Title:
Novel oncolytic adenoviral vectors
Document Type and Number:
Kind Code:
A1

Abstract:
The present invention relates to oncolytic adenoviral vectors and their use in methods of gene therapy. Provided is a recombinant viral vector comprising an adenoviral nucleic acid backbone, wherein said nucleic acid backbone comprises in sequential order: A left ITR, a termination signal sequence, an E2F responsive promoter which is operably linked to a gene essential for replication of the recombinant viral vector, an adenoviral packaging signal, and a right ITR.
Representative Image:
Inventors:
Cheng, Cheng (Rockville, MD, US)
Clarke, Lori (Olney, MD, US)
Connelly, Sheila (Ijamsville, MD, US)
Ennist, David Leonard (Bethesda, MD, US)
Forry-schaudies, Suzanne (Rockville, MD, US)
Gorziglia, Mario (Doylestown, PA, US)
Hallenbeck, Paul L. (Gaithersburg, MD, US)
Hay, Carl M. (Damascus, MD, US)
Jakubczak, John Leonard (Germantown, MD, US)
Kaleko, Michael (Rockville, MD, US)
Phipps, Sandrina (Reston, VA, US)
Police, Seshidhar Reddy (Gaithersburg, MD, US)
Ryan, Patricia Clare (Montgomery Village, MD, US)
Stewart, David A. (Eldersburg, MD, US)
Xie, Yuefeng (Germantown, MD, US)
Application Number:
10/081969
Publication Date:
06/05/2003
Filing Date:
02/22/2002
View Patent Images:
Images are available in PDF form when logged in. To view PDFs, Login  or  Create Account (Free!)
Primary Class:
International Classes:
(IPC1-7): C12N009/22; C12N015/861; C12N007/00
Attorney, Agent or Firm:
Novartis Corporation, Thomas Hoxie (PATENT AND TRADEMARK DEPT, SUMMIT, NJ, 079011027)
Claims:

What is claimed is:



1. A recombinant viral vector comprising an adenoviral nucleic acid backbone, wherein said nucleic acid backbone comprises in sequential order: a left ITR, a termination signal sequence, an E2F responsive promoter which is operably linked to a gene essential for replication of the recombinant viral vector, an adenoviral packaging signal, and a right ITR.

2. The recombinant viral vector of claim 1, wherein the termination signal sequence is the SV40 early polyadenylation signal sequence.

3. The recombinant viral vector of claim 1, wherein the E2F responsive promoter is the human E2F-1 promoter.

4. The recombinant viral vector of claim 1, wherein the adenoviral nucleic acid backbone is derived from adenovirus serotype 5 (Ad5) or serotype 35 (Ad35).

5. The recombinant viral vector of claim 1, wherein the gene essential for replication is the E1A gene.

6. The recombinant viral vector of claim 1, further comprising a deletion upstream of the termination signal sequence.

7. The recombinant viral vector of claim 6, further comprising a deletion between nucleotides 103 and 551 of the adenoviral type 5 backbone or other corresponding bps of other Adenovirus serotypes.

8. The recombinant viral vector of claim 1, further comprising a mutation or deletion in the E3 region.

9. The recombinant viral vector of claim 5, further comprising a tissue-specific promoter operably linked to E4.

10. The recombinant viral vector of claim 9, wherein said tissue-specific promoter is derived from the human telomerase reverse transcriptase promoter.

11. The recombinant viral vector of claim 9, wherein said tissue-specific promoter is the Trtex promoter SEQ ID NO:94 or the TERT promoter of SEQ ID NO:93.

12. The recombinant viral vector of claim 9, which is the Ar17pAE2fFTrtex vector.

13. The recombinant viral vector of claim 9, wherein said tissue-specific promoter is derived from the osteocalcin promoter.

14. The recombinant viral vector of claim 8, wherein the E3 region has been deleted from said backbone.

15. The recombinant viral vector of claim 1, which is the Ar6pAE2fF vector, or the Ar35E2FE1a vector.

16. The recombinant viral vector of claim 1, further comprising a mutation or deletion in the E1 gene.

17. The recombinant viral vector of claim 16, wherein said mutation or deletion results in the loss of the active 19 kD protein expressed by the wild-type E1b gene.

18. The recombinant viral vector of claim 1, further comprising a therapeutic gene.

19. The recombinant viral vector of claim 18, wherein said therapeutic gene is inserted in the E3 region.

20. The recombinant viral vector of claim 19, wherein said therapeutic gene is inserted in place of the 19 kD or 14.7 kD E3 gene.

21. The recombinant viral vector of claim 18, wherein said therapeutic gene is an immunostimulatory gene.

22. The recombinant viral vector of claim 21, wherein said immunostimulatory gene is a cytokine.

23. The recombinant viral vector of claim 21, wherein the immunostimulatory gene is selected from the group consisting of GM-CSF, IL1, IL2, IL4, IL5, IFNα, IFNγ, TNFα, IL12, IL18, and flt3.

24. The recombinant viral vector of claim 21, wherein said immunostimulatory gene is selected from the group consisting of MIP1α, MIP3α, CCR7 ligand, calreticulin, B7, CD28, MHC class I, MHC class II, and TAPs.

25. The recombinant viral vector of claim 21, wherein said immunostimulatory gene is a tumor associated antigen.

26. The recombinant viral vector of claim 25, wherein said tumor associated antigen is selected from the group consisting of MART-1, gp100(pmel-17), tyrosinase, tyrosinase-related protein 1, tyrosinase-related protein 2, a melanocyte-stimulating hormone receptor, MAGE1, MAGE 2, MAGE 3, MAGE 12, BAGE, GAGE, NY-ESO-1, β-catenin, MUM-1, CDK-4, caspase 8, KIA 0205, HLA-A2R1701, α-fetoprotein, telomerase catalytic protein, G-250, MUC-1, carcinoembryonic protein, p53, Her2/neu, triosephosphate isomerase, CDC-27, and LDLR-FUT.

27. The recombinant viral vector of claim 21, wherein said immunostimulatory gene is an antibody that blocks inhibitory signals.

28. The recombinant viral vector of claim 27, wherein the inhibitory signal is due to expression of CTLA4.

29. The recombinant viral vector of claim 18, wherein the therapeutic gene is an anti-angiogenic gene.

30. The recombinant viral vector of claim 29, wherein said anti-angiogenic gene is selected from the group consisting of a VEGFNEGFR antagonist, an angiopoietin/Tie antagonist, an Ephrin/Eph antagonist, and an FGF/FGFR antagonist.

31. The recombinant viral vector of claim 29, wherein said anti-angiogenic gene is an inhibitor of PDGF, TGFβ, or IGF-1.

32. The recombinant viral vector of claim 29, wherein said anti-angiogenic gene is a fragment of an extracellular matrix protein.

33. The recombinant viral vector of claim 32, wherein said extracellular matrix protein is selected from the group consisting of angiostatin, endostatin, kininostatin, fibrinogen-E, thrombospondin, tumstatin, canstatin, and restin.

34. The recombinant viral vector of claim 29, wherein the anti-angiogenic gene is a fragment of TrpRS.

35. The recombinant viral vector of claim 29, wherein the anti-angiogenic gene is selected from the group consisting of sFlt-1, sFlk, sNRP1, sTie-2, IP-10, PF-4, Gro-beta, IFN-gamma (Mig), sEphB4, sephrinB2, vasostatin, PEDF, prolactin fragment, proliferin-related protein, METH-1, and METH-2.

36. The recombinant viral vector of claim 18, wherein said therapeutic gene is a suicide gene.

37. The recombinant viral vector of claim 36, wherein said suicide gene is selected from the group consisting of CPG2, CA, CD, cyt-450, dCK, HSV-TK, NR, PNP, TP, VZV-TK, and XGPRT.

38. The recombinant viral vector of claim 1, wherein said recombinant viral vector is capable of selectively replicating in and lysing Rb-pathway defective cells.

39. The recombinant viral vector of claim 38, wherein tumor-selectivity is at least about 3-fold as measured by E1A RNA levels in infected tumor vs. non-tumor cells.

40. A recombinant viral vector comprising an Ad5 nucleic acid backbone, wherein said backbone comprises in sequential order: a left ITR, an SV40 early polyA site, a human E2F-1 promoter operably linked to the E1A gene, an adenoviral packaging signal, and a right ITR.

41. The recombinant viral vector of claim 40 further comprising a deletion between nucleotides 103 and 551 of the adenoviral backbone.

42. The recombinant viral vector of claim 40 further comprising a mutation or deletion in the E1b gene, wherein said mutation or deletion results in the loss of the active 19 kD protein expressed by the wild-type E1b gene.

43. The recombinant viral vector of claim 40, further comprising a tissue-specific promoter operably linked to E4.

44. The recombinant viral vector of claim 43, wherein said tissue-specific promoter is derived from the human telomerase reverse transcriptase promoter.

45. The recombinant viral vector of claim 43, wherein said tissue-specific promoter is the Trtex promoter.

46. The recombinant viral vector of claim 43, which is the Ar17pAE2fFTrtex vector.

47. The recombinant viral vector of claim 43, wherein said tissue-specific promoter is derived from the osteocalcin promoter.

48. An adenoviral vector particle comprising the viral vector of claims 1.

49. The adenoviral vector particle of claim 48, further comprising a targeting ligand included in a capsid protein of said particle.

50. The particle of claim 49, wherein said capsid protein is a fiber protein.

51. The particle of claim 50, wherein said ligand is in the HI loop of said fiber protein.

52. A method of selectively killing a neoplastic cell in a cell population which comprises contacting an effective amount of the adenoviral vector particle of claim 48 with said cell population under conditions where the recombinant viral vector can transduce the cells of said cell population.

53. The method of claim 52, wherein the neoplastic cell has a defect in the Rb-pathway.

54. A pharmaceutical composition comprising the adenoviral vector particle of claim 48 and a pharmaceutically acceptable carrier.

55. A method of treating a host organism having a neoplastic condition, comprising administering a therapeutically effective amount of the composition of claim 54 to said host organism.

56. The method of treatment of claim 55,wherein the host organism is a human patient.

57. The method of treatment of claim 55, wherein the neoplastic condition is lung, breast, prostate, or colon cancer.

58. The vector of claim 1, wherein said backbone comprises a gene of the E3 coding region.

59. The vector of claim 58, wherein said gene is selected from the group consisting of E3-6.7, KDa, gp19KDa, 11.6 KDa (ADP), 10.4 KDa (RIDα), 14.5 KDa (RIDβ), and E3-14.7Kda.

60. The method of treatment of claim 55, wherein administration is the intratumoral injection of a therapeutically effective dosage of the composition of claim 54.

Description:

[0001] This application claims the benefit of U.S. Patent Application No. 60/270,922, filed Feb. 23, 2001; U.S. Patent Application No. 60/295,037, filed Jun. 1, 2001; and U.S. Patent Application No. 60/348,670, filed Jan. 14, 2002, which are herein incorporated by reference.

FIELD OF THE INVENTION

[0002] The present invention generally relates to substances and methods useful for the treatment of neoplastic disease. More specifically, it relates to oncolytic adenoviral vectors and their use in methods of gene therapy.

BACKGROUND OF THE INVENTION

[0003] Adenoviruses that replicate selectively in tumor cells are being developed as anticancer agents (“oncolytic adenoviral vectors”). Such oncolytic vectors amplify the input virus dose due to viral replication in the tumor, leading to spread of the virus throughout the tumor mass. In situ replication of adenoviruses leads to cell lysis. This in situ replication may allow relatively low, non-toxic doses to be highly effective in the selective elimination of tumor cells.

[0004] One approach to achieving selectivity is to introduce loss-of-function mutations in viral genes that are essential for growth in non-target cells but not in tumor cells. This strategy is exemplified by the use of Addl1520, which has a deletion in the E1b-55 KD gene. In normal cells, the adenoviral E1b-55 KD protein is needed to bind to p53 to prevent apoptosis. In p53-deficient tumor cells, E1b-55K binding to p53 is unnecessary. Thus, deletion of E1b-55 KD should theoretically restrict vector replication to p53-deficient tumor cells.

