Plaque It!
Sponsored by: Flash of Genius |
This application is a Continuation of U.S. patent application Ser. No. 09/628,494, filed Jul. 28, 2000, which claims the benefit of U.S. Provisional Application Ser. No. 60/146,623, filed Jul. 30, 1999, and U.S. Provisional Application Ser. No. 60/171,857, filed Dec. 22, 1999, which applications are incorporated herein by reference.
This invention was made with government support under grant nos. NS23724, NS33797, HL59601 from the National Institutes of Health. The United States Government may have certain rights in this invention.
The invention relates generally to the regulation of wakefulness, sleep, narcolepsy, mood, fatigue and attention, particularly to genes products, and compounds that affect the activity of such genes and gene products in wakefulness, sleep, narcolepsy, mood, fatigue and attention.
Sleep and Its Disorders
Sleep is a vital behavior of unknown function that consumes one-third of any given human life. Electrophysiological studies have shown that sleep is a heterogeneous state most classically separated into rapid eye movement (REM) sleep and non-REM sleep (Dement (1994) In Principles and Practices of Sleep Medicine, Kryger, Roth and Dement, eds. (Philadelphia: W.B. Saunders Company), pp. 3-15.). REM sleep is characterized by vivid dreaming, muscle atonia, desynchronized EEG activity and REMs. Non-REM sleep is characterized by synchronized EEG activity, partial muscle relaxation and less frequent dreaming mentation (Dement, 1994, supra). The propensity to sleep or stay awake is regulated by homeostatic (sleep-debt dependent) and circadian (clock dependent) processes (Borbély, ibid, pp. 309-320.). Circadian processes are believed to be primarily generated at the genetic level within the suprachiasmatic nucleus of the hypothalamus (Klein et al. (1991). In Suprachiasmatic Nucleus The Mind's Clock (New York: Oxford University Press); Moore et al. (1998) Chronobiol. Int.15, 475-487).
While progress has been made in understanding of the generation of circadian rhythmicity, sleep generation is still poorly understood at the molecular level. The study of narcolepsy is one path to understanding sleep generation. Narcolepsy, a disabling neurological disorder affecting more than 1 in 2,000 Americans, is the only known neurological disorder that specifically affects the generation and organization of sleep. The disorder is characterized by daytime sleepiness, sleep fragmentation and symptoms of abnormal REM sleep such as cataplexy, sleep paralysis and hypnagogic hallucinations (Aldrich (1993) Prog. Neurobiol. 41, 533-541; Nishino et al. (1997) Prog. Neurobiol. 52, 27-78; Aldrich (1998) Neurology 50, S2-S7). Narcolepsy is also associated with disturbances in attention/concentration, and frequently with fatigue and depression (Roth et al. (1975) Sweitzer Archiv fir Neurologie, Neurochirugie und Psychiatrie. 116(2); 291-300; Goswami (1998). Neurology 50(suppl 1): S31 -S36). Narcolepsy also occurs in animals, and has been most intensively studied in canines (Foutz et al. (1979) Sleep 1, 413-421; Baker et al. (1985) In Brain Mechanisms of Sleep, McGinty et al. eds. (New York: Raven Press), pp 199-233; Nishino et al. supra; Cederberg et al. (1998) Vet. Rec. 142, 31-36). A large number of physiological and pharmacological studies have demonstrated a close similarity between human and canine narcolepsy. Strikingly, humans and canines with narcolepsy exhibit cataplexy, which are sudden episodes of muscle weakness (akin to REM sleep-associated atonia) that are triggered primarily by positive emotions (Foutz et al. (1979), supra; Baker et al. (1985), supra; Nishino et al. (1997) supra).
Although familial cases of narcolepsy have been reported, most human occurrences are sporadic, and conventional wisdom has suggested the disorder is multigenic and environmentally influenced (Honda et al. (1990) In Handbook of Sleep Disorder, Thorpy, ed. (New York: Marcel Dekker, Inc), pp. 217-234). One predisposing genetic factor is a specific HLA-DQ allele, HLA-DQB1*0602 (Matsuki et al. (1992) Lancet 339, 1052; Mignot et al. (1994) Sleep 17, S60-S67; Mignot et al. (1994) Sleep 17, S68-S76; Mignot et al. (1997) Sleep 20(11):1012-20). Because of the tight HLA association, the disorder in humans has been suggested to be autoimmune in nature; however all attempts to verify this hypothesis have failed (Mignot et al. (1995) Adv. Neuroimmunol. 5, 23-37). In Doberman pinschers, the disorder is transmitted as a single autosomal recessive trait with full penetrance, canarc-1 (Foutz et al. (1979), supra; Baker et al. (1985), supra).
Pharmacological, neurochemical and physiological studies implicate monoaminergic and cholinergic neurotransmissions as the main modulators in narcolepsy (Mignot (1993) J. Neurosci. 13, 1057-1064; Mignot et al. (1993) Psychopharmacology 113, 76-82; Nishino et al. (1997), supra). The human sleep disorder is currently treated symptomatically with amphetamine-like stimulants for the control of daytime sleepiness and antidepressant drugs for the control of abnormal REM sleep manifestations (e.g., cataplexy) (Aldrich, (1993), supra; Wender (1998) J Clin Psychiatry;59 Suppl 7:76-9).
Pharmacological analysis using the canine model has shown that inhibition of dopamine uptake and/or stimulation of dopamine release mediates the wake promoting effects of amphetamine-like stimulants (Nishino et al. (1997), supra), and that inhibition of noradrenergic uptake mediates the anticataplectic effects of antidepressive therapy (Mignot et al. (1993), supra). The observed effects on cataplexy parallel the well-established REM suppressant effect of adrenergic uptake inhibitors. Stimulation of cholinergic transmission using acetylcholine esterase inhibitors or direct M2 agonists also stimulates cataplexy (Nishino et al. (1997), supra). These results suggest that the pharmacological control of cataplexy, a symptom resembling REM sleep atonia, is very similar to the control of REM sleep and involves a reciprocal interaction between pontine cholinergic REM-on cells and aminergic locus coeruleus (LC) REM-off cells and their projection sites (Mignot et al. (1993), supra; Nishino et al. (1997), supra).
In order to determine the neuroanatomical basis for the sleep abnormalities observed in narcolepsy, several complementary approaches have been taken. In both human and canine subjects with narcolepsy, brain neurotransmitter levels and receptors have been measured (Miller et al. (1990) Brain Res. 509, 169-171; Aldrich (1993), supra). In narcoleptic animals, the most consistent abnormalities were observed in the amygdala where significant increases in dopamine and metabolite levels were reported in two independent studies (Miller et al., supra). These results were interpreted as suggesting decreased dopamine turnover and accumulation of dopamine in presynaptic terminals. Another important finding was the observation of increased muscarinic M2 receptors in the pontine reticular formation (Baker et al. (1985), supra; Kilduff et al. (1986) Sleep 9, 102-107), a region where cholinergic stimulation triggers REM sleep in normal animals. Local injection or perfusion of cholinergic agonists in the pontine reticular formation or the basal forebrain area triggers REM sleep and/or REM sleep atonia in narcoleptic canines (Nishino et al. (1997), supra). In narcoleptic animals, however, much lower doses can trigger muscle atonia, thus suggesting hypersensitivity to cholinergic stimulation. Furthermore, dopaminergic autoreceptor stimulation (D3) in the ventral tegmental area (VTA) induces cataplexy and sleepiness in narcoleptic but not in control canines (Reid et al. (1996) Brain Res. 733, 83-100). Because this dopaminergic system and its projection to the nucleus accumbens and other limbic structures is involved in the perception of pleasurable emotions, this observation could explain the triggering of cataplexy by positive emotions (Reid et al. (1996), supra; Nishino et al. (1997), supra). Narcolepsy may thus result from abnormal interactions between REM-on cholinergic pathways and mesocorticolimbic dopaminergic systems (Nishino et al. (1997), supra).
The Hypocretin Receptor and the Hypocretin Ligand and Feeding Patterns
As with the field of modulation of sleep patterns, the molecular basis of the regulation of energy balance and feeding patterns is beginning to be better understood. The discovery of hypocretins (orexins) and the hypocretin receptors has facilitated the unraveling of the regulatory pathways involved in eating habits. Hypocretins, which are encoded by a singe preprohypocretin mRNA transcript, are likely produced by processing of a precursor protein into two related peptides, hypocretin-1 and -2 (De Lecea et al. (1989) Proc. Natl. Acad. Sci. (USA) 95, 322-327; Sakurai et al. (1998) Cell 92, 573-585). Hypocretins are localized in the synaptic vesicle and possess neuroexcitatory effects (De Lecea et al, supra). Two orphan receptors were found to bind hypocretin-1 (also called orexin-A) and hypocretin-2 (orexin-B) with different affinity profiles (Sakurai et al., (1998), supra). The first of these receptors, now called hypocretin receptor 1 (HCRTR1), was shown to selectively bind hypocretin-1 whereas the HCRTR2 receptor binds both hypocretin-1 and 2 with a similar affinity (Sakurai et al. (1998), supra).
Initially, the finding that preprohypocretin RNA molecules and hypocretin-immunoreactive cell bodies were discretely localized to a subregion of the dorsolateral hypothalamus and a hypothesized colocalization of hypocretins with melanin concentrating hormone (MCH), a potent orexigeneic peptide, suggested a possible role of this system in the control of feeding (De Lecea et al., 1998). Furthermore, centrally administered hypocretin-1 and -2 stimulate appetite in rodents, and preprohypocretin mRNA is upregulated by fasting (Sakurai et al., 1998). However, more recent experiments suggest a more complex picture. First, the suggested initial colocalization with MCH was not substantiated by further studies (Broberger et al. (1998) J. Comp. Neurol. 402, 460-474). Second, there is controversy regarding the magnitude of the effect of hypocretins on food consumption in rodents (Lubkin et al. (1998) Biochem. Biophys. Res. Commun. 253, 241-245; Edwards et al. (1999) J. Endocrinol. 160, R7-R12; Ida (1999) Brain Res. 821, 526-529; Moriguchi et al. (1999) Neurosci. Lett. 264, 101-104; Sweet (1999) Brain Res. 821, 535-538). For example, while hypocretins stimulate short-term food intake, these peptides do not alter 24 hour total food consumption (Ida et al (1999), supra). Some authors have also suggested that hypocretins exert a shift in the diurnal pattern of food intake. The effect on energy metabolism seems to be more pronounced than that on feeding behavior (Lubkin et al. (1998), supra) and differs with the circadian time of administration (Ida et al, (1999), supra). Recent studies suggest complex interactions between hypocretins, MCH-containing neurons, neuropeptide Y, agouti gene-related protein systems and leptins in the control of feeding and energy balance (Broberger et al. (1998), supra; Beck et al. (1999) Biochem. Biophys. Res. Commun. 258, 119-122; Horvath et al. (1999). J. Neurosci. 19, 1072-1087; Kalra et al. (1999) Endocrine Rev. 20, 68-100; Marsh et al. (1999) Nature Genet. 21, 119-122; Moriguchi et al., supra; Yamamoto et al. (1999) Mol. Brain Res. 65, 14-22).
