, Q, Y and L, wherein at least 50% of the X's are G, more preferably at least 60% of the X's are G. For each repeat "p" in the above formula, each m and n may be the same or different.
At least 50% of the repeating units of the spider silk protein can be represented by the formula (I), (II) or (III), respectively, preferably at least 70% of the repeating units can be represented by the formula (I), (II) or (III).
The isolated cDNA of the invention contains repeating units which code for the sequence (A) m GGAGQGGYGGLGGQG!(SEQ. ID. NO. 5) (IV)
wherein m is 6 or 7.
The spider silk or fragment or variant thereof usually has a molecular weight of at least about 16,000 daltons, preferably 16,000 to 100,000 daltons, more preferably 50,000 to 80,000 daltons for fragments and greater than 100,000 but less than 300,000 daltons, preferably 120,000 to 300,000 daltons for the full length protein. The molecular weight of the spider silk protein shown in FIG. 6 and listed in SEQ. ID. NO. 2 is 64,492 daltons.
In the above formulas (I)-(IV), the protein may have additional amino acids or amino acid sequences inserted into the protein in the middle thereof or at the ends thereof so long as the protein possesses the desired physical characteristics. Likewise, some of the amino acids or amino acid sequences may be deleted from the protein so long as the protein possesses the desired physical characteristics. Amino acid substitutions may also be made in the sequences so long as the protein possesses the desired physical characteristics.
The major protein from Nephila clavipes dragline silk has been cloned. The sequence comprises a repeating hexamer of Gly-Gly-X-Gly-Y-Gly (SEQ. ID. NO. 6), where X and Y are predominantly Gln and Ala but can be other amino acids. These repeats are separated by varying length amino acid inserts composed of Ala and Ser with small amounts of other amino acids possible. A representative sequence is as follows: ##STR1##
The protein of the invention is constituted primarily by repeats of the sequence AGRGGXGGZGAG(A) 6 -7 GAGQGGYGGLGGQG (SEQ. ID. NO. 7)
with X and Y being L, Y or Q but with X not the same amino acid as Z.
SILK PROTEIN 2
The cDNA codes for a spider silk protein comprising repeating units which contain a sequence which can be represented by the following general formula (β)(α!) p (I)
wherein α is an amorphous region which can form an α-helix when stretched, β is a region which forms a β-sheet like structure and p is an integer of 1 to 100, preferably 15 to 50, more preferably 18 to 22 for fragments and 25 to 100, preferably 30 to 90 for the full length protein.
The α region is preferably an alanine rich region which contains 4 to 10 A's, preferably 6 to 10 A's. The α region contains at least 50% alanine, preferably at least 60% alanine, more preferably about 70-100% alanine and comprises about 35 to 50%, preferably 30 to 40% of the total protein based on the total number of amino acids. The α region may contain other amino acids such as serine and/or glycine. Such substitutions may have no significant effect on function.
The β region is any sequence which forms a linked β-turn. The β-turn region is composed of repeats of GPGQQGPGYYGPGQQGPSGPGS (SEQ. ID. NO. 8) with occasional substitutions and one insert of GGY. The βTurn region has a much higher amount of proline than the βcrystalline region of silk protein 1. It is believed that the proline is responsible or causing the turns or "kinks" in the protein. Each β-turn will usually contain 1 proline, usually from 0 to 2 prolines. Each E-region will usually contain more than 1 β-turn, usually 4 or 5 β-turns. The β-region preferably comprises 40-70% of the total protein, more preferably 50-60% of the total protein. The above percentages (%) refer to % of amino acids. For each repeat "p" in the above formula, the α and β regions may be the same or different.
The cDNA codes for spider silk protein which comprises repeating units which can also be represented by the following general formula (β)(α)(v)! p (II)
wherein α, β and p are as defined above, v is a variable region and wherein the variable region (v), if present, is a region containing 0 to about 20 amino acids, usually 0 to about 18 amino acids, which usually contains the sequence GPGGY (SEQ. ID. NO. 9) and/or GPGQQ (SEQ. ID. NO. 10). A majority of the repeating units in the spider silk protein may contain these units as defined in this paragraph. Representative sequences falling within this formula are shown in Table 2 below (SEQ. ID. NO.:4, amino acids 5-469).
| TABLE 2 |
| ________________________________________________________ __________________ |
| │-----------β------------│------α---.vertline .--------v----------│ GPGQQGPGGYGPGQQGP--SGPGSAAAAAAAAAA----GPGGYGPGQQGPGGY ##STR2## ##STR3## ##STR4## ##STR5## ##STR6## GPGQQGPGGYGPGQQGP--SGPGSAAAAAAAAA---------------GPGGY ##STR7## ##STR8## ##STR9## ##STR10## ##STR11## |
| ________________________________________________________ __________________ |
The isolated cDNA of the invention may code for a protein comprising repeating units which contain a sequence which can be represented by the following general formula (A) m (X) n ! p (III)
wherein m is 4 to 10, preferably 6 to 10, n is 10 to 20, preferably 12 to 18 and more preferably 14 to 16, p is as defined above and each X, which may be the same or different, is selected from the group consisting of P, G, A, Q, Y and L, wherein at least 50% of the X's are G, more preferably at least 60% of the X's are G. For each repeat "p" in the above formula, each m and n may be the same or different.
At least 50% of the repeating units of the spider silk protein can be represented by the formula (I), (II) or (III), respectively, preferably at least 70% of the repeating units can be represented by the formula (I), (II) or (III).
The isolated cDNA of the invention may contain repeating units which code for the sequence β(A) m ! (IV)
wherein β is as defined above and m is 6 to 10.
The spider silk or fragment or variant thereof usually has a molecular weight of at least about 16,000 daltons, preferably 16,000 to 100,000 daltons, more preferably 50,000 to 80,000 daltons for fragments and greater than 100,000 but less than 300,000 daltons, preferably 120,000 to 300,000 daltons for the full length protein. The molecular weight of the spider Silk Protein 2 shown in FIG. 7 and listed in SEQ. ID. NO. 4 is 51,157 daltons.
In the above formulas (I)-(IV), the protein may have additional amino acids or amino acid sequences inserted into the protein in the middle thereof or at the ends thereof so long as the protein possesses the desired physical characteristics. Likewise, some of the amino acids or amino acid sequences may be deleted from the protein so long as the protein possesses the desired physical characteristics. Amino acid substitutions may also be made in the sequences so long as the protein possesses the desired physical characteristics.
Abbreviations for amino acids used herein are conventionally defined as described hereinbelow unless otherwise indicated. ______________________________________ Three-letter One-letter Amino Acid abbreviation symbol ______________________________________ Alanine Ala A Arginine Arg R Asparagine Asn N Aspartic acid Asp D Asparagine or aspartic acid Asx B Cysteine Cys C Glutamine Gln Q Glutamine acid Glu E Glutamine or glutamic acid Glx Z Glycine Gly G Histidine His H Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Trp W Tyrosine Tyr Y Valine Val V ______________________________________
Recombinant spider silk protein can be recovered from cultures by lysing the cells to release spider silk protein which is present inside the cells. Initially, cell debris can be separated by centrifugation. The remaining debris and the supernatant are then repeatedly treated with solvents in which the cell debris are soluble but in which the spider silk protein is not soluble to thereby precipitate spider silk protein. These procedures can be repeated and combined with other procedures including filtration, dialysis and/or chromatography to obtain a pure product.
In accordance with degeneracy of genetic code, it is possible to substitute at least one base of the base sequence of a gene by another kind of base without causing the amino acid sequence of the polypeptide produced from the gene to be changed. Hence, the DNA of the present invention may also have any base sequence that has been changed by substitution in accordance with degeneracy of genetic code. For example, the amino acid sequence coded by a modified DNA corresponding to FIG. 6 obtained by the above-mentioned substitution is identical with the amino acid sequence of FIG. 6.
The DNA is readily modified by substitution, deletion or insertion of nucleotides, thereby resulting in novel DNA sequences encoding spider silk protein or its derivatives. These modified sequences are used to produce mutant spider silk protein and to directly express spider silk protein.
DNA regions are operably linked when they are functionally related to each other. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein which participates in the secretion of the polypeptide; a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation. Generally, operably linked means contiguous and, in the case of secretory leaders, contiguous and in reading phase.
Suitable host cells are prokaryotes, yeast or higher eukaryotic cells. Prokaryotes include gram negative or gram positive bacteria, for example E. coli or Bacilli. Higher eukaryotic cells include established cell lines of insect, spider or mammalian origin as described below.
Prokaryotic host-vector systems are preferred for the expression of spider silk protein. A plethora of suitable microbial vectors are available. Generally, a microbial vector will contain an origin of replication recognized by the intended host, a promoter which will function in the host and a phenotypic selection gene, for example, a gene encoding proteins conferring antibiotic resistance or supplying an auxotrophic requirement.
Vectors must contain a promoter which is recognized by the host organism. This is generally a promoter homologous to the intended host. Promoters most commonly used in recombinant DNA construction include the β-lactamase (penicillinase) and lactose promoter systems, a tryptophan (trp) promoter system and the tac promoter. While these are the most commonly used, other known microbial promoters are suitable. Details concerning their nucleotide sequences have been published, enabling a skilled worker operably to ligate them to DNA encoding spider silk protein in plasmid vectors and the DNA encoding spider silk protein. At the present time a preferred vector is pGEM3Z. Other possible expression vectors are λ GT11 and pGEM5Zft.
In addition to prokaryotes, eukaryotic microbes such as yeast cultures may be transformed with spider silk protein encoding vectors. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among lower eukaryotic host microorganisms, although a number of other strains are commonly available. Yeast vectors generally will contain an origin of replication from the 2 micron yeast plasmid or an autonomously replicating sequence (ARS), a promoter, a DNA sequence coding for spider silk protein, sequences for polyadenylation and transcription termination and a selection gene.
Suitable promoting sequences in yeast vectors include the promoters for metallothionein, 3-phosphoglycerate kinase or other glycolytic enzymes.
Other promoters, which have additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned metallothionein and glyceraldehyde-3-phosphate dehydrogenase, as well as enzymes responsible for maltose and galactose utilization. In constructing suitable expression plasmids, the termination sequences associated with these genes are also ligated into the expression vector 3' of the spider silk protein coding sequences to provide polyadenylation of the mRNA and termination.
In addition to microorganisms, cultures of cells derived from multicellular organisms may also be used as hosts. In principal, any higher eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture. For example, an insect virus such as Baculovirus can be used to express silk protein in insect cells. However, interest has been greatest in vertebrate cells, and propagation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years. Examples of useful host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and WI38, BHK, COS-7 and MDCK cell lines. Expression vectors for such cells ordinarily include (if necessary) an origin of replication, a promoter located upstream from the gene to be expressed, along with a ribosome binding site, RNA splice site (if intron-containing genomic DNA is used), a polyadenylation site, and a transcriptional termination sequence.
The transcriptional and translational control sequences in expression vectors to be used in transforming vertebrate cells are often provided by viral sources. For example, commonly used promoters are derived from polyoma, Adenovirus 2, and most preferably Simian Virus 40 (SV40). The early and late promoters are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication. Smaller or larger SV40 fragments may also be used, provided the approximately 250 bp sequence extending from the Hind III site toward the BgII site located in the viral origin of replication is included.
An origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e.g., Polyoma, Adenovirus, VSV, or BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.
The protein and DNA sequence of the major protein in dragline silk is described hereinbelow. The protein sequence comprises a repeating pattern which is divided into three segments. The first segment contains up to 9 amino acids. This sequence is AGRGGLGGQ (SEQ. ID. NO. 11) but the segment can contain no amino acids or a combination of the first three with either of the second set of three. The second segment is composed of 9 or 10 amino acids with a sequence of GAGAAAAAA(A) (SEQ. ID. NO. 12). This sequence is present in all repeats. The final segment is composed of 15 amino acids with a sequence of GGAGQGGYGGLGGQG (SEQ. ID. NO. 13). The variability in this segment is at the underlined position which can also be S,N or A. This third segment is found in all repeats. In all of these segments there are rare substitutions of other amino acids but no pattern is seen nor are they present in more than 5% of the repeats sequenced.
The DNA sequence for this protein shows a very high preference for A or T in the third position of the codon. This is such that only about 10% of the codons end in G or C compared to an expected 50% if it is random. This is likely a stability factor for the DNA to prevent recombination and deletion events from occurring.