[0005] Another approach is to use tumor-selective promoters to control the expression of early viral genes required for replication (U.S. Pat. No. 5,998,205 (Hallenbeck et al., 1999)). Thus, in this approach the adenoviral vectors will specifically replicate and lyse tumor cells if the gene that is essential for replication is exclusively under the control of a promoter or other transcriptional regulatory element which is tumor-specific.

[0006] It is an object of the present invention to provide novel oncolytic adenoviral vectors for the treatment of neoplastic disease, which exhibit a high degree of tumor selectivity, therapeutic efficacy, and safety when administered to a host organism.

BRIEF DESCRIPTION OF THE DRAWINGS

[0007] FIG. 1 : Cleavage and polyadenylation process for the SV40 early poly(A) site (SEQ ID NO:1).

[0008] FIG. 2 : E1A transcription control region (SEQ ID NO:2).

[0009] FIG. 3 : Sequence of Ar6pAE2fF from left and right ends of viral DNA. Regions of Ar6pAE2fF confirmed by DNA sequencing. Panel A. Regions in first 1802 nucleotides are the inverted terminal repeat (ITR) (nucleotides 1-103), poly-adenylation signal (nucleotides 116-261), a human E2F-1 promoter (nucleotides 283-555), E1A gene (nucleotides 574-1647) and a portion of the E1b gene (nucleotides 1648-1802) are indicated (SEQ ID NO:3). Panel B. Regions in the last 531 nucleotides are the PacI restriction site (nucleotides 33967-33974) (underlined), the packaging signal (nucleotides 34020-34217 and the ITR (34310-34412).

[0010] FIG. 4 : Sequence of Ar6F from left end of viral DNA (SEQ ID NO:4). The first 660 nucleotides at the left end of Ar6F. The ITR (nucleotides 1-103), a multiple cloning site (MCS) (nucleotides 104-134) and a portion of the E1A gene (nucleotides 135-660) are shown.

[0011] FIG. 5 : Sequence of Ar6pAF from left end of viral DNA. The first 660 nucleotides at the left end of Ar6pAF. The ITR (nucleotides 1-103), the SV40 early polyA signal (nucleotides 104-134) and a portion of the E1A gene (nucleotides 298-660) are shown.

[0012] FIG. 6 : Schematic diagram of Ar6pAF and Ar6pAE2fF vectors. The backbone adenoviral sequences are derived from the pAr6pAF and pAr6pAE2fF infectious plasmids. The intermediate vector backbone adenoviral sequences are derived from Addl327, an E3-deleted adenovirus type 5, in which the packaging signal is located immediately upstream of the right ITR. The Ar6pAF vector backbone is deleted in the E1A promoter and the SV-40 poly(A) signal is inserted after the left ITR. The Ar6pAE2fF vector backbone contains, after the SV-40 poly(A) signal sequences, a E2F-1 promoter (bp-212 to +51), a DNA segment of four intact E2F, one NF-kB and four Sp-1 consensus sequences.

[0013] FIG. 7 : Comparison of body weight change after administration of vectors Addl327, AvPAE1A09i, Ar6F, Ar6pAF, Addl312.

[0014] FIG. 8 : Backbones of vectors Addl327, AvE1A09i, AvPAE1A09i, Ar6F, Ar6pAF, Addl312

[0015] FIG. 9 : Mean H460 tumor volume after intratumoral injections of Ar6pAE2fF. Comparison of in vivo growth of H460 tumors after five consecutive daily (study day 1-5) intratumoral injections of Ar6pAE2fF at 5×10 8 (n=13), 5×10 9 (n=13), or 5×10 1 (n=12) particles/dose/day. Control animals were treated IT with HBSS (n=13) or Addl327 (n=12, 5×10 10 particles/dose/day) also for 5 consecutive days. Data is expressed as mean tumor volume+SE. *p<0.05 compared to HBSS treated controls using one-way RM ANOVA with Tukey's test for multiple comparison.

[0016] FIG. 10 : Survival of tumor-bearing animals after intratumoral injections of Ar6pAE2fF. Survival of tumor bearing animals after treatment with Ar6pAE2fF. Animals were observed until study day 32. Numbers of animals in each treatment group were as follows: HBSS, n=13; Ar6pAE2fF at 5×10 8 , n=13; 5×10 9 , n=13; and 5×10 1 particles/dose/day, n=12; and Addl327 at 5×10 10 particles/dose/day, n=12. The survival of animals was analyzed by the Mantel-Haenszel logrank test.

[0017] FIG. 11 : Mean Hep3B tumor volume after intratumoral injections of Ar6pAE2fF. Comparison of in vivo growth of Hep3B tumors after five consecutive daily (study day 1-5) intratumoral injections of Ar6pAE2fF at 5×10 8 (n=11), 5×10 9 (n=11), or 5×10 10 (n=10) particles/dose/day. Control animals were treated IT with HBSS (n=10) or Addl327 (n=11, 5×10 10 particles/dose/day) also for 5 consecutive days. Data is expressed as mean tumor volume+SE. *p<0.05 compared to HBSS treated controls using one-way RM ANOVA with Tukey's test for multiple comparison. **p<0.05 compared to Ar6pAE2fF at 5×10 8 particles/dose/day by t-test.

[0018] FIG. 12 : Survival of tumor-bearing animals after intratumoral injections of Ar6pAE2fF. Survival of tumor bearing animals after treatment with Ar6pAE2fF. Animals were observed until study day 32. Numbers of animals in each treatment group were as follows: HBSS, n=11; Ar6pAE2fF at 5×10 8 , n=11; 5×10 9 , n=11; and 5×10 10 particles/dose/day, n=10; and Addl327 at 5×10 10 particles/dose/day, n=11. The survival of animals was analyzed by the Mantel-Haenszel logrank test.

[0019] FIG. 13 : Schematic diagram of adenovirus right donor plasmid pDR2F.

[0020] FIG. 14 : Schematic diagram of adenovirus right donor plasmid pDR2mGmF. The adenovirus right donor plasmid pDR2mGmF is an 11526 bp circular molecule. The mGm-cDNA is at position 8059 to 8520.

[0021] FIG. 15 : Schematic diagram of plasmid pG1mGmSvNa.

[0022] FIG. 16 : Schematic diagram of plasmid pG1 NaSvBg.

[0023] FIG. 17 : Sequence of the murine GM-CSF cDNA (SEQ ID NO:7) and protein (SEQ ID NO:8). Sequence of the 7878 to 8826 region of the pDR2mGmF plasmid was confirmed by DNA sequencing. This region includes the murine GM-CSF cDNA insert.

[0024] FIG. 18 : Pathway used to generate pAr6pAE2fmGmF plasmid. The 37763 bp Ar6pAE2fmGmF large plasmid was generated through the homologous recombination of the pDR2mGmF/FspI +SpeI fragment (9284 bps) and the pAr6pAE2fF/PacI +SrfI fragment (30695 bps) in E coli BJ5183 cells. In this plasmid, the mGM-CSF cDNA was cloned into the XbaI site of the adenoviral E3 region.

[0025] FIG. 19 : MTS assay of oncolytic vectors on different tumor cell lines.

[0026] FIG. 20 : Sequence of Ar6pAE2fhGmF region from 28536 to 29273 of the viral genome including the human GM-CSF cDNA insert (SEQ ID NO:19) and the human GM-CSF protein sequence (SEQ ID NO:20).

[0027] FIG. 21 : Pathway used to generate pAr6pAE2fhGmF. The 37587 bp pAr6pAE2fhGmF large plasmid was generated through the homologous recombination of the pDR2hGmF/(Fsp I+Spe I) fragment (9284 bps) and the pAr6pAE2fF/(Pac I+Srf I) fragment (30695 bps) in E coli BJ5183 cells. In this plasmid, the hGM-CSF cDNA was cloned into the Xba I site of the adenoviral E3 region.

[0028] FIG. 22 : MTS assay of oncolytic vectors on different tumor cell lines.

[0029] FIG. 23 : Efficacy of GM-CSF armed oncolytic vectors in H460 non-small cell lung carcinoma tumor model. Volumes of H460 human xenograft tumors were measured periodically following treatment of pre-established tumors with oncolytic adenoviral vectors. Comparison of in vivo growth of H460 tumors after five intratumoral injections of PBS, or 2×10 10 particles/injection (panel A) or 1×10 11 particles/injection (panel B) of Addl312, Addl327, Ar6pAE2fF or Ar6pAE2fmGmF. Each treatment group is identified by symbols as listed in the graph insets. Vector injections were on study days 10, 12, 14, 17, and 19, as indicated by the arrows along the x-axis. Data are represented by average tumor volume +SEM. Asterisks indicate significant differences compared to Addl312 negative control vector-treated tumors (p<0.05, RM-OW-ANOVA using Tukey's test). At the low dose (panel A), differences were significant for Addl327, Ar6pAE2fF and Ar6pAE2fmGmF compared to Addl312. At the high dose (panel B), differences compared to Addl312 were significant only for the mouse GM-CSF containing Ar6pAE2fmGmF vector.

[0030] FIG. 24 : Efficacy of GM-CSF armed oncolytic vectors in Hep3B hepatocellular carcinoma tumor model. The in vivo growth of Hep3B tumors following intratumoral injections of Addl312, Ar6pAE2fF, Ar6pAE2fhGmF, or Ar6pAE2fmGmF at 2×10 7 (panel A), 2×10 8 (panel B), or 2×10 9 (panel C) particles/injection (n=10/group) was analyzed. Vectors were injected on study days 15, 18, 20, 22, and 25 as indicated by the arrows along the x-axes. Control animals were treated with PBS (n=10). Data represent group averages +SEM. Asterisks indicate p<0.05 compared to dose-matched Addl312-treated tumors. Crosses indicate p<0.05 compared to the Ar6pAE2fF vector and pound symbols indicate p<0.05 for Addl312-treated tumors compared to PBS-treated tumors. Tumors were measured for 47 days following Hep3B tumor cell inoculation.

[0031] FIG. 25 : Schematic diagram of PCR and overlap PCR for □gp19 donor plasmids The mGM-CSF or hGM-CSF cDNA was inserted into the E3 region replacing the E3-gp19 open reading frame (ORF) using two steps of PCR amplification. In the first step, 3 individual PCR amplifications were carried out using 3 pairs of primers and corresponding DNA templates. In the second step, the 3 DNA fragments generated in first step were mixed as the template DNA for the overlap PCR amplification using primer 1 and primer 6 as primers. The overlap PCR product was then digested with BsiWI/NotI and used to replace the BsiWI/NotI region of adenoviral E3 containing the E3-gp19 open reading frame.

[0032] FIG. 26 : Schematic Diagram of Δgp19 Vectors

[0033] FIG. 27 a : Pathway Used to Generate the pAr6pAE2f(E3+,mGm,Dg19b)F Large Plasmid The 38977 bp pAr6pAE2(E3+,mGm,Dg19b)F large plasmid was generated through the homologous recombination of the pDR2(E3+,mGm,Dg19b)F/(Fsp I+Spe I) fragment (9284 bps) and the pAr6pAE2fF/(Pac I+Srf I) fragment (30695 bps) in E coli BJ5183 cells. In this plasmid, the mGM-CSF cDNA was swapped into the E3 gp19kD ORF of the adenoviral E3 region.

[0034] FIG. 27 b : Pathway Used to Generate the pAr6pAE2f(E3+,hGm,Dg19b)F Large Plasmid The 38950 bp pAr6pAE2(E3+,hGm,Dg19b)F large plasmid was generated through the homologous recombination of the pDR2(E3+,hGm,Dg19b)F/(Fsp I+Spe I) fragment (9284 bps) and the pAr6pAE2fF/(Pac I+Srf I) fragment (30695 bps) in E coli BJ5183 cells. In this plasmid, the hGM-CSF cDNA was swapped into the E3 gp19 kD ORF of the adenoviral E3 region.