Further neuronatomical work on hypocretins and their receptors suggests a broader role than the regulation of energy balance and feeding, although the extent of that broader role had not been determined nor the specific effects that may be manifested been specifically verified. Immunocytochemical studies have shown that while the preprohypocretin-positive neurons are discretely localized in the perifornical nucleus and in the dorsal and lateral hypothalamic areas, their projections are widely distributed throughout the brain (Peyron et al. (1998) J. Neurosci. 18, 9996-10015; Date et al. (1999) Proc. Natl. Acad. Sci. (USA) 96, 748-753; Mondal et al. (1999) Biochem. Biophys. Res. Comm. 256, 495-499; Nambu et al. (1999) Brain Res. 827, 243-260; van den Pol (1999). J. Neurosci. 19, 3171-3182). Consistent with the potential role of hypocretins in the regulation of feeding, projection sites include intrahypothalamic sites such as the arcuate nucleus and paraventricular nucleus. However, other major projection sites include the cerebral cortex, the spinal cord (dorsal horn), medial nuclei groups of the thalamus, the olfactory bulb, basal forebrain structures such as the diagonal band of Brocca and the septum, limbic structures such as the amygdala and the medial part of the accumbens nucleus, and brainstem areas such as periaqueductal gray, reticular formation, pedunculopine and parabrachial nuclei, locus coeruleus, raphe nuclei, substantia nigra pars compacta and ventral tegmental area (Peyron et al., supra,; Date et al., supra; Nambu et al., supra; van den Pol, supra). A particularly dense projection is to the monoaminergic cell groups such as the raphe nucleus and the locus coeruleus (Peyron et al., supra). Of special interest is the finding that the HCRTR1 receptor transcript in rats is mostly localized in the ventromedian hypothalamic nucleus, hippocampal formation, dorsal raphe and locus coeruleus. In contrast, mRNA molecules encoding the HCRTR2 receptor are more abundant in the paraventricular nuclei and in the nucleus accumbens (Trivedi et al. (1998) FEBS Lett. 438, 71-75). Experiments using radioligand binding and immunocytochemical techniques are needed to further establish the respective pattern of expression of these receptors in relation to hypocretin projection sites.
Conclusion
Because sleep generation is poorly understood at the molecular level, the production of compounds that can be used to promote sleep or vigilance, as well as diagnosis of sleep disorders, can be difficult and imprecise. Thus, there is a need in the field for methods for identification of sleep-regulating compounds and diagnosing sleep disorders. The present invention addresses these problems in the field of sleep, as well as problems in the areas of mood and attention deficit hyperactivity disorders.
The present invention is directed to methods for identification of compounds that affect wakefulness, attention deficit hyperactivity disorder, chronic fatigue syndrome and mood disorders (e.g., depression) through interaction with the hypocretin receptor system. The present invention is also directed to detection of abnormal levels of hypocretin in a subject, as well as detection of an abnormal immune response against hypocretin (orexins), hypocretin contiaining cells and/or hypocretin receptors, where detection of abnormal hypocretin levels or detection of an abnormal immune response is indicative of a sleep disorder, particularly of narcolepsy. The present invention is also directed to a methods relating to the detection of a mutation or polymorphism in the gene encoding the hypocretin receptors, the detection of antibodies disrupting the cells containing the hypocretin receptorsor the hypocretin polypeptides, and the use of hypocretin biological markers in predicting treatment response using compounds interacting with the hypocretin receptor system.
FIG. 1 is a schematic providing an overview of the region containing the canine narcolepsy gene. Human (top) and canine (bottom) chromosomal regions of conserved synteny are displayed. Human Expressed Sequence-Tag loci (ESTs) are displayed on the human map in the top panel. Key recombinant animals are listed by name in the center of the Figure. The canine narcolepsy critical region is indicated by an open box.
FIG. 2 is the map of a BAC clone contig covering the 800 kb segment known to contain canarc-1. The BAC clone sizes are drawn to scale. Selected polymorphic microsatellite markers are indicated by dotted lines. STSs for which locations were not strictly constrained are spaced at roughly equidistant intervals between constrained markers. The canine narcolepsy gene critical region is flanked by marker 26-12 (immediately distal to EST 250618) and marker 530-5 (immediately distal to EST 416643). All BAC clones were genotyped with available informative markers to determine canarc-1 associated status. Narcolepsy/control segments are indicated by solid and dashed lines, respectively. Unclassified clones are indicated by underling the clone designation.
FIG. 3 is an autoradiogram showing alternate restriction fragment length polymorphism alleles associated with the control versus narcolepsy-associated BAC clones when hybridized with an HCRTR2 probe.
FIGS. 4A, 4B and 4 C are photographs showing the results of PCR amplification studies of the HCRTR2 locus in narcoleptic and control dogs. FIG. 4A: Amplification of HCRTR2 cDNA from control and narcoleptic Doberman Pinschers using primers from were designed in the 5′ and 3′ untranslated regions of the HCRTR2 gene (exon 1 and exon 7); control dog (Lane 1); narcoleptic dog (Lane 2). FIG. 4B: Amplification of narcoleptic and wild-type Doberman Pinscher genomic DNA with PCR primers flanking the SINE insertion. Lanes 1-2: wild-type Dobermans (Alex and Paris); lanes 3-4: narcoleptic Dobermans (Tasha and Cleopatra); lanes 5-6: heterozygous carrier Dobermans (Grumpy and Bob). FIG. 4C. Amplification of narcoleptic and wild-type Labrador retriever Hcrtr2 cDNAs. Lane 1: control dog; Lane 2, narcoleptic dog.
FIG. 5 is a schematic showing the deduced amino acid sequences of the hypocretin receptor 2 in wild-type dog, human, rat and narcoleptic dogs. Amino acid residues that are not identical in at least two sequences are boxed. Putative transmembrane (TM) domains are marked above the aligned sequences. Arrows indicate exon/intron boundaries in the gene structure of the dog.
FIG. 6 is a schematic showing the genomic organization of the canine Hcrtr2 locus which is encoded by 7 exons. In transcripts from narcoleptic Doberman pinschers, exon 3 is spliced directly to exon 5, omitting exon 4 (wild-type versus narc.Dob.). The genomic DNA of narcoleptic Dobermans contains an 226 bp insertion corresponding to a common canine SINE repeat element (open box) located 35 bp upstream of exon 4. The insertion of the SINE displaces a putative lariat branchpoint sequence (BPS, underlined) located at position −40 through 46 upstream of the 3′ splice site in control animals. No candidate BPS sequences are present in this vicinity in the narcolepsy-associated intron. In transcripts from narcoleptic Labrador retrievers, exon 5 is spliced directly to exon 7, omitting exon 6 (wild-type versus narc.Lab.). Genomic DNA analysis revealed a G to A transition in the 5′ splice site consensus sequence (indicated by a double underline).
FIG. 7 is a schematic providing the DNA sequence of human hypocretin polypeptide (HCRT) and indicating the polymorphism of the invention.
FIGS. 8A and 8B is a schematic providing the DNA sequence of human hypocretin receptor 1 (HCRTR1) and indicating the polymorphism of the invention.
FIGS. 9A and 9B is a schematic providing the DNA sequence of human hypocretin receptor 2 (HCRTR2) and indicating the polymorphism of the invention.
FIGS. 10 A-G are photographs showing detection of Prepro-Hcrt mRNA, Melanin Concentrating Hormone (MCH) mRNA, and HLA-DR in the hypothalamus of control and narcoleptic subjects. FIGS. 10A and 10B show prepro-Hcrt mRNA in control (FIG. 10B) and narcoleptic (FIG. 10A). FIGS. 10D and 10C show MCH mRNA in the same region in control (FIG. 10D) and narcoleptic (FIG. 10C) subjects. HLA-DR staining is shown for control (FIG. 10G) and two narcoleptic (FIGS. 10 E and F) subjects. Abbreviations: f, fornix. Scale bar in (FIGS. 10 A-D) represents 10 mm and in (FIGS. 10 E-G) it represents 200 μm.
Before the present invention is described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications and other forms of publically available information mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.
It must be noted that as used herein and in the appended claims, the singular forms “a”, “and”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a compound” includes a plurality of such compounds and reference to “the polynucleotide” includes reference to one or more polynucleotides and equivalents thereof known to those skilled in the art, and so forth.
The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
Definitions
Unless specifically indicated otherwise, “hypocretin receptor” as used herein is meant to refer to all subtypes of the hypocretin receptor, including hypocretin receptor 1 (also known as the orexin receptor 1) and the hypocretin receptor 2 (also known as the orexin receptor 2). “Hypocretin receptor” is interchangeable with “hypocretin receptor,” “hypocretin (orexin) receptor,” and with “orexin receptor.” The DNA and amino acid sequences of human hypocretin receptor 1 are provided at GenBank accession no. g4557636. The DNA and amino acid sequences of human hypocretin receptor 2 are provided at GenBank accession no. g4557638.
“Hypocretin receptor gene” as used herein is meant to encompass a nucleic acid sequence encoding a hypocretin receptor, which gene can encompass 5′ and 3′ flanking sequences and intronic sequences.