Spider dragline silk has a number of unusual properties. These include a tensile strength greater than steel or carbon fibers (200 ksi), elasticity as great as some nylon (35%), a stiffness as low as silk (0.6 msi), and the ability to supercontract in water (up to 60% decrease in length). These properties are unmatched by any other material. The new material of the invention would provide these features in a very low weight material. The cloned protein of the invention is the major component for this silk.
Spider silk, especially dragline silk, has a tensile strength of over 200 ksi and yet has an elasticity of nearly 35%. This combination results in it having the greatest energy input necessary to break any known fiber including Kevlar™ and steel. This combination is also unique in both biological and man-made materials. When spun into fibers, which can be done by dissolving spider silk in an appropriate solvent and forcing it through a small orifice, spider silk can have numerous uses. For example, one large volume use is for clothing. Silk with elasticity would have a unique place in the market even at high prices. It may also be applicable for certain kinds of high strength uses such as rope, surgical sutures, flexible tie downs for certain electrical components and even as a biomaterial for implantation (e.g., artificial ligaments or aortic banding). Thus, there are numerous applications for the invention including high-tech clothing, rope, sutures, medical coverings and others where various combinations of strength and elasticity are required. It is also possible to modify the properties of the silk fibers by altering the protein sequence.
The fibers may be used for the same uses as natural spider silk fibers. The fibers may also be mixed with various plastics and/or resins to prepare a fiber-reinforced plastic and/or resin product. Because spider silk is stable up to 100° C., the fibers may be used to reinforce thermal injected plastics.
The present invention is also directed to a method for preparing variants of natural spider silk protein which comprises determining the DNA sequence of a gene which codes for natural spider silk protein, preparing a variant of said DNA sequence, and expressing said variant of said DNA sequence in a cell or microorganism to produce a variant spider silk protein having properties different form the properties of natural spider silk. The variants of natural spider silk DNA may be prepared by identifying regions of said DNA of said gene which correspond to amorphous regions in said natural spider silk protein and modifying said DNA sequence corresponding to said amorphous region or regions to change the elasticity characteristics of the protein expressed by said variant DNA or identifying regions of said DNA of said gene which correspond to β-crystalline regions in said natural spider silk protein and modifying said DNA sequence corresponding to said β-crystalline region or regions to change the strength characteristics of said protein.
Based on the amino acid sequence of peptides derived from Nephila dragline silk, DNA probes are used to identify several clones from a silk gland cDNA library. More specifically, over 2 kb of two separate clones have been sequenced in the manner described in Example 3 for the Nephila dragline silk protein. The largest of these clones (2.5 kb) has been fully sequenced. The sequence contains the poly A site, 340 bases of the 3' untranslated region and the remainder a protein coding region. The protein region contains a basic 34 amino acid repeat. The repeat itself contains three regions. The first comprises 0-9 amino acids with a sequence of AGR(GGX) 2 (SEQ. ID. NO. 11). Clearly this region is not highly conserved. The second region has a sequence of GAG(A) x (SEQ. ID. NO. 12) which is highly conserved in all repeats and is 8-10 amino acids long. The third segment is (GGX)5 (SEQ. ID. NO. 13) and is 15 amino acids long and is very highly conserved. In most cases, X is A, Q, Y or L. Clones for other silk proteins have been isolated and sequenced. In addition, the amino acid sequence from several spider silk proteins have been determined and these include: Nephila dragline (GYGPG (SEQ. ID. NO. 14), GQGAG (SEQ. ID. NO. 15), GAGQG (SEQ. ID. NO. 16), GYGGLG (SEQ. ID. NO. 12)) and cocoon (SAFQ) (SEQ. ID. NO. 18) and Araneus dragline (GPYGPGQQGP) (SEQ. ID. NO. 19) and cocoon (FLGG (SEQ. ID. NO. 20), SVGLV-L/I -A-Y-A-L (SEQ. ID. NO. 21)). Over 18 positive clones have been identified from a Nephila silk gland library using an 18 mer probe based on the dragline protein sequence.
In accordance with the invention, the recombinant protein can be made in bacteria, purified, if necessary, and spun into fibers. The optimum protein size for production may be determined so that the protein still retains the important physical properties.
The sequences of the spider silk protein repeats may vary in many ways and yet still be within the scope of the invention. For instance, Gln, Leu, and Tyr may be substituted for each other in the sequence. Moreover, the removal of poly-Ala segments results in a silk having a lower elasticity. Furthermore, additional variety in the protein sequence may result in replacing one Gly in each pair of Glys in the GGX with a Ser.
Accordingly, the silk protein of the invention can be varied depending upon its intended use. For example, when lower elasticity is desirable, the poly-Ala stretch of the protein sequence should be removed. In contrast, when a high degree of elasticity is desired, the length of the poly-Ala stretch should be increased. Also, if a less stiff silk is desired, glycine should be substituted with serine.
In accordance with the present invention, large quantities of protein having the desired properties can be obtained. This protein can be made into fibers for any intended use. Clones may also be sequenced for making minor ampullate, cocoon and swathing silks.
Mixed composites of fibers are also of interest due to their unique properties. Such mixed composites confer flexible behavior into otherwise stiff materials and would provide strength at the same time.
The following Examples are intended to illustrate the claimed invention and will enable others skilled in the art to understand the invention more completely. However, the invention should not be interpreted as being limited to only these representative Examples.
The major and minor silks from the spiders Nephila clavipes are harvested as described in Work, R.W., et al. J. Arachnol., 10, 1-10 (1982), and then allowed to completely dry at room temperature. A length of 3-5 cm of silk is used for each FTIR experiment. Spectra are obtained with an Analect FX 6260 FTIR spectrometer through an Analect Micro-XA FTIR microscope at 2 cm -1 resolution. Interferograms of 128 scans are routinely obtained and spectra are partially deconvoluted by the method of Kauppinen, J. K., et al., Appl. Sectrosc. 35, 271-276, (1986), employing Gaussian components with a half width at half height of 12 cm -1 and a resolution enhancement factor (K) of 2. Axial extension experiments are carried out by fixing one end of the silk and attaching the other end to small suspended weights of the indicated size.
Before carrying out the actual experiments, the uniformity of the silk fiber is examined by taking FTIR spectra of several randomly selected sites along the fiber, both parallel and perpendicular to the polarized light. The spectra differed from each other by less than 2 cm -1 in terms of peak positions (results not shown). Thus, the silk fiber is shown to be spectrally homogeneous.
To examine the possibility of structural changes in major ampullate silk of the spider Nephila clavipes when the protein responds to axial strain, FTIR spectra of individual silk fibers are obtained through an infrared microscope. Original and partially deconvoluted infrared spectra of silk fibers, with the IR radiation polarized perpendicular to the fiber axis, are shown in FIG. 1C and FIG. 1D, respectively, as a function of axial tension on the fiber. Strong perpendicular dichroism in the amide 1 band is found for peaks at 1694, 1630 and 1620 cm -1 , consistent with the high content of β-structure previously detected in other forms of silk by IR spectroscopy, Suzuki, E., Spectrochim. Acta., 23A, 2303-2308 (1987); Fraser, R.D., et al., Conformation in Fibrous Protein, Academic Press, New York and London (1973). Weak bands at 1657 and 1675 cm -1 are also evident and can be assigned to disordered regions and anti-parallel β-sheet respectively, Fraser, R. D. B., et al., Conformation in Fibrous Protein, Academic Press, New York and London (1973); Byler, D. M., Biopolymers, 25, 469-487 (11986). Amide II bands are seen at 1520 and 1550 cm -1 indicating β-sheet and a very small amount of helical region respectively, Fraser, R. D. B. Conformation in Fibrous Protein, Academic Press, New York and London (1973); Cantor, C.R. et al, Biophysical Chemistry, Part II, 466-472, Freemnan, San Francisco (1980). When tension is applied to the silk fiber the radiation perpendicular to the fiber axis shows only minor changes in the Amide I region. In contrast, the peak near 1550 cm -1 in the Amide II region decreases in intensity upon applied tension and shifts to 1557 cm -1 .
Strikingly different results are observed when the radiation is oriented parallel to the fiber axis (FIG. 1A and FIG. 1B). While all of the β-structure peaks are still clearly evident and their position unchanged, application of tension produces a dramatic increase in the absorbance at 1651 cm -1 . A peak in this region which displays parallel dichroism is strongly indicative of an α-helical structure, Fraser, R. D. B., et al., Conformation in Fibrous Protein, Academic Press, New York and London (1973); Byler, D. M., et al., Biopolymers, 25, 469-487 (1986). A similar increase is seen in the Amide II band at 1559 cm -1 which also indicates the formation of helix. A band at 1512 cm -1 is formed as well and splits into two components at 1508 and 1517 cm -1 under tension. An absorbance in this region in proteins is usually assigned to either nonhydrogen-bonded peptide groups, Cantor, C. R., et al., Biophysical Chemistry, Part II, 466-472 (1980), Freemnan, San Francisco, or tyrosine residues, Fraser, R. D. B., et al. Conformation in the Fibrous Protein, Academic Press, New York and London (1973). The tyrosine content of this fiber is only 3-4%, so the latter assignment seems less likely, which also suggests a conformational change is induced by the tension. Additional confirmation that the observed changes are involved in the elastic behavior of drag-like silk comes from the complete return of the original spectra when tension is released. Two phases can be distinguished in the relaxation process (FIG. 2). During the first phase (0-1 hr after tension release) the spectra show the silk structure quickly but not completely returning toward its original form. In the second phase (1-12 hrs. after tension release) the relaxed silk gradually assumes the complete initial conformation.
Example 1 is repeated on silk from the major ampullate gland of another spider species Araneus gemmoides which is extracted in the same manner as described in Example 1. The spectra of a silk fiber with fiber axis perpendicular and parallel to the polarized light are shown in FIG. 3. As seen previously there is a peak around 1650 cm -1 which appears as tension is applied and the silk fiber is parallel to the polarized incident radiation. Furthermore, in the parallel spectra of the major ampullate silks the peak around 1645 cm -1 from unordered structure is replaced by an α-helical signal as axial tension is applied.
To investigate the possibility that the α-helical structure formed by stretching originates from randomly oriented α-helices preexisting prior to applied tension and that the applied force merely reorients the helices into a parallel array, FTIR spectra of silk fiber are measured with unpolarized light. Several strands of silk are randomly oriented on the sample plate without applied tension and spectra are obtained. The result is shown in FIG. 4. No evidence for α-helix is found in these spectra as should be seen if preexisting α-helices are present in the relaxed state.
An additional test of this hypothesis is performed by examining the spectra of silk fibers from the minor ampullate gland. The silk produced form the minor ampullate is distinct from that of the major gland in terms of amino acid composition, function and mechanical properties, Anderson, S. O. Comp. Biochem. Physiol., 35, 705-711 (1970); Work, R. W., et al., J. Arachnol., 15, 65-80 (1987); Work, R. W., Text. Res. J., 47: 650-662 (1977); Tillinghast, E. K., et al., Ecophsiol. of Spiders, 203-210 (1987), Springer, Heideberg). In particular, this silk is significantly less elastic and has a lower tensile strength than that of major ampullate gland silk, Work, R. W., J. Text Res. 47: 650-662 (1977); Lucase, F., et al., J. Text Res., 46:T440-T452 (1955). Therefore, the two different types of silk fibers are compared in terms of conformational features and molecular responses to tension employing FTIR. The spectra of silk from the minor ampullate gland with its fiber axis perpendicular and parallel to incident polarized infrared radiation are shown in FIG. 5. The spectra of major and minor ampullate silks with the fiber axis parallel to the polarized light are very different. Of particular interest is the observation that no evidence of α-helical formation can be detected in the spectra of the less elastic silk when tension is applied. Instead, a peak at 1665 cm -1 appears which suggests an increase in turns in minor ampullate silk upon the very limited stretching which occurs.
The structural basis of spider silk elasticity is also examined by obtaining partial primary structure information. The dragline silk proteins from both Nephila clavipes and Araneus gemmoides are partially digested by limited acid hydrolysis, the resulting peptides are isolated by reversed-phase HPLC and sequenced by gas phase Edman-degradation, Hewick, R. M., et al., J. Biol. Chem., 256, 7990-7997 (1981). Peptides with a sequence of GQGAG and GAGQG are found to be the most common with a peptide of sequence GYGGLG nearly as common in Nephila clavipes. Based on analogy with Bombyx mori fibroin, the peptides containing alternating glycine residues presumably form the β-sheet regions, Lucas, F., et al., Comprehensive Biochem., 26B, 475-558 (1968). Partial sequencing of Araneus gemmoides reveal the Gly-rich repetitive peptides which have high propensity to form β-sheet as well. Most intriguingly, tri- and tetra- peptides containing primarily alanine residues are also observed in both species, suggesting that they are most likely present in more irregular conformations in the amorphous regions.