[0035] FIG. 28 : MTS Assay of Δgp19 mGM-CSF Vectors on H460 and Hep3B Tumor Cell Lines. Two human tumor cell lines, H460 (non-small cell lung carcinoma) and Hep3B (hepatocellular carcinoma), were used. For each cell line, two MTS assays have been performed for all vectors. One representative MTS assay from each cell line is presented.

[0036] FIG. 29 : GM-CSF expression mediated by Δgp19 GM-CSF vectors in infected H460 cells detected by ELISA. The Δgp19 kD vectors were assayed for their ability to mediate GM-CSF transgene expression in the culture media of H460 cells infected with viral vectors.

[0037] FIG. 30 : Anti-tumor activity of oncolytic adenoviruses in the Hep3B xenograft subcutaneous tumor model. Comparison of the in vivo growth of Hep3B tumors following five intratumoral injections of PBS, or 2×10 9 particles/injection of Addl312, Ar6pAE2fF, Ar6pAE2fmGmF, or Ar6pAE2f(E3+,mGm,Dg19b)F (n=10 per group). Symbols representing the different treatment groups are shown in the graph inset. Vector injections were on days 11, 13, 15, 17, and 19 as indicated by the arrows along the x-axis. Tumor volumes when vector injections began were 175 mm 3 for all groups, except for tumors treated with the Ar6pAE2f(E3+,mGM,Dg19b)F vector, where the initial tumor volumes were 290 mm 3 . Asterisks indicate a p value <0.05 compared to Addl312 vector-treated tumors (by repeat-measures, one-way ANOVA).

[0038] FIG. 31 : Anti-tumor activity of oncolytic adenoviruses in the H460 xenograft subcutaneous tumor model. Comparison of the in vivo growth of H460 tumors following five intratumoral injections of controls or oncolytic vectors. Panel A, H460 tumors injected with 2×10 10 particles/injection of Addl312, Ar6pAE2fF, or Ar6pAE2fmGmF, or 1×10 10 particles/injection of Ar6pAE2f(E3+,mGm,Dg19b)F (n=10 per group). Panel B, H460 tumors injected with 1×10 11 particles/injection of Addl312, Ar6pAE2fF, or Ar6pAE2fmGmF, or 5×10 10 particles/injection of Ar6pAE2f(E3+,mGm,Dg19b)F (n=10 per group). Symbols representing the different treatment groups are shown in the graph inset. Vector injections were on days 12, 14, 16, 19, and 21 as indicated by the arrows along the x-axis. Tumor volumes when vector injections began were 160 mm 3 for all groups, except for tumors treated with the Ar6pAE2f(E3+mGM,Dg19b)F vector, where the initial tumor volumes were 120 mm 3 . Asterisks indicate a p value <0.05 compared to Addl312 vector-treated tumors (by repeat-measures, one-way ANOVA).

[0039] FIG. 32 : Schematic diagram of adenovirus pDr5hGmF and pDr5mGmF right donor plasmids. The adenovirus right donor plasmid pDr5hGmF and pDr5mGmF are circular molecules 12674 bp and 12701 bp in size, respectively. The loxP sites were removed from their parental plasmids pDR2(E3+,mGm,Dg19b)F and pDR2(E3+,hGm,Dg19b)F by replacing the NotI/SphI fragment with the NotI/SphI fragment from wild type Ad5.

[0040] FIG. 33 : Pathway used to generate the pAr15pAE2fhGmF plasmid. The 38910 bp pAr 5pAE2fhGmF large plasmid was generated through homologous recombination of the pDr5hGmF/(FspI+SpeI) fragment (10432 bps) and the pAr6pAE2fF/(PacI+SrfI) fragment (30695 bp) in E coli BJ5183 cells. In this plasmid, the hGM-CSF cDNA was swapped into the E3-gp19 ORF of the adenoviral E3 region and the loxP site was removed from E3 region.

[0041] FIG. 34 : Pathway used to generate the pAr15pAE2fmGmF plasmid. The 38938 bp pAr15pAE2fmGmF large plasmid was generated through the homologous recombination of the pDr5mGmF/(FspI+SpeI) fragment (10459 bp) and the pAr6pAE2fF/(PacI+SrfI) fragment (30695 bp) in E. coli BJ5183 cells. In this plasmid, the mGM-CSF cDNA was swapped into the E3 gp19 ORF of the adenoviral E3 region and the loxP site was removed from E3 region.

[0042] FIG. 35 : MTS assay of Ar 5pAE2fhGmF and Ar 5pAE2fmGmF vectors on H460 and Hep3B tumor cell lines. MTS assays were performed to evaluate the oncolytic potential of the Ar15pAE2fhGmF and Ar15pAE2fmGmF vectors. Two human tumor cell lines, H460 (non-small cell lung carcinoma) and Hep3B (hepatocellular carcinoma), were used. For each cell line, two MTS assays were performed using all the indicated vectors and one representative MTS assay from each cell line is presented. Ar15pAE2fF was used for comparison of LD50s of “armed” vectors vs “unarmed” vectors. Ar6pAE2fmGmF and Ar6pAE2f(E3+, mGm, Dg19b) were also included. In addition, control viruses Addl327 (replication competent Ad5 positive control virus) and Addl312 (E1 deficient negative control) were also included in the MTS assays. The Ar15pAE2fhGmF and Ar15pAE2fmGmF vectors retained the oncolytic capacity of the Ar6pAE2fF vector in both cell lines tested.

[0043] FIG. 36 : GM-CSF expression mediated by Ar15pAE2fhGmF and Ar15pAE2fmGmF vectors in infected H460 cells detected by ELISA. The Ar15pAE2fGmF vectors were assayed for their ability to mediate human or mouse GM-CSF transgene expression in the culture media of H460 cells and Hep3B cells infected with viral vectors. The Ar15pAE2fGmF vectors induce the in vitro production of GM-CSF at levels similar to the E3 deleted Ar6pAE2fGmF series.

[0044] FIG. 37 : Schematic diagram of PCR and overlap PCR for ΔE3-14.7 plasmids. The human GM-CSF cDNA was inserted into the E3 region replacing the E3-14.7 ORF using two steps of PCR amplification. In the first step, 3 individual PCR amplifications were carried out using 3 pairs of primers and corresponding DNA templates as summarized in Tables 2 and 3. In the second step, the 3 DNA fragments generated in first step were mixed as the template DNA for the overlap PCR amplification using primers 1 and 6. The overlap PCR product was then digested with XhoI/SphI and used to replace the XhoI/SphI region of plasmid pDR4F containing the E3-14.7 open reading frame.

[0045] FIG. 38 : Schematic Diagram of ΔE3-14.7 Vectors.

[0046] FIG. 39 : Schematic Diagram of Adenovirus Right Donor Plasmid pDr6hGmF. The adenovirus right donor plasmid pDR6hGmF is a circular molecule of 12774 bp. The human GM-CSF (hGm) cDNA was swapped into the position of the E3-14.7 ORF in the pDR4F plasmid using PCR amplification and overlap PCR amplification followed by restriction enzyme digestion (XhoI/SphI) and ligation.

[0047] FIG. 40 : Pathway Used to Generate the pAr16pAE2fhGmF Large Plasmid. The 39011 bp pAr16pAE2fhGmF large plasmid was generated through the homologous recombination of the pDR6hGmF/(Fsp I+Spe I) fragment (10532 bps) and the pAr6pAE2fF/(Pac I+Srf I) fragment (30695 bps) in E coli BJ5183 cells. In this plasmid, the hGM-CSF cDNA was swapped into the E3-14.7 ORF of the adenoviral E3 region.

[0048] FIG. 41 : MTS Assay of AE3-14.7 hGM-CSF Vector on H460 Tumor Cell Line. To evaluate the oncolytic potential of the Ar16pAE2fhGmF vector, MTS assays were performed. Human tumor cell line H460 (non-small cell lung carcinoma) was used. Two MTS assays have been done for all vectors and the assays gave similar LD50 values for each vector. The oncolytic capacity of Ar16pAE2fhGmF is compared to Ar6pAE2fF, Ar6pAE2fhGmF, and Ar6pAE2f(E3+,hGm,Dg19)F. In addition, control viruses Addl327 (replication competent Ad5 positive control virus) and Addl312 (E1A deficient negative control) were also included in the MTS assays. The Ar16pAE2fhGmF vectors retained the oncolytic capacity of the Ar6pAE2fF vector.

[0049] FIG. 42 : GM-CSF Expression Mediated by ΔE3-14.7 hGM-CSF Vector (Ar16pAE2fhGmF) Compared to Ar6pAE2fF, Ar6pAE2fhGmF and Ar6pAE2f(E+,hGm,Dg19)F in Infected H460 Cells 24 Hours Post-infection. The Ar16pAE2fhGmF vector was assayed for its ability to mediate GM-CSF transgene expression in the culture media of H460 cells infected with viral vectors. H460 cells were plated in 6-well plates using 2 ml/well of culture media at a density of 2.5×10 5 cells/well. The next day, the media were removed and the cultured cells were transduced in duplicate with viral vectors at 10, 100, and 1000 particles/cell in 500 □l serum-free medium. After two hours of incubation at 37° C. in a 5% CO 2 incubator, virus was aspirated and 2 ml of fresh complete culture medium was added to each well. At 24 hours post infection, the supernatants were collected for hGM-CSF ELISA.

[0050] FIG. 43 : Spread of adenoviruses in H460 xenograft tumors detected by FACS. At day 1, 4, and 7 after the injection of viruses or PBS, tumors were analyzed for hexon staining using intracellular flow cytometry. The percentage of hexon positive cells from each mouse was displayed in the graph, with the bar as the mean (n=10). The PBS negative control group had fewer mice.

[0051] *: p<0.05 between Ar6pAE2fF or Ar6pAE2fE3F and Addl312, ANOVA

[0052] □: p<0.05 between Ar6pAE2fF and Ar6pAE2fE3F vectors, ANOVA

[0053] FIG. 44 : Spread of adenoviruses in Hep3B xenograft tumors detected by FACS. On days 1, 4 and 7 after the injection of viruses or PBS, tumors were analyzed for hexon staining using flow cytometry. The percentage of hexon positive cells from each mouse was displayed in the graph, with the bar as the mean (n=10). The PBS negative control group had fewer mice.

[0054] *: p<0.05 between Ar6pAE2fhGmF or Ar6pAE2f(E3+,hGm,Dg19)F and Addl312, ANOVA

[0055] □: p<0.05 between Ar6pAE2fhGmF and Ar6pAE2f(E3+,hGm,Dg19)F vectors, ANOVA

[0056] FIG. 45 : Flowchart for construction of pArpAE2fFTrtex. The plasmids that were used for the construction of the large plasmid for the oncolytic vector Ar17pAE2fFTrtex are depicted. The specific alterations are noted and described in the text in more detail.

[0057] FIG. 46 : The final right end shuttle plasmid (pDr17TrtexF) and the large plasmid (pAr17pAE2fFTrtex) used to make the oncolytic vector Ar17pAE2fFTrtex are shown here.

[0058] FIG. 47 : Sequence of the right end of Ar17pAE2fFTrtex (SEQ ID NO:17): The right end of the vector was sequenced and is shown here. The viral ITR and packaging signal are at 36305 to 36203. The Trtex promoter is located at 35843 to 35606. Additional regions were also sequenced including the E3 region and the left end of the virus.

[0059] FIG. 48 : Diagram of Ar17pAE2fFTrtex: The diagram of the final vector is depicted schematically in this figure. The known transcription factor binding sites are indicated above each added promoter. Briefly, a E2F-1 promoter is driving the E1 transcription unit and a telomerase reverse transcriptase (Tert) promoter is driving the E4 transcription unit. The E3 region is completely wild type.