Unless specifically indicated otherwise, “hypocretin” as used herein is meant to refer to all subtypes of the naturally occurring ligands of the hypocretin receptors, including hypocretin 1 (also known as the orexin A) and hypocretin 2 (also known as the orexin B). “Hypocretin (orexin)” and “orexin” are interchangeable with “hypocretin” and with “orexin.”
As used herein the term “isolated” is meant to describe a compound of interest that is in an environment different from that in which the compound naturally occurs. □Isolated” is meant to include compounds that are within samples that are substantially enriched for the compound of interest and/or in which the compound of interest is partially or substantially purified.
As used herein, the term “substantially purified” refers to a compound that is removed from its natural environment and is at least 60% free, preferably 75% free, and most preferably 90% free from other components with which it is naturally associated.
The term “treatment” is used herein to encompass any treatment of any disease or condition in a mammal, particularly a human, and includes: a) preventing a disease, condition, or symptom of a disease or condition from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; b) inhibiting a disease, condition, or symptom of a disease or condition, e.g., arresting its development and/or delaying its onset or manifestation in the patient; and/or c) relieving a disease, condition, or symptom of a disease or condition, e.g., causing regression of the condition or disease and/or its symptoms.
By “subject” or “patient” is meant any mammalian subject for whom diagnosis or therapy is desired, particularly humans. Other subjects may include cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, and so on. In one embodiment, subjects of particular interest are those having a sleep disorder amenable to treatment (e.g., to mitigate symptoms associated with the disorder) by, for example, administration of an agent that binds an hypocretin receptor.
By “hypocretin-related disorder,” and “disorder caused by an alteration in hypocretin receptor activity” is meant a disorder that is caused by an increase or decrease in binding of hypocretin to a hypocretin receptor relative to that found in an unaffected subject. Exemplary such disorders include, but are not necessarily limited to, sleep disorders (e.g., narcolepsy), mood disorders (e.g., depression), chronic fatigue syndrome, and hyperactivity disorders (e.g., attention deficit disorder). An increase or decrease in hypocretin receptor activity can be caused by, for example, increased or decreased levels or availability of endogenous hypocretin ligand, increased or decreased levels or availability of endogenous hypocretin receptor, alterations in a hypocretin receptor that affect the binding affinity or avidity of the receptor for hypocretin, and alterations in a hypocretin polypeptide that affect its binding affinity or avidity to a hypocretin receptor.
“LOD score” is meant to refer to an indicated probability (the logarithm of the ratio of the likelihood) that a genetic marker locus and the recited gene locus (e.g., hcrtr, particularly hcrtr2) are linked at a particular distance.
“Genetic marker” or “marker” is meant to refer to a variable nucleotide sequence (polymorphism) that is present in genomic DNA and which is identifiable with specific oligonucleotides (e.g., distinguishable by nucleic acid amplification and observance of a difference in size or sequence of nucleotides due to the polymorphism). The “locus” of a genetic marker or marker refers to its situs on the chromosome in relation to another locus as, for example, represented by LOD score and recombination fraction. Markers, as illustrated herein, can be identified by any one of several techniques know to those skilled in the art, including microsatellite or short tandem repeat (STR) amplification, analyses of restriction fragment length polymorphisms (RFLP), single nucleotide polymorphism (SNP), detection of deletion or insertion sites, and random amplified polymorphic DNA (RAPD) analysis.
“Genetic marker indicative of a mutation in the hcrtr2 gene locus” (e.g., in the context of detection of narcolepsy in canines), refers to a marker that: (a) is genetically linked and co-segregates with the hcrtr2 gene locus such that the linkage observed has a statistically significant LOD score; (b) in canines, comprises a region of canine chromosome 12, particularly between markers 26-8 and 530-3 inclusive -(c) contains a polymorphism informative for the narcoleptic genotype (e.g., comprises or is linked to a hcrtr2 mutation linked to narcolepsy); and/or (d) can be used in a linkage assay or other molecular diagnostic assays (DNA test) to identify normal alleles (wild type; (+)), and mutant (narcoleptic) alleles (by the presence of the polymorphism), and hence can distinguish narcoleptic dogs, carriers of narcoleptic alleles, and normal dogs. In that regard, markers additional to those illustrative examples disclosed herein, that map either by linkage or by physical methods so close to the hcrtr2 gene locus that any polymorphism in or with such derivative chromosomal regions, may be used in a molecular diagnostic assay for detection of hcrtr2 or carrier status.
“Co-segregate” generally means inheritance together of two specific loci; e.g., the loci are located so physically close on the same chromosome that the rate of genetic recombination between the loci is as low as 0%, as observed by statistical analysis of inheritance patterns of alleles in a mating. “Linkage” generally means co-segregation of two loci in the subject (e.g., canine breed) analyzed.
“Linkage test” and “molecular diagnostic assay” generally refer to a method for determining the presence or absence of one or more allelic variants linked with narcolpesy, e.g., with a mutant hcrtr2 gene locus, such that the method may be used for the detection of narcolepsy gene carrier status, whether through statistical probability or by actual detection of a mutated hypocretin receptor gene.
“Polymorphism” is meant to refer to a marker that is distinguishably different (e.g., in size, electrophoretic migration, nucleotide sequence, ability to specifically hybridize to an oligonucleotide under standard conditions) as compared to an analogous region from a subject of the same specieis (e.g., a dog of the same breed or pedigree).
“Nucleic acid amplification” or “amplify” is meant to refer to a process by which nucleic acid sequences are amplified in number. Several methods are known to those skilled in the art for enzymatically amplifying nucleic acid sequences including polymerase chain reaction (“PCR”), ligase chain reaction (LCR), and nucleic acid sequence-based amplification (NASBA).
“Consisting essentially of a nucleotide sequence” is meant, for the purposes of the specification or claims to refer to the nucleotide sequence disclosed, and also encompasses nucleotide sequences which are identical in sequence except for a base changes or substitutions therein while retaining the same ability to function as described, e.g., to detect a narcoleptic polymorphism, e.g., a mutant hcrtr gene linked to narcolepsy.
“Capable of hybridizing under high stringency conditions” means annealing a strand of DNA complementary to the DNA of interest under highly stringent conditions. Likewise, “capable of hybridizing under low stringency conditions” refers to annealing a strand of DNA complementary to the DNA of interest under low stringency conditions. In the present invention, hybridizing under either high or low stringency conditions generally involves hybridizing a nucleic acid sequence, with a second target nucleic acid sequence. “High stringency conditions” for the annealing process may involve, for example, high temperature and/or low salt content, which disfavor hydrogen bonding contacts among mismatched base pairs. “Low stringency conditions” generally involve lower temperature, and/or higher salt concentration than that of high stringency conditions. Such conditions allow for two DNA strands to anneal if substantial, though not near complete complementarity exists between the two strands, as is the case among DNA strands that code for the same protein but differ in sequence due to the degeneracy of the genetic code. Appropriate stringency conditions which promote DNA hybridization, for example, 6×SSC at about 45° C., followed by a wash of 2×SSC at 50° C. are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.31-6.3.6. For example, the salt concentration in the wash step can be selected from a low stringency of about 2×SSC at 50° C. to a high stringency of about 0.2×SSC at 50° C. In addition, the temperature in the wash step can be increased from low stringency at room temperature, about 22° C., to high stringency conditions, at about 65° C. Other stringency parameters are described in Maniatis, T., et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring N.Y., (1982), at pp. 387-389; see also Sambrook J. et al., Molecular Cloning: A Laboratory Manual, Second Edition, Volume 2, Cold Spring Harbor Laboratory Press, Cold Spring, N.Y. at pp. 8.46-8.47 (1989).
Overview
The present invention is based on the discovery that a specific mutation in the hypocretin receptor causes narcolepsy in a canine model, that a mutation in the hypocretin peptide gene is associated with narcolepsy in humans, and that most human narcolepsy cases are associated with decreased levels of hypocretins as shown by detection of hypocretin levels (hypocretin peptide levels and preprohypocretin mRNA levels) in narcoleptic human tissues.
The findings upon which the invention is based identifies the hypocretin system as a major sleep/narcolepsy-modulating system, (e.g., hypocretin acts as sleep-modulating neurotransmitters) and opens novel potential therapeutic approaches for narcoleptic patients as well as patients suffering from other sleep disorders and/or who wish to modulate their sleep patterns (e.g., increase vigilance, facilitate sleep, etc.). These discoveries also indicate that detection of hypocretin can serve as a diagnostic tool to determine the susceptibility to a sleep disorder, to identify subject's suffering from a sleep disorder, and/or to confirm a phenotypic diagnosis of sleep disorder-susceptible or affected individuals. Because sleep, mood, fatigue and attention are tightly connected at the biochemical, clinical and therapeutic levels, the finding upon which the invention is based also indicates that the hypocretin system is involved in these related functions. Therefore, diagnostics to identify subjects susceptible to or having a sleep disorder (e.g., narcolepsy) can be applied to identify subjects susceptible to or having conditions such as mood disorders (e.g., depression), chronic fatigue syndrome, and hyperactivity disorders (e.g., attention deficit disorder). Likewise, drugs that act on hypocretins and/or hypocretin receptors to modulate hypocretin receptor activity can also serve to alleviate symptoms of mood disorders, chronic fatigue syndrome, and hyperactivity disorders. Likewise, drugs that are proposed in treatment of eating disorders (e.g., that reduce obesity) due to their interaction with hypocretin and/or hypocretin receptor(s) can be useful in the treatment of sleep disorders, as well as the above-listed exemplary related or associated disorders.
Thus the present invention is directed to, for example, the use of the hypocretin receptor in screening for compounds that bind the receptors and affect sleep patterns and wakefulness. The present invention also encompasses the detection of an abnormal or aberrant humoral or cellular immune response against hypocretins and/or their receptors, as well as detection of hypocretin levels, for the identification of subjects susceptible to a sleep disorder, particularly narcolepsy. The present invention is also directed to polymorphisms of the hypocretin receptor-encoding polynucleotide sequence for the identification of subjects susceptible to, or who are carriers for, a sleep disorder, particularly narcolepsy. The use of such polymorphisms or hypocretin measures to predict treatment responses with hypocretin receptor ligands is also encompassed by the invention. These various aspects of the invention can also find application in the diagnosis and treatment of disorders tightly associated with sleep disorders such as narcolepsy, e.g., mood disorders (e.g., depression), hyperactivity disorders (e.g., attention deficit hyperactivity disorder), and/or fatigue disorders (e.g., chronic fatigue syndrome).
