[0001] This application claims the benefit of U.S. Patent Application No. 60/270,922, filed Feb. 23, 2001; U.S. Patent Application No. 60/295,037, filed Jun. 1, 2001; and U.S. Patent Application No. 60/348,670, filed Jan. 14, 2002, which are herein incorporated by reference.
[0002] The present invention generally relates to substances and methods useful for the treatment of neoplastic disease. More specifically, it relates to oncolytic adenoviral vectors and their use in methods of gene therapy.
[0003] Adenoviruses that replicate selectively in tumor cells are being developed as anticancer agents (“oncolytic adenoviral vectors”). Such oncolytic vectors amplify the input virus dose due to viral replication in the tumor, leading to spread of the virus throughout the tumor mass. In situ replication of adenoviruses leads to cell lysis. This in situ replication may allow relatively low, non-toxic doses to be highly effective in the selective elimination of tumor cells.
[0004] One approach to achieving selectivity is to introduce loss-of-function mutations in viral genes that are essential for growth in non-target cells but not in tumor cells. This strategy is exemplified by the use of Addl1520, which has a deletion in the E1b-55 KD gene. In normal cells, the adenoviral E1b-55 KD protein is needed to bind to p53 to prevent apoptosis. In p53-deficient tumor cells, E1b-55K binding to p53 is unnecessary. Thus, deletion of E1b-55 KD should theoretically restrict vector replication to p53-deficient tumor cells.
[0005] Another approach is to use tumor-selective promoters to control the expression of early viral genes required for replication (U.S. Pat. No. 5,998,205 (Hallenbeck et al., 1999)). Thus, in this approach the adenoviral vectors will specifically replicate and lyse tumor cells if the gene that is essential for replication is exclusively under the control of a promoter or other transcriptional regulatory element which is tumor-specific.
[0006] It is an object of the present invention to provide novel oncolytic adenoviral vectors for the treatment of neoplastic disease, which exhibit a high degree of tumor selectivity, therapeutic efficacy, and safety when administered to a host organism.
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051] *: p<0.05 between Ar6pAE2fF or Ar6pAE2fE3F and Addl312, ANOVA
[0052] □: p<0.05 between Ar6pAE2fF and Ar6pAE2fE3F vectors, ANOVA
[0053]
[0054] *: p<0.05 between Ar6pAE2fhGmF or Ar6pAE2f(E3+,hGm,Dg19)F and Addl312, ANOVA
[0055] □: p<0.05 between Ar6pAE2fhGmF and Ar6pAE2f(E3+,hGm,Dg19)F vectors, ANOVA
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082] The present invention provides novel and improved oncolytic adenoviral vectors and their uses in methods of gene therapy. In a preferred embodiment, the oncolytic adenoviral vector has an E2F promoter operably linked to the E1 gene. In a particularly preferred embodiment, the oncolytic adenoviral vectors has an E2F promoter operably linked to the E1 a gene and the human telomerase reverse transcriptase promoter operably linked to the E4 gene.
[0083] Accordingly, in one aspect, the present invention provides a recombinant viral vector comprising an adenoviral nucleic acid backbone, wherein said nucleic acid backbone comprises in sequential order: A left ITR, a termination signal sequence, an E2F responsive promoter which is operably linked to a first gene essential for replication of the recombinant viral vector, an adenoviral packaging signal and a right ITR.
[0084] In a second aspect, the invention provides a recombinant viral vector comprising an adenoviral nucleic acid backbone, wherein said nucleic acid backbone comprises in sequential order: A left ITR, a termination signal sequence, an E2F responsive promoter which is operably linked to a first gene essential replication of the recombinant viral vector, a telomerase promoter operably linked to a second gene essential for replication, an adenoviral packaging signal and a right ITR.
[0085] In another aspect, the invention provides adenoviral particles comprising these vectors. Preferably, the particles further comprise a targeting ligand included in a capsid protein of the particles.
[0086] In another aspect, the adenoviral particles carry at least one therapeutic transgene. Preferably, the particles further comprise a polynucleotide encoding a cytokine such as GM-CSF that can stimulate a systemic immune response against tumor cells.
[0087] In another aspect, there is provided a method of selectively killing a neoplastic cell in a cell population which comprises contacting a suitable amount of the recombinant viral vector of the invention with said cell population under conditions where the recombinant viral vector can transduce the cells of said cell population.
[0088] In a further aspect a pharmaceutical composition comprising the recombinant viral vector of the invention and a pharmaceutically acceptable carrier is provided.
[0089] In yet another aspect a method of treating a host organism having a neoplastic condition is provided, comprising administering a therapeutically effective amount of the composition of the invention to said host organism.