The combination of FTIR and peptide sequencing suggests a molecular mechanism for the elasticity of spider silk. The simplest interpretation of the FTIR results is that tension along the fiber leads to the formation of helices (probably of the alpha type). Sequencing of spider silk peptides demonstrates the similarity to other forms of silk with alternating glycine residues in β-sheet regions. There are also other structurally less well defined regions, which in the particular case of spider silk appear to be alanine rich. Short polypeptides rich in alanine have a strong tendency to form α-helices, Yang, D. S. C., et al., Nature, 333, 232-237 (1988). It has also been shown that stretching fibers of polyalanine leads to the formation of a regular α-helical structure, Bamford, C. H., et al., Nature, 173, 27-31 (1954). Recently, short alanine-based peptides are found to have the propensity to form unusually stable a-helical structure and individual alanine residues are thought to possess high helical potential, Marqusees, et al., Proc. Natl. Acad. Sci. USA, 86, 5286-5290 (1989). Thus, the alanine rich segments in the amorphous regions of major ampullate dragline silk are very likely to be the source of the observed tension induced formation of α-helix.
Major ampullate spider silk can be most simply pictured as semicrystalline regions of interlocking β-sheets which give the fiber its remarkable strength. These regions appear to change little when force is applied along the fiber axis. The β-sheet portions of individual polypeptide chains are interspersed with short, alanine-rich domains which are disordered when the fiber is in a relaxed state. Application of tension induces these regions to become helical with the energy for helix formation arising at least partially from the applied mechanical forces. This force-induced formation of ordered structure is a unique finding and may be of general relevance to other biochemical systems. This clearly contrasts with the α to β transformation seen upon stretching in some other silks, (Lucase, F., et al., Comprehensive Biochem., 26B, 475-558 (1968). When tension is relaxed the ordered regions are then entropically driven back to a more disordered state producing the observed elasticity.
1. Purification and identification of silk proteins
The spiders in this research are Nephila clavipes purchased from Marine Specimens Ltd., Florida. The first step to be taken is to obtain pure silk from a single type of silk gland. Using the method described by Work et al., J. Arachrol., 10, 1-10, (1982), an apparatus was designed to draw a single silk fiber from one spinnerette of the spider. The single silk fiber is stuck on a spool. A variable speed electrical drill is then used to forcibly remove 0.5-1 mg of pure silk from the spinnerette. The pure silk is dissolved in 5M LiSCN, TFA (trifluoroacetic acid) 100% at room temperature and then is run on reverse phase HPLC (high performance liquid chromatography), using a C-18 column with buffer A containing 0.4M acetic acid/pyridine, pH 4.0 and buffer B which consists of buffer A containing 40% propanol. Two peaks of peptide are observed by fluorescence.
2. Amino acid composition of the protein(s)
The pure silk is hydrolyzed in 6N HCl for 35 min at 155° C. under vacuum to prevent oxidation. After drying and removal of HCl, the sample is analyzed by the OPA (O-phthalaldehyde) (Jones, et al., J. Liq. Chromat., 4, 565-586 (1985) and the PITC (phenyl isothiocyanate) (Heinrickson, R. L., et al. Anal. Biochem., 136, 65-74 (1984) methods with HPLC on a C-18 reverse-phase column.
3. Protein cleavage and fragment purification
The preliminary results show a "ragged" amino terminus of the whole silk protein. Thus, either the proteins in the silk do not have the same sequences or their N-terminal sequences do not start at the same place. Protein cleavage and fragment purification are conducted to provide the fragments of silk protein for partial sequencing. The fragments are cleaved by 6M HCl hydrolyzing under a temperature of 155° C. for 3 min. The fragments are purified by running on HPLC using a C-18 reverse-phase column.
| ______________________________________ |
| Time speed Volume of B-buffer % Record |
| ______________________________________ |
| 0 0 10 cm/60 min 20 min 6.6 40 min 13.2 flow volume 60 min 19.8 0.75 ml/min 80 min 33.3 100 min 50 120 min 66.6 140 min 100 |
| ______________________________________ |
4. Partial amino acid sequencing of protein
The pure fragments are sequenced by an Applied Biosystem gas phase protein sequencer (470A) based on an amino acid analysis of the fragments, which provides the information to determine if the fragments could represent a suitable sequence for a DNA probe such as GQGAG (SEQ. ID. NO. 15), GAGQG (SEQ. ID. NO. 16)or GYGLG.
5. Construction of synthetic DNA probe
Synthesis of synthetic DNA probes is conducted using an automated Applied Biosystems DNA synthesizer (430A). The product DNA can be utilized as the hybridization probes. Since glycine and alanine are the major components of the protein, using four different codons for these amino acids at the third position increases the possibility of matching the most frequent codon on these fragments. 5'CCnCGnCCnGT(C or T)CC3' (SEQ. ID. NO. 22)
n=ACGT, four different bases.
6. Cloning cDNA from silk gland mRNA
In order to obtain mRNA from silk glands, the spiders are forcibly silked to stimulate mRNA synthesis, Canceles, G.C., et al., J. Exp. Zoo., 216, 1-6 (1981). The major ampullate silk glands are dissected from the abdomen of the spiders (picture of anatomical location of the silk glands is from the book, Foelix, F. R., Biology of Spider) and immersed in liquid nitrogen immediately. After adding a small amount of liquid nitrogen and silk glands into a pestle and mortar, the glands are ground to powder. RNA is extracted by the SDS hot phenol method, Taylor, D. W., et al., Mol. Biochem, Parasitol, 10, 305-318 (1984). An oligo dT column is used to isolate the mRNA from the total RNA, Haim Aviv et al., PNAS, 69; 1408-1412 (1972).
The reverse transcription of the mRNA to cDNA is done using the RiboClone™ cDNA Synthesis System from Promega (Technical Manual). The RiboClone™ system is a kit for efficient, complete synthesis of double-stranded cDNA from poly(A)+mRNA starting material. After making cDNA, the radioactively labeled cDNA is run through a Sepharose™ 4B (pharmacia) gel filtration column to separate large fragments from small fragments. cDNA's larger than 500 bp are ligated into the vectors and transformed into XL1-Blue™ E. coli (Stratagene) to construct a cDNA library (Maniatis, T., et al., Molecular Cloning, A Lab Manual (1982)).
The Bluescript™ SK (Stratagene) plasmids which have the function of producing single strand DNA under the trigger of helper phages (Manual from Stratagene) are used as the vectors to clone the cDNA. The Bluescript™ SK and XL1-Blue™ system provides a convenient host-vector system for cloning cDNA. The vector contains T7 and T3 promoters flanking a polylinker for convenient in vitro synthesis of RNA from cloned cDNA. Also, the polylinker is positioned so that insertion of a cloned DNA interrupts a lacI gene, providing a method for color selection of clones containing inserts. Furthermore, the plasmids can be rescued as bacteriophage containing a single-stranded DNA. The XL1-Blue™ strain is an appropriate E. coli host cell. The Bluescript™ SK plasmids from Stratagene have been large scale produced (Large prep using the Triton lysis method, Frederick M. Ausubel, et al., Current Protocols in Molecular Biology, Volume 1, 1987), lysozyme incubation time was 20 min at 37° C. and purified by CsCl gradient in an ultracentrifuge (L7-5, Beckman)(Frederick M. Ausubel, et al., Current Protocols in Molecular Biology, Volume 1, 1987, published by Greene Publishing Associates and Wiley-Interscience) using vti80 rotor at 24° C., 54,000 rpm overnight. Further plasmids clean-up is done by SDS sucrose gradient, Maniatis, T., et al., Molecular Cloning, A Lab Manual (1982), published by Cold Spring Harbor.
The pBluescript™ SK plasmids are cut by restriction enzyme Smal to create a blunt end. In order to reduce the self-ligation rate of the plasmids, alkaline phosphatase from calf intestine (CIP) (Mannheim Boehringer) is used to remove the phosphate at the 5-end of the plasmids (Maniatis, T., et al., Molecular Cloning, A Lab Manual (1982) published by Cold Spring Harbor). Deactivation of CIP was conducted at 75° C. instead of 68° C. for 30 min. and Elutip-d™ column (Schleicher and Schuell, Manufacturer, Manual for purification of DNA) was used to purify and clear the vectors. Elutip-d™ columns are pre-poured ion exchange columns containing a matrix similar to RPC-5.
Ligation of cDNA with pBluescript™ SK is carried out at 4° C. overnight by T4 DNA ligase (Maniatis, T., et al., Molecular Cloning, A Lab Manual (1982), published by Cold Spring Harbor) then transformed into competent XL-1 blue E. coli. The bacteria are inoculated overnight in 1×YT and grown up to OD 600 0.3-0.6. The bacteria are spun down in a JA 20 rotor at 5000 rpm for 5 min, then resuspended in 1/2 the original volume of 50 mM CaCl 2 +10mM Tris, pH 8. The solution is iced for 20 min. and the cells are spun down the same as before and resuspended in 1/20-1/50 of the original volume of 50 mM CaCl 2 . Aliquot in 0.3 ml. Add DNA to the appropriate tubes. Ice for 60 min. and heat shock for 3 min. at 45° C. Spread the plates and incubate for overnight at 37° C. The colonies of bacterial cells with the plasmid which has ampicillin resistance markers survive in the YT agar plates with ampicillin.
7. Synthetic oligodeoxynucleotide to screen the cDNA library
The synthetic oligodeoxynucleotide probes are labeled with p 32 by T4 polynucleotide kinase (Maniatis, T., et al., Molecular Cloning, A Lab Manual (1982), published by Cold Spring Harbor). The white colonies from the plates were transferred to 96 well assay plates with YT medium with ampicillin and grown again at 37° C. overnight. Then the bacteria with plasmid are transferred to Hybond-N™ hybridization transfer membranes (Amersham) using a 32 pin stamp and allowed to grow overnight in ampicillin plates. The 32 pin stamp is a homemade stamp consisting of pins inserted into a styrofoam block to match to wells of the 96 well plate. Then plasmid numbers are amplified on chloramphenicol plates. NaOH was used to lyse the bacteria and the DNA on the membranes was fixed by baking in an oven with a vacuum at 80° C. for 2 Hr (Maniatis, T., et al., Molecular Cloning, a lab manual (1982), published by Cold Spring Harbor).
The libraries were screened by a radioactively labeled oligodeoxynucleotide probe using the method of Wood and Lawn because of the highly complex DNA structure, Wood, W. I., et al., PNAS, 82, 1585-1588 (1985).
8. Applying Southern transfer and hybridization of the DNA to confirm positive colonies from the first screening
Positive colonies are picked and the grown in YT medium and the plasmid DNA with inserts are extracted by mini preparation. (Promega Catalog and Frederick M. Ausubel, et al., Current Protocols in Molecular Biology, Volume 1, 1987). After running the DNA in the agarose gel, the samples are blotted onto Hybond-N™ membranes (Maniatis, T., et al., Molecular Cloning, A Lab Manual (1982), published by Cold Spring Harbor) and hybridized again by the same probes as above, Wood, W. I., et al., PNAS, 82, 1585-1588, (1985).
9. Restriction enzyme digestion DNA of the positive colonies
Since there was more than one colony showing positive by the probe hybridization, restriction enzymes including BamHl, Ecor1, Pst1, Hae3, Apal, Clal, Hinc2, Hind3, Kpn1, Sal1, Sal2, Xho1, Ssp1 and Sph1 are applied (Digestion conditions for each enzyme according to the manufacturer instruction) to detect the differences between these positive colonies as well as to obtain information for further DNA sequencing analysis.
10. Subcloning the restriction enzyme digested fragments and screening by the probe
In order to avoid wasting time on sequencing of suspicious colonies, the fragments digested by Hae III and Pst1 were filled by four different dNTP ACGT using a Klenow fragment of E. coli DNA polymerase (Maniatis, T., et al., Molecular Cloning, A Lab Manual (1982)) to create blunt-end fragments. Then the fragments were randomly subcloned into an M13 phage by the same procedure as cloning. The plaques were screened again by the probes (as above). The positive plaques were probed again by southern hybridization, Wood, W. I., et al., PNAS, 82, 1585-1588, (1985).