[0060] FIG. 49 : Adenoviral E4 expression measured by semi-quantitative RT-PCR. The E4 region is encoded on the opposite strand in the viral genome. Total RNA was isolated from Hep3B cells 24 hours after infection with 10 ppc of Ar17pAE2fFTrtex. Depicted is a schematic diagram of the right end of the Ar17pAE2fFTrtex viral genome with relative positions of primers used in RT-PCR reactions along with the approximate size of the products. PCR 2.f paired with PCR 3.r or PCR 4.r were designed to detect all E4 transcripts. PCR 2.f paired with PCR 5.r was used to detect transcripts that initiated from any cryptic start sites upstream of the E4 region. +1, indicates the approximate position of transcriptional initiation site of the native hTERT promoter.

[0061] FIG. 50 : Sequence of a hTERT promoter and a portion of the E4 region of Ar17pAE2fFTrtex is shown (SEQ ID NO:21). In the Ad genome, the E4 genes are oriented in the reverse direction. A hTERT promoter sequence is indicated by the double underline. The boxed sequence labeled “ExtP1” indicates the antisense oligonucleotide primer used in the primer extension assay to map the transcriptional initiation sites for the E4 region. Nucleotides indicated by the gray boxes are the three transcription initiation sites we identified. The start sites previously identified by Horikawa I, Cable PL, Afshari C, Barrett J C. Cloning and characterization of the promoter region of human telomerase reverse transcriptase gene. Cancer Res. 1999 Feb 15:59(4):826-30 and Takakura M, Kyo S, Kanava T, Hirano H, Takeda J. Yutsudo M, Inoue M. Cloning of human telomerase catalytic subunit ( hTERT ) gene promoter and identification of proximal core promoter sequences essential for transcriptional activation in immortalized and cancer cells. Cancer Res. 1999 Feb 1;59(3):551-7 in the endogenous hTERT gene are indicated by bold solid underlines.

[0062] FIG. 51 : Tumors were established by injecting 1×10 7 Hep3B cells subcutaneously into the right flank of 6-8 week old female nude mice (Harlan). Two weeks after implantation, mice with tumors ranging from 91.6-218.5 mm 3 were selected and randomly distributed into groups (n=17-18). Each mouse was weighed prior to intravenous injection. The control groups received HBSS or Addl312 at 4.5×10 12 vp/kg (n=18). Ar17pAE2fFTrtex treatment groups received 1.5×10 12 (n=18), 3.0×10 12 (n=17), or 4.5×10 12 (n=18) vp/kg. All dose volumes were 10 ml/kg. Groups means+SEM are represented. *, p<0.05 vs. HBSS controls (Dunnett test).

[0063] FIG. 52 : Survival of tumor bearing animals after treatment with HBSS, Addl312 (4.5×10 12 vp/kg), or Ar17pAE2fFTrtex (1.5×10 12 vp/kg, 3.0×10 12 vp/kg, or 4.5×10 12 vp/kg). Animals were observed until study day 42, n=17-18 per group. The survival curves were plotted using GraphPad Prism, and analyzed by the Mantel-Haenszel logrank test (p<0.004 for all treatment doses compared to HBSS).

[0064] FIG. 53 : Group mean body weights are shown following a single intravenous injection of the indicated test article. The number of animals evaluated at each scheduled data collection time point was 18-33, except for SD29 when n=9-22. Vector doses were adjusted on the basis of individual animal body weight on the day of dosing. Lo Dose: 1.5×10 12 vp/kg; Mid Dose: 3.0×10 vp/kg; Hi Dose: 4.5×10 12 vp/kg. Group means ±SD are represented, with no statistically significant differences between groups.

[0065] FIG. 54 : Comparison of in vivo growth of Hep3B tumors after a single iv injection of Ar17pAE2fFTrtex at 3×10 12 (n=16) or 4.5×10 12 (n=16) particles/kg. Control groups were injected with HBSS (n=16) or Addl312 (n=16) at 4.5×10 12 particles/kg. Data is expressed as mean tumor volume+SE. (*p<0.05) For both Ar17pAE2fFTrtex treated groups compared to HBSS treated controls using one-way ANOVA with Student-Newman-Keuls test for multiple comparison.

[0066] FIG. 55 : Survival of tumor bearing animals after treatment with Ar17pAE2fFTrtex. Animals were observed until study day 58. Numbers of animals in each treatment group were as follows: HBSS, n=16; Ar17pAE2fFTrtex at 3×10 12 , n=16; and 4.5×10 12 , n=16; and Addl312 at 4.5×10 12 particles/kg, n=16. The survival of animals was analyzed by the Mantel-Haenszel logrank test.

[0067] FIG. 56 : Analysis of mean % body weight change from Hep3B tumor bearing animals treated with the oncolytic adenoviral vector Ar17pAE2fFTrtex, Addl312 or HBSS. Body weights were measured once per week. Data is expressed as mean tumor volume+SD.

[0068] FIG. 57 : Tumors were established by injecting 1×10 7 Hep3B cells subcutaneously into the right flank of 6-8 week old female nude mice (Harlan). Two weeks after implantation, mice with tumors ranging from 90-215 mm 3 were selected and randomly distributed into groups (n=12/group). Each mouse was weighed prior to intravenous injection. The control mice received HBSS. Ar17pAE2fFTrtex treatment groups received 3×10 11 (n=12), 6×10 11 (n=12), 1×10 12 (n=12), or 3×10 12 (n=12) vp/kg. All dose volumes were 10 ml/kg. Groups means (+SEM) are represented. *, p<0.05 vs. HBSS controls (Dunnett's method).

[0069] FIG. 58 : Individual tumor volumes for study days 3 through 22 are presented. All dose volumes were 10 ml/kg. A) The control group treated with HBSS. Treatment groups received Ar17pAE2fFTrtex at B) 3×10 11 vp/kg, C) 6×10 11 vp/kg, D) 1×10 12 , or E) 3×10 12 vp/kg. (n=12/group).

[0070] FIG. 59 : Survival of tumor bearing animals after treatment with HBSS or Ar17pAE2fFTrtex (3×10 11 vp/kg, 6×10 11 vp/kg, 1×10 12 vp/kg, or 3×10 12 vp/kg). Animals were observed until study day 39, n=12 per group. The survival curves were plotted using GraphPad Prism, and analyzed by the Mantel-Haenszel logrank test.

[0071] FIG. 60 : Percent body weight change from study day 1 are shown following a single intravenous injection of the indicated dose (n=12). Vector doses were adjusted on the basis of individual animal body weight on the day of dosing. A single intravenous injection of Ar17pAE2fFhTrtex at 3×10 11 (n=12), 6×10 11 (n=12), 1×10 12 (n=12), or 3×10 12 (n=12) viral particles/kg in a final volume of 10 ml/kg was administered on study day 1. *, p<0.05 vs study day 1 percent body weight change, Kruskal-Wallis One-Way ANOVA on Ranks.

[0072] FIG. 61 : Vector DNA copies per cell in tumors and livers collected from mice prior to treatment (n=3) and at indicated times and after intravenous injection of Ar17pAE2fFTrtex at 3.0×10 12 vp/kg (n=5). Molecular analysis was done by PCR using primers specific for adenoviral hexon DNA. Results are expressed as hexon copy number per cell.

[0073] FIG. 62 : The mean body weight change as a percent of the SD1 body weight+st dev was followed for a cohort of five mice in each treatment group. Animals were injected with a single intravenous dose of the indicated vectors on SD1. *, p<0.05 vs. HBSS (one-way ANOVA).

[0074] FIG. 63 : Improved isobologram with additivity envelope for Ar17pAE2fFTrtex and Taxol against Hep3B and PC3M.2AC6 cells. In the table, EC 50 of virus or chemotherapy single treatment was termed as 1. EC 50 of virus or chemotherapy agents in the combination were divided by the EC 50 of single treatments.

[0075] FIG. 64 : Improved isobologram with additivity envelope for Ar17pAE2fFTrtex and Doxorubicin against Hep3B and PC3M.2AC6 cells. In the table, EC 50 of virus or chemotherapy single treatment was termed as 1. EC 50 of virus or chemotherapy agents in the combination were divided by the EC 50 of single treatments.

[0076] FIG. 65 : Improved isobologram with additivity envelope for Ar17pAE2fFTrtex and Epothilone B against Hep 3B cells. In the table, EC 50 of virus or chemotherapy single treatment was termed as 1. EC 50 of virus or chemotherapy agents in the combination were divided by the EC 50 Of single treatments.

[0077] FIG. 66 : Tumor growth curve in the doxorubicin combination study. Comparison of in vivo growth of Hep3B tumors after a single i.v. injection of Ar17pAE2fFTrtex at 3×10 12 particle/kg (n=10) alone or in combination with doxorubicin given i.p. at 10 mg/kg. A group was given doxorubicin alone (n=10) i.p. at 10 mg/kg. A control group was injected with HBSS (n=10). Other details are described in the text. * means p<0.001 by t-test compared to all other groups at study day 20. One mouse was found dead at study day 27 in combination group, so the n=9 to end of study. Data is expressed as mean tumor volume+SEM.

[0078] FIG. 67 : Tumor growth curve in the Doxil® combination study. Comparison of in vivo growth of Hep3B tumors after a single i.v. injection of Ar17pAE2fFTrtex at 1×10 12 (n=10) vp/kg alone or at 1×10 12 or 6×10 11 vp/kg in combination with Doxile given i.v. at 9 mg/kg. A group was given Doxil® alone (n=10) i.v. at 9 mg/kg. Other details are described in the text. A negative control group was injected with HBSS (n=9). *means p<0.01 by t-test compared to all other groups at study day 21. Data is expressed as mean tumor volume±SEM.

[0079] FIG. 68 : Toxicity of Ar17pAE2fFTrtex in primary human hepatocytes (PHH). PHH were transduced with indicated vectors at 1, 10 and 50 ppc. Panel A: Cytotoxicity as measured by LDH release was measured five days after transduction. Means±sd from triplicate wells is shown. * p<0.05 Ar17pAE2fFTrtex versus Ar13pAE2fF by t-test. Panel B: Cytotoxicity measured seven days after transduction. Means±range from 1-3 wells is shown. Statistical comparisons not possible for data in panel B due to low replicate number.

[0080] FIG. 69 : Ad35-based oncolytic vectors. Ar35OscE1A and Ar35E2FE1A both contain the E1 region under the control of a tumor-specific promoter, a osteocalcin or a E2F promoter, respectively. Ar35E2F+E1A contains in addition, the E4 region under the control of a tumor-specific promoter.

[0081] FIG. 70 : Effect of Ar35OscE1A on a subcutaneous PC3 tumor in nude mice. Groups of 10 animals each were treated with vehicle (HBSS), Ad35v0.5 (an E1 deficient Ad35 based vector), Ar6pAOscE3F (the Ad5-based oncolytic vector containing the osteocalcin promoter driving expression of E1a), Ad35 (wt virus), and Ar35OscE1a (the Ad35-based oncolytic vector containing the osteocalcin promoter driving expression of E1a). All vectors were delivered intratumorally (IT), using a single dose of 2×10 11 particles/mouse (1×10 13 particles/kg).

SUMMARY OF THE INVENTION

[0082] The present invention provides novel and improved oncolytic adenoviral vectors and their uses in methods of gene therapy. In a preferred embodiment, the oncolytic adenoviral vector has an E2F promoter operably linked to the E1 gene. In a particularly preferred embodiment, the oncolytic adenoviral vectors has an E2F promoter operably linked to the E1 a gene and the human telomerase reverse transcriptase promoter operably linked to the E4 gene.