[0090] The present invention provides novel viral vectors based on the oncolytic adenoviral vector strategy as described in U.S. Pat. No. 5,998,205, issued Dec. 7, 1999 to Hallenbeck et al., the disclosure of which is hereby incorporated by reference in its entirety. In particular, oncolytic adenoviral vectors are disclosed in which expression of an adenoviral gene, which is essential for replication, is controlled by E2F-responsive promoters which are selectively transactivated in cancer cells. Examples of E2F-responsive promoters are disclosed in PCT publication WO 98/13508, published Apr. 2, 1998.
[0091] Without being bound by theory, the inventors believe that the mechanism of action is as follows. The selectivity of E2F-responsive promoters (hereinafter sometimes referred to as E2F promoters) is based on the derepression of the E2F promoter/transactivator in Rb-pathway defective tumor cells. In quiescent cells, E2F binds to the tumor suppressor protein pRB in ternary complexes. In its complexed form, E2F functions to repress transcriptional activity from promoters with E2F binding sites, including the E2F-1 promoter itself (Zwicker J, and Muller R.
[0092] In the majority of tumor types, the Rb cell cycle regulatory pathway is disrupted, suggesting that Rb-pathway deregulation is obligatory for tumorigenesis (Strauss M, Lukass J and Bartek J.
[0093] In one aspect the present invention now provides recombinant viral vector comprising an adenoviral nucleic acid backbone, wherein said nucleic acid backbone comprises in sequential order: A left ITR, a termination signal sequence, an E2F responsive promoter which is operably linked to a first gene essential for replication of the recombinant viral vector, an adenoviral packaging signal, and a right ITR.
[0094] In another aspect, the present invention now provides recombinant viral vector comprising an adenoviral nucleic acid backbone, wherein said nucleic acid backbone comprises in sequential order: A left ITR, a termination signal sequence, an E2F responsive promoter which is operably linked to a first gene essential for replication of the recombinant viral vector, a telomerase promoter operably linked to a second gene essential for replication, an adenoviral packaging signal, and a right ITR.
[0095] The recombinant viral vectors of this invention are useful as therapeutics for cancer therapy. In particular, the vectors of the invention preferentially kill Rb-pathway defective tumor cells as compared to cells which are non-defective in the Rb-pathway. Furthermore, such vectors exhibit a favorable toxicity profile, which is clinically acceptable for the condition to be treated. Without wishing to be limited by theoretical considerations, the specific regulation of viral replication by a E2F promoter, which is preferably shielded from readthrough transcription by the upstream termination signal sequence, avoids toxicity that would occur if it replicated in non-target tissues, allowing for the favorable efficacy/toxicity profile. Preferably, the specificity of the regulation of viral replication by a E2F promoter may be further enhanced in the vectors of the invention because of the positioning of the packaging signal downstream of the E2F-linked gene essential for replication. This positioning provides for the possibility to delete sequences of the adenoviral backbone which are located upstream of the E2F-linked gene and which would encompass the packaging signal in its wild-type position. Such deletions further improve the specificity of regulation of viral replication by a E2F promoter. Thus, the combination and the sequential positioning of the genetic elements employed in the vectors of this invention provide for the vector's therapeutic efficacy, while at the same time synergistically minimizing toxicity and side effects in the patient. The recombinant viral vectors of the invention may further comprise a telomerase promoter operably linked to the E4 gene.
[0096] The present invention contemplates the use of all adenoviral serotypes. In a preferred embodiment, the adenoviral nucleic acid backbone is derived from adenovirus serotype 2(Ad2), 5 (Ad5) or 35 (Ad35). A preferred vector comprises an Ad5 nucleic acid backbone, wherein the backbone comprises in sequential order a left ITR, an SV40 early polyA site, a human E2F-1 promoter operably linked to the E1A gene, a telomerase promoter operably linked to the E4 gene, an adenoviral packaging signal, and a right ITR.
[0097] A preferred vector is Ar6pAE2fF. The vector Ar6pAE2fF is an adenovirus vector that uses a fragment of the human E2F-1 promoter to selectively regulate E1A expression and thus adenoviral replication in tumor cells. Characterization of the Ar6pAE2fF vector in vitro shows that it selectively kills Rb-pathway defective tumor cells over normal primary cells. Likewise, this vector is shown to be preferentially replicated in human tumor cell lines versus normal primary cells. Studies in vivo show that this vector has a superior early toxicity profile to the non-selective replication competent virus, Addl327, when administered intravenously in SCID mice. Further in vivo studies in subcutaneous xenograft models in nude mice show efficacy against different tumors, in particular against tumors of the liver and lung. Furthermore, intra-tumoral administration of Ar6pAE2fF in two independent human xenograft models elicited dose-dependent effects on tumor growth and progression. Ar6pAE2fF is shown to provide advantages in efficacy, selectivity, and safety as compared to the oncolytic adenoviral vector Addl 520.