11. Sequencing the positive subclone fragments
Positive plaques of M13 phages with inserts were cultured at 37° C. with BSJ 72 E. coli overnight to produce single strand DNA for DNA sequencing. For purification of single strand DNA, 1 ml phage containing the supernatant mix with 0.25 ml RNAase/PEG(PEG 10%, NaCl2.5M, EDTA 0.015M) standing for 2-3 hr. at room temperature. Spin 5 min. in microfuge to pellet phage. Remove solution as much as possible. Dissolve the pellet in 0.07 ml proteinase solution (0.01M Tris pH8, 0.001M EDTA pH8, 0.2% Sarkosyl, 0.07 mg/ml Proteinase K), incubation 20 min. at 55° C., add 0.05 ml 0.25M NaCl. Extract with 0.15 ml water saturated Phenol, extract with 0.130 ml Phenol/CHCl/Isoamyl Alcohol (50/45/5%), then extract with 0.120 ml CHCl. Precipitate with 0.2 ml EtOH at -80° C. more than 20 min. or -20° C. more than 1 hr. Spin 15 min. then wash the pellet with 70% EtOH, dry pellet and resuspend in 40 ml H 2 O. After purification of single strand DNA, the universal primer for an M13 phage was used to hybridize the template and the DNA was sequenced based on the method of, Sanger, F., et al., PNAS, 74:5463-5467 (1977). S 35 -dATP was used as labelling for an exposure picture of the sequencing. The apparatus of Sequencing Gel Electrophoresis System (Model S2) (obtained from BRL, Bethesda Research Laboratories Life Technologies, Inc.) is operated in accordance with the manufacturer's instructions.
Running condition: 70 Watts Time: 3-7 hours.
The larger gel plate is siliconized. The glass is then baked 4 hours at 90° C., only when the glass is new or washed by NaOH. Each time the larger plate was siliconized without baking before using.
The smaller plate is treated with 2 ml of a 2% solution in ethanol of 3-Methacryloxypropyl-trimethoxysilan(Sigma) each time before using. Both larger and smaller plates were thoroughly cleaned with detergent and distilled water. 90% ethanol was used to do final cleaning before being siliconized, treatment of 3-methacryloxypropyl-trimethoxysilan and filling gel.
7% Acrylamide/bis, 8M Urea gel was used all the time.
For 500 ml stock Acrylamide solution
| ______________________________________ |
| Acrylamide 33.2 g Bis-acrylamide 1.75 g Urea 240 g |
| ______________________________________ |
Solution should be deionized by Amberlite MB-3 Monobed Resin(Sigma), 25 g for 500 ml solution.
For 1 liter 10x sequencing buffer TBE
| ______________________________________ |
| Tris base 160 g Boric Acid 38 g Disodium EDTA 9 g |
| ______________________________________ |
1×; TBE buffer is the working condition mixing with 7% acrylamide/bis/urea solution.
15% Ammonium persulphate (0.20 ml) and TEMED (0.05 ml) were used to catalyze 60 ml. total volume of gel for polymerization.
12. Sequencing the colonies which have a sequence which hybridizes with the probes
Three colonies are sequenced using the method of Sanger, F., et al., PNAS, 74, 5463-5467 (1977). S 35 -dATP was used as labelling for exposure picture of the sequencing. Because the sizes of these colonies are different, ranging from 800 bp to 2.4 k BP, each reaction of sequencing only provided clear reading of 300 to 350 BP. In order to read the whole sequence of the DNA, a kit for the partial deletion DNA from Promega, the "Erase-a-Base™ System", was used to create different sizes of DNA for sequencing (Technical Manual, "Erase-a-Base™ System" Promega).
13. Sequencing 2.4 kb DNA of spider silk protein
The partial sequencing results from the 2.4 kb DNA showed a repetitive sequence and high GC complex structure which can cause the fragments to delete and religate. In order to obtain correct sequence information, restriction enzyme Hae III was used to cut the 2.4 kb into small fragments varying from 150 to 900 bp and these Hae III fragments were separated by 1% low melting point agarose (Bethesda Research Laboratories) then purified by hot phenol, Maniatis, T., et al., Molecular Cloning, A Lab Manual (1982), and Elutip-d™. The pure fragments in different sizes were subcloned (same method as cloning) into pBluescript™ KS(±) plasmids and M13 phages mp 18 as well as mp 19 (from Strategene) respectively for sequencing.
14. Northern blotting and hybridization to determine the size of mRNA for silk proteins
mRNA is purified by running whole RNA through the oligo-dT affinity column (same as above) and through a denaturing formaldehyde agarose gel, Frederick M. Ausubel, et al., Current Protocols in Molecular Biology, Volume 1, 4.9.5-4.9.8 (1987). The mRNA were blotted onto Zeta-probe membranes, Maniatis, T., et al., Molecular Cloning, A Lab Manual (1982). Hae III digested fragments were separated by agarose gel electrophoresis (same procedure as above). Nick translation kit (Nick Translation reagent Kit, Bethesda Research Laboratories) was used to make radioactive labeled probes using the 900 bp fragment as a template. Membrane with mRNA was hybridized at 75° C. by the probes to determine the size of mRNA of the silk proteins, Bio-Rad, Instruction Manual 4.3, Zeta-probe Blotting Membranes.
The DNA sequence and the corresponding amino acid sequence of the silk proteins are shown in FIG. 6.
A clone of spider silk DNA (2.0 kb) (See FIG. 6) in pBluescript™ SK±plasmids is selected. An insert is placed in the SmaI site. The pBluescript™ SK+ vector is digested by SmaI restriction enzymes in the same manner as #6 in Example 3.
The insert is cut out from pBluescript™SK+ at the BamHI and EcoRI sites, ("NEB", New England Biolabs). The EcoRI site is filled in with a Klenow Fragment (Promega, Inc. supplied the fragment and protocol) to provide a blunt end at the EcoRI site. The BamHI overhang is left to insure proper orientation of the insert into the new vector pGEM™-3Z (Promega). The pGEM™ plasmid provides a multiple cloning site polylinker placed between a T7 promoter and a SP6 promoter to provide for convenient in vitro RNA synthesis from cloned DNA templates. This vector is prepared by digesting with BamHI (BamHI digestion is carried out at 37° C. for 30 min. using the BRL reaction buffer (Bethesda Research Labs)) leaving an overhang and HincII (NEB) blunt end. The two plasmids are ligated using T-4 DNA ligase. T-4 DNA ligation is carried out at 4° C. overnight using 10×ligation buffer (Maniatis, T., et al., Molecular Cloning, A Lab Manual (1982)). ##STR12##
Transformation of the ligated DNA is performed by adding the DNA to previously made competent cells. After incubation of cells and DNA for 2 hours at 0° C., the cells and DNA are combined with 0.85% saline soft agar (3 ml of soft agar) and poured onto LB agar plates supplemented with 40 μg/ml X-gal, 50 μg/ml ampicillin and 40 μg/ml IPTG (isopropyl β-D-trisgalactopyranoside). X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside), ampicillin and IPTG are growth additives which are determined to be necessary for adequate growth of the transformants (Stratagene, BRL). The three host cell lines used are JM109 (Stratagene), DH5αF (Bethesda Research Laboratories), and SURE (Stratagene).
Expression of spider silk protein is induced by the addition of IPTG (Bethesda Research Laboratories (BRL)) in the growth media while culturing at 37° C. The extracted protein (50 μl ) is examined by PAGE/SDS phastgel (Pharmacia). Since only a small amount of protein is produced, a reading frame shift in the plasmid is induced.
The reading frame shift is accomplished by digesting the plasmid with 1 Unit SphI (SphI digestion is carried out at 37° C. for 30 min. using the Promega SphI 10×buffer (Promega, Inc.)), then cutting off the 3' overhang of 4 bases with 1 Unit T-4DNA polymerase (Promega). 3' overhang is removed by adding 1 Unit T-4 DNA polymerase at room temperature for 10 mins. The bases removed are CGTA. Self-ligation occurs in a volume of 50 μl at 4° C. overnight. This plasmid is then self ligated with 1 Unit T-4 DNA ligase (New England Biolabs) to form plasmid pLM-4; and transformed as described above for the previous plasmids (Stratagene, BRL) into SURE™ E. coli host cells (Stratagene). SURE™ E. coli contain mutations which suppress homologous recombination, providing for stabilization of cloned DNA containing repeated sequences. The SURE™ E. coli transformed with plasmid pLM-4 was deposited at the American Type Culture Collection, 12301 Parklawn drive, Rockville, Md., U.S.A. on Mar. 27, 1991 under the conditions of the Budapest Treaty and was assigned Deposit No. 68567.
Expression of 20-30 mg/1 spider silk protein is induced by the addition of 40 μg/ml isopropylthiogalactoside (IPTG) (BRL) in the growth media. The protein is detected by PAGE/SDS (Pharmacia). This protein has the sequence as shown in FIG. 6.
The protein could be purified by centrifugation of the bacteria at 600×g for 15 min. and disruption of the bacteria by suspension in 1M acetic acid followed by centrifugation at 3000×g for 20 min. The pellet could be dissolved in 5% SDS(1:10 vol:vol) and the centrifugation repeated. The pellet is then treated with RNase and DNAase(0.01 mg/g) and the centrifugation repeated. The pellet is dissolved in 5M Li perchlorate and dialyzed against water(1:100 vol:vol) with 4 changes of water. The dialyzed suspension is centrifuged at 15,000×g for 30 min. The dissolving in Li perchlorate, dialysis and centrifugation is repeated 3 times.
10-20 mg of the protein silk from any of Examples 1, 2 or 4 (Predictive) are collected. The silk is dissolved to saturation in 5M Li SCN or Li perchlorate. The solution containing the dissolved silk is forced through a small gauge long needle (size 24 or smaller) and then into a 1M acetic acid solution. The fiber begins to form as it emerges from the needle.
Spider Silk Protein 2 was cloned as follows. From an existing Nephila clavipes major ampullate gland cDNA library, replicate nitrocellulose filters were produced. The colonies on the filters were fixed (Maniatis et al, Molecular Cloning, Cold Spring Harbor Laboratory (1982)) and hybridized with a kinased (Maniatis et al, Molecular Cloning, A Lab Manual, Cold Spring Harbor Laboratory (1982)) degenerate probe of 14 nucleotides named Ming 1 whose sequence, based on the pentapeptide G-Y-G-P-G (SEQ. ID. NO. 14), is CCNGGNCCATANCC. (SEQ. ID. NO. 25)
Hybridization followed the procedures of Wood et al (PNAS USA, 82, 1585 (1985)) utilizing tetramethylammonium chloride. The filters were autoradiographed and the twelve darkest colonies were used to generate alkaline quick preparations that were digested with EcoRI and Bam HI. The gel was photographed after ethidium bromide staining and vacublotted to Zeta-probe™ membrane (Biorad). Kinased Ming 1 was used as a probe to hybridize to the Southern blot. The clone containing the largest apparent insert, clone number six with approximately two kilobases, was used for all subsequent studies. An expression vector is constructed in the same manner as in Example 4 to form plasmid pMB-2.
The original Spider Silk 2 clone (p6B) was cut with BamH1 and Sac1 restriction endonucleases and subjected to Exonuclease III digestion for 30 sec. at 35° C. This DNA was treated with S1 nuclease and Klenow to produce a blunt ended DNA which was self-ligated (T4 DNA ligase) to form a pBluescript™ SK+ plasmid with a Spider Silk 2 insert 173 bp shorter than the original clone (p6B). This plasmid, pMB-2, has a DNA sequence which starts at the Sac1site of pBluescript and continues with nucleotide number 172 (the CCC) of sequence ID. NO. 3.
The E. coli SURE™ cells containing the plasmid (pMB-2) were deposited at the American Type Culture Collection 12301 Parklawn Drive, Rockville, Md., USA on Mar. 27, 1991 and was assigned Deposit No. 68568. Expression of a fusion protein (lac gene+spider silk protein)-could be induced by addition of IPTG in the same manner as in Example 4. The protein could be purified in the same manner as in Example 4 and formed into a fiber in the same manner as in Example 5.