[0083] Accordingly, in one aspect, the present invention provides a recombinant viral vector comprising an adenoviral nucleic acid backbone, wherein said nucleic acid backbone comprises in sequential order: A left ITR, a termination signal sequence, an E2F responsive promoter which is operably linked to a first gene essential for replication of the recombinant viral vector, an adenoviral packaging signal and a right ITR.

[0084] In a second aspect, the invention provides a recombinant viral vector comprising an adenoviral nucleic acid backbone, wherein said nucleic acid backbone comprises in sequential order: A left ITR, a termination signal sequence, an E2F responsive promoter which is operably linked to a first gene essential replication of the recombinant viral vector, a telomerase promoter operably linked to a second gene essential for replication, an adenoviral packaging signal and a right ITR.

[0085] In another aspect, the invention provides adenoviral particles comprising these vectors. Preferably, the particles further comprise a targeting ligand included in a capsid protein of the particles.

[0086] In another aspect, the adenoviral particles carry at least one therapeutic transgene. Preferably, the particles further comprise a polynucleotide encoding a cytokine such as GM-CSF that can stimulate a systemic immune response against tumor cells.

[0087] In another aspect, there is provided a method of selectively killing a neoplastic cell in a cell population which comprises contacting a suitable amount of the recombinant viral vector of the invention with said cell population under conditions where the recombinant viral vector can transduce the cells of said cell population.

[0088] In a further aspect a pharmaceutical composition comprising the recombinant viral vector of the invention and a pharmaceutically acceptable carrier is provided.

[0089] In yet another aspect a method of treating a host organism having a neoplastic condition is provided, comprising administering a therapeutically effective amount of the composition of the invention to said host organism.

DETAILED DESCRIPTION OF THE INVENTION

[0090] The present invention provides novel viral vectors based on the oncolytic adenoviral vector strategy as described in U.S. Pat. No. 5,998,205, issued Dec. 7, 1999 to Hallenbeck et al., the disclosure of which is hereby incorporated by reference in its entirety. In particular, oncolytic adenoviral vectors are disclosed in which expression of an adenoviral gene, which is essential for replication, is controlled by E2F-responsive promoters which are selectively transactivated in cancer cells. Examples of E2F-responsive promoters are disclosed in PCT publication WO 98/13508, published Apr. 2, 1998.

[0091] Without being bound by theory, the inventors believe that the mechanism of action is as follows. The selectivity of E2F-responsive promoters (hereinafter sometimes referred to as E2F promoters) is based on the derepression of the E2F promoter/transactivator in Rb-pathway defective tumor cells. In quiescent cells, E2F binds to the tumor suppressor protein pRB in ternary complexes. In its complexed form, E2F functions to repress transcriptional activity from promoters with E2F binding sites, including the E2F-1 promoter itself (Zwicker J, and Muller R. Cell cycle - regulated transcription in mammalian cells. Prog. Cell Cycle Res 1995; 1:91-99). Thus the E2F-1 promoter is transcriptionally inactive in resting cells. In normal cycling cells, pRB-E2F complexes are dissociated in a regulated fashion, allowing for controlled derepression of E2F and subsequent cell cycling (Dyson, N. The regulation of E 2F by pRB-family proteins. Genes and Development 1998; 12:2245-2262).

[0092] In the majority of tumor types, the Rb cell cycle regulatory pathway is disrupted, suggesting that Rb-pathway deregulation is obligatory for tumorigenesis (Strauss M, Lukass J and Bartek J. Unrestricted cell cycling and cancer. Nat Med 1995; 12:1245-1246). These mutations can be in Rb itself or in other factors that have an effect on upstream regulators of pRB, such as the cyclin-dependent kinase, p16 (Weinberg, R A. The retinoblastoma protein and cell cycle control. Cell 1995; 81:323-330). One consequence of these mutations is the disruption of E2F-pRB binding and an increase in free E2F in tumor cells. The abundance of free E2F in turn results in high level expression of E2F responsive genes in tumor cells, driving them into S phase. The E2F-1 promoter used here has been shown to up-regulate the expression of marker genes in an adenovirus vector in a rodent tumor model but not normal proliferating cells in vivo (Parr M J et al. Tumor - selective transgene expression in vivo mediated by an E 2 F - responsive adenoviral vector. Nature Med 1997; Oct;3(10):1145-1149).

[0093] In one aspect the present invention now provides recombinant viral vector comprising an adenoviral nucleic acid backbone, wherein said nucleic acid backbone comprises in sequential order: A left ITR, a termination signal sequence, an E2F responsive promoter which is operably linked to a first gene essential for replication of the recombinant viral vector, an adenoviral packaging signal, and a right ITR.

[0094] In another aspect, the present invention now provides recombinant viral vector comprising an adenoviral nucleic acid backbone, wherein said nucleic acid backbone comprises in sequential order: A left ITR, a termination signal sequence, an E2F responsive promoter which is operably linked to a first gene essential for replication of the recombinant viral vector, a telomerase promoter operably linked to a second gene essential for replication, an adenoviral packaging signal, and a right ITR.

[0095] The recombinant viral vectors of this invention are useful as therapeutics for cancer therapy. In particular, the vectors of the invention preferentially kill Rb-pathway defective tumor cells as compared to cells which are non-defective in the Rb-pathway. Furthermore, such vectors exhibit a favorable toxicity profile, which is clinically acceptable for the condition to be treated. Without wishing to be limited by theoretical considerations, the specific regulation of viral replication by a E2F promoter, which is preferably shielded from readthrough transcription by the upstream termination signal sequence, avoids toxicity that would occur if it replicated in non-target tissues, allowing for the favorable efficacy/toxicity profile. Preferably, the specificity of the regulation of viral replication by a E2F promoter may be further enhanced in the vectors of the invention because of the positioning of the packaging signal downstream of the E2F-linked gene essential for replication. This positioning provides for the possibility to delete sequences of the adenoviral backbone which are located upstream of the E2F-linked gene and which would encompass the packaging signal in its wild-type position. Such deletions further improve the specificity of regulation of viral replication by a E2F promoter. Thus, the combination and the sequential positioning of the genetic elements employed in the vectors of this invention provide for the vector's therapeutic efficacy, while at the same time synergistically minimizing toxicity and side effects in the patient. The recombinant viral vectors of the invention may further comprise a telomerase promoter operably linked to the E4 gene.

[0096] The present invention contemplates the use of all adenoviral serotypes. In a preferred embodiment, the adenoviral nucleic acid backbone is derived from adenovirus serotype 2(Ad2), 5 (Ad5) or 35 (Ad35). A preferred vector comprises an Ad5 nucleic acid backbone, wherein the backbone comprises in sequential order a left ITR, an SV40 early polyA site, a human E2F-1 promoter operably linked to the E1A gene, a telomerase promoter operably linked to the E4 gene, an adenoviral packaging signal, and a right ITR.

[0097] A preferred vector is Ar6pAE2fF. The vector Ar6pAE2fF is an adenovirus vector that uses a fragment of the human E2F-1 promoter to selectively regulate E1A expression and thus adenoviral replication in tumor cells. Characterization of the Ar6pAE2fF vector in vitro shows that it selectively kills Rb-pathway defective tumor cells over normal primary cells. Likewise, this vector is shown to be preferentially replicated in human tumor cell lines versus normal primary cells. Studies in vivo show that this vector has a superior early toxicity profile to the non-selective replication competent virus, Addl327, when administered intravenously in SCID mice. Further in vivo studies in subcutaneous xenograft models in nude mice show efficacy against different tumors, in particular against tumors of the liver and lung. Furthermore, intra-tumoral administration of Ar6pAE2fF in two independent human xenograft models elicited dose-dependent effects on tumor growth and progression. Ar6pAE2fF is shown to provide advantages in efficacy, selectivity, and safety as compared to the oncolytic adenoviral vector Addl 520.

[0098] A particularly preferred vector is Ar17pAE2fFTrtex. Ar17pAE2fFTrtex is a tumor-selective oncolytic adenovirus designed for the treatment of a broad range of cancer indications. Without being bound by theory, the inventors engineered Ar17pAE2fFTrtex to be dependent on the presence of the two most common alterations in human cancer, namely defects in the Rb-pathway (˜85% of all cancers) and over expression of telomerase (˜85% of all cancers). Like the intratumoral oncolytic adenovirus Ar6pAE2fF, Ar17pAE2fFTrtex utilizes a E2F-1 promoter to control expression of the adenoviral E1 gene. To increase tumor selectivity appropriate for systemic delivery, the adenoviral E4 gene in Ar17pAE2fFTrtex is controlled by a hTERT (human telomerase reverse transcriptase) promoter. Ar17pAE2fFTrtex is expected to replicate in the majority of cancer cells, lead to tumor selective-expression of toxic viral proteins, cytolysis, and enhancement of sensitivity to chemotherapy, cytokines and cytotoxic T lymphocytes.

[0099] As used herein, the term “viral vector” is used according to its art-recognized meaning. It refers to a nucleic acid vector construct which includes at least one element of viral origin and may be packaged into a viral vector particle. The viral vector particles may be utilized for the purpose of transferring DNA into cells either in vitro or in vivo.

[0100] A nucleic acid sequence is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter is operably linked to a gene if it affects the transcription of said gene. Operably linked DNA sequences are typically contiguous.

[0101] A termination signal sequence within the meaning of the invention may be any genetic element that causes RNA polymerase to terminate transcription, such as for example a polyadenylation signal sequence. A polyadenylation signal sequence is a recognition region necessary for endonuclease cleavage of an RNA transcript that is followed by the polyadenylation consensus sequence AATAAA. A polyadenylation signal sequence provides a “polyA site”, i.e. a site on a RNA transcript to which adenine residues will be added by post-transcriptional polyadenylation. Polyadenylation signal sequences are useful insulating sequences for transcription units within eukaryotic cells and eukaryotic viruses. Generally, the polyadenylation signal sequence includes a core poly(A) signal which consists of two recognition elements flanking a cleavage-polyadenylation site ( FIG. 1 ). Typically, an almost invariant MUAAA hexamer lies 20 to 50 nucleotides upstream of a more variable element rich in U or GU residues. Cleavage between these two elements is usually on the 3′ side of an A residue and, in vitro, is mediated by a large, multicomponent protein complex. The choice of a suitable polyadenylation signal sequence will consider the strength of the polyadenylation signal sequence, as completion of polyadenylation process correlates with poly(A) site strength (Chao et al., Molecular and Cellular Biology , August 1999, PP5588-5600). For example, the strong SV40 late poly(A) site is committed to cleavage more rapidly than the weaker SV40 early poly(A) site. The person skilled in the art will consider to choose a stronger polyadenylation signal sequence if a more substantive reduction of nonspecific transcription is required in a particular vector construct. In principle, any polyadenylation signal sequence may be useful for the purposes of the present invention. However, in preferred embodiments of this invention the termination signal sequence is either the SV40 late polyadenylation signal sequence or the SV40 early polyadenylation signal sequence. Preferably, the termination signal sequence is isolated from its genetic source and inserted into the viral vector at a suitable position upstream of a E2F responsive promoter.

[0102] The termination signal sequence increases the therapeutic effect because it will reduce replication and toxicity of the oncolytic adenoviral vectors in non-target cells. Oncolytic vectors of the present invention with a polyadenylation signal inserted upstream of the E1A coding region are superior to their non-modified counterparts as they demonstrated the lowest level of E1A expression in nontarget cells. Thus, insertion of a polyadenylation signal sequence to stop nonspecific transcription from the left ITR will improve the specificity of E1A expression from the respective promoter. Insertion of the polyadenylation signal sequences will reduce replication of the oncolytic adenoviral vector in nontarget cells and therefore toxicity. A termination signal sequence could also be placed before (5′) any promoter in the vector. In one embodiment, the terminal signal sequence is placed before a heterologous promoter operably linked to the E4 gene.