Hypocretins in the Pathophysiology of Narcolepsy and the Regulation of REM Sleep
The present invention is based on the discovery that the hypocretin system (hypocretin receptors and hypocretin peptides) is involved in narcolepsy and the regulation of sleep. Prior to the discovery described herein, there was no direct evidence suggesting significant sleep/wake effects for hypocretins. The discovery that a mutation in the hypocretin receptor locus produces canine narcolepsy indicates that hypocretins and the hypocretin receptor are major neuromodulators of sleep in interaction with aminergic and cholinergic systems. This effect may be especially important during early development since, the canine model, narcolepsy typically develops between 4 weeks and 6 months of age and severity increases until animals are approximately one year old (Mignot (1993) J. Neurosci. 13, 1057-1064; Mignot et al. (1993) Psychopharmacology 113, 76-82; Riehl et al. (1998) Exp. Neurol. 152, 292-302). Furthermore, canarc-1 heterozygote animals may exhibit brief episodes of cataplexy when pharmacologically stimulated with a combination of cholinergic agonists and drugs depressing monoaminergic activity but only during early development (Mignot (1993) J. Neurosci. 13, 1057-1064; Mignot et al. (1993) Psychopharmacology 113, 76-82). Projection sites and reported hypocretin receptor localization are in agreement with a concerted effect of hypocretins, monoamines and acetylcholine on sleep-wake regulation. Central and peripheral administration of hypocretins can be potently wake-promoting and suppress REM sleep via a stimulation of a hypocretin receptor in control, but not in narcoleptic, subjects.
The Canine Narcolepsy Model and Polymorphisms in Human Narcolepsy
The phenotypes of human and canine narcolepsy and associated neurochemical abnormalities are strikingly similar (Baker 1985, supra; Nishino et al. (1997), supra). The observation than human narcolepsy is associated with low cerebrospinal fluid (CSF) hypocretin levels indicates that abnormalities in the hypocretin neurotransmission system are also involved in human cases. Mutations in the hypocretin receptor gene or other hypocretin family genes may thus be involved in some cases of human narcolepsy
The present invention also provides an example of narcolepsy-cataplexy in a human subject caused by a mutation in the signal peptide of the hypocretin polypeptide gene. This subject was non-HLA-DQB1*0602, had no CSF hypocretin levels and started narcolepsy-cataplexy at a very young age (6 months of age, as opposed to adolescence in HLA-associated narcolepsy cases). The observation that rare cases of symptomatic secondary narcolepsies are most typically associated with lesions surrounding the third ventricle (Aldrich et al. (1989) Neurology 39, 1505-1508) is also consistent with a destruction of hypocretin containing cell groups. As most cases of human narcolepsy are non-familial and strongly HLA associated (Mignot, 1997, supra) an autoimmune process directed against the hypocretin receptor or hypocretin containing cells in the hypothalamus-, or more complex neuroimmune interactions may also be involved in the pathophysiology of most cases of human narcolepsy.
Therapeutics and Methods for Identifying Therapeutics for Modulation of Sleep and/or Treatment of Narcolepsy and Other Sleep Disorders
In view of the discovery that a mutation in the hypocretin receptor and abnormal levels of hypocretin polypeptide causes narcolepsy, it follows that hypocretins, hypocretin analogues, other hypocretin receptor agonists, and hypocretin receptor antagonists offer new therapeutic avenues in narcolepsy and other sleep disorders, as well as in the modulation of sleep patterns, wakefulness, and vigilance in sleep disorder-affected and sleep-disorder unaffected individuals. Due to the association of narcolepsy with depression, chronic fatigue syndrome and attention deficit hyperactivity disorders, the discovery of the present invention also provides new therapeutic strategies for these conditions as well. A reduction of hypocretin neurotransmission can be supplemented in some cases by increasing ligand availability.
Mood Regulation Hyperactivity, Narcolepsy and Hypocretins:
An other application of the invention is in the area of mood disturbances and attention deficit hyperactivity disorder (ADHD). Narcolepsy has been previously associated with disturbances in attention/concentration and frequently fatigue and depression (Roth et al. 1975 supra; Goswami, 1998, supra). The discovery upon which the present invention is based makes it clear that mood disorders, hyperactivity disorders, and chronic fatigue syndrome can also be caused by a defect in the hypocretin system. Thus, where these disorders are so associated with a hypocretin system alteration (e.g., an alteration in levels of hypocretin peptide or hypocretin receptor production or function), such disorders can be treated and be expected to be responsive to therapy based upon alteration of the hypocretin system.
Specific aspects of the invention will now be described in more detail.
Identification of Individuals Susceptible to or Having Narcolepsy or Other Hypocretin-and/or Hypocretin Receptor-Mediated—Disorder and Identification of Subjects Having Differential Therapeutic Responses to Drugs Interacting with the Hypocretin Receptor Systems
Individuals susceptible to or having a sleep disorder caused by a hypocretin polypeptide or hypocretin receptor abnormality can be identified by (1) detection of a hypocretin receptor-encoding or hypocretin peptide sequence that contains a mutation that affects hypocretin neurotransmission function (e.g., ligand production, binding, signal transduction, and the like), (2) by detection of an abnormal immune response against hypocretin receptor, hypocretin-containing cells or its endogenous ligand (i.e. the hypocretin peptide system), and/or (3) by measuring hypocretin levels in the subject. These biological markers can also be used to predict therapeutic responsivity to drugs interacting with the hypocretin receptor system. For example, where a subject is identified as having a disorder associated with an abnormally low level of hypocretin peptide, then the subject would be expected to respond to administration of drugs that act as agonists of the hypocretin receptor or otherwise mimic or enhance the activity of hypocretin.
Diagnosis Based Upon Detection of a Polymorphism
Polymorphisms in the hypocretin receptor gene can be used to identify individuals having or susceptible to narcolepsy, and can also be used to identify carriers of the narcolepsy gene, and can similarly be used to identify a subject having a condition amenable to treatment by modulation of hypocretin receptor activity (e.g., by upregulating expression of normal hypocretin receptor, by providing an unaffected copy of the hypocretin receptor-encoding sequence, etc.). Diagnosis of such conditions or disorders can be performed by protein, DNA or RNA sequence and/or hybridization analysis of any convenient sample from a patient, e.g. biopsy material, blood sample, scrapings from cheek, etc., to examine levels of hypocretin receptor expression, and/or hypocretin receptor activity.
For example, a nucleic acid sample from a patient having a disorder that may be treated by hypocretin receptor modulation can be analyzed for the presence of a predisposing polymorphism in hypocretin receptor, e.g., a polymorphism similar to that identified in the canine model described herein. In another example, a patient may have a mutation that impairs the hypocretin peptide or its production as described below. A typical patient genotype will have at least one predisposing mutation on at least one chromosome. The presence of a polymorphic hypocretin receptor or hypocretin peptide sequence that affects the activity or expression of the gene product, and confers an increased susceptibility to an hypocretin associated disorder is considered a predisposing polymorphism. Individuals are screened by analyzing their DNA or mRNA for the presence of a predisposing polymorphism, as compared to sequence from an unaffected individual(s). Specific sequences of interest include, for example, any polymorphism that is associated with a sleep disorder, particularly narcolepsy, which polymorphisms can include, but are not necessarily limited to, insertions, substitutions and deletions in the coding region sequence, intron sequences that affect splicing, or promoter or enhancer sequences that affect the activity and expression of the protein.
A number of methods are available for analyzing nucleic acids for the presence of a specific sequence, e.g., to examine a sample for a polymorphism and/or to examine the level of hypocretin receptor mRNA production. Where large amounts of DNA are available for polymorphism analysis, genomic DNA is used directly. Alternatively, the region of interest is cloned into a suitable vector and grown in sufficient quantity for analysis.
Where expression of hypocretin or hypocretin receptors is to be analyzed, cells that express hypocretin receptor genes may be used as a source of mRNA, which may be assayed directly or reverse transcribed into cDNA for analysis. The nucleic acid may be amplified by conventional techniques, such as the polymerase chain reaction (PCR), to provide sufficient amounts for analysis. The use of the polymerase chain reaction is described in Saiki, et al. 1985 Science 239:487; a review of current techniques may be found in Sambrook, et al. Molecular Cloning: A Laboratory Manual, CSH Press 1989, pp.14.2-14.33. Amplification may also be used to determine whether a polymorphism is present, by using a primer that is specific for the polymorphism.
A detectable label may be included in an amplification reaction. Suitable labels include fluorochromes, e.g. fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin, allophycocyanin, 6-carboxyfluorescein (6-FAM), 2′,7′-dimethoxy-4′,5′-dichloro-6-carboxyfluorescein (JOE), 6-carboxy-X-rhodamine (ROX), 6-carboxy-2′,4′,7′,4,7-hexachlorofluorescein (HEX), 5-carboxyfluorescein (5-FAM) or N,N,N′,N′-tetramethyl-6-carboxyrhodamine (TAMRA), radioactive labels, e.g. 32 P, 35 S, 3 H; etc. The label may be a two stage system, where the amplified DNA is conjugated to biotin, haptens, etc. having a high affinity binding partner, e.g. avidin, specific antibodies, etc., where the binding partner is conjugated to a detectable label. The label may be conjugated to one or both of the primers. Alternatively, the pool of nucleotides used in the amplification is labeled, so as to incorporate the label into the amplification product.