To facilitate high rate expression of spider major ampullate silk in bacteria, three expression vectors are used. All these are available from New England BioLabs with the precise instruction manual. The vectors have beta-lactamase gene for screening with ampicillin, and polylinker site for cloning constructed with a part of maltose binding protein (mal E) upstream of poly-liker site as well as an alpha subunit donor of beta-galactosidase downstream of poly-liker site. Transcription is conducted by tac promoter which is regulated by IPTG. The repressor gene of latose operon is also attached in all vectors, therefore high copy number of plasmid DNA may not dilute the repressors in cytosol of E. coli cells by providing competitive tac promoter region proportional to the number of plasmid DNA in a cell. The plasmid pLM4 which codes spider Silk Protein 1 is digested with EcoRI followed by purification on an agarose gel. The vector pMAL-cRI (NEB) is digested with EcoRI as well followed by CIP (calf intestinal alkaline phosphatase, Boehringer-Mannheim) treatment, then purified on an agarose gel. Two separated fragments are ligated with T4-ligase (Promega) in the presence of 5% PEG8000 (polyethyleneglycol 8000, Sigma) for one hour at 37° C. Ligate is transformed to SURE™ competent cells (Stratagene) according to the instruction manual, then pored onto LB plate containing ampicillin, X-gal and IPTG. Proper oriented clones are screened by either restriction enzyme digestion or DNA sequencing. The plasmid pMH2 which codes Silk Protein 2 is digested with both BamHI and XbaI to excise out the cDNA followed by filling 5'-end overhangs with Klenow fragment of E. coli polymerase I (USB), then purified on an agarose gel as above. Expression vector, pMAL-c or pMAL-p, is digested with StuI to produce the blunt ends followed by CIP treatment and purification on an agarose gel as well. Two purified fragments are ligated with T4-ligase, and transformed in SURE competent cells. Either restriction enzyme digestion or DNA sequencing is carried out to determine the orientation of the insert. E. coli cells containing either pMAL-cRI or pMAL-c vector produce spider silk in cytosol, while E. coli cells containing pMAL-p vector excrete spider silk in peri-plasma. The former product is purified in the same manner as in Example 4, but the latter product is recovered by treating cells simply with lysozyme at the concentration of 0.1 mg/ml on ice for 30 min followed by centrifugation to recover supernatant. Recovered protein is a fused protein with a part of maltose binding protein. Using a part of maltose binding protein, with an affinity column which is provided from NEB with the vectors, fused protein is purified. The excess maltose binding protein is removed by digesting the fused protein with the factor Xa which recognizes and cut between the maltose binding protein and spider silk. Factor Xa is provided from NEB as well.
All publications, including U.S. Patents, referred to in this application are herein incorporated by reference.
The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the present invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims.
| ________________________________________________________ __________________ |
| SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 69 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2338 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephilia clavipes (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..2154 (D) OTHER INFORMATION: /product="Nephila clavipes dragline silk protein" (x) PUBLICATION INFORMATION: (A) AUTHORS: Xu, Ming Lewis, Randolph V. (B) TITLE: Structure of a protein superfiber: Spider drafline silk (C) JOURNAL: Proc. Natl. Acad. Sci. U.S.A. (D) VOLUME: 87 (F) PAGES: 7120-7124 (G) DATE: Sept.-1990 (K) RELEVANT RESIDUES IN SEQ ID NO:1: FROM 1 TO 2338 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: CAAGGGGCAGGTGCAGCAGCAGCAGCAGCTGGAGGTGCCGGACAAGGA48 GlnGlyAlaGlyAlaAlaAlaAlaAlaAlaGlyGlyAlaGlyGlnGly 151015 GGATATGGAGGTCTTGGTGGACAAGGAGCTGGTCAAGGTGGATATGGA96 GlyTyrGlyGlyLeuGlyGlyGlnGlyAlaGlyGlnGlyGlyTyrGly 202530 GGTCTTGGTGGACAAGGTGCCGGACAAGGAGCTGGTGCAGCCGCCGCA144 GlyLeuGlyGlyGlnGlyAlaGlyGlnGlyAlaGlyAlaAlaAlaAla 354045 GCAGCAGCTGGTGGTGCCGGACAAGGAGGATATGGAGGTCTTGGAAGC192 AlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlySer 505560 CAAGGTGCTGGACGAGGTGGACAAGGAGCTGGAGCAGCCGCTGCAGCT240 GlnGlyAlaGlyArgGlyGlyGlnGlyAlaGlyAlaAlaAlaAlaAla 65707580 GCGGGTGGTGCCGGACAAGGAGGTTATGGAGGTCTTGGAAGTCAAGGT288 AlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlySerGlnGly 859095 GCAGGACGAGGTGGATTAGGTGGACAAGGGGCAGGTGCAGCAGCCGCT336 AlaGlyArgGlyGlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAlaAla 100105110 GCAGCAGCTGGAGGTGCCGGACAAGGAGGATATGGAGGCCTTGGAAAC384 AlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlyAsn 115120125 CAAGGTGCTGGACGAGGTGGACAAGGTGCAGCAGCAGCAGCAGCTGGA432 GlnGlyAlaGlyArgGlyGlyGlnGlyAlaAlaAlaAlaAlaAlaGly 130135140 GGTGCTGGACAAGGAGGATATGGAGGTCTTGGAAGCCAAGGTGCAGGA480 GlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlySerGlnGlyAlaGly 145150155160 CGAGGTGGATTAGGTGGACAAGGTGCAGGTGCAGCAGCAGCAGCAGCC528 ArgGlyGlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAlaAlaAlaAla 165170175 GGAGGTGCTGGACAAGGCGGATACGGTGGTCTTGGTGGACAAGGTGCC576 GlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlyGlyGlnGlyAla 180185190 GGACAAGGAGGCTATGGAGGACTTGGAAGCCAAGGTGCTGGACGAGGA624 GlyGlnGlyGlyTyrGlyGlyLeuGlySerGlnGlyAlaGlyArgGly 195200205 GGATTAGGTGGACAAGGTGCAGGTGCAGCAGCAGCAGCAGCAGCTGGA672 GlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAlaAlaAlaAlaAlaGly 210215220 GGTGCCGGACAAGGAGGACTAGGTGGACAAGGTGCTGGACAAGGAGCT720 GlyAlaGlyGlnGlyGlyLeuGlyGlyGlnGlyAlaGlyGlnGlyAla 225230235240 GGAGCATCCGCTGCAGCAGCTGGTGGTGCCGGACAAGGAGGATATGGA768 GlyAlaSerAlaAlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGly 245250255 GGTCTTGGAAGCCAAGGTGCTGGACGAGGTGGAGAAGGTGCAGGCGCA816 GlyLeuGlySerGlnGlyAlaGlyArgGlyGlyGluGlyAlaGlyAla 260265270 GCCGCAGCAGCAGCCGGAGGTGCTGGACAAGGAGGATACGGTGGTCTT864 AlaAlaAlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeu 275280285 GGTGGACAAGGTGCCGGACAAGGAGGCTATGGAGGACTTGGAAGCCAA912 GlyGlyGlnGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlySerGln 290295300 GGTGCTGGACGAGGAGGATTAGGTGGACAAGGTGCAGGTGCAGCAGCA960 GlyAlaGlyArgGlyGlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAla 305310315320 GCTGGAGGTGCCGGGCAAGGAGGACTAGGTGGACAAGGTGCTGGACAA1008 AlaGlyGlyAlaGlyGlnGlyGlyLeuGlyGlyGlnGlyAlaGlyGln 325330335 GGAGCTGGAGCAGCCGCTGCAGCAGCTGGTGGTGCCGGACAAGGAGGA1056 GlyAlaGlyAlaAlaAlaAlaAlaAlaGlyGlyAlaGlyGlnGlyGly 340345350 TATGGAGGTCTTGGAAGCCAAGGTGCAGGACGAGGTGGATTAGGTGGA1104 TyrGlyGlyLeuGlySerGlnGlyAlaGlyArgGlyGlyLeuGlyGly 355360365 CAAGGGGCAGGTGCAGTAGCCGCTGCAGCAGCTGGAGGTGCCGGACAA1152 GlnGlyAlaGlyAlaValAlaAlaAlaAlaAlaGlyGlyAlaGlyGln 370375380 GGAGGATATGGAGGTCTTGGAAGCCAAGGTGCTGGACGAGGTGGACAA1200 GlyGlyTyrGlyGlyLeuGlySerGlnGlyAlaGlyArgGlyGlyGln 385390395400 GGAGCTGGAGCAGCCGCTGCAGCAGCTGGTGGTGCCGGACAAAGAGGT1248 GlyAlaGlyAlaAlaAlaAlaAlaAlaGlyGlyAlaGlyGlnArgGly 405410415 TATGGAGGTCTTGGAAATCAAGGTGCAGGACGAGGTGGATTAGGTGGA1296 TyrGlyGlyLeuGlyAsnGlnGlyAlaGlyArgGlyGlyLeuGlyGly 420425430 CAAGGGGCAGGTGCAGCAGCCGCTGCAGCAGCTGGAGGTGCCGGACAA1344 GlnGlyAlaGlyAlaAlaAlaAlaAlaAlaAlaGlyGlyAlaGlyGln 435440445 GGAGGATATGGAGGCCTTGGAAACCAAGGTGCTGGACGAGGTGGACAA1392 GlyGlyTyrGlyGlyLeuGlyAsnGlnGlyAlaGlyArgGlyGlyGln 450455460 GGTGCAGCAGCAGCAGCTGGAGGTGCCGGACAAGGAGGATATGGAGGT1440 GlyAlaAlaAlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGly 465470475480 CTTGGAAGCCAAGGTGCTGGACGAGGTGGACAAGGTGCAGGCGCAGCC1488 LeuGlySerGlnGlyAlaGlyArgGlyGlyGlnGlyAlaGlyAlaAla 485490495 GCAGCAGCAGCCGTAGGTGCTGGACAAGAAGGAATACGTGGACAAGGT1536 AlaAlaAlaAlaValGlyAlaGlyGlnGluGlyIleArgGlyGlnGly 500505510 GCCGGACAAGGAGGCTATGGAGGACTTGGAAGCCAAGGTTCTGGTCGA1584 AlaGlyGlnGlyGlyTyrGlyGlyLeuGlySerGlnGlySerGlyArg 515520525 GGAGGATTAGGTGGACAAGGTGCAGGTGCAGCAGCAGCAGCAGCTGGA1632 GlyGlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAlaAlaAlaAlaGly 530535540 GGTGCTGGACAAGGAGGATTAGGTGGACAAGGTGCTGGACAAGGAGCT1680 GlyAlaGlyGlnGlyGlyLeuGlyGlyGlnGlyAlaGlyGlnGlyAla 545550555560 GGAGCAGCCGCTGCAGCAGCTGGTGGTGTTAGACAAGGAGGATATGGA1728 GlyAlaAlaAlaAlaAlaAlaGlyGlyValArgGlnGlyGlyTyrGly 565570575 GGTCTTGGAAGCCAAGGTGCTGGACGAGGTGGACAAGGTGCAGGCGCA1776 GlyLeuGlySerGlnGlyAlaGlyArgGlyGlyGlnGlyAlaGlyAla 580585590 GCCGCAGCAGCAGCCGGAGGTGCTGGACAAGGAGGATATGGTGGTCTT1824 AlaAlaAlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeu 595600605 GGTGGACAAGGTGTTGGCCGAGGTGGATTAGGTGGACAGGGTGCAGGC1872 GlyGlyGlnGlyValGlyArgGlyGlyLeuGlyGlyGlnGlyAlaGly 610615620 GCAGCGGCAGCTGGTGGTGCTGGACAAGGAGGATATGGTGGTGTTGGT1920 AlaAlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyValGly 625630635640 TCTGGGGCGTCTGCTGCCTCTGCAGCTGCATCCCGGTTGTCTTCTCCT1968 SerGlyAlaSerAlaAlaSerAlaAlaAlaSerArgLeuSerSerPro 645650655 CAAGCTAGTTCAAGAGTTTCATCAGCTGTTTCCAACTTGGTTGCAAGT2016 GlnAlaSerSerArgValSerSerAlaValSerAsnLeuValAlaSer 660665670 GGTCCTACTAATTCTGCGGCCTTGTCAAGTACAATCAGTAACGTGGTT2064 GlyProThrAsnSerAlaAlaLeuSerSerThrIleSerAsnValVal 675680685 TCACAAATTGGCGCCAGCATCCTGGTCTTTCTGGATGTGATGTCCTCA2112 SerGlnIleGlyAlaSerIleLeuValPheLeuAspValMetSerSer 690695700 TTCAAGCTCTTCTCGAGGTTGTTTCTGCTCTTATCCAGATCT2154 PheLysLeuPheSerArgLeuPheLeuLeuLeuSerArgSer 705710715 TAGGTTCTTCCAGCATCGGCCAAGTTAACTATGGTTCCGCTGGACAAGCCACTCAGATCG 2214 TTGGTCAATCAGTTTATCAAGCCCTAGGTTAAATGTAAAATCAAGAGTTGCTAAAACTTA 2274 ATGAACTCGGGCTGTTTATTTGTGTTAGGTTTTAAAATATTTTCAATAAATATTATGCAT 2334 ATAA2338 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 718 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: GlnGlyAlaGlyAlaAlaAlaAlaAlaAlaGlyGlyAlaGlyGlnGly 151015 GlyTyrGlyGlyLeuGlyGlyGlnGlyAlaGlyGlnGlyGlyTyrGly 202530 GlyLeuGlyGlyGlnGlyAlaGlyGlnGlyAlaGlyAlaAlaAlaAla 354045 AlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlySer 505560 GlnGlyAlaGlyArgGlyGlyGlnGlyAlaGlyAlaAlaAlaAlaAla 65707580 AlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlySerGlnGly 859095 AlaGlyArgGlyGlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAlaAla 100105110 AlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlyAsn 115120125 GlnGlyAlaGlyArgGlyGlyGlnGlyAlaAlaAlaAlaAlaAlaGly 130135140 GlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlySerGlnGlyAlaGly 145150155160 ArgGlyGlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAlaAlaAlaAla 165170175 GlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlyGlyGlnGlyAla 180185190 GlyGlnGlyGlyTyrGlyGlyLeuGlySerGlnGlyAlaGlyArgGly 195200205 GlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAlaAlaAlaAlaAlaGly 210215220 GlyAlaGlyGlnGlyGlyLeuGlyGlyGlnGlyAlaGlyGlnGlyAla 225230235240 GlyAlaSerAlaAlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGly 245250255 GlyLeuGlySerGlnGlyAlaGlyArgGlyGlyGluGlyAlaGlyAla 260265270 AlaAlaAlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeu 275280285 GlyGlyGlnGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlySerGln 290295300 GlyAlaGlyArgGlyGlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAla 305310315320 AlaGlyGlyAlaGlyGlnGlyGlyLeuGlyGlyGlnGlyAlaGlyGln 325330335 GlyAlaGlyAlaAlaAlaAlaAlaAlaGlyGlyAlaGlyGlnGlyGly 340345350 TyrGlyGlyLeuGlySerGlnGlyAlaGlyArgGlyGlyLeuGlyGly 355360365 GlnGlyAlaGlyAlaValAlaAlaAlaAlaAlaGlyGlyAlaGlyGln 370375380 GlyGlyTyrGlyGlyLeuGlySerGlnGlyAlaGlyArgGlyGlyGln 385390395400 GlyAlaGlyAlaAlaAlaAlaAlaAlaGlyGlyAlaGlyGlnArgGly 405410415 TyrGlyGlyLeuGlyAsnGlnGlyAlaGlyArgGlyGlyLeuGlyGly 420425430 GlnGlyAlaGlyAlaAlaAlaAlaAlaAlaAlaGlyGlyAlaGlyGln 435440445 GlyGlyTyrGlyGlyLeuGlyAsnGlnGlyAlaGlyArgGlyGlyGln 450455460 GlyAlaAlaAlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGly 465470475480 LeuGlySerGlnGlyAlaGlyArgGlyGlyGlnGlyAlaGlyAlaAla 485490495 AlaAlaAlaAlaValGlyAlaGlyGlnGluGlyIleArgGlyGlnGly 500505510 AlaGlyGlnGlyGlyTyrGlyGlyLeuGlySerGlnGlySerGlyArg 515520525 GlyGlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAlaAlaAlaAlaGly 530535540 GlyAlaGlyGlnGlyGlyLeuGlyGlyGlnGlyAlaGlyGlnGlyAla 545550555560 GlyAlaAlaAlaAlaAlaAlaGlyGlyValArgGlnGlyGlyTyrGly 565570575 GlyLeuGlySerGlnGlyAlaGlyArgGlyGlyGlnGlyAlaGlyAla 580585590 AlaAlaAlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeu 595600605 GlyGlyGlnGlyValGlyArgGlyGlyLeuGlyGlyGlnGlyAlaGly 610615620 AlaAlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyValGly 625630635640 SerGlyAlaSerAlaAlaSerAlaAlaAlaSerArgLeuSerSerPro 645650655 GlnAlaSerSerArgValSerSerAlaValSerAsnLeuValAlaSer 660665670 GlyProThrAsnSerAlaAlaLeuSerSerThrIleSerAsnValVal 675680685 SerGlnIleGlyAlaSerIleLeuValPheLeuAspValMetSerSer 690695700 PheLysLeuPheSerArgLeuPheLeuLeuLeuSerArgSer 705710715 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1995 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (vii) IMMEDIATE SOURCE: (B) CLONE: p6B (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1785 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: CCTGGAGGATATGGACCAGGACAACAAGGCCCAGGAGGATATGGCCCT48 ProGlyGlyTyrGlyProGlyGlnGlnGlyProGlyGlyTyrGlyPro 151015 GGACAACAAGGACCATCTGGACCTGGCAGTGCCGCTGCAGCAGCAGCA96 GlyGlnGlnGlyProSerGlyProGlySerAlaAlaAlaAlaAlaAla 202530 GCCGCCGCAGCAGGACCTGGAGGATATGGCCCTGGACAACAAGGACCC144 AlaAlaAlaAlaGlyProGlyGlyTyrGlyProGlyGlnGlnGlyPro 354045 GGAGGATATGGACCAGGACAACAAGGACCCGGAAGATATGGACCAGGA192 GlyGlyTyrGlyProGlyGlnGlnGlyProGlyArgTyrGlyProGly 505560 CAACAAGGACCATCTGGACCTGGCAGTGCCGCTGCAGCCGCAGCAGGA240 GlnGlnGlyProSerGlyProGlySerAlaAlaAlaAlaAlaAlaGly 65707580 TCTGGACAACAAGGCCCAGGAGGATATGGACCACGTCAACAAGGTCCA288 SerGlyGlnGlnGlyProGlyGlyTyrGlyProArgGlnGlnGlyPro 859095 GGAGGTTATGGACAAGGACAACAAGGACCATCTGGACCAGGCAGTGCA336 GlyGlyTyrGlyGlnGlyGlnGlnGlyProSerGlyProGlySerAla 100105110 GCCGCAGCCTCAGCCGCAGCCTCAGCAGAATCTGGACAACAAGGCCCA384 AlaAlaAlaSerAlaAlaAlaSerAlaGluSerGlyGlnGlnGlyPro 115120125 GGAGGTTATGGACCAGGTCAACAAGGCCCAGGAGGTTATGGACCAGGT432 GlyGlyTyrGlyProGlyGlnGlnGlyProGlyGlyTyrGlyProGly 130135140 CAACAAGGTCCTGGAGGATATGGACCAGGACAACAAGGACCATCTGGA480 GlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGlyProSerGly 145150155160 CCAGGTAGTGCCGCTGCAGCAGCCGCCGCCGCATCAGGACCTGGACAA528 ProGlySerAlaAlaAlaAlaAlaAlaAlaAlaSerGlyProGlyGln 165170175 CAAGGACCAGGAGGATATGGACCAGGTCAACAAGGTCCTGGAGGATAT576 GlnGlyProGlyGlyTyrGlyProGlyGlnGlnGlyProGlyGlyTyr 180185190 GGACCAGGACAACAAGGACCATCTGGACCAGGTAGTGCCGCTGCAGCC624 GlyProGlyGlnGlnGlyProSerGlyProGlySerAlaAlaAlaAla 195200205 GCCGCCGCCGCATCAGGACCTGGACAACAAGGACCAGGAGGATATGGA672 AlaAlaAlaAlaSerGlyProGlyGlnGlnGlyProGlyGlyTyrGly 210215220 CCAGGTCAACAAGGTCCAGGAGGTTATGGACCAGGACAACAAGGACTA720 ProGlyGlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGlyLeu 225230235240 TCTGGACCAGGCAGTGCAGCTGCAGCAGCCGCAGCAGGACCTGGACAA768 SerGlyProGlySerAlaAlaAlaAlaAlaAlaAlaGlyProGlyGln 245250255 CAAGGACCCGGAGGATATGGACCAGGACAACAAGGACCATCTGGACCC816 GlnGlyProGlyGlyTyrGlyProGlyGlnGlnGlyProSerGlyPro 260265270 GGTAGTGCCGCTGCAGCAGCAGCCGCCGCAGCAGGACCTGGAGGATAT864 GlySerAlaAlaAlaAlaAlaAlaAlaAlaAlaGlyProGlyGlyTyr 275280285 GGCCCTGGACAACAAGGACCCGGAGGATATGGACCAGGACAACAAGGA912 GlyProGlyGlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGly 290295300 CCATCTGGAGCAGGCAGTGCAGCAGCAGCAGCCGCAGCAGGACCTGGA960 ProSerGlyAlaGlySerAlaAlaAlaAlaAlaAlaAlaGlyProGly 305310315320 CAACAAGGATTAGGAGGTTATGGACCAGGACAACAAGGTCCAGGAGGA1008 GlnGlnGlyLeuGlyGlyTyrGlyProGlyGlnGlnGlyProGlyGly 325330335 TATGGACCAGGACAACAAGGTCCAGGAGGATATGGACCAGGTAGTGCA1056 TyrGlyProGlyGlnGlnGlyProGlyGlyTyrGlyProGlySerAla 340345350 TCTGCAGCAGCAGCCGCAGCAGGACCTGGACAACAAGGACCAGGAGGA1104 SerAlaAlaAlaAlaAlaAlaGlyProGlyGlnGlnGlyProGlyGly 355360365 TATGGACCTGGACAACAAGGACCATCTGGACCAGGCAGTGCATCTGCA1152 TyrGlyProGlyGlnGlnGlyProSerGlyProGlySerAlaSerAla 370375380 GCAGCAGCCGCAGCCGCAGCAGGACCAGGAGGATATGGACCAGGACAA1200 AlaAlaAlaAlaAlaAlaAlaGlyProGlyGlyTyrGlyProGlyGln 385390395400 CAAGGTCCAGGAGGATATGCACCAGGACAACAAGGACCATCTGGACCA1248 GlnGlyProGlyGlyTyrAlaProGlyGlnGlnGlyProSerGlyPro 405410415 GGCAGTGCATCTGCAGCAGCAGCCGCAGCCGCAGCAGGACCAGGAGGA1296 GlySerAlaSerAlaAlaAlaAlaAlaAlaAlaAlaGlyProGlyGly 420425430 TATGGACCAGGACAACAAGGTCCAGGAGGATATGCACCAGGACAACAA1344 TyrGlyProGlyGlnGlnGlyProGlyGlyTyrAlaProGlyGlnGln 435440445 GGACCATCTGGACCAGGCAGTGCAGCAGCAGCAGCAGCTGCCAGTGCA1392 GlyProSerGlyProGlySerAlaAlaAlaAlaAlaAlaAlaSerAla 450455460 GGACCTGGTGGATATGGACCAGCGCAACAGGGACCATCTGGTCCTGGA1440 GlyProGlyGlyTyrGlyProAlaGlnGlnGlyProSerGlyProGly 465470475480 ATCGCAGCTTCAGCTGCTTCAGCAGGACCTGGAGGTTATGGACCAGCA1488 IleAlaAlaSerAlaAlaSerAlaGlyProGlyGlyTyrGlyProAla 485490495 CAACAAGGACCAGCTGGATATGGGCCTGGAAGCGCAGTAGCAGCCTCT1536 GlnGlnGlyProAlaGlyTyrGlyProGlySerAlaValAlaAlaSer 500505510 GCCGGTGCAGGATCTGCAGGTTATGGGCCAGGTTCTCAAGCTTCCGCT1584 AlaGlyAlaGlySerAlaGlyTyrGlyProGlySerGlnAlaSerAla 515520525 GCAGCTTCTCGTCTGGCTTCTCCAGATTCAGGCGCTAGAGTTGCATCA1632 AlaAlaSerArgLeuAlaSerProAspSerGlyAlaArgValAlaSer 530535540 GCTGTTTCTAACTTGGTATCCAGTGGCCCAACTAGCTCTGCTGCCTTA1680 AlaValSerAsnLeuValSerSerGlyProThrSerSerAlaAlaLeu 545550555560 TCAAGTGTTATCAGTAACGCTGTGTCTCAAATTGGCGCAAGTAATCCT1728 SerSerValIleSerAsnAlaValSerGlnIleGlyAlaSerAsnPro 565570575 GGTCTCTCTGGTTGCGATGTCCTCATTCAAGCTCTCTGGAAATCGTTT1776 GlyLeuSerGlyCysAspValLeuIleGlnAlaLeuTrpLysSerPhe 580585590 CTGCTTGTGTAACCATCCTTTCTTCATCCAGCATTGGTCAAGTTAATT1824 LeuLeuVal 595 ATGGAGCGGCTTCTCAGTTCGCCCAAGTTGTCGGCCAATCTGTTTTGA1872 GTGCATTTTAATTGAAAAATTTATTAAAATATGCATGGATTTTCTAGC1920 CTGGGCAACTAATTGCTCGTACTATGTAATTTTTTTTTAAATAAATTC1968 TTTGCAACTTCTAAAAAAAAAAAAAAA1995 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 595 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: ProGlyGlyTyrGlyProGlyGlnGlnGlyProGlyGlyTyrGlyPro 151015 GlyGlnGlnGlyProSerGlyProGlySerAlaAlaAlaAlaAlaAla 202530 AlaAlaAlaAlaGlyProGlyGlyTyrGlyProGlyGlnGlnGlyPro 354045 GlyGlyTyrGlyProGlyGlnGlnGlyProGlyArgTyrGlyProGly 505560 GlnGlnGlyProSerGlyProGlySerAlaAlaAlaAlaAlaAlaGly 65707580 SerGlyGlnGlnGlyProGlyGlyTyrGlyProArgGlnGlnGlyPro 859095 GlyGlyTyrGlyGlnGlyGlnGlnGlyProSerGlyProGlySerAla 100105110 AlaAlaAlaSerAlaAlaAlaSerAlaGluSerGlyGlnGlnGlyPro 115120125 GlyGlyTyrGlyProGlyGlnGlnGlyProGlyGlyTyrGlyProGly 130135140 GlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGlyProSerGly 145150155160 ProGlySerAlaAlaAlaAlaAlaAlaAlaAlaSerGlyProGlyGln 165170175 GlnGlyProGlyGlyTyrGlyProGlyGlnGlnGlyProGlyGlyTyr 180185190 GlyProGlyGlnGlnGlyProSerGlyProGlySerAlaAlaAlaAla 195200205 AlaAlaAlaAlaSerGlyProGlyGlnGlnGlyProGlyGlyTyrGly 210215220 ProGlyGlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGlyLeu 225230235240 SerGlyProGlySerAlaAlaAlaAlaAlaAlaAlaGlyProGlyGln 245250255 GlnGlyProGlyGlyTyrGlyProGlyGlnGlnGlyProSerGlyPro 260265270 GlySerAlaAlaAlaAlaAlaAlaAlaAlaAlaGlyProGlyGlyTyr 275280285 GlyProGlyGlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGly 290295300 ProSerGlyAlaGlySerAlaAlaAlaAlaAlaAlaAlaGlyProGly 305310315320 GlnGlnGlyLeuGlyGlyTyrGlyProGlyGlnGlnGlyProGlyGly 325330335 TyrGlyProGlyGlnGlnGlyProGlyGlyTyrGlyProGlySerAla 340345350 SerAlaAlaAlaAlaAlaAlaGlyProGlyGlnGlnGlyProGlyGly 355360365 TyrGlyProGlyGlnGlnGlyProSerGlyProGlySerAlaSerAla 370375380 AlaAlaAlaAlaAlaAlaAlaGlyProGlyGlyTyrGlyProGlyGln 385390395400 GlnGlyProGlyGlyTyrAlaProGlyGlnGlnGlyProSerGlyPro 405410415 GlySerAlaSerAlaAlaAlaAlaAlaAlaAlaAlaGlyProGlyGly 420425430 TyrGlyProGlyGlnGlnGlyProGlyGlyTyrAlaProGlyGlnGln 435440445 GlyProSerGlyProGlySerAlaAlaAlaAlaAlaAlaAlaSerAla 450455460 GlyProGlyGlyTyrGlyProAlaGlnGlnGlyProSerGlyProGly 465470475480 IleAlaAlaSerAlaAlaSerAlaGlyProGlyGlyTyrGlyProAla 485490495 GlnGlnGlyProAlaGlyTyrGlyProGlySerAlaValAlaAlaSer 500505510 AlaGlyAlaGlySerAlaGlyTyrGlyProGlySerGlnAlaSerAla 515520525 AlaAlaSerArgLeuAlaSerProAspSerGlyAlaArgValAlaSer 530535540 AlaValSerAsnLeuValSerSerGlyProThrSerSerAlaAlaLeu 545550555560 SerSerValIleSerAsnAlaValSerGlnIleGlyAlaSerAsnPro 565570575 GlyLeuSerGlyCysAspValLeuIleGlnAlaLeuTrpLysSerPhe 580585590 LeuLeuVal 595 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephila clavipes (ix) FEATURE: (A) NAME/KEY: Duplication (B) LOCATION: 1..21 (D) OTHER INFORMATION: /label=repeat |
| ________________________________________________________ __________________ |
| unit /note="spider silk protein repeat unit" (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 1..6 (D) OTHER INFORMATION: /label=alanine |
| ________________________________________________________ __________________ |
| stretch /note="this segment of alanines in the repeat unit can also contain 7 alanine residues." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: AlaAlaAlaAlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGly 151015 LeuGlyGlyGlnGly 20 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..33 (D) OTHER INFORMATION: /label=representative /note="This peptide is a representative one that illustrates the ggxgyg hexamer repeat motif of the spider silk protein I." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: GlyGlyGlnGlyAlaGlyAlaAlaAlaAlaGlyGlyAlaGlyGlnGly 151015 GlyTyrGlyGlyValGlySerGlyAlaSerAlaAlaSerAlaAlaAla 202530 Ser (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..33 (D) OTHER INFORMATION: /label=repeat |
| ________________________________________________________ __________________ |
| unit /note="The protein of the present invention is constituted primarily of repeats of this sequence." (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 13..18 (D) OTHER INFORMATION: /label=alanine |
| ________________________________________________________ __________________ |
| stretch /note="This run of alanine residues can also have 7 residues." (ix) FEATURE: (A) NAME/KEY: Variable amino acid (B) LOCATION: 6 (D) OTHER INFORMATION: /label=modified |