[0103] A E2F-responsive promoter has at least one E2F binding site. Preferably, the E2F-responsive promoter is a mammalian E2F promoter, more preferred is a human E2F promoter. In a preferred embodiment of the invention, the E2F-responsive promoter is the human E2F-1 promoter, particularly preferred is the human E2F-1 promoter having the sequence as described in FIG. 3 .

[0104] The E2F-responsive promoter does not have to be the full length wild type promoter, but should have a tumor-selectivity of at least 3-fold, preferably at least 10-fold, at least 30-fold or even at least 300-fold. Tumor-selectivity can be determined by a number of assays using known techniques, such as the techniques employed in example 4, for example RT-PCR. Preferably the tumor-selectivity of the adenoviral vectors is quantified by E1A RNA levels, as further described in example 4, and preferably the E1A RNA levels obtained in H460 cells are compared to those in PrEC cells in order to determine tumor-selectivity for the purposes of this invention. The relevant conditions of the experiment should follow those described in example 4. For example, Ar6pAE2fF in example 4 displays a tumor-selectivity of 2665/8-fold, i.e. about 332-fold.

[0105] E2F responsive promoters typically share common features such as Sp I and/or ATT7 sites in proximity to their E2F site(s), which are frequently located near the transcription start site, and lack of a recognizable TATA box. E2F-responsive promoters include E2F promoters such as the E2F-1 promoter, dihydrofolate reductase (DHFR) promoter, DNA polymerase A (DPA) promoter, c-myc promoter and the B-myb promoter. The E2F-1 promoter contains four E2F sites that act as transcriptional repressor elements in serum-starved cells. Preferably, an E2F-responsive promoter has at least two E2F sites.

[0106] Without being bound by theory, the understanding of selective hTERT expression in cancer is based on the current knowledge of the molecular underpinnings involved in tumorigenesis. hTERT is the rate-limiting catalytic subunit of telomerase, a multicomponent ribonucleoprotein enzyme that has also been shown to be active in ˜85% of human cancers but not normal somatic cells (Kilian A et al. Hum Mol Genet. 1997 Nov:6(12):2011-9; Kim N W et al. Science. 1994 Dec 23;266(5193):2011-5; Shay JW et al. European Journal of Cancer 1997; 5, 787-791; Stewart SA et al. Semin Cancer Biol. 2000 Dec;10(6):399-406). Telomerase synthesizes telomeric DNA to enable cells to proliferate without senescence. In humans this activity is restricted to germ line cells, stem cells, and activated B and T cells, an attribute necessary for these cells to repopulate diminished cell populations or mediate an immune response (Kim N W et al. Science. 1994 Dec 23;266(5193):2011-5; Hivama K et al. J Natl Cancer Inst. 1995 Jun 21;87(12):895-902). However, most other normal human cells have a limited lifespan due to lack of telomerase (Poole J C et al. Gene. 2001 May 16;269(1-2):1-12; Shay J W et al. Hum Mol Genet. 2001 Apr;10(7):677-85). Cancer cells appear to require immortalization for tumorigenesis and telomerase activity is almost always necessary for immortalization (Kim N W et al. Science. 1994 Dec 23;266(5193):2011-5; Kivono T et al. Nature 1998;396:84), although there is an alternative pathway not involving telomerase that maintains telomere length in a small percentage of tumors (Bryan T M et al. Nat Med. 1997 Nov;3(11):1271-4). Interestingly, immortalization appears to require an Rb-pathway defect (Kivono T et al. Nature 1998;396:84). Thus, the majority of tumors have both an Rb-pathway defect and disregulated telomerase, two pathways specifically targeted by Ar 7pAE2fFTrtex.

[0107] The term TERT promoter refers to the native TERT promoter and functional fragments, mutations and derivatives thereof. The TERT promoter does not have to be the full-length wild type promoter. One skilled in the art knows how to derive fragments from a TERT promoter and test them for the desired specificity. Preferably, the TERT promoter of the invention is a mammalian TERT promoter, more preferred is a human TERT promoter (hTERT). In one embodiment of the invention, the TERT promoter consists essentially of SEQ ID NO:93 which is a 397 bp fragment of the hTERT promoter. In a preferred embodiment of the invention, the TERT promoter consists essentially of SEQ ID NO:94, which is a 245 bp fragment of the hTERT promoter. In a preferred embodiment, a TERT promoter is operably linked to the adenovirus E4 region. 1

ccctcgctggcgtccctgcaccctgggagcgcgagcg SEQ ID NO:93
gcgcgcgggcggggaagcgcggcccagacccccgggt
ccgcccggagcagctgcgctgtcggggccaggccggg
ctcccagtggattcgcgggcacagacgcccaggaccg
cgcttcccacgtggcggagggactggggacccgggca
cccgtcctgccccttcaccttccagctccgcctcctc
cgcgcggaccccgccccgtcccgacccctcccgggtc
cccggcccagccccctccgggccctcccagcccctcc
ccttcctttccgcggccccgccctctcctcgcggcgc
gagtttcaggcagcgctgcgtcctgctgcgcacgtgg
gaagccctggccccggccacccccgcg
ccccacgtggcggagggactggggacccgggcacccg SEQ ID NO:94
tcctgccccttcaccttccagctccgcctcctccgcg
cggaccccgccccgtcccgacccctcccgggtccccg
gcccagccccctccgggccctcccagcccctcccctt
cctttccgcggccccgccctctcctcgcggcgcgagt
ttcaggcagcgctgcgtcctgctgcgcacgtgggaag
ccctggccccggccacccccgcg

[0108] The recombinant viral vector comprises a gene essential for replication. The term “gene essential for replication” refers to a nucleic acid sequence whose transcription is required for the vector to replicate in the target cell. For example, if the vector construct of the invention is an adenoviral vector, the gene essential for replication may be selected from the group consisting of E1A, E1, E2 and E4 coding sequences. Most preferably, the gene essential for replication is selected from the group consisting of the E1A, E1b, and E4 coding sequences. Particularly preferred is the adenoviral E1A gene as the gene essential for replication.

[0109] In a preferred embodiment, the recombinant viral vector further comprises a deletion upstream of the termination signal sequence. Preferred are deletions between nucleotides 103 and 551 of the adenoviral type 5 backbone or corresponding positions in other serotypes. In particular, deletions between nucleotides 189 and 551 or corresponding positions in other serotypes are preferred.

[0110] A deletion in the packaging signal 5′ to the termination signal sequence may be such that the packaging signal becomes non-functional. In one embodiment, the deletion comprises a deletion 5′ to the termination signal sequence wherein the deletion spans at least the nucleotides 189 to 551. In another embodiment the deletion comprises a deletion 5′ to the termination signal sequence wherein the deletion spans at least nucleotides 103 to 551 ( FIG. 2 ). In these situations, it is preferred that the packaging signal is located (i.e. re-inserted) at a position 3′ to the termination signal sequence and downstream of the E2F-linked gene essential for replication.

[0111] In the context of adenoviral vectors, the term “5′” is used interchangeably with “upstream” and means in the direction of the left ITR. In the context of adenoviral vectors, the term “3′” is used interchangeably with “downstream” and means in the direction of the right ITR.

[0112] In one embodiment, the invention further comprises a mutation or deletion in the E3 region. However, in an alternative, preferred embodiment, all or a part of the E3 region may be preserved or re-inserted in the oncolytic adenoviral vector. Presence of all or a part of the E3 region may decrease the immunogenicity of the adenoviral vector. It also increases cytopathic effect in tumor cells and decreases toxicity to normal cells. Preferably, the vector expresses more than half of the E3 proteins.

[0113] In an alternative embodiment, the invention further comprises a mutation or deletion in the E1b gene. Preferably the mutation or deletion in the E1 gene is such that the E1-19 kD protein becomes non-functional. This modification of the El b region may be combined with vectors where all or a part of the E3 region is present.

[0114] In a preferred embodiment, the oncolytic adenoviral vector further comprises at least one therapeutic gene. The therapeutic gene, preferably in the form of cDNA, can be inserted in any position that does not adversely affect the infectivity or replication of the vector. Preferably, it is inserted in the E3 region in place of at least one of the polynucleotide sequences coding for the E3 proteins. Most preferably, the therapeutic gene is inserted in place of the 19 kD or 14.7 kD E3 gene.

[0115] A therapeutic gene can be one that exerts its effect at the level of RNA or protein. Therapeutic genes that may be introduced into the adenovirus include a factor capable of initiating apoptosis, antisense or ribozymes, which among other capabilities may be directed to mRNAs encoding proteins essential for proliferation, such as structural proteins, transcription factors, polymerases, etc., genes encoding cytotoxic proteins, genes that encode an engineered cytoplasmic variant of a nuclease (e.g. RNase A) or protease (e.g. trypsin, papain, proteinase K, carboxypeptidase, etc.), or encode the Fas gene, and the like.

[0116] Other therapeutic genes of interest include, but are not limited to, immunostimulatory, anti-angiogenic, and suicide genes. Immunostimulatory genes include, but are not limited to, cytokines (GM-CSF, IL1, IL2, IL4, IL5, IFNa, IFNγ, TNFα, IL12, IL18, and flt3), proteins that stimulate interactions with immune cells (B7, CD28, MHC class I, MHC class II, TAPs), tumor-associated antigens (immunogenic sequences from MART-1, gpl 00(pmel-17), tyrosinase, tyrosinase-related protein 1, tyrosinase-related protein 2, melanocyte-stimulating hormone receptor, MAGE1, MAGE2, MAGE3, MAGE12, BAGE, GAGE, NY-ESO-1, β-catenin, MUM-1, CDK-4, caspase 8, KIA 0205, HLA-A2R1701, α-fetoprotein, telomerase catalytic protein, G-250, MUC-1, carcinoembryonic protein, p53, Her2/neu, triosephosphate isomerase, CDC-27, LDLR-FUT, telomerase reverse transcriptase, and PSMA), cDNAs of antibodies that block inhibitory signals (CTLA4 blockade), chemokines (MIP1a, MIP3a, CCR7 ligand, and calreticulin), and other proteins. Anti-angiogenic genes include, but are not limited to, METH-1, METH -2, TrpRS fragments, proliferin-related protein, prolactin fragment, PEDF, vasostatin, various fragments of extracellular matrix proteins and growth factor/cytokine inhibitors. Various fragments of extracellular matrix proteins include, but are not limited to, angiostatin, endostatin, kininostatin, fibrinogen-E fragment, thrombospondin, tumstatin, canstatin, and restin. Growth factor/cytokine inhibitors include, but are not limited to, VEGFNEGFR antagonist, sFlt-1, sFlk, sNRP1, angiopoietin/tie antagonist, sTie-2, chemokines (IP-10, PF-4, Gro-beta, IFN-gamma (Mig), IFNα, FGF/FGFR antagonist (sFGFR), Ephrin/Eph antagonist (sEphB4 and sephrinB2), PDGF, TGFβ and IGF-1.

[0117] A “suicide gene” encodes for a protein which itself can lead to cell death, as with expression of diphtheria toxin A, or the expression of the protein can render cells selectively sensitive to certain drugs, e.g., expression of the Herpes simplex thymidine kinase gene (HSV-TK) renders cells sensitive to antiviral compounds, such as acyclovir, gancyclovir and FIAU (1-(2-deoxy-2-fluoro-β-D-arabinofuranosil)-5-iodouracil). Other suicide genes include, but are not limited to, genes that encode for carboxypeptidase G2 (CPG2), carboxylesterase (CA), cytosine deaminase (CD), cytochrome P450 (cyt-450), deoxycytidine kinase (dCK), nitroreductase (NR), purine nucleoside phosphorylase (PNP), thymidine phosphorylase (TP), varicella zoster virus thymidine kinase (VZV-TK), and xanthine-guanine phosphoribosyl transferase (XGPRT). Alternatively, the therapeutic gene can exert its effect at the level of RNA, for instance, by encoding an antisense message or ribozyme, a protein that affects splicing or 3′ processing (e.g., polyadenylation), or a protein that affects the level of expression of another gene within the cell, e.g. by mediating an altered rate of mRNA accumulation, an alteration of mRNA transport, and/or a change in post-transcriptional regulation. The addition of a therapeuitc gene to the virus would result in a virus with an additional antitumor mechanism of action. Thus, a single entity (i.e., the virus carrying a therapeutic transgene) would be capable of inducing multiple antitumor mechanisms.