[0098] A particularly preferred vector is Ar17pAE2fFTrtex. Ar17pAE2fFTrtex is a tumor-selective oncolytic adenovirus designed for the treatment of a broad range of cancer indications. Without being bound by theory, the inventors engineered Ar17pAE2fFTrtex to be dependent on the presence of the two most common alterations in human cancer, namely defects in the Rb-pathway (˜85% of all cancers) and over expression of telomerase (˜85% of all cancers). Like the intratumoral oncolytic adenovirus Ar6pAE2fF, Ar17pAE2fFTrtex utilizes a E2F-1 promoter to control expression of the adenoviral E1 gene. To increase tumor selectivity appropriate for systemic delivery, the adenoviral E4 gene in Ar17pAE2fFTrtex is controlled by a hTERT (human telomerase reverse transcriptase) promoter. Ar17pAE2fFTrtex is expected to replicate in the majority of cancer cells, lead to tumor selective-expression of toxic viral proteins, cytolysis, and enhancement of sensitivity to chemotherapy, cytokines and cytotoxic T lymphocytes.
[0099] As used herein, the term “viral vector” is used according to its art-recognized meaning. It refers to a nucleic acid vector construct which includes at least one element of viral origin and may be packaged into a viral vector particle. The viral vector particles may be utilized for the purpose of transferring DNA into cells either in vitro or in vivo.
[0100] A nucleic acid sequence is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter is operably linked to a gene if it affects the transcription of said gene. Operably linked DNA sequences are typically contiguous.
[0101] A termination signal sequence within the meaning of the invention may be any genetic element that causes RNA polymerase to terminate transcription, such as for example a polyadenylation signal sequence. A polyadenylation signal sequence is a recognition region necessary for endonuclease cleavage of an RNA transcript that is followed by the polyadenylation consensus sequence AATAAA. A polyadenylation signal sequence provides a “polyA site”, i.e. a site on a RNA transcript to which adenine residues will be added by post-transcriptional polyadenylation. Polyadenylation signal sequences are useful insulating sequences for transcription units within eukaryotic cells and eukaryotic viruses. Generally, the polyadenylation signal sequence includes a core poly(A) signal which consists of two recognition elements flanking a cleavage-polyadenylation site (
[0102] The termination signal sequence increases the therapeutic effect because it will reduce replication and toxicity of the oncolytic adenoviral vectors in non-target cells. Oncolytic vectors of the present invention with a polyadenylation signal inserted upstream of the E1A coding region are superior to their non-modified counterparts as they demonstrated the lowest level of E1A expression in nontarget cells. Thus, insertion of a polyadenylation signal sequence to stop nonspecific transcription from the left ITR will improve the specificity of E1A expression from the respective promoter. Insertion of the polyadenylation signal sequences will reduce replication of the oncolytic adenoviral vector in nontarget cells and therefore toxicity. A termination signal sequence could also be placed before (5′) any promoter in the vector. In one embodiment, the terminal signal sequence is placed before a heterologous promoter operably linked to the E4 gene.
[0103] A E2F-responsive promoter has at least one E2F binding site. Preferably, the E2F-responsive promoter is a mammalian E2F promoter, more preferred is a human E2F promoter. In a preferred embodiment of the invention, the E2F-responsive promoter is the human E2F-1 promoter, particularly preferred is the human E2F-1 promoter having the sequence as described in
[0104] The E2F-responsive promoter does not have to be the full length wild type promoter, but should have a tumor-selectivity of at least 3-fold, preferably at least 10-fold, at least 30-fold or even at least 300-fold. Tumor-selectivity can be determined by a number of assays using known techniques, such as the techniques employed in example 4, for example RT-PCR. Preferably the tumor-selectivity of the adenoviral vectors is quantified by E1A RNA levels, as further described in example 4, and preferably the E1A RNA levels obtained in H460 cells are compared to those in PrEC cells in order to determine tumor-selectivity for the purposes of this invention. The relevant conditions of the experiment should follow those described in example 4. For example, Ar6pAE2fF in example 4 displays a tumor-selectivity of 2665/8-fold, i.e. about 332-fold.
[0105] E2F responsive promoters typically share common features such as Sp I and/or ATT7 sites in proximity to their E2F site(s), which are frequently located near the transcription start site, and lack of a recognizable TATA box. E2F-responsive promoters include E2F promoters such as the E2F-1 promoter, dihydrofolate reductase (DHFR) promoter, DNA polymerase A (DPA) promoter, c-myc promoter and the B-myb promoter. The E2F-1 promoter contains four E2F sites that act as transcriptional repressor elements in serum-starved cells. Preferably, an E2F-responsive promoter has at least two E2F sites.