The sample nucleic acid, e.g. amplified or cloned fragment, is analyzed by one of a number of methods known in the art. Polymorphism analysis can be performed by sequencing the nucleic acid (e.g., genomic DNA or cDNA produced from mRNA) by dideoxy or other methods, and comparing the sequence to either a neutral hypocretin receptor sequence (e.g., an hypocretin receptor/peptide sequence from an unaffected individual) or to a known, affected hypocretin receptor/peptide sequence (e.g., a hypocretin receptor sequence of a known polymorphism). Hybridization with the variant sequence may also be used to determine its presence, by Southern blots, dot blots, etc. The hybridization pattern of a control and variant sequence to an array of oligonucleotide probes immobilized on a solid support, as described in U.S. Pat. No. 5,445,934, or in WO95/35505, may also be used as a means of detecting the presence of variant sequences. Single strand conformational polymorphism (SSCP) analysis, denaturing gradient gel electrophoresis (DGGE), mismatch cleavage detection, and heteroduplex analysis in gel matrices are used to detect conformational changes created by DNA sequence variation as alterations in electrophoretic mobility. Alternatively, where a polymorphism creates or destroys a recognition site for a restriction endonuclease (restriction fragment length polymorphism, RFLP), the sample is digested with that endonuclease, and the products size fractionated to determine whether the fragment was digested. Fractionation is performed by gel or capillary electrophoresis, particularly acrylamide or agarose gels.
Analysis of relative hypocretin peptide/receptor transcriptional levels and hypocretin receptor/peptide polymorphisms can also be performed using polynucleotide arrays, and detecting the pattern of hybridization to the array, e.g., both the identity of the sequences on the array to which the sample hybridizes and/or the relative levels of hybridization (e.g., qualitative or quantitative differences in levels of expression). The hybridization pattern of a control and test sample to an array of oligonucleotide probes immobilized on a solid support, as described in U.S. Pat. No. 5,445,934, or in WO95/35505, may be used in such assays. In one embodiment of the invention, an array of oligonucleotides are provided, where discrete positions on the array are complementary to at least a portion of mRNA or genomic DNA of the hypocretin receptor/peptide loci. Such an array may comprise a series of oligonucleotides, each of which can specifically hybridize to a nucleic acid sequence, e.g., mRNA, cDNA, genomic DNA, etc. from the hypocretin receptor locus or to the hypocretin peptide locus. For example, the can comprise at least 2 different polymorphic sequences, e.g., polymorphisms located at unique positions within the locus, usually at least about 5, more usually at least about 10, and may include as many as 50 to 100 different polymorphisms. The oligonucleotide sequence on the array will usually be at least about 12 nt in length, may be the length of the provided hypocretin receptor/peptide sequences, or may extend into the flanking regions to generate fragments of 100 to 200 nt in length. For examples of arrays, see Hacia et al. 1996 Nature Genetics 14:441-447; Lockhart et al. 1996 Nature Biotechnol. 14:1675-1680; and De Risi et al. 1996 Nature Genetics 14:457-460.
The analysis of hypocretin gene polymorphisms may be used not only for diagnosing a sleep disorder but also to predict therapeutic response to hypocretin related drug treatment. For example, subjects with a given hypocretin receptor polymorphism may be shown to require much lower dose of a drug acting on hypocretin receptor to produce sleep (in case of a hypocretin receptor antagonist) or wakefulness (in case of a hypocretin receptor agonist in the treatment of narcolepsy or sleepiness, chronic fatigue syndrome, attention deficit disorder or depression) than other subjects. Analysis of hypocretin gene polymorphisms may also be indicative of the presence of other disorders tightly associated with sleep disorders in the subject, e.g., mood disorders (e.g. depression), chronic fatigue syndrome, hyperactivity disorders (e.g., attention hyperactivity deficit disorder (e.g., ADHD)), and the like.
Detection of Canine Narcolepsy Using Nucleic Acid Diagnostics
In one embodiment of the invention, comprises nucleic acid probes, nucleic acid primers, and kits comprising such probes and/or primers for detection of the canine narcolepsy/Hcrtr2 susceptibility locus. The invention is also directed to methods for identifying subjects, particularly canine subjects, susceptible to or having narcolepsy using nucleic acid diagnostic methods.
Methods
In general, the diagnostic methods of the invention are carried out by first collecting nucleic acid samples (e.g., DNA or RNA) by relatively noninvasive techniques, e.g., DNA samples can be obtained with minimal penetration into body tissues of the subjects to be tested. Common noninvasive tissue sample collection methods may be used and include withdrawing buccal cells via cheek swabs and withdrawing blood samples. Following isolation of by standard techniques, PCR is performed on the sample nucleic acid utilizing pre-designed primers that produce enzyme restriction sites on those nucleic acid samples that harbor the defective gene. Where the sample is RNA, the RNA is gerenaly first reverse transcribed to cDNA, and then PCR performed. Treatment of the amplified DNA with appropriate restriction enzymes allows one to analyze for the presence of the defective allele. One skilled in the art will appreciate that this method may be applied not only to Doberman pinschers, Laborador retrievers, and Dachsunds, but also to other breeds that may be susceptible to or carriers for narcolepsy.
Probes and Primers
In general, the probes comprise at least a portion of a genetic marker that is linked to narcolepsy, e.g., a genetic marker indicative of a mutation in the hcrtr2 locus. The genetic markers are located on canine chromosome 12, in genomic regions that are analogous to genes or noncoding regions mapping to human chromosome 6 in the region of p12.2-q21. The region of canine chromosome 12 comprising genetic markers that are useful in the methods of the invention (“narcolepsy-informative region”) are indicated in FIG. 1, with Hcrtr2 indicating the position of the hypocretin 2 receptor gene. It will be appreciated and understood by those skilled in the art that with the identification of this region of canine chromosome 12 containing markers useful in the method of the present invention, and with the disclosure of exemplary genetic markers and the mapping of such markers to the narcolepsy-informative region (e.g., the region surrounding hcrtr2), that additional markers useful with the method of the present invention can be identified by routine linkage mapping.
Genetic markers useful in the present invention can be made using different methodologies known to those in the art. For example, using the map illustrated in FIG. 1, the narcolepsy-informative region of canine chromosome 12 (e.g., the region flanking and including the hcrtr2 gene) may be microdissected, and fragments cloned into vectors to isolate DNA segments which can be tested for linkage with the narcolepsy susceptibility locus. Alternatively, with the nucleotide sequences provided herein and described in more detail below, isolated DNA segments can be obtained from the narcolepsy-informative region of canine chromosome 12 by nucleic acid amplification (e.g., polymerase chain reaction) or by nucleotide sequencing of the relevant region of chromosome 9 (“chromosome walking”). Using the linkage test of the present invention, the DNA segments may be assessed for their ability to co-segregate with the narcolepsy susceptibility locus (e.g., a LOD score may be calculated), and thus determine the usefulness of each DNA segment in a molecular diagnostic assay for detection of narcolepsy or the carrier status.
The diagnostic method of the present invention may be used to determine the genotype of an individual dog, or a set of dogs that are closely related to a dog known to be affected with narcolepsy, by identifying in each of these dogs which alleles are present using a set of marker loci linked to narcolepsy. These linked marker loci cover a region (“narcolepsy-informative region”) commencing approximately at the level of the GSTA2 gene and ending at the primase 2A gene (Pnm2A) (see FIG. 1,). Linked marker loci that are located in close proximity to the Hcrtr2 locus include microsatellite markers listed in FIG. 2 (26-8 to 530-3 inclusive).
In general, nucleic acid molecules useful as probes comprise at least about 15 contiguous nucleotides (nt), and may comprise at least about 20, 25, or 100 to 500 contiguous nucleotides. Where the probes are to be used in a hybridization assay (e.g., to provide for direct detection of a narcolepsly-linked polymorphism), the probe comprises a sequence having a unique identifier for the mutated region, e.g., the probe provides for detection of aberrant splicing or for a single or multi-nucleotide change in a canine hypocretin receptor sequence (e.g., in a hypocretin 2 receptor sequence (hcrtr2)). Preferably, the probe is capable of hybridizing under high stringency conditions to a sequence encoding a mutated canine hypocretin receptor that causes canine narcolepsy or a complement thereof.
Exemplary sequences from which the probe sequence can be obtained include, but are not necessarily limited to, probes that specifically hybridize to the canine sequences listed in FIG. 6 and also included in GenBank Accession number AF164626, which provides for detection of narcolepsy in Doberman pinschers and Labradors. The Doberman narcolepsy mutation may be dectected using primers amplifying the region flanking the mutation consiting of the sine insertion described in FIG. 6 such as 554-65seqF (5′GGGAGGAACAGAAGGAGAGAATTT3′ (SEQ ID NO:3)) and R4/7-6R(110) (5′ATAGTTGTTAATGTGTACTTTAAGGC3′ (SEQ ID NO:4)) as shown in FIG. 4B. The labrador sequence(narc.Lab) listed in FIG. 6 can provide for detection a single nucleotide change within this sequence relative to wildtype (e.g., a G to A transversion at the 5′ splice site consensus sequence 3′ of exon 6,). The region containing the mutation can be amplified with primers flanking the mutated region such as
| 6INF(162) | (5′GACTTCATTTGGCCTTTGATTTAC3′ (SEQ ID NO:5)) | |
| and | ||
| 7EXR(1620) | (5′TTTTGATACGTTGTCGAAATTGCT3′ (SEQ ID NO:6)). |
Where the canine narcolepsy susceptibility locus is to be detected by amplification of the region (e.g., through RFLP analysis using PCR), exemplary primers suitable for use in the invention are provided in the table below.
