Title:
Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases
Document Type and Number:
Kind Code:
A1

Abstract:
The invention provides methods and compositions for using immunostimulatory nucleic acids to treat non-allergic inflammatory diseases. Non-allergic inflammatory diseases that may be treated according to the methods and products of the invention include psoriasis and inflammatory bowel disease. The invention further provides methods for augmenting a Th1 response to immunostimulatory nucleic acid involving inhibition of prostaglandin-mediated counter-regulatory response.

Inventors:
Krieg, Arthur M. (Wellesley, MA, US)
Berg, Daniel J. (Iowa City, IA, US)
      Plaque It!

Sponsored by:
Flash of Genius
Application Number:
10/112653
Publication Date:
03/13/2003
Filing Date:
03/29/2002
View Patent Images:
Images are available in PDF form when logged in. To view PDFs, Login  or  Create Account (Free!)
Primary Class:
International Classes:
(IPC1-7): A61K048/00
Attorney, Agent or Firm:
FEDERAL RESERVE PLAZA,WOLF GREENFIELD & SACKS, PC (600 ATLANTIC AVENUE, BOSTON, MA, 02210-2211, US)
Claims:

We claim:



1. A method for treating a non-allergic inflammatory disease, comprising: administering to a subject having or at risk of developing a non-allergic inflammatory disease a therapeutically effective amount of an immunostimulatory nucleic acid to treat or prevent the non-allergic inflammatory disease.

2. The method of claim 1, wherein the therapeutically effective amount of the immunostimulatory nucleic acid reduces or prevents non-allergic inflammation in a tissue of the subject.

3. The method of claim 1, wherein the non-allergic inflammatory disease involves an epithelium.

4. The method of claim 1, wherein the non-allergic inflammatory disease involves a mucosal epithelium.

5. The method of claim 1, wherein the non-allergic inflammatory disease is selected from the group consisting of: psoriasis, eczema, allergic contact dermatitis, latex dermatitis, and inflammatory bowel disease.

6. The method of claim 1, wherein the non-allergic inflammatory disease is psoriasis.

7. The method of claim 1, wherein the non-allergic inflammatory disease is allergic contact dermatitis.

8. The method of claim 1, wherein the non-allergic inflammatory disease is latex dermatitis.

9. The method of claim 1, wherein the immunostimulatory nucleic acid is a CpG nucleic acid.

10. The method of claim 1, wherein the immunostimulatory nucleic acid is a methylated CpG nucleic acid.

11. The method of claim 1, wherein the immunostimulatory nucleic acid is a T-rich nucleic acid.

12. The method of claim 1, wherein the immunostimulatory nucleic acid is a poly-G nucleic acid.

13. The method of claim 12, wherein the poly-G nucleic acid comprises the formula 5′-X1X2GGGX3X4-3′ wherein each of X1, X2, X3, and X4 is any nucleotide other than G.

14. The method of claim 13, wherein the poly-G nucleic acid does not include any of the formulas 5′-GXGGG-3′, 5′-XGGGG-3′, or 5′-GGGXG-3′, wherein X is any nucleotide.

15. The method of claim 1, wherein the immunostimulatory nucleic acid is a synthetic nucleic acid.

16. The method of claim 1, wherein the immunostimulatory nucleic acid comprises at least one stabilized internucleotide linkage.

17. The method of claim 16, wherein the stabilized internucleotide linkage is a phosphorothioate linkage.

18. The method of claim 1, wherein the immunostimulatory nucleic acid has a backbone completely made up of stabilized internucleotide linkages.

19. The method of claim 1, wherein the immunostimulatory nucleic acid comprises between 6 and 100 nucleotides.

20. The method of claim 1, wherein the immunostimulatory nucleic acid comprises between 8 and 40 nucleotides.

21. The method of claim 1, wherein the immunostimulatory nucleic acid induces IL-12.

22. The method of claim 1, wherein the immunostimulatory nucleic acid induces IFN-α.

23. The method of claim 1, wherein the immunostimulatory nucleic acid induces IFN-γ.

24. The method of claim 1, wherein the immunostimulatory nucleic acid induces IL-10.

25. The method of claim 1, wherein the immunostimulatory nucleic acid is administered locally to damaged epithelium.

26. The method of claim 1, wherein the immunostimulatory nucleic acid is administered locally to intact epithelium.

27. The method of claim 1, wherein the immunostimulatory nucleic acid is administered systemically.

28. The method of claim 1, wherein the immunostimulatory nucleic acid is administered orally.

29. The method of claim 1, wherein the immunostimulatory nucleic acid is administered parenterally.

30. The method of claim 1, wherein the immunostimulatory nucleic acid is administered topically.

31. The method of claim 1, wherein the immunostimulatory nucleic acid is administered transdermally.

32. The method of claim 1, further comprising administering to the subject an anti-inflammatory agent selected from the group consisting of: anti-inflammatory corticosteroids, nonsteroidal anti-inflammatory drugs, vitamin A analogs, vitamin D analogs, retinoids, cytokines, agonists of cytokines, antagonists of cytokines, agonists of cytokine receptors, antagonists of cytokine receptors, cytokine receptor analogs, antibodies specific for cytokines, antibodies specific for cytokine receptors, and immunosuppressive agents.