[0106] Without being bound by theory, the understanding of selective hTERT expression in cancer is based on the current knowledge of the molecular underpinnings involved in tumorigenesis. hTERT is the rate-limiting catalytic subunit of telomerase, a multicomponent ribonucleoprotein enzyme that has also been shown to be active in ˜85% of human cancers but not normal somatic cells (Kilian A et al.
[0107] The term TERT promoter refers to the native TERT promoter and functional fragments, mutations and derivatives thereof. The TERT promoter does not have to be the full-length wild type promoter. One skilled in the art knows how to derive fragments from a TERT promoter and test them for the desired specificity. Preferably, the TERT promoter of the invention is a mammalian TERT promoter, more preferred is a human TERT promoter (hTERT). In one embodiment of the invention, the TERT promoter consists essentially of SEQ ID NO:93 which is a 397 bp fragment of the hTERT promoter. In a preferred embodiment of the invention, the TERT promoter consists essentially of SEQ ID NO:94, which is a 245 bp fragment of the hTERT promoter. In a preferred embodiment, a TERT promoter is operably linked to the adenovirus E4 region.
ccctcgctggcgtccctgcaccctgggagcgcgagcg SEQ ID NO:93 gcgcgcgggcggggaagcgcggcccagacccccgggt ccgcccggagcagctgcgctgtcggggccaggccggg ctcccagtggattcgcgggcacagacgcccaggaccg cgcttcccacgtggcggagggactggggacccgggca cccgtcctgccccttcaccttccagctccgcctcctc cgcgcggaccccgccccgtcccgacccctcccgggtc cccggcccagccccctccgggccctcccagcccctcc ccttcctttccgcggccccgccctctcctcgcggcgc gagtttcaggcagcgctgcgtcctgctgcgcacgtgg gaagccctggccccggccacccccgcg ccccacgtggcggagggactggggacccgggcacccg SEQ ID NO:94 tcctgccccttcaccttccagctccgcctcctccgcg cggaccccgccccgtcccgacccctcccgggtccccg gcccagccccctccgggccctcccagcccctcccctt cctttccgcggccccgccctctcctcgcggcgcgagt ttcaggcagcgctgcgtcctgctgcgcacgtgggaag ccctggccccggccacccccgcg
[0108] The recombinant viral vector comprises a gene essential for replication. The term “gene essential for replication” refers to a nucleic acid sequence whose transcription is required for the vector to replicate in the target cell. For example, if the vector construct of the invention is an adenoviral vector, the gene essential for replication may be selected from the group consisting of E1A, E1, E2 and E4 coding sequences. Most preferably, the gene essential for replication is selected from the group consisting of the E1A, E1b, and E4 coding sequences. Particularly preferred is the adenoviral E1A gene as the gene essential for replication.
[0109] In a preferred embodiment, the recombinant viral vector further comprises a deletion upstream of the termination signal sequence. Preferred are deletions between nucleotides 103 and 551 of the adenoviral type 5 backbone or corresponding positions in other serotypes. In particular, deletions between nucleotides 189 and 551 or corresponding positions in other serotypes are preferred.
[0110] A deletion in the packaging signal 5′ to the termination signal sequence may be such that the packaging signal becomes non-functional. In one embodiment, the deletion comprises a deletion 5′ to the termination signal sequence wherein the deletion spans at least the nucleotides 189 to 551. In another embodiment the deletion comprises a deletion 5′ to the termination signal sequence wherein the deletion spans at least nucleotides 103 to 551 (
[0111] In the context of adenoviral vectors, the term “5′” is used interchangeably with “upstream” and means in the direction of the left ITR. In the context of adenoviral vectors, the term “3′” is used interchangeably with “downstream” and means in the direction of the right ITR.
[0112] In one embodiment, the invention further comprises a mutation or deletion in the E3 region. However, in an alternative, preferred embodiment, all or a part of the E3 region may be preserved or re-inserted in the oncolytic adenoviral vector. Presence of all or a part of the E3 region may decrease the immunogenicity of the adenoviral vector. It also increases cytopathic effect in tumor cells and decreases toxicity to normal cells. Preferably, the vector expresses more than half of the E3 proteins.
[0113] In an alternative embodiment, the invention further comprises a mutation or deletion in the E1b gene. Preferably the mutation or deletion in the E1 gene is such that the E1-19 kD protein becomes non-functional. This modification of the El b region may be combined with vectors where all or a part of the E3 region is present.
[0114] In a preferred embodiment, the oncolytic adenoviral vector further comprises at least one therapeutic gene. The therapeutic gene, preferably in the form of cDNA, can be inserted in any position that does not adversely affect the infectivity or replication of the vector. Preferably, it is inserted in the E3 region in place of at least one of the polynucleotide sequences coding for the E3 proteins. Most preferably, the therapeutic gene is inserted in place of the 19 kD or 14.7 kD E3 gene.