| Exemplary Primers Suitable for Use in Detection of Canine Narcolepsy | |||||
| Susceptibility Locus | |||||
| Length | |||||
| Primer | Sequence | Repeat | bp | ||
| 530-3F1 | AAATGTCTAATCACTTTGCCCA | (SEQ ID NO:32) | (TA)25 | 150 | |
| 530-3R1 | CAAATCATGTCTAATAAGGGGC | (SEQ ID NO:33) | |||
| 530-5F1 | TTGGTGGCTAGTTTTACTCTCTT | (SEQ ID NO:34) | (GAAA)320 bp | 430 | |
| 530-5R1 | TGAATTCCAGTCAAATAAACAAA | (SEQ ID NO:35) | |||
| 6-28-6/F1 | TACTATTGCAGTTGGCATGCTG | (SEQ ID NO:36) | (CTTT)40 | 313 | |
| 6-28-6/R1 | GCATTACTTTGATACCAAACCC | (SEQ ID NO:37) | |||
| 6-28-8/F2 | TGGACATGTCAGGGATTAAAAG | (SEQ ID NO:38) | (AT)10(ATCT)11 | 300 | |
| 6-28-8/R1 | AATCCTTTGAGATTTGGAGAGG | (SEQ ID NO:39) | |||
| 6-28-2/F2 | GAATTTGTAGAGCTTGGCTAGG | (SEQ ID NO:40) | (CTTT)40 | 300 | |
| 6-28-2/R2 | GATGTGTAGAGGCCATCAAGAG | (SEQ ID NO:41) | |||
| 5-19-6/F1 | CTACCAATTGTACACCCACACA | (SEQ ID NO:42) | (AT)9 . . . (GATA)15 | 227 | |
| 5-19-6/R1 | TCCTTTGAGATTTGGAGAGGTA | (SEQ ID NO:43) | |||
| 4- | ctttgtgcagagtcttcttga | (SEQ ID NO:44) | (CA)5 . . . (CA)6 . . . (CA)7 | 180 | |
| 12t(ca)L | |||||
| 4- | gtggagtagctgctctaatagg | (SEQ ID NO:45) | |||
| 12t(ca)R | |||||
| 2-12-5/F1 | CAAAGCAGCAGGGTACAAAATC | (SEQ ID NO:46) | (GAAA)100 bp | 212 | |
| 2-12-5/R1 | CTTGGGATACCCCCAGTACTCC | (SEQ ID NO:47) | |||
| 26-1/F1 | GAGGCAAAATTTGCTTTTTCTC | (SEQ ID NO:48) | (CTTT)15 | 217 | |
| 26-1/R1 | GCAAGTTCCAATCAACCTCAAT | (SEQ ID NO:49) | |||
| 08.26- | GCCTAACAAAATGGCACATGA | (SEQ ID NO:50) | (CAAA)7 | 182 | |
| 8/T3/F | |||||
| 08.26- | GTTGAAATTAAACTCCATCCTG | (SEQ ID NO:51) | |||
| 8/T3/R | |||||
| 26-12/F1 | TAATCTGATTTTCCTGGAATCA | (SEQ ID NO:52) | (GAAA)180bp | 228 | |
| 26-12/R1 | GGAGGCATAAATGCTAGGAAG | (SEQ ID NO:53) | |||
| “Length” refers to the size of the amplified product generated using the corresponding primers. | |||||
Alternatively, where the invention involves detection of susceptibility of a canine subject to narcolepsy, the methods involve use of, and thus kits can comprise, at least one, generally at least two primers for amplification (e.g., by PCR) of a region of genomic DNA or of an mRNA (or cDNA produced from such mRNA) encoding a region of a canine hypocretin receptor gene so as to provide for detection of narcolepsy-linked mutations in the hypocretin receptor gene (e.g., the presence of a short interspersed nucleotide element (SINE) sequence, the presence of an aberrant splice junction sequence, and the like). In one embodiment, the primers are designed so that the size of the amplified gene product will be detectably different when produced from an animal having a mutant hypocretin receptor relative to a wild-type animal (i.e., an animal that does not have a hypocretin receptor mutation associated with narcolepsy. Amplification can also be accomplished using ligation amplification reaction technology (LAR) known to those skilled in the art. LAR is a method analogous to PCR for DNA amplification wherein ligases are employed for elongation in place of polymerases used for PCR.
The nucleic acid sequences described herein, particulary those useufl as hybridization probes, can be incorporated into an appropriate recombinant vector, e.g., viral vector or plasmid, which is capable of transforming an appropriate host cell, either eukaryotic (e.g., mammalian) or prokaryotic (e.g., E. coli ). Such DNA may involve alternate nucleic acid forms, such as cDNA, gDNA, and DNA prepared by partial or total chemical synthesis. The DNA may also be accompanied by additional regulatory elements, such as promoters, operators and regulators, which are necessary and/or may enhance the expression of an encoded gene product. In this way, cells may be induced to over-express a hypocretin receptor or hypocretin gene, thereby generating desired amounts of a target hypocretin receptor or hypocretin protein. It is further contemplated that, for example, sequences encoding the mutated canine hypocretin receptor polypeptide sequences of the present invention may be utilized to manufacture canine mutant hypocretin receptor using standard synthetic methods.
Polypeptides in Diagnosis
One skilled in the art will appreciate that the a defective protein encoded by a defective hypocretin receptor gene of the present invention may also be of use in formulating a complementary diagnostic test for canine narcolepsy that may provide further data in establishing the presence of the defective allele. Thus, production of the defective hypocretin receptor polypeptide, either through expression in transformed host cells as described above or through chemical synthesis, is also contemplated by the present invention.
Application to Human Narcolepsy
The ordinarily skilled artisan will readily appreciate that while the above specifically describes detection of narcolepsy in dogs, the probes and primers of similar design can be used in detection of narcolepsy in humans, e.g., probes and primers for detection of truncated or otherwise mutated hypocretin receptor polypeptide-encoding sequences. In one embodiment, the probes or primers are designed to detect polymorphisms in the region between and including EST 250618 and HCRTR2 on human chromosome 6p 1 2.2-q21.
Kits for Detecting Sequence Polymorphisms
In a related aspect, the invention provides kits for detection of nucleic acid encoding a hypocretin receptor or hypocretin peptide polymorphism by hybridization of the probe to a sample suspected of comprising a nucleic acid encoding such polymorphism. Such kits can comprise, for example, a probe specific for a hypocretin receptor or hypocretin peptide polymorphism, which probe may be detectably labeled. Alternatively, a detectable label or reagent for detecting specific binding of the probe to a sample suspected of comprising a hypocretin receptor or polypeptide polymorphism can be provided as a separate component. The kit can further comprise a positive control sample, a negative control sample or both to facilitate analysis of results with the test sample. In one embodiment, the probe is bound to a solid support, and the sample suspected of containing nucleic acid comprising a hypocretin-related polymorphism (e.g., a polymorphism in a hypocretin receptor gene or a hypocretin polypeptide gene) is contacted with the support-bound probe and, after removing unbound material, formation of hybridized complexes between the probe and the test sample are detected.
The invention also provides kits for detection of a nucleic acid comprising a hypocretin receptor or hypocretin peptide polymorphism by hybridization by using a probe to amplify a nucleic acid fragment. In this embodiment, the kit can comprise primers suitable for use in amplification (e.g., using PCR) of a locus that encompasses a region of a hypocretin-related polymorphism. The primers can be detectably labeled, or the kit can further comprise an additional reagent to provide for detection of amplified product. The amplified product from the test sample is then analyzed (e.g., by determining the size or length of the amplified product) to determine if the test sample comprises a nucleic acid encoding a hypocretin-related polymorphism. For example, the size of the amplified product from the test sample is compared to a control sample (e.g., a positive control sample which comprises a hypocretin-related polymorphism, or a negative control sample which comprises a wildtype (unaffected) sample).
Diagnosis Based Upon Detection of an Abnormal Immune Response
Individuals having or susceptible to a sleep disorder mediated by hypocretin receptor system can be identified by detection of an abnormal or aberrant immune response in the subject (e.g., an autoimmune response), which may be directed against a hypocretin receptor, hypocretin-containing cells and/or an endogenous ligand of a hypocretin receptor. In one embodiment, the method of diagnosis involves the detection of autoantibodies that bind a hypocretin receptor, against a protein component expressed in hypocretin receptor containing cells or against a hypocretin receptor endogenous ligand. In a second embodiment, the method of diagnosis involves the detection of an abnormal immune cellular reactivity (for example production of cytokines in the presence of a hypocretin-related antigen) in presence of hypocretins, hypocretin system or protein component of hypocretin containing cells.
In general, such screening immunoassays are performed by obtaining a sample from a patient suspected of having an hypocretin receptor-associated disorder. “Samples,” as used herein, include tissue biopsies, biological fluids, organ or tissue culture derived fluids, and fluids extracted from physiological tissues, as well as derivatives and fractions of such fluids. Exemplary samples include, but are not necessarily limited to, cerebrospinal fluid (CSF), blood, a blood derivative, serum, plasma, and the like.
Diagnosis may be determined using a number of methods that are well known in the art. For example, antibodies against the hypocretin ligand/receptor peptides can be detected using material coated with the hypocretin ligand/receptor peptide, addition of the patient material and detection of autoantibodies using anti-human immunoglobulins. In another example, antibodies against a hypocretin receptor can be detected in a sample from a subject suspected of having or susceptible to a sleep disorder by incubating the sample with the hypocretin receptor (e.g., purified hypocretin receptor or portion thereof retaining ligand binding activity, extracts or cell lines expressing the receptor or a binding domain of a hypocretin receptor, and the like) in the presence of a detectably labeled hypocretin receptor ligand (e.g., detectably labeled hypocretin (orexin)). The presence of antibody-antigen complex is then detected with a secondary antibody (anti-human immunoglobulin antibody) against the receptor, and/or the ability of the sample to compete for hypocretin receptor binding with the detectably labeled hypocretin receptor ligand (or inhibit such binding) is assessed. This can be accomplished using any of a variety of methods known in the art (e.g., fluorescence activated cell sorter (FACS), ELISA, etc.). The presence of anti-hypocretin receptor antibodies or anti-hypocretin antibodies in the sample is indicative of a sleep disorder, or susceptibility to a sleep disorder, in the subject.
Kits for Detecting Aberrant Immune Responses that Affect Hypocretin System Function
In a related aspect, the invention provides kits for detection of an aberrant immune response (e.g., an autoimmune response) that affects hypocretin-related activity in a subject. Such kits can comprise, for example, a specific binding reagent (e.g., a prehypocretin protein, a hypocretin peptide or antigenic fragment thereof, a hypocretin receptor or antigenic fragment thereof, or any antigenic protein component contained in hypocretin containing cell) for detecting the presence of anti-hypocretin system antibodies in a sample obtained from the subject. The specific binding reagent may be detectably labeled or a detectable label for detection of binding reagent specifically bound to a hypocretin-related component of the sample. The kit can further comprise a positive control sample, a negative control sample or both to facilitate analysis of results with the test sample. In one embodiment, the specific binding reagent is bound to a solid support, and the sample suspected of containing an anti-hypocretin system antibody is contacted with the support-bound probe. After removing unbound material, formation of hybridized complexes between the probe and the test sample are detected.