[0118] The DNA sequence encoding the therapeutic gene may preferably be selected from either GM-CSF, thymidine kinase, Nos, FasL, or sFasR (soluble Fas receptor). In a particularly preferred embodiment, the therapeutic gene is GM-CSF.

[0119] Granulocyte macrophage colony stimulating factor (GM-CSF) is a multi-functional glycoprotein produced by T cells, macrophages, fibroblasts and endothelial cells. It stimulates the production of granulocytes (neutrophils, eosinophils & basophils) and cells of the monocytic lineage, including monocytes, macrophages and dendritic cells (reviewed in Armitage J O et al.

[0120] Blood 1998 Dec 15;92(12):4491-508). In addition, it activates the effector functions of these cells and also appears to stimulate the differentiation of B cells. Since the early 1990's, a number of groups have investigated the clinical use of recombinant human GM-CSF for the treatment of cancer.

[0121] Of central importance in the oncology setting is the ability of GM-CSF to augment the antigen presentation capability of the subclass of dendritic cells (DC) capable of stimulating robust anti-tumor responses (Gasson et al. Blood 1991 Mar 15;77(6):1131-45; Mach et al. Cancer Res. 2000 Jun 15;60(12):3239-46; reviewed in Mach and Dranoff, Curr Opin Immunol. 2000 Oct;12(5):571-5). In the vaccine setting, DCs that are recruited by GM-CSF to the vaccine site are presumed to capture tumor proteins. Among the proteins captured by DCs will be tumor antigens (i.e., proteins expressed specifically by the tumor, Boon and Old, Curr Opin Immunol. 1997 Oct 1 ;9(5):681-3). Presentation of tumor antigen epitopes to T cells in the draining lymph nodes is then expected to result in systemic immune responses to tumor metastases. Also, irradiated tumor cells expressing GM-CSF function as potent vaccines against tumor challenge (Dranoff, et al. Proc National Acad Sciences 1993; 90:3539-3543; Jaffee, et al. J Clin Oncol 2001; 19:145-156; reviewed in Pardoll, Annu Rev Immunol 1995;13:399-415). Data such as these have stimulated a number of clinical trials, most notably in melanoma, and prostate, renal and pancreatic carcinoma (Simons J W et al. Cancer Res. 1999; 59:5160-5168; Simons J W et al. Cancer Res 1997; 57:1537-1546; Soiffer R et al. Proc. Natl. Acad. Sci USA 1998; 95:13141-13146; Jaffee. et al. J Clin Oncol 2001: 19:145-156). In addition, GM-CSF expression has been shown preclinically to elicit a protease that cleaves plasminogen to produce angiostatin, a known anti-angiogenic protein (Dong Z et al, Cell. 1997 Mar 21;88(6):801-10; Dong Z et al. J Exp Med 1998; 188:755-763).

[0122] The DNA sequence encoding a therapeutic gene is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter and/or the E3 promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the Rous Sarcoma Virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; and the ApoAI promoter. In a preferred embodiment, the promoter is a tissue-specific promoter as disclosed in U.S. Pat. No. 5,998,205, issued Dec. 7, 1999 to Hallenbeck, et al. An E2F-responsive promoter is particularly preferred, such as the human E2F-1 promoter.

[0123] The invention further comprises combinations of two or more transgenes with synergistic, complementary and/or nonoverlapping toxicities and methods of action. The resulting oncolytic adenovirus would retain the viral oncolytic functions and would, for example, additionally be endowed with the ability to induce immune and anti-angiogenic responses, etc.

[0124] The invention further comprises adenoviral vector particles, which comprise the viral vectors of the invention. Preferably, the viral particles further comprise a targeting ligand included in a capsid protein of the particle. Preferably, the capsid protein is a fiber protein, and most preferably, the ligand is in the HI loop of the fiber protein.

[0125] The adenoviral vectors of the invention are made by standard techniques known to those skilled in the art. The vectors are transferred into packaging cells by techniques known to those skilled in the art. Packaging cells provide complementing functions to the functions provided by the genes in the adenovirus genome that are to be packaged into the adenovirus particle. The production of such particles requires that the vector be replicated and that those proteins necessary for assembling an infectious virus be produced. The packaging cells are cultured under conditions that permit the production of the desired viral vector particle. The particles are recovered by standard techniques. The preferred packaging cells are those that have been designed to limit homologous recombination that could lead to wild-type adenoviral particles. Such cells are disclosed in U.S. Pat. Nos. 5,994,128, issued Nov. 30, 1999 to Fallaux, et al., and 6,033,908, issued Mar. 7, 2000 to Bout, et al. The packaging cell known as PER.C6, which is disclosed in these patents, is particularly preferred.

[0126] In a preferred embodiment of the invention, the recombinant viral vectors and particles selectively replicate in and lyse Rb-pathway defective cells. In the majority of tumor types, the Rb/cell cycle regulatory pathway is disrupted, suggesting that Rb-pathway disregulation may be obligatory for tumorgenesis (Strauss M, Lukass J and Bartek J.

[0127] Unrestricted cell cycling and cancer. Nat Med 1995; 12:1245-1246). Rb itself is mutated in some tumor types, and in other tumor types factors upstream of Rb are deregulated (Weinberg, R A. The retinoblastoma protein and cell cycle control. Cell 1995; 81:323-330). One effect of these Rb-pathway changes in tumors is the loss of pRB binding to E2F, and an apparent increase in free E2F in tumor cells. The abundance of free E2F in turn results in high level expression of E2F responsive genes in tumor cells, including the E2F-1 gene. Accordingly, the term “Rb-pathway defective cells” may be functionally defined as cells which display an abundance of “free” E2F, as measured by gel mobility shift assay or by chromatin immunoprecipitation (Takahashi Y, Rayman J B, Dynlacht B D. Analysis of promoter binding by the E 2F and pRB families in vivo: distinct E2F proteins mediate activation and repression. Genes Dev. 2000 Apr 1;14(7):804-16).

[0128] In particular, cells which have mutations in genes encoding factors that phosphorylate pRB may be Rb-pathway defective cells within the meaning of the invention. pRB is temporally regulated by phosphorylation during the cell cycle. Among the factors that phosphorylate pRB is the complex of cyclin-dependent-kinase 4 (CDK4) and its regulatory subunit, D-type cyclins (CycD). CDK4 is in turn regulated by the p16 small molecular weight CDK inhibitor. Phosphorylation by CDKs reversibly inactivates pRB, resulting in transcriptional activation by E2F-DP-1 dimers and entry into S phase of the cell cycle. Dephosphorylation of pRB after mitosis causes re-entry into G 1 phase. In tumor cells, any one or several of the cell cycle checkpoint proteins may be modified, leading to cell cycle deregulation and unrestricted cell cycling. Loss of the pRB-E2F-DP-1 interaction, or abundance of “free E2F,” results in derepression/activation of promoters having E2F sites. Although the inventors do not wish to be limited by these theoretical considerations, we believe that derepression of the E2F-1 promoter in Ar6pAE2fF leads to transcription of E1A, viral replication, and oncolysis.

[0129] Accordingly, in another aspect there is provided a method of selectively killing a neoplastic cell in a cell population which comprises contacting an effective amount of the viral vectors or viral particles of the invention with said cell population under conditions where the viral vectors or particles can transduce the neoplastic cells in the cell population, replicate, and kill the neoplastic cells. Preferably, the neoplastic cell has a defect in the Rb-pathway.

[0130] The viral vectors of the invention are useful in studying methods of killing neoplastic cells in vitro or in animal models. Preferably, the cells are mammalian cells. More preferably, the mammalian cells are primate cells. Most preferably, the primate cells are human cells.

[0131] In a further aspect of the invention, a pharmaceutical composition comprising the recombinant viral vectors and particles of the invention and a pharmaceutically acceptable carrier is provided. Such compositions, which can comprise an effective amount of adenoviral vectors and particles of this invention in a pharmaceutically acceptable carrier, are suitable for local or systemic administration to individuals in unit dosage forms, sterile parenteral solutions or suspensions, sterile non-parenteral solutions or oral solutions or suspensions, oil in water or water in oil emulsions and the like. Formulations for parenteral and non-parenteral drug delivery are known in the art. Compositions also include lyophilized and/or reconstituted forms of the adenoviral vectors and particles of the invention. Acceptable pharmaceutical carriers are, for example, saline solution, protamine sulfate (Elkins-Sinn, Inc., Cherry Hill, N.J.), water, aqueous buffers, such as phosphate buffers and Tris buffers, or Polybrene (Sigma Chemicel, St. Louis Mo.) and phosphate-buffered saline and sucrose. The selection of a suitable pharmaceutical carrier is deemed to be apparent to those skilled in the art from the teachings contained herein. These solutions are sterile and generally free of particulate matter other than the desired adenoviral virions. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, etc. Excipients which enhance infection of cells by adenovirus may be included.

[0132] The viral vectors are administered to a host in an amount which is effective to inhibit, prevent, or destroy the growth of the tumor cells through replication of the viral vectors in the tumor cells. Such administration may be by systemic administration as hereinabove described, or by direct injection of the vectors in the tumor. In general, the vectors are administered systemically in an amount of at least 5×10 9 particles per kilogram body weight and in general, such an amount does not exceed 2.5×10 12 particles per kilogram body weight. The vectors are administered intratumorally in an amount of at least 2×10 10 particles and in general such an amount does not exceed 2×10 13 particles. The exact dosage to be administered is dependent upon a variety of factors including the age, weight, and sex of the patient, and the size and severity of the tumor being treated. The viruses may be administered one or more times, depending upon the immune response potential of the host. Single or multiple administrations of the compositions can be carried out with dose levels and pattern being selected by the treating physician. If necessary, the immune response may be diminished by employing a variety of immunosuppressants, so as to permit repetitive administration, without a strong immune response. Antineoplastic adenoviral therapy of the present invention may be combined with other antineoplastic protocols.

[0133] Delivery can be achieved in a variety of ways, employing liposomes, direct injection, catheters, topical applications, etc.

[0134] In yet another aspect, a method of treating a host organism having a neoplastic condition is provided, comprising administering a therapeutically effective amount of the composition of the invention to said host organism.

[0135] In a preferred embodiment of the invention, the neoplastic tissue is abnormally proliferating, and preferably malignant tumor tissue. Preferably, the viral vector is distributed essentially throughout the tissue or tumor mass due to its capacity for selective replication in the tumor tissue.

[0136] All neoplastic conditions are potentially amenable to treatment with the methods of the invention. Tumor types include, but are not limited to hematopoietic, pancreatic, neurologic, hepatic, gastrointestinal tract, endocrine, biliary tract, sinopulmonary, head and neck, soft tissue sarcoma and carcinoma, dermatologic, reproductive tract, and the like. Preferred tumors for treatment are those with a high mitotic index relative to normal tissue. Preferred tumors are solid tumors.

[0137] In a preferred embodiment of the method of treatment, the neoplastic condition is lung, colon, breast, or prostate cancer.

[0138] In a preferred embodiment the host organism is a human patient. For human patients, if a therapeutic gene is included in the vector, the therapeutic gene will generally be of human origin although genes of closely related species that exhibit high homology and biologically identical or equivalent function in humans may be used if the gene does not produce an adverse immune reaction in the recipient. A therapeutic active amount of a nucleic acid sequence or a therapeutic gene is an amount effective at dosages and for a period of time necessary to achieve the desired result. This amount may vary according to various factors including but not limited to sex, age, weight of a subject, and the like.