[0115] A therapeutic gene can be one that exerts its effect at the level of RNA or protein. Therapeutic genes that may be introduced into the adenovirus include a factor capable of initiating apoptosis, antisense or ribozymes, which among other capabilities may be directed to mRNAs encoding proteins essential for proliferation, such as structural proteins, transcription factors, polymerases, etc., genes encoding cytotoxic proteins, genes that encode an engineered cytoplasmic variant of a nuclease (e.g. RNase A) or protease (e.g. trypsin, papain, proteinase K, carboxypeptidase, etc.), or encode the Fas gene, and the like.
[0116] Other therapeutic genes of interest include, but are not limited to, immunostimulatory, anti-angiogenic, and suicide genes. Immunostimulatory genes include, but are not limited to, cytokines (GM-CSF, IL1, IL2, IL4, IL5, IFNa, IFNγ, TNFα, IL12, IL18, and flt3), proteins that stimulate interactions with immune cells (B7, CD28, MHC class I, MHC class II, TAPs), tumor-associated antigens (immunogenic sequences from MART-1, gpl 00(pmel-17), tyrosinase, tyrosinase-related protein 1, tyrosinase-related protein 2, melanocyte-stimulating hormone receptor, MAGE1, MAGE2, MAGE3, MAGE12, BAGE, GAGE, NY-ESO-1, β-catenin, MUM-1, CDK-4, caspase 8, KIA 0205, HLA-A2R1701, α-fetoprotein, telomerase catalytic protein, G-250, MUC-1, carcinoembryonic protein, p53, Her2/neu, triosephosphate isomerase, CDC-27, LDLR-FUT, telomerase reverse transcriptase, and PSMA), cDNAs of antibodies that block inhibitory signals (CTLA4 blockade), chemokines (MIP1a, MIP3a, CCR7 ligand, and calreticulin), and other proteins. Anti-angiogenic genes include, but are not limited to, METH-1, METH -2, TrpRS fragments, proliferin-related protein, prolactin fragment, PEDF, vasostatin, various fragments of extracellular matrix proteins and growth factor/cytokine inhibitors. Various fragments of extracellular matrix proteins include, but are not limited to, angiostatin, endostatin, kininostatin, fibrinogen-E fragment, thrombospondin, tumstatin, canstatin, and restin. Growth factor/cytokine inhibitors include, but are not limited to, VEGFNEGFR antagonist, sFlt-1, sFlk, sNRP1, angiopoietin/tie antagonist, sTie-2, chemokines (IP-10, PF-4, Gro-beta, IFN-gamma (Mig), IFNα, FGF/FGFR antagonist (sFGFR), Ephrin/Eph antagonist (sEphB4 and sephrinB2), PDGF, TGFβ and IGF-1.
[0117] A “suicide gene” encodes for a protein which itself can lead to cell death, as with expression of diphtheria toxin A, or the expression of the protein can render cells selectively sensitive to certain drugs, e.g., expression of the Herpes simplex thymidine kinase gene (HSV-TK) renders cells sensitive to antiviral compounds, such as acyclovir, gancyclovir and FIAU (1-(2-deoxy-2-fluoro-β-D-arabinofuranosil)-5-iodouracil). Other suicide genes include, but are not limited to, genes that encode for carboxypeptidase G2 (CPG2), carboxylesterase (CA), cytosine deaminase (CD), cytochrome P450 (cyt-450), deoxycytidine kinase (dCK), nitroreductase (NR), purine nucleoside phosphorylase (PNP), thymidine phosphorylase (TP), varicella zoster virus thymidine kinase (VZV-TK), and xanthine-guanine phosphoribosyl transferase (XGPRT). Alternatively, the therapeutic gene can exert its effect at the level of RNA, for instance, by encoding an antisense message or ribozyme, a protein that affects splicing or 3′ processing (e.g., polyadenylation), or a protein that affects the level of expression of another gene within the cell, e.g. by mediating an altered rate of mRNA accumulation, an alteration of mRNA transport, and/or a change in post-transcriptional regulation. The addition of a therapeuitc gene to the virus would result in a virus with an additional antitumor mechanism of action. Thus, a single entity (i.e., the virus carrying a therapeutic transgene) would be capable of inducing multiple antitumor mechanisms.
[0118] The DNA sequence encoding the therapeutic gene may preferably be selected from either GM-CSF, thymidine kinase, Nos, FasL, or sFasR (soluble Fas receptor). In a particularly preferred embodiment, the therapeutic gene is GM-CSF.