Diagnosis Based Upon Detection of Hypocretin Levels
The subjects having or susceptible to a sleep disorder (e.g., narcolepsy) can be identified by assessing levels of hypocretin in a subject. In general, the assays contemplated by the invention involve contacting a test sample from a subject suspected of having or being susceptible to a sleep disorder such as narcolepsy with a hypocretin binding-molecule (most typically antibodies), and detecting complexes (e.g., by radioimmunoassays). Other assays covered by the invention may indirectly measure hypocretin levels by measuring the biological activity of the peptide using in vivo biological tests (e.g. using tissue known to express a specific and measurable response to hypocretin stimulation via hypocrerin receptors) or by measuring the expression of such peptide or receptor in a biological sample. The assay can involve detection of preprohypocretin and all its derivatives (e.g. hypocretin-1, hypocretin-2, both hypocretin-1 and hypocretin-2 and other peptide fragments derived from preprohypocretin). As used in the context of the detection assay, “hypocretin” is meant to encompass detection of either one or both forms of hypocretin or any preprohypocretin derivatives. The assay can also involve detection of hypocretin-producing and/or hypocretin-containing cells in patient tissue (e.g., using imaging technology such as Magnetic Resonance Imaging, Positron Emission Tomography and the like) to, assess distraction of such cells and/or measuring levels of hypocretin receptor or hypocretin peptide expression using such imaging methods or other suitable methods known in the art.
Detection of a level of hypocretin that is decreased or increased relative to a level in a normal subject is indicative of a sleep disorder, particularly narcolepsy, in the subject. For example, detection of decreased, especially dramatically decreased hypocretin levels in a subject is indicative of narcolepsy. The biological marker may also be used to predict treatment response to hypocretin receptor drugs. For example, a narcoleptic subject with no detectable hypocretin levels in his cerebrospinal fluid may have a better therapeutic response to hypocretin receptor agonists that a subject with normal hypocretin level. While direct detection of hypocretin is described herein, it is to be understood that detection of other polypeptides or other molecules that provide for indirect assessment of hypocretin levels is also contemplated by the invention. For example, detection of a polypeptide (other than mature hypocretin) that results from processing of preprohypocretin can serve as a surrogate marker for hypocretin levels.
Any sample that is suitable for detection of hypocretin levels either qualitatively or quantitatively is suitable for use in the method of the invention. Exemplary samples suitable for use in the detection assay of the invention include, but are not necessarily limited to cerebrospinal fluid (CSF), blood, seminal fluid, urine, white blood cells and the like. The patient sample may be used directly, or diluted as appropriate, e.g., about 1:10 and usually not more than about 1:10,000. Immunoassays may be performed in any physiological buffer, e.g. PBS, normal saline, HBSS, PBS, etc.
Methods for detection of hypocretin involve the detection of binding between hypocretin and a hypocretin-specific binding molecule (e.g., anti-hypocretin antibodies or fragments thereof that retain antigen binding specificity, hypocretin receptors or fragments thereof that retains hypocretin binding specificity, and the like) or other methods. Detection of a level of hypocretin that is lower or higher relative to a normal hypocretin level (e.g., a hypocretin level in a non-affected subject) is indicative of a sleep disorder, particularly narcolepsy, in the subject. As will be readily apparent to the ordinarily skilled artisan upon reading the present specification, detection of hypocretin can be accomplished in a variety of ways.
In one embodiment, a conventional sandwich type assay is used. A sandwich assay is performed by first immobilizing proteins from the test sample on an insoluble surface or support. The test sample may be bound to the surface by any convenient means, depending upon the nature of the surface, either directly or indirectly. The particular manner of binding is not crucial so long as it is compatible with the reagents and overall methods of the invention. They may be bound to the plates covalently or non-covalently, preferably non-covalently.
The insoluble supports may be any compositions to which the test sample polypeptides can be bound, which is readily separated from soluble material, and which is otherwise compatible with the overall method of detecting and/or measuring hypocretin. The surface of such supports may be solid or porous and of any convenient shape. Examples of suitable insoluble supports to which the receptor is bound include beads, e.g., magnetic beads, membranes and microtiter plates. These are typically made of glass, plastic (e.g. polystyrene), polysaccharides, nylon or nitrocellulose. Microtiter plates are especially convenient because a large number of assays can be carried out simultaneously, using small amounts of reagents and samples.
After adding the patient sample or fractions thereof to the support, non-specific binding sites on the insoluble support, i.e. those not occupied by sample polypeptide, are generally blocked. Preferred blocking agents include non-interfering proteins such as bovine serum albumin, casein, gelatin, and the like. Alternatively, several detergents at non-interfering concentrations, such as Tween, NP40, TX100, and the like may be used.
Samples, fractions or aliquots thereof can be added to separately assayable supports (for example, separate wells of a microtiter plate). Preferably, a series of standards, containing known concentrations of hypocretin is assayed in parallel with the samples or aliquots thereof to serve as controls and to provide a means for quantitating the amounts of hypocretin in the test sample. Generally from about 0.001 ml to 1 ml of sample, diluted or otherwise, is sufficient, usually about 2 ml to 50 ml sufficing. Preferably, each sample and standard will be added to multiple wells so that mean values can be obtained for each.
After the test sample polypeptides are immobilized on the solid support, a hypocretin-specific binding molecule that specifically binds hypocretin (e.g., an anti-hypocretin specific antibody (e.g., an anti-hypocretin-1 monoclonal or polyclonal antibody, preferably a monoclonal antibody) or other hypocretin-binding molecule (e.g. a hypocretin receptor or fragment thereof)) is added. For sake of clarity in this example, the hypocretin-specific binding molecule is a monoclonal antibody that specifically binds hypocretin. However, it is to be understood that other hypocretin-specific binding molecules can be readily substituted for the antibody in this example. Methods for generating antibodies that specifically bind hypocretin are well known in the art, and need not be described in detail here. Furthermore, anti-hypocretin antibodies are commercially available and can be used in the methods of the present invention.
The incubation time of the sample and the anti-hypocretin first receptor should be for at time sufficient for binding to the insoluble polypeptide to form an antibody-hypocretin complex. Generally, from about 0.1 to 3 hr is sufficient, usually 1 hr sufficing.
After incubation, the insoluble support is generally washed of non-bound components. Generally, a dilute non-ionic detergent medium at an appropriate pH, generally 7-8, is used as a wash medium. From one to six washes may be employed, with sufficient volume to thoroughly wash non-specifically bound proteins present in the sample.
After washing, formation of anti-hypocretin antibody/hypocretin complexes to the sample can be detected by virtue of a detectable label on the anti-hypocretin antibody. Where the anti-hypocretin antibody is not detectably labeled, antibody binding can be detected by contacting the sample with a solution containing first receptor-specific second receptor (e.g., anti-hypocretin antibody-specific second receptor), in most cases a secondary antibody (i.e., an anti-antibody). The second receptor may be any compound which binds antibodies with sufficient specificity such that the bound antibody is distinguished from other components present. In one embodiment, second receptors are antibodies specific for the anti-hypocretin antibody, and may be either monoclonal or polyclonal sera, e.g. goat anti-mouse antibody, rabbit anti-mouse antibody, etc.
The antibody-specific second receptors are preferably labeled to facilitate direct, or indirect quantification of binding. Examples of labels which permit direct measurement of second receptor binding include light-detectable labels, radiolabels (such as 3 H or 125 I), fluorescers, dyes, beads, chemiluminescers, colloidal particles, and the like. Examples of labels which permit indirect measurement of binding include enzymes where the substrate may provide for a colored or fluorescent product. In one embodiment, the second receptors are antibodies labeled with a covalently bound enzyme capable of providing a detectable product signal after addition of suitable substrate. Examples of suitable enzymes for use in conjugates include horseradish peroxidase, alkaline phosphatase, malate dehydrogenase and the like. Where not commercially available, such antibody-enzyme conjugates are readily produced by techniques known to those skilled in the art.
Alternatively, the second receptor may be unlabeled. In this case, a labeled second receptor-specific compound is employed which binds to the bound second receptor. Such a second receptor-specific compound can be labeled in any of the above manners. It is possible to select such compounds such that multiple compounds bind each molecule of bound second receptor. Examples of second receptor/second receptor-specific molecule pairs include antibody/anti-antibody and avidin (or streptavidin)/biotin. Since the resultant signal is thus amplified, this technique may be advantageous where only a small amount of hypocretin is present, or where the background measurement (e.g., non-specific binding) is unacceptably high. An example is the use of a labeled antibody specific to the second receptor. More specifically, where the second receptor is a rabbit anti-allotypic antibody, an antibody directed against the constant region of rabbit antibodies provides a suitable second receptor specific molecule. The anti-Ig will usually come from any source other than human, such as ovine, rodentia, particularly mouse, or bovine.
The volume, composition and concentration of anti-antibody solution provides for measurable binding to the antibody already bound to receptor. The concentration will generally be sufficient to saturate all antibody potentially bound to hypocretin. When antibody ligands are used, the concentration generally will be about 0.1 to 50 mg/ml, preferably about 1 mg/ml. The solution containing the second receptor is generally buffered in the range of about pH 6.5-9.5. The solution may also contain an innocuous protein as previously described. The incubation time should be sufficient for the labeled ligand to bind available molecules. Generally, from about 0.1 to 3 hr is sufficient, usually 1 hr sufficing.
After the second receptor or second receptor-conjugate has bound, the insoluble support is generally again washed free of non-specifically bound second receptor, essentially as described for prior washes. After non-specifically bound material has been cleared, the signal produced by the bound conjugate is detected by conventional means. Where an enzyme conjugate is used, an appropriate enzyme substrate is provided so a detectable product is formed. More specifically, where a peroxidase is the selected enzyme conjugate, a preferred substrate combination is H 2 O 2 and is O-phenylenediamine which yields a colored product under appropriate reaction conditions. Appropriate substrates for other enzyme conjugates such as those disclosed above are known to those skilled in the art. Suitable reaction conditions as well as means for detecting the various useful conjugates or their products are also known to those skilled in the art. For the product of the substrate O-phenylenediamine for example, light absorbance at 490-495 nm is conveniently measured with a spectrophotometer.