| ________________________________________________________ __________________ |
| a.a. /note="This residue can be leucine, tyrosine or Glutamine" (ix) FEATURE: (A) NAME/KEY: Variable amino acid (B) LOCATION: 9 (D) OTHER INFORMATION: /label=modified |
| ________________________________________________________ __________________ |
| a.a. /note="This residue can be leucine, tyrosine or glutamine and must be a different amino acid than position 6" (ix) FEATURE: (A) NAME/KEY: Variable amino acid (B) LOCATION: 26 (D) OTHER INFORMATION: /label=modified |
| ________________________________________________________ __________________ |
| a.a. /note="This residue can be leucine, tyrosine or glutamine" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: AlaGlyArgGlyGlyXaaGlyGlyXaaGlyAlaGlyAlaAlaAlaAla 151015 AlaAlaGlyGlyAlaGlyGlnGlyGlyXaaGlyGlyLeuGlyGlyGln 202530 Gly (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..22 (D) OTHER INFORMATION: /label=B |
| ________________________________________________________ __________________ |
| turn |
| ________________________________________________________ __________________ |
| repeat /note="Beta turn repeat unit in spider silk protein 2." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: GlyProGlyGlnGlnGlyProGlyTyrTyrGlyProGlyGlnGlnGly 151015 ProSerGlyProGlySer 20 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..5 (D) OTHER INFORMATION: /label=repeat |
| ________________________________________________________ __________________ |
| unit /note="first variable region repeat motif of spider silk protein 2." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: GlyProGlyGlyTyr 15 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..5 (D) OTHER INFORMATION: /label=repeat |
| ________________________________________________________ __________________ |
| unit /note="second variable region repeat motif in spider silk protein 2." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: GlyProGlyGlnGln 15 (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..9 (D) OTHER INFORMATION: /label=1st |
| ________________________________________________________ __________________ |
| segment /note="first segment of spider silk protein repeats." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: AlaGlyArgGlyGlyLeuGlyGlyGln 15 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..9 (D) OTHER INFORMATION: /label=2nd |
| ________________________________________________________ __________________ |
| segment /note="Second segment of spider silk protein repeat unit. This segment is present in all repeats." (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 4..9 (D) OTHER INFORMATION: /label=alanine |
| ________________________________________________________ __________________ |
| stretch /note="This run of alanines can also contain 7 alanines." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: GlyAlaGlyAlaAlaAlaAlaAlaAla 15 (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..15 (D) OTHER INFORMATION: /label=3rd |
| ________________________________________________________ __________________ |
| segment /note="Third segment of repeat unit of spider silk protein." (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 13 (D) OTHER INFORMATION: /label=variable /note="This amino acid can also be serine, asparagine or alanine" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: GlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlyGlyGlnGly 151015 (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..5 (D) OTHER INFORMATION: /label=fragment /note="fragment of sequence from Nephila dragline silk protein." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: GlyTyrGlyProGly 15 (2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..5 (D) OTHER INFORMATION: /label=fragment /note="fragment of sequence from Nephila dragline silk protein." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: GlyGlnGlyAlaGly 15 (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..5 (D) OTHER INFORMATION: /label=fragment /note="fragment of sequence from Nephila dragline silk protein." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: GlyAlaGlyGlnGly 15 (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..6 (D) OTHER INFORMATION: /label=fragment /note="fragment of sequence from Nephila dragline silk protein." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: GlyTyrGlyGlyLeuGly 15 (2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 4 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..4 (D) OTHER INFORMATION: /label=fragment /note="fragment of sequence from Nephila coccoon silk protein." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: SerAlaPheGln (2) INFORMATION FOR SEQ ID NO:19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 10 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Araneus gemmoides (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..10 (D) OTHER INFORMATION: /label=fragment /note="fragment of sequence from Araneus dragline silk protein." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: GlyProTyrGlyProGlyGlnGlnGlyPro 1510 (2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 4 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Araneus gemmoides (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..4 (D) OTHER INFORMATION: /label=fragment /note="fragment of sequence from Araneus coccoon silk protein." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: PheLeuGlyGly 1 (2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 10 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Araneus gemmoides (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..10 (D) OTHER INFORMATION: /label=fragment /note="fragment of sequence from Araneus coccoon silk protein." (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 6 (D) OTHER INFORMATION: /label=leucine /note="This amino acid can also be isoleucine." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: SerValGlyLeuValLeuAlaTyrAlaLeu 1510 (2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: YES (ix) FEATURE: (A) NAME/KEY: - (B) LOCATION: 1..14 (D) OTHER INFORMATION: /label=oligonucleotide /note="Synthetic degenerate oligonucleotide for screening Nephila clavipes cDNA library." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: CCNCGNCCNGTYCC14 (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: - (B) LOCATION: group(1..21, 41..57) (D) OTHER INFORMATION: /label=vector /note="Bluescript SK+vector sequence." (ix) FEATURE: (A) NAME/KEY: - (B) LOCATION: 22..41 (D) OTHER INFORMATION: /label=insert /note="insert segment shown in box, page 16, line 37 of Specification. "nnnn"region is approximately 2.0 kilobases." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: GATATCGAATTCCTGCAGCCCCAGGNNNNNNNNNNNNNGGGATCCACTAGTTCTAG A57 (2) INFORMATION FOR SEQ ID NO:24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: - (B) LOCATION: 1..24 (D) OTHER INFORMATION: /label=vector /note="portion of the sequence of the pGEM3Z cloning vector" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: AGGTCGACTCTAGAGGATCCCCGG24 (2) INFORMATION FOR SEQ ID NO:25: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: YES (ix) FEATURE: (A) NAME/KEY: - (B) LOCATION: 1..14 (D) OTHER INFORMATION: /label=oligonucleotide /note="oligonucleotide derived from reverse translation of GYGPG pentapeptide from Nephila clavipes silk protein 2" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: CCNGGNCCATANCC14 (2) INFORMATION FOR SEQ ID NO:26: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 47 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..47 (D) OTHER INFORMATION: /label=silk2 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: GlyProGlyGlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGly 151015 ProSerGlyProGlySerAlaAlaAlaAlaAlaAlaAlaAlaAlaAla 202530 GlyProGlyGlyTyrGlyProGlyGlnGlnGlyProGlyGlyTyr 354045 (2) INFORMATION FOR SEQ ID NO:27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 38 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..38 (D) OTHER INFORMATION: /label=silk2 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: GlyProGlyGlnGlnGlyProGlyArgTyrGlyProGlyGlnGlnGly 151015 ProSerGlyProGlySerAlaAlaAlaAlaAlaAlaGlySerGlyGln 202530 GlnGlyProGlyGlyTyr 35 (2) INFORMATION FOR SEQ ID NO:28: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 52 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..52 (D) OTHER INFORMATION: /label=silk2 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28: GlyProArgGlnGlnGlyProGlyGlyTyrGlyGlnGlyGlnGlnGly 151015 ProSerGlyProGlySerAlaAlaAlaAlaSerAlaAlaAlaSerAla 202530 GluSerGlyGlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGly 354045 ProGlyGlyTyr 50 (2) INFORMATION FOR SEQ ID NO:29: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..41 (D) OTHER INFORMATION: /label=silk2 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29: GlyProGlyGlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGly 151015 ProSerGlyProGlySerAlaAlaAlaAlaAlaAlaAlaAlaSerGly 202530 ProGlyGlnGlnGlyProGlyGlyTyr 3540 (2) INFORMATION FOR SEQ ID NO:30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..40 (D) OTHER INFORMATION: /label=silk2 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30: GlyProGlyGlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGly 151015 ProSerGlyProGlySerAlaAlaAlaAlaAlaAlaAlaSerGlyPro 202530 GlyGlnGlnGlyProGlyGlyTyr 3540 (2) INFORMATION FOR SEQ ID NO:31: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..29 (D) OTHER INFORMATION: /label=silk2 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31: GlyProGlyGlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGly 151015 LeuSerGlyProGlySerAlaAlaAlaAlaAlaAlaAla 2025 (2) INFORMATION FOR SEQ ID NO:32: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..36 (D) OTHER INFORMATION: /label=silk2 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32: GlyProGlyGlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGly 151015 ProSerGlyProGlySerAlaAlaAlaAlaAlaAlaAlaAlaAlaGly 202530 ProGlyGlyTyr 35 (2) INFORMATION FOR SEQ ID NO:33: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 39 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..39 (D) OTHER INFORMATION: /label=silk2 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33: GlyProGlyGlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGly 151015 ProSerGlyAlaGlySerAlaAlaAlaAlaAlaAlaAlaGlyProGly 202530 GlnGlnGlyLeuGlyGlyTyr 35 (2) INFORMATION FOR SEQ ID NO:34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..32 (D) OTHER INFORMATION: /label=silk2 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34: GlyProGlyGlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGly 151015 ProGlyGlyTyrGlyProGlySerAlaSerAlaAlaAlaAlaAlaAla 