[0119] Granulocyte macrophage colony stimulating factor (GM-CSF) is a multi-functional glycoprotein produced by T cells, macrophages, fibroblasts and endothelial cells. It stimulates the production of granulocytes (neutrophils, eosinophils & basophils) and cells of the monocytic lineage, including monocytes, macrophages and dendritic cells (reviewed in Armitage J O et al.
[0120] Blood 1998 Dec 15;92(12):4491-508). In addition, it activates the effector functions of these cells and also appears to stimulate the differentiation of B cells. Since the early 1990's, a number of groups have investigated the clinical use of recombinant human GM-CSF for the treatment of cancer.
[0121] Of central importance in the oncology setting is the ability of GM-CSF to augment the antigen presentation capability of the subclass of dendritic cells (DC) capable of stimulating robust anti-tumor responses (Gasson et al.
[0122] The DNA sequence encoding a therapeutic gene is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter and/or the E3 promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the Rous Sarcoma Virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; and the ApoAI promoter. In a preferred embodiment, the promoter is a tissue-specific promoter as disclosed in U.S. Pat. No. 5,998,205, issued Dec. 7, 1999 to Hallenbeck, et al. An E2F-responsive promoter is particularly preferred, such as the human E2F-1 promoter.
[0123] The invention further comprises combinations of two or more transgenes with synergistic, complementary and/or nonoverlapping toxicities and methods of action. The resulting oncolytic adenovirus would retain the viral oncolytic functions and would, for example, additionally be endowed with the ability to induce immune and anti-angiogenic responses, etc.
[0124] The invention further comprises adenoviral vector particles, which comprise the viral vectors of the invention. Preferably, the viral particles further comprise a targeting ligand included in a capsid protein of the particle. Preferably, the capsid protein is a fiber protein, and most preferably, the ligand is in the HI loop of the fiber protein.
[0125] The adenoviral vectors of the invention are made by standard techniques known to those skilled in the art. The vectors are transferred into packaging cells by techniques known to those skilled in the art. Packaging cells provide complementing functions to the functions provided by the genes in the adenovirus genome that are to be packaged into the adenovirus particle. The production of such particles requires that the vector be replicated and that those proteins necessary for assembling an infectious virus be produced. The packaging cells are cultured under conditions that permit the production of the desired viral vector particle. The particles are recovered by standard techniques. The preferred packaging cells are those that have been designed to limit homologous recombination that could lead to wild-type adenoviral particles. Such cells are disclosed in U.S. Pat. Nos. 5,994,128, issued Nov. 30, 1999 to Fallaux, et al., and 6,033,908, issued Mar. 7, 2000 to Bout, et al. The packaging cell known as PER.C6, which is disclosed in these patents, is particularly preferred.
[0126] In a preferred embodiment of the invention, the recombinant viral vectors and particles selectively replicate in and lyse Rb-pathway defective cells. In the majority of tumor types, the Rb/cell cycle regulatory pathway is disrupted, suggesting that Rb-pathway disregulation may be obligatory for tumorgenesis (Strauss M, Lukass J and Bartek J.
[0127] Unrestricted cell cycling and cancer. Nat Med 1995; 12:1245-1246). Rb itself is mutated in some tumor types, and in other tumor types factors upstream of Rb are deregulated (Weinberg, R A.
[0128] In particular, cells which have mutations in genes encoding factors that phosphorylate pRB may be Rb-pathway defective cells within the meaning of the invention. pRB is temporally regulated by phosphorylation during the cell cycle. Among the factors that phosphorylate pRB is the complex of cyclin-dependent-kinase 4 (CDK4) and its regulatory subunit, D-type cyclins (CycD). CDK4 is in turn regulated by the p16 small molecular weight CDK inhibitor. Phosphorylation by CDKs reversibly inactivates pRB, resulting in transcriptional activation by E2F-DP-1 dimers and entry into S phase of the cell cycle. Dephosphorylation of pRB after mitosis causes re-entry into G
[0129] Accordingly, in another aspect there is provided a method of selectively killing a neoplastic cell in a cell population which comprises contacting an effective amount of the viral vectors or viral particles of the invention with said cell population under conditions where the viral vectors or particles can transduce the neoplastic cells in the cell population, replicate, and kill the neoplastic cells. Preferably, the neoplastic cell has a defect in the Rb-pathway.
[0130] The viral vectors of the invention are useful in studying methods of killing neoplastic cells in vitro or in animal models. Preferably, the cells are mammalian cells. More preferably, the mammalian cells are primate cells. Most preferably, the primate cells are human cells.