EXAMPLES

[0139] The invention will now be described with respect to the following examples; it is to be understood, however, that the scope of the present invention is not intended to be limited thereby.

Example 1

Construction and Molecular Characterization of Replication-Selective Adenoviruses Ar6F, Ar6PAF and Ar6pAE2fF

[0140] Two adenovirus backbones that were designed to minimize nonspecific activation of the E1A gene were developed. The Ar6F adenoviral vector contains the left side ITR directly linked to the E1A coding region (SEQ ID NO:5), with the intervening nucleotides deleted (nucleotides 104-551 in the Ad5 sequence, GenBank accession number M73260) and replaced with a multiple cloning site ( FIG. 4 ). The Ar6pAF adenoviral vector is identical to Ar6F except that it contains the 145 nucleotide SV-40 early poly(A) signal inserted between the left ITR and the E1A coding region (SEQ ID NO: 6, FIG. 5 ). In both of these vectors, the packaging signal normally present near the left ITR was moved to the right ITR ( FIG. 3 , panel B; Seq ID NO:4). This was performed by replacing the right ITR with the reverse complementary sequence of the first 392 bp of Ad5, which contains the left ITR and the packaging signal. Finally, to generate the adenoviral vector Ar6pAE2fF, the tumor selective promoter E2F-1 was inserted between the SV-40 early poly(A) signal and the E1A coding region present in Ar6pAF ( FIG. 3 , panel A; Seq ID NO:3).

[0141] The first 1802 nucleotides of the Ar6pAE2fF adenoviral vector, including the ITR, poly(A), E2F-1 promoter and the E1A gene was confirmed by DNA sequencing (SEQ ID NO:3). In addition, the last 531 nucleotides at the right end of the vector, containing the packaging signal and right ITR was confirmed by sequencing (SEQ ID NO: 4, FIG. 3 ).

[0142] Adenoviral genomes containing these modifications were cloned by standard methods in bacterial plasmids. Homologous recombination in E. coli was performed between these bacterial shuttle plasmids containing fragments of the Ad genome to generate plasmids (pAr6F, pAr6pAF, and pAr6pAE2fF) containing full-length infectious viral genomes (He et al., 1998 . A simplified system for generating recombinant adenoviruses. PNAS 95. 2509-2514). These plasmids containing full length adenoviral genomes were linearized with a restriction enzyme to release the adenoviral genome DNA from the bacterial plasmid sequences. The adenoviral DNA was then transfected into a complementing cell line AE1-2a (Gorziglia et al., 1996 . Elimination of both E 1 and E2a from adenovirus vectors further improves prospects for in vivo human gene therapy. J. Virol. 6,4173-4178) using the LipofectaAMINE-PLUS reagent system (Life Technologies, Rockville, Md.). The cells were incubated at 37° C. for approximately 5-7 days. Adenovirus was amplified and purified by CsCI gradient as described (Jakubczak et al., 2001 . Adenovirus type 5 viral particles pseudotyped with mutagenized fiber proteins show diminished infectivity of coxsackie B-Adenovirus receptor-bearing cells. J. Virol. 75:2972-2981). Virus particle concentrations were determined by spectrophotometric analysis (Mittereder et al., 1996 . Evaluation of the concentration and bioactivity of adenovirus vectors for gene therapy. J. Virol. 70, 7498-7509).

[0143] 1.2 Viral DNA Isolation and Southern Analysis

[0144] DNA was isolated from CsCI-purified virus preparation as described (Puregene Kit, Gentra). Viral DNA was digested with the indicated restriction enzymes and analyzed on 1% agarose/TAE gels containing ethidium bromide. A total of 1 ug of each DNA sample was digested with ClaI, XbaI, Hpal, SalI and BamHI and subjected to Southern analysis according to standard procedures. The probe was prepared by random oligonucleotide priming and contained the E2F-1 promoter.

[0145] FIG. 6 summarizes the cloning and structures of Ar6pAF and Ar6pAE2fF vectors. The DNA structure of a research lot of Ar6pAE2fF vector was confirmed by Southern analysis. The expected left DNA region fragments were obtained using five independent restriction endonucleases. Southern blot analysis with an E2F promoter DNA probe demonstrated the expected hybridization pattern for all restriction endonucleases. Thus, these results confirmed the presence of the E2F-1 promoter in the correct position and verified the integrity of the viral DNA.

[0146] 1.3 Limiting Dilution Cloning of Ar6pAE2fF Vector in PER.C6 Cells

[0147] A seed lot of Ar6pAE2fF vector was produced for further evaluations. To obtain a pure seed lot of a virus it is necessary to isolate a clone derived from a single virus particle. The cloning of Ar6pAE2fF virus was accomplished through viral limiting dilution as described in below.

[0148] Ten 96 well plates of PER.C6 cells (Fallaux et al., 1998 . New helper cells and matched early region 1- deleted adenovirus vectors prevent generation of replication-competent adenoviruses. Human. Gene Ther 9, 1909-1917) were plated at 5×10 3 cells/well in 0.04 ml volume /well. PER.C6 cells were grown in DMEM with the addition of 10% FBS and 10 mM MgCl 2 . 10 ul of Ar6pAE2fF containing 1×10 −2 particles/ul was added to each well, giving a final infection of 0.1 particle/well. Infected cells were incubated at 37° C. and 5% CO 2 for 4 hours, after which 150 ul of media was added. The virus infected cells were incubated at 37° C. and 5% CO 2 for 12 days followed by scoring for CPE. The 0.1 particle /cells clones 7-9 from PER.C6 cells were harvested on day 13.Three clones, 7-9 showed CPE and were freeze thawed 5 times and amplified on PER.C6 cells plated in 6 well dishes. On day 3, CVL were prepared from clones 7-9 and clone 7 was further amplified in a T150 of PER.C6 cells. Ar6pAE2fF clone 7 T150 was harvested 2 days post-infection, a time at which the cells had reached complete CPE.

[0149] The CVL was freeze thawed 5 times and cellular debris was spun out. A T75 flask of PER.C6 cells was plated and infected with 0.5 ml of the above CVL.

[0150] Of the 960 wells infected with 0.1 particle/cell, three wells showed CPE. These 3 clones were in the range of the theoretical numbers of clones expected. Statistically, only 4 wells out of the 10 plates should give CPE. This gives odds of 1:2500 that there will be more than one infectious particle/well when assuming a particle:pfu ratio of 25. The three clones were amplified in PER.C6 cells and the genome of clone 7 showed the expected size DNA fragments when analyzed with HpaI, XhoI and XbaI restriction endonuclease.

[0151] 1.4 Sequence Analysis.

[0152] The 5′-end first 1802 nucleotides and the last 3′-end nucleotides from bp 33881-34412 of the plasmids pDL6pAE2f and Ar6pAE2fF clone 7 were directly sequenced (SEQ ID NO:3, FIG. 3A ).

[0153] Regions of Ar6pAE2fF were confirmed by DNA sequencing. Regions in first 1802 nucleotides are ITR (nucleotides 1-103), poly-adenylation signal (nucleotides 116-261), human E2F-1 promoter (nucleotides 283-555), E1A gene (nucleotides 574-1647) and a portion of the E1 gene (nucleotides 1648-1802) are indicated (SEQ ID NO:3, FIG. 3A ). Regions in the last 531 nucleotides are the PacI restriction site (nucleotides 33967-33974) (underlined), the packaging signal (nucleotides 34020-34217 and the ITR (34310-34412) (SEQ ID NO:4, FIG. 3B ).

Example 2

Characterization of E1A Expression by FACS

[0154] To determine if deletions of enhancer elements and insertion of a polyA signal would be sufficient for efficient transcription termination, a quantitative E1A FACS assay was used to evaluate E1A expression in a non-complementing A549 cell background (p16− p53+ Rb+). We compared the E1A expression from cells infected with Addl327, Addl312, Ar6F, Ar6pAF or Ar6pAE2fF at doses of 10, 50, 250 and 1250 virus particles per cell (VPC) (Table 1). The highest level of E1A expression was observed with the Addl327 at all range of doses. In contrast, the E1A deleted mutant Addl312 showed no E1A expression. Under the conditions used in this experiment (10 to 1250 VPC) there was about 80% to 22% less E1A detected in cells transduced with Ar6F than in those transduced with Addl327. The E1A expression in cells transduced with Ar6pAF was significantly reduced about 100% to 96%, in all doses, as compared to the expression from cells infected with the Addl327. The expression of E1A from cells infected with the Ar6pAE2fF oncolytic vector was reduced 50% as compared with the Addl327 virus at a dose of 50VPC.

[0155] In conclusion, the insertion of a poly(A) signal in the Ar6pAF vector reduced the E1A expression in A549 cells. In contrast, insertion of the E2F-1 promoter reestablished the E1A expression, thus demonstrating that E1A expression was exclusively due to the inserted promoter. 2

TABLE 1
E1A expression in A549 noncomplementing cells
10 vpc 50 vpc 250 vpc 1250 vpc
Addl327 27.5 ± 2.2 72.9 ± 3.8 94.4 ± 0.7 98.4 ± 0.4
Addl312  0.0 ± 0.0  0.0 ± 0.0  0.0 ± 0.0  0.0 ± 0.0
Ar6F  5.6 ± 0.8 28.3 ± 1.1 59.4 ± 4.7 76.9 ± 3.6
Ar6pAF  0.0 ± 0.0  0.1 ± 0.1  0.3 ± 0.1  3.8 ± 2.4
Ar6pAE2fF ND 39.7 ± 0.1 ND ND
Noncomplementing A549 cells were infected with either vector at 10, 50, 250 and 1250 VPC. E1A expression was determined 24 hours postinfection by FACS.

[0156] Protocol for E1A FACS Assays

[0157] Cells were plated the day before infection in 12-well plates. The next day, media was aspirated from cells, virus dose formulations in particles per cell (ppc) were added to the wells and the plates were rocked at 37° C. for 4 hours. Virus/media was aspirated, washed one time, then replaced with complete growth media and incubated 20 hours at 37° C. Cells were harvested by trypsin-EDTA digestion, and fixed in 70% ethanol for 20 minutes at room temperature. Then the cells were washed one time and resuspended in FACS buffer (PBS, 3% FBS, 0.1% NaN 3 ). 10 □l of a 1:10 dilution of unconjugated anti-E1A antibody (Calbiochem, Anti-Adenovirus 2E1A, Human (Ab-1)) or mouse IgG 2 a isotype control (Sigma M-5409) was added and incubated at room temperature for 30 minutes. The cells were washed one time with FACS buffer. Then 50 □l of 1:40 dilution of GAM PE (Sigma P-9670) was added and incubated at room temperature for 30 minutes. Then the cells were washed, resuspended in 200 □l FACS buffer, and 20,000 events on FACSCAN were acquired.

Example 3

Toxicity of Adenoviral Vectors

[0158] Acute hepatic toxicity in Balb/c SCID male mice was used to distinguish between adenoviral vectors with different levels of E1A activity. A profound difference in serum liver enzyme elevations was observed between vectors with wild-type E1A expression and those with minimal or silent E1A expression.

[0159] Studies were designed with ten animals per group. Control groups were HBSS vehicle alone, the negative control E1A-deleted Addl312 and the E1A-containing positive control Addl327. Viruses were injected at a dose of 6.25×10 11 particles/kg intravenously into the tail vein in a volume of 10 ml/kg; an equivalent dose volume of HBSS (10 mL/kg) was injected in the vehicle control group. Animals were injected on study day 1, with an interim sacrifice of half of each group on study day 4 and a terminal sacrifice of the remaining animals on study day 15. On study days 4 and 15, serum was collected from all mice, and the livers removed from the animals scheduled for sacrifice (5/group). In addition, body weights were measured on all surviving mice on study days −3, 1, 3, 4, 8 and 15. 3

TABLE 2
Acute toxicity of E1A containing adenoviral ectors