202530 (2) INFORMATION FOR SEQ ID NO:35: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 37 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..37 (D) OTHER INFORMATION: /label=silk2 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35: GlyProGlyGlnGlnGlyProGlyGlyTyrGlyProGlyGlnGlnGly 151015 ProSerGlyProGlySerAlaSerAlaAlaAlaAlaAlaAlaAlaAla 202530 GlyProGlyGlyTyr 35 (2) INFORMATION FOR SEQ ID NO:36: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 37 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..37 (D) OTHER INFORMATION: /label=silk2 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36: GlyProGlyGlnGlnGlyProGlyGlyTyrAlaProGlyGlnGlnGly 151015 ProSerGlyProGlySerAlaSerAlaAlaAlaAlaAlaAlaAlaAla 202530 GlyProGlyGlyTyr 35 (2) INFORMATION FOR SEQ ID NO:37: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..36 (D) OTHER INFORMATION: /label=silk2 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37: GlyProGlyGlnGlnGlyProGlyGlyTyrAlaProGlyGlnGlnGly 151015 ProSerGlyProGlySerAlaAlaAlaAlaAlaAlaAlaSerAlaGly 202530 ProGlyGlyTyr 35 (2) INFORMATION FOR SEQ ID NO:38: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..25 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38: GlnGlyAlaGlyAlaAlaAlaAlaAlaAlaGlyGlyAlaGlyGlnGly 151015 GlyTyrGlyGlyLeuGlyGlyGlnGly 2025 (2) INFORMATION FOR SEQ ID NO:39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..13 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39: AlaGlyGlnGlyGlyTyrGlyGlyLeuGlyGlyGlnGly 1510 (2) INFORMATION FOR SEQ ID NO:40: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..28 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40: AlaGlyGlnGlyAlaGlyAlaAlaAlaAlaAlaAlaAlaGlyGlyAla 151015 GlyGlnGlyGlyTyrGlyGlyLeuGlySerGlnGly 2025 (2) INFORMATION FOR SEQ ID NO:41: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..30 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41: AlaGlyArgGlyGlyGlnGlyAlaGlyAlaAlaAlaAlaAlaAlaGly 151015 GlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlySerGlnGly 202530 (2) INFORMATION FOR SEQ ID NO:42: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..34 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42: AlaGlyArgGlyGlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAlaAla 151015 AlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlyAsn 202530 GlnGly (2) INFORMATION FOR SEQ ID NO:43: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..28 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43: AlaGlyArgGlyGlyGlnGlyAlaAlaAlaAlaAlaAlaGlyGlyAla 151015 GlyGlnGlyGlyTyrGlyGlyLeuGlySerGlnGly 2025 (2) INFORMATION FOR SEQ ID NO:44: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..32 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44: AlaGlyArgGlyGlyLeuGlyGlyGlnAlaGlyAlaAlaAlaAlaAla 151015 AlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlyGlyGlnGly 202530 (2) INFORMATION FOR SEQ ID NO:45: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..13 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45: AlaGlyGlnGlyGlyTyrGlyGlyLeuGlySerGlnGly 1510 (2) INFORMATION FOR SEQ ID NO:46: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 31 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..31 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46: AlaGlyArgGlyGlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAlaAla 151015 AlaAlaAlaGlyGlyAlaGlyGlnGlyGlyLeuGlyGlyGlnGly 202530 (2) INFORMATION FOR SEQ ID NO:47: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..27 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47: AlaGlyGlnGlyAlaGlyAlaSerAlaAlaAlaAlaGlyGlyAlaGly 151015 GlnGlyGlyTyrGlyGlyLeuGlySerGlnGly 2025 (2) INFORMATION FOR SEQ ID NO:48: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..30 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48: AlaGlyArgGlyGlyGluGlyAlaGlyAlaAlaAlaAlaAlaAlaGly 151015 GlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlyGlyGlnGly 202530 (2) INFORMATION FOR SEQ ID NO:49: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..13 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49: AlaGlyGlnGlyGlyTyrGlyGlyLeuGlySerGlnGly 1510 (2) INFORMATION FOR SEQ ID NO:50: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..28 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50: AlaGlyArgGlyGlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAlaAla 151015 GlyGlyAlaGlyGlnGlyGlyLeuGlyGlyGlnGly 2025 (2) INFORMATION FOR SEQ ID NO:51: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..27 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51: AlaGlyGlnGlyAlaGlyAlaAlaAlaAlaAlaAlaGlyGlyAlaGly 151015 GlnGlyGlyTyrGlyGlyLeuGlySerGlnGly 2025 (2) INFORMATION FOR SEQ ID NO:52: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..34 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52: AlaGlyArgGlyGlyLeuGlyGlyGlnGlyAlaGlyAlaValAlaAla 151015 AlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlySer 202530 GlnGly (2) INFORMATION FOR SEQ ID NO:53: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..30 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53: AlaGlyArgGlyGlyGlnGlyAlaGlyAlaAlaAlaAlaAlaAlaGly 151015 GlyAlaGlyGlnArgGlyTyrGlyGlyLeuGlyAsnGlnGly 202530 (2) INFORMATION FOR SEQ ID NO:54: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..34 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54: AlaGlyArgGlyGlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAlaAla 151015 AlaAlaAlaGlyGlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlyAsn 202530 GlnGly (2) INFORMATION FOR SEQ ID NO:55: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..27 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55: AlaGlyArgGlyGlyGlnGlyAlaAlaAlaAlaAlaGlyGlyAlaGly 151015 GlnGlyGlyTyrGlyGlyLeuGlySerGlnGly 2025 (2) INFORMATION FOR SEQ ID NO:56: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..27 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56: AlaGlyArgGlyGlyGlnGlyAlaGlyAlaAlaAlaAlaAlaAlaVal 151015 GlyAlaGlyGlnGluGlyIleArgGlyGlnGly 2025 (2) INFORMATION FOR SEQ ID NO:57: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..13 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57: AlaGlyGlnGlyGlyTyrGlyGlyLeuGlySerGlnGly 1510 (2) INFORMATION FOR SEQ ID NO:58: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..30 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58: SerGlyArgGlyGlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAlaAla 151015 AlaAlaGlyGlyAlaGlyGlnGlyGlyLeuGlyGlyGlnGly 202530 (2) INFORMATION FOR SEQ ID NO:59: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..27 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59: AlaGlyGlnGlyAlaGlyAlaAlaAlaAlaAlaAlaGlyGlyValArg 151015 GlnGlyGlyTyrGlyGlyLeuGlySerGlnGly 2025 (2) INFORMATION FOR SEQ ID NO:60: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..30 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60: AlaGlyArgGlyGlyGlnGlyAlaGlyAlaAlaAlaAlaAlaAlaGly 151015 GlyAlaGlyGlnGlyGlyTyrGlyGlyLeuGlyGlyGlnGly 202530 (2) INFORMATION FOR SEQ ID NO:61: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..30 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:61: ValGlyArgGlyGlyLeuGlyGlyGlnGlyAlaGlyAlaAlaAlaAla 151015 GlyGlyAlaGlyGlnGlyGlyTyrGlyGlyValGlySerGly 202530 (2) INFORMATION FOR SEQ ID NO:62: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: Not Relevant (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (v) FRAGMENT TYPE: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: nephila clavipes (ix) FEATURE: (A) NAME/KEY: Peptide (B) LOCATION: 1..13 (D) OTHER INFORMATION: /label=silk1 |
| ________________________________________________________ __________________ |
| repeat (xi) SEQUENCE DESCRIPTION: SEQ ID NO:62: AlaSerAlaAlaSerAlaAlaAlaSerArgLeuSerSer 1510 (2) INFORMATION FOR SEQ ID NO:63: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 1 (D) OTHER INFORMATION: /note="X can be ala or gly or ser" (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 7 (D) OTHER INFORMATION: /note="X can be ala or gly" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:63: XaaGlyArgGlyGlyLeuXaaGlyGln 15 (2) INFORMATION FOR SEQ ID NO:64: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 5 (D) OTHER INFORMATION: /note="X can be ala or ser or val" (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 6..9 (D) OTHER INFORMATION: /note="polyalanine region can be up to 6 residues long" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:64: GlyAlaGlyAlaXaaAlaAlaAlaAla 15 (2) INFORMATION FOR SEQ ID NO:65: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 6 (D) OTHER INFORMATION: /note="X can be gly or arg or glu" (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 9 (D) OTHER INFORMATION: /note="X can be gly or arg" (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 12 (D) OTHER INFORMATION: /note="X can be gly or val" (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 13 (D) OTHER INFORMATION: /note="X can be gly or ser or asn" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:65: GlyGlyAlaGlyGlnXaaGlyTyrXaaGlyLeuXaaXaaGlnGly 151015 (2) INFORMATION FOR SEQ ID NO:66: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 3 (D) OTHER INFORMATION: /note="X can be gly or arg" (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 9 (D) OTHER INFORMATION: /note="X can be gly or arg" (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 11 (D) OTHER INFORMATION: /note="X can be gly or ala" (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 17 (D) OTHER INFORMATION: /note="X can be pro or leu" (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 20 (D) OTHER INFORMATION: /note="X can be pro or ala" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:66: GlyProXaaGlnGlnGlyProGlyXaaTyrXaaProGlyGlnGlnGly 151015 XaaSerGlyXaaGlySer 20 (2) INFORMATION FOR SEQ ID NO:67: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 2 (D) OTHER INFORMATION: /note="X can be ala or ser" (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 5 (D) OTHER INFORMATION: /note="X can be ala or ser" (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 8 (D) OTHER INFORMATION: /note="X can be ala or ser" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:67: AlaXaaAlaAlaXaaAlaAlaXaaAla 15 (2) INFORMATION FOR SEQ ID NO:68: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 10 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: 7 (D) OTHER INFORMATION: /note="X can be pro or leu" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:68: GlyProGlyGlnGlnGlyXaaGlyGlyTyr 1510 (2) INFORMATION FOR SEQ ID NO:69: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: Not Relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:69: GlyGlyXaaGlyXaaGly 15 |
| ________________________________________________________ __________________ |