[0131] In a further aspect of the invention, a pharmaceutical composition comprising the recombinant viral vectors and particles of the invention and a pharmaceutically acceptable carrier is provided. Such compositions, which can comprise an effective amount of adenoviral vectors and particles of this invention in a pharmaceutically acceptable carrier, are suitable for local or systemic administration to individuals in unit dosage forms, sterile parenteral solutions or suspensions, sterile non-parenteral solutions or oral solutions or suspensions, oil in water or water in oil emulsions and the like. Formulations for parenteral and non-parenteral drug delivery are known in the art. Compositions also include lyophilized and/or reconstituted forms of the adenoviral vectors and particles of the invention. Acceptable pharmaceutical carriers are, for example, saline solution, protamine sulfate (Elkins-Sinn, Inc., Cherry Hill, N.J.), water, aqueous buffers, such as phosphate buffers and Tris buffers, or Polybrene (Sigma Chemicel, St. Louis Mo.) and phosphate-buffered saline and sucrose. The selection of a suitable pharmaceutical carrier is deemed to be apparent to those skilled in the art from the teachings contained herein. These solutions are sterile and generally free of particulate matter other than the desired adenoviral virions. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, etc. Excipients which enhance infection of cells by adenovirus may be included.
[0132] The viral vectors are administered to a host in an amount which is effective to inhibit, prevent, or destroy the growth of the tumor cells through replication of the viral vectors in the tumor cells. Such administration may be by systemic administration as hereinabove described, or by direct injection of the vectors in the tumor. In general, the vectors are administered systemically in an amount of at least 5×10
[0133] Delivery can be achieved in a variety of ways, employing liposomes, direct injection, catheters, topical applications, etc.
[0134] In yet another aspect, a method of treating a host organism having a neoplastic condition is provided, comprising administering a therapeutically effective amount of the composition of the invention to said host organism.
[0135] In a preferred embodiment of the invention, the neoplastic tissue is abnormally proliferating, and preferably malignant tumor tissue. Preferably, the viral vector is distributed essentially throughout the tissue or tumor mass due to its capacity for selective replication in the tumor tissue.
[0136] All neoplastic conditions are potentially amenable to treatment with the methods of the invention. Tumor types include, but are not limited to hematopoietic, pancreatic, neurologic, hepatic, gastrointestinal tract, endocrine, biliary tract, sinopulmonary, head and neck, soft tissue sarcoma and carcinoma, dermatologic, reproductive tract, and the like. Preferred tumors for treatment are those with a high mitotic index relative to normal tissue. Preferred tumors are solid tumors.
[0137] In a preferred embodiment of the method of treatment, the neoplastic condition is lung, colon, breast, or prostate cancer.
[0138] In a preferred embodiment the host organism is a human patient. For human patients, if a therapeutic gene is included in the vector, the therapeutic gene will generally be of human origin although genes of closely related species that exhibit high homology and biologically identical or equivalent function in humans may be used if the gene does not produce an adverse immune reaction in the recipient. A therapeutic active amount of a nucleic acid sequence or a therapeutic gene is an amount effective at dosages and for a period of time necessary to achieve the desired result. This amount may vary according to various factors including but not limited to sex, age, weight of a subject, and the like.
[0139] The invention will now be described with respect to the following examples; it is to be understood, however, that the scope of the present invention is not intended to be limited thereby.
[0140] Two adenovirus backbones that were designed to minimize nonspecific activation of the E1A gene were developed. The Ar6F adenoviral vector contains the left side ITR directly linked to the E1A coding region (SEQ ID NO:5), with the intervening nucleotides deleted (nucleotides 104-551 in the Ad5 sequence, GenBank accession number M73260) and replaced with a multiple cloning site (
[0141] The first 1802 nucleotides of the Ar6pAE2fF adenoviral vector, including the ITR, poly(A), E2F-1 promoter and the E1A gene was confirmed by DNA sequencing (SEQ ID NO:3). In addition, the last 531 nucleotides at the right end of the vector, containing the packaging signal and right ITR was confirmed by sequencing (SEQ ID NO: 4,
[0142] Adenoviral genomes containing these modifications were cloned by standard methods in bacterial plasmids. Homologous recombination in
[0143] 1.2 Viral DNA Isolation and Southern Analysis
[0144] DNA was isolated from CsCI-purified virus preparation as described (Puregene Kit, Gentra). Viral DNA was digested with the indicated restriction enzymes and analyzed on 1% agarose/TAE gels containing ethidium bromide. A total of 1 ug of each DNA sample was digested with ClaI, XbaI, Hpal, SalI and BamHI and subjected to Southern analysis according to standard procedures. The probe was prepared by random oligonucleotide priming and contained the E2F-1 promoter.