The absence or presence of antibody binding may be determined by various methods that are compatible with the detectable label used, e.g., microscopy, radiography, scintillation counting, etc. Generally the amount of bound anti-hypocretin antibody detected will be compared to control samples (e.g., positive controls containing known amounts of hypocretin or negative controls lacking such polypeptides). The presence of decreased levels of bound anti-hypocretin antibody indicative of decreased levels of hypocretin in the sample, which in turn is indicative of a sleep disorder, particularly narcolepsy in the subject from whom the sample was obtained. Usually at least about a 2-fold decrease, often about a 4- to 5-fold decrease, generally a decrease in hypocretin levels to an undetectable level (e.g., less than about 40 pg/ml) in the test sample relative to hypocretin levels associated with normal subjects (e.g., subjects not affected by a sleep disorder such as narcolepsy) is indicative of a sleep disorder, particularly narcolepsy in a subject. In general, a 2-5 fold increase is also indicative of narcolepsy. The severity of the sleep disorder or the treatment response may also be directly correlated with the level of hypocretin in the sample.
Variations of the hypocretin detection assay of the invention as described above will be readily apparent to the ordinarily skilled artisan. For example, a competitive assay may be used, e.g., radioimmunoassay, etc. In addition to the patient sample, a competitor to hypocretin for binding to the hypocretin-specific binding molecule is added to the reaction mix. Usually, the competitor molecule will be labeled and detected as previously described, where the amount of competitor binding will be proportional to the amount of hypocretin in the sample. In one embodiment, the competitor molecule is a detectably labeled hypocretin polypeptide or fragment thereof that specifically binds the selected hypocretin-specific binding molecule to be used in the assay. Suitable detectable labels include those described above (e.g., radioactive labels, fluorescent labels, and the like). The concentration of competitor molecule will be from about 10 times the maximum anticipated hypocretin concentration to about equal concentration in order to make the most sensitive and linear range of detection.
Another alternative protocol is to provide hypocretin-specific binding molecules bound to the insoluble surface. After immobilization of the hypocretin-specific binding molecule on the insoluble support, the test sample is added, the sample incubated to allow binding of hypocretin, and complexes of hypocretin-hypocretin-specific binding molecule detected as described above.
In yet another alternative embodiment, the detection assay may be carried out in solution. For example, anti-hypocretin antibody is combined with the test sample, and immune complexes of antibody and hypocretin are detected. Other immunoassays (e.g., Ouchterlony plates or Western blots may be performed on protein gels or protein spots on filters) are known in the art and may find use as diagnostics.
In a related embodiment, the invention provides kits for detecting hypocretin in a sample obtained from a subject, where the kit can comprise as its components any or all of the reagents described above. In some embodiments, the reagents may be bound to a soluble support where appropriate, and may be detectably labeled or provided in conjunction with an additional reagent to facilitate detection.
Identification of Compounds that Bind the Orexin Receptor and Regulate Wakefulness
In another aspect the invention features a method for identification and use of wakefulness-promoting (hypocretin receptor agonist) and sleep-promoting (hypocretin receptor antagonists) agents by screening candidate agents for the ability to bind the hypocretin receptor in vitro and/or in vivo. Based on the observation that narcolepsy is associated with depression, fatigue and attention defect, and that hypocretins interact with monoaminergic systems involved in the regulation of these functions, the invention also features a method for identification and use of hypocretin receptor agonists in the treatment of attention deficit hyperactivity disorder, chronic fatigue syndrome and depression. Exemplary screening assays are described in more detail below.
Drug Screening
The animal models described herein, as well as methods using the hypocretin receptor in vitro, can be used to identify candidate agents that affect hypocretin receptor expression (e.g., by affecting hypocretin receptor promoter function) or that otherwise affect hypocretin receptor activity, e.g., by binding to stimulate or antagonize hypocretin receptor activity (e.g., the binding agent acts as an hypocretin receptor agonist and thus promotes wakefulness, or the binding agent acts as an hypocretin receptor antagonist and promotes sleep). Agents of interest include those that enhance, inhibit, regulate, or otherwise affect hypocretin receptor activity and/or expression. Agents that alter hypocretin receptor activity and/or expression can be used to, for example, treat or study disorders associated with decreased hypocretin receptor activity. “Candidate agents” is meant to include synthetic molecules (e.g., small molecule drugs, peptides, or other synthetically produced molecules or compounds, as well as recombinantly produced gene products) as well as naturally-occurring compounds (e.g., polypeptides, endogenous factors present in mammalian cells, hormones, plant extracts, and the like) and derivatives of such naturally-occurring compounds (e.g., hypocretin derivatives or analogues having altered receptor binding characteristics, etc)
Agents that stimulate or otherwise increase hypocretin receptor activity (e.g., hypocretin receptor “agonists,” which includes, but are not necessarily limited to, agents that bind to and stimulate hypocretin receptor, agents that promote binding of endogenous hypocretin ligand, agents that increase hypocretin receptor expression, and the like) are of interest as agents that enhance wakefulness. Agents that inhibit hypocretin receptor activity (e.g., hypocretin receptor “antagonists,” which includes, but are not necessarily limited to, agents that bind to hypocretin receptor but do not substantially stimulate the activity of the receptor, agents that block binding of hypocretin receptor agonists, agents that decrease hypocretin receptor expression, and the like) are of interest as agents that promote sleep. Agonistic and antagonistic agents can be used for the treatment of sleep disorders and/or for administration to subjects who wish to enhance their vigilance or promote sleep, but who are not affected or fully affected by a sleep disorder.
Exemplary embodiments of the drug screening assays of the invention will now be described in more detail.
Drug Screening Assays
Of particular interest in the present invention is the identification of agents that have activity in affecting hypocretin receptor expression and/or function. Drug screening can be designed to identify agents that provide a replacement or enhancement for hypocretin receptor function, or that reverse or inhibit hypocretin receptor function. Of particular interest are screening assays for agents that have a low toxicity for human cells.
The term “agent” as used herein describes any molecule with the capability of altering or mimicking the expression or physiological function of hypocretin receptor. Generally a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection.
Candidate agents encompass numerous chemical classes, including, but not limited to, organic molecules (e.g., small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons), peptides, antisense polynucleotides, and ribozymes, and the like. Candidate agents can comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules including, but not limited to: polynucleotides, peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.
Screening of Candidate Agents In Vitro
A wide variety of in vitro assays may be used to screen candidate agents for the desired biological activity, including, but not limited to, in vitro binding assays using labeled ligands, measurements of intracellular effects in cells expressing or having surface hypocretin receptors (e.g., calcium imaging, GTP binding, second messenger systems, etc.), protein-DNA binding assays (e.g., to identify agents that affect hypocretin receptor expression), electrophoretic mobility shift assays, immunoassays for protein binding, and the like. For example, by providing for the production of large amounts of hypocretin receptor protein, one can identify ligands or substrates that bind to, modulate or mimic the action of the proteins. The purified protein may also be used for determination of three-dimensional crystal structure, which can be used for modeling intermolecular interactions, transcriptional regulation, etc.
The screening assay can be a binding assay, wherein one or more of the molecules may be joined to a label, and the label directly or indirectly provide a detectable signal. Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g. magnetic particles, and the like. Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc. For the specific binding members, the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures.
A variety of other reagents may be included in the screening assays described herein. Where the assay is a binding assay, these include reagents like salts, neutral proteins, e.g. albumin, detergents, etc that are used to facilitate optimal protein-protein binding, protein-DNA binding, and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc. may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4 and 40° C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically between 0.1 and 1 hours will be sufficient.
Many mammalian genes have homologs in yeast and lower animals. The study of such homologs“physiological role and interactions with other proteins in vivo or in vitro can facilitate understanding of biological function. In addition to model systems based on genetic complementation, yeast has been shown to be a powerful tool for studying protein-protein interactions through the two hybrid system described in Chien et al. 1991 Proc. Natl. Acad. Sci. USA 88:9578-9582. Two-hybrid system analysis is of particular interest for exploring transcriptional activation by hypocretin receptor proteins and to identify cDNAs encoding polypeptides that interact with hypocretin receptor.
In one embodiment, the screening assay is a competitive binding assay to identify agents that compete with hypocretin for binding of the hypocretin receptor.
Screening of Candidate Agents In Vivo
Candidate agents can be screened in an animal model of a sleep disorder (e.g., in the narcoleptic canine model described in the Examples below; in animals that are transgenic for an alteration in hypocretin receptor, e.g., a transgenic hypocretin receptor “knock-out,” hypocretin receptor “knock-in,” hypocretin receptor comprising an operably linked reporter gene, and the like).
In one embodiment, screening of candidate agents is performed in vivo in a transgenic animal described herein. Transgenic animals suitable for use in screening assays include any transgenic animal having an alteration in hypocretin receptor expression, and can include transgenic animals having, for example, an exogenous and stably transmitted human hypocretin receptor gene sequence, a reporter gene composed of a (removed human) hypocretin receptor promoter sequence operably linked to a reporter gene (e.g., β-galactosidase, CAT, or other gene that can be easily assayed for expression), or a homozygous or heterozygous knockout of an hypocretin receptor gene. The transgenic animals can be either homozygous or heterozygous, preferably homozygous, for the genetic alteration and, where a sequence is introduced into the animal's genome for expression, may contain multiple copies of the introduced sequence. Where the in vivo screening assay is to identify agents that affect the activity of the hypocretin receptor promoter, the hypocretin receptor promoter can be operably linked to a reporter gene (e.g., luciferase) and integrated into the non-human host animal's genome or integrated into the genome of a cultured mammalian cell line.
In general, the candidate agent is administered to the animal, and the effects of the candidate agent determined. The candidate agent can be administered in any manner desired and/or appropriate for delivery of the agent in order to effect a desired result. For example, the candidate agent can be administered by injection (e.g., by injection intravenou