[0145]
[0146] 1.3 Limiting Dilution Cloning of Ar6pAE2fF Vector in PER.C6 Cells
[0147] A seed lot of Ar6pAE2fF vector was produced for further evaluations. To obtain a pure seed lot of a virus it is necessary to isolate a clone derived from a single virus particle. The cloning of Ar6pAE2fF virus was accomplished through viral limiting dilution as described in below.
[0148] Ten 96 well plates of PER.C6 cells (Fallaux et al., 1998
[0149] The CVL was freeze thawed 5 times and cellular debris was spun out. A T75 flask of PER.C6 cells was plated and infected with 0.5 ml of the above CVL.
[0150] Of the 960 wells infected with 0.1 particle/cell, three wells showed CPE. These 3 clones were in the range of the theoretical numbers of clones expected. Statistically, only 4 wells out of the 10 plates should give CPE. This gives odds of 1:2500 that there will be more than one infectious particle/well when assuming a particle:pfu ratio of 25. The three clones were amplified in PER.C6 cells and the genome of clone 7 showed the expected size DNA fragments when analyzed with HpaI, XhoI and XbaI restriction endonuclease.
[0151] 1.4 Sequence Analysis.
[0152] The 5′-end first 1802 nucleotides and the last 3′-end nucleotides from bp 33881-34412 of the plasmids pDL6pAE2f and Ar6pAE2fF clone 7 were directly sequenced (SEQ ID NO:3,
[0153] Regions of Ar6pAE2fF were confirmed by DNA sequencing. Regions in first 1802 nucleotides are ITR (nucleotides 1-103), poly-adenylation signal (nucleotides 116-261), human E2F-1 promoter (nucleotides 283-555), E1A gene (nucleotides 574-1647) and a portion of the E1 gene (nucleotides 1648-1802) are indicated (SEQ ID NO:3,
[0154] To determine if deletions of enhancer elements and insertion of a polyA signal would be sufficient for efficient transcription termination, a quantitative E1A FACS assay was used to evaluate E1A expression in a non-complementing A549 cell background (p16− p53+ Rb+). We compared the E1A expression from cells infected with Addl327, Addl312, Ar6F, Ar6pAF or Ar6pAE2fF at doses of 10, 50, 250 and 1250 virus particles per cell (VPC) (Table 1). The highest level of E1A expression was observed with the Addl327 at all range of doses. In contrast, the E1A deleted mutant Addl312 showed no E1A expression. Under the conditions used in this experiment (10 to 1250 VPC) there was about 80% to 22% less E1A detected in cells transduced with Ar6F than in those transduced with Addl327. The E1A expression in cells transduced with Ar6pAF was significantly reduced about 100% to 96%, in all doses, as compared to the expression from cells infected with the Addl327. The expression of E1A from cells infected with the Ar6pAE2fF oncolytic vector was reduced 50% as compared with the Addl327 virus at a dose of 50VPC.
[0155] In conclusion, the insertion of a poly(A) signal in the Ar6pAF vector reduced the E1A expression in A549 cells. In contrast, insertion of the E2F-1 promoter reestablished the E1A expression, thus demonstrating that E1A expression was exclusively due to the inserted promoter.
TABLE 1 E1A expression in A549 noncomplementing cells 10 vpc 50 vpc 250 vpc 1250 vpc Addl327 27.5 ± 2.2 72.9 ± 3.8 94.4 ± 0.7 98.4 ± 0.4 Addl312 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 Ar6F 5.6 ± 0.8 28.3 ± 1.1 59.4 ± 4.7 76.9 ± 3.6 Ar6pAF 0.0 ± 0.0 0.1 ± 0.1 0.3 ± 0.1 3.8 ± 2.4 Ar6pAE2fF ND 39.7 ± 0.1 ND ND
[0156] Protocol for E1A FACS Assays
[0157] Cells were plated the day before infection in 12-well plates. The next day, media was aspirated from cells, virus dose formulations in particles per cell (ppc) were added to the wells and the plates were rocked at 37° C. for 4 hours. Virus/media was aspirated, washed one time, then replaced with complete growth media and incubated 20 hours at 37° C. Cells were harvested by trypsin-EDTA digestion, and fixed in 70% ethanol for 20 minutes at room temperature. Then the cells were washed one time and resuspended in FACS buffer (PBS, 3% FBS, 0.1% NaN
[0158] Acute hepatic toxicity in Balb/c SCID male mice was used to distinguish between adenoviral vectors with different levels of E1A activity. A profound difference in serum liver enzyme elevations was observed between vectors with wild-type E1A expression and those with minimal or silent E1A expression.
[0159] Studies were designed with ten animals per group. Control groups were HBSS vehicle alone, the negative control E1A-deleted Addl312 and the E1A-containing positive control Addl327. Viruses were injected at a dose of 6.25×10
TABLE 2 Acute toxicity of E1A containing adenoviral ectors