33. A method for treating inflammatory bowel disease, comprising: administering to a subject having or at risk of developing an inflammatory bowel disease a therapeutically effective amount of an immunostimulatory nucleic acid to treat or prevent the inflammatory bowel disease.

34. The method of claim 33, wherein the inflammatory bowel disease is ulcerative colitis.

35. The method of claim 33, wherein the inflammatory bowel disease is Crohn's disease.

36. The method of claim 33, wherein the immunostimulatory nucleic acid is a CpG nucleic acid.

37. The method of claim 33, wherein the immunostimulatory nucleic acid is a methylated CpG nucleic acid.

38. The method of claim 33, wherein the immunostimulatory nucleic acid is a T-rich nucleic acid.

39. The method of claim 33, wherein the immunostimulatory nucleic acid is a poly-G nucleic acid.

40. The method of claim 39, wherein the poly-G nucleic acid comprises the formula 5′-X1X2GGGX3X4-3′ wherein each of X1, X2, X3, and X4 is any nucleotide other than G.

41. The method of claim 40, wherein the poly-G nucleic acid does not include any of the formulas 5′-GXGGG-3′, 5′-XGGGG-3′, or 5′-GGGXG-3′, wherein X is any nucleotide.

42. The method of claim 33, wherein the immunostimulatory nucleic acid is a synthetic nucleic acid.

43. The method of claim 33, wherein the immunostimulatory nucleic acid comprises at least one stabilized internucleotide linkage.

44. The method of claim 43, wherein the stabilized internucleotide linkage is a phosphorothioate linkage.

45. The method of claim 33, wherein the immunostimulatory nucleic acid has a backbone completely made up of stabilized internucleotide linkages.

46. The method of claim 33, wherein the immunostimulatory nucleic acid comprises between 6 and 100 nucleotides.

47. The method of claim 33, wherein the immunostimulatory nucleic acid comprises between 8 and 40 nucleotides.

48. The method of claim 33, wherein the immunostimulatory nucleic acid induces IL-12.

49. The method of claim 33, wherein the immunostimulatory nucleic acid induces IFN-α.

50. The method of claim 33, wherein the immunostimulatory nucleic acid induces IFN-γ.

51. The method of claim 33, wherein the immunostimulatory nucleic acid induces IL-10.

52. The method of claim 33, wherein the immunostimulatory nucleic acid is administered locally to damaged mucosal epithelium.

53. The method of claim 33, wherein the immunostimulatory nucleic acid is administered locally to intact mucosal epithelium.

54. The method of claim 33, wherein the immunostimulatory nucleic acid is administered systemically.

55. The method of claim 33, wherein the immunostimulatory nucleic acid is administered orally.

56. The method of claim 33, wherein the immunostimulatory nucleic acid is administered rectally.

57. The method of claim 33, wherein the composition is administered parenterally.

58. The method of claim 33, further comprising administering to the subject an anti-inflammatory agent selected from the group consisting of: 5-aminosalicylate, agents containing 5-aminosalicylate, anti-inflammatory corticosteroids, nonsteroidal anti-inflammatory drugs, cytokines, agonists of cytokines, antagonists of cytokines, agonists of cytokine receptors, antagonists of cytokine receptors, cytokine receptor analogs, antibodies specific for cytokines, antibodies specific for cytokine receptors, and immunosuppressive agents.

59. The method of claim 33, further comprising administering to the subject an anti-inflammatory agent selected from the group consisting of: 5-aminosalicylate and agents containing 5-aminosalicylate.

60. A pharmaceutical composition, comprising: an immunostimulatory nucleic acid in an effective amount for preventing or treating an immune or inflammatory response associated with a non-allergic inflammatory disease, a non-allergic inflammatory disease medicament, and a pharmaceutically acceptable carrier.

61. The pharmaceutical composition of claim 60, wherein the non-allergic inflammatory disease is selected from the group consisting of: psoriasis, eczema, allergic contact dermatitis, latex dermatitis, and inflammatory bowel disease.

62. The pharmaceutical composition of claim 60, wherein the immunostimulatory nucleic acid is a CpG nucleic acid.

63. The pharmaceutical composition of claim 60, wherein the immunostimulatory nucleic acid is a methylated CpG nucleic acid.

64. The pharmaceutical composition of claim 60, wherein the immunostimulatory nucleic acid is a T-rich nucleic acid.

65. The pharmaceutical composition of claim 60, wherein the immunostimulatory nucleic acid is a poly-G nucleic acid.

66. The pharmaceutical composition of claim 65, wherein the poly-G nucleic acid comprises the formula 5′-X1X2GGGX3X4-3′ wherein each of X1, X2, X3, and X4 is any nucleotide other than G.

67. The pharmaceutical composition of claim 66, wherein the poly-G nucleic acid does not include any of the formulas 5′-GXGGG-3′, 5′-XGGGG-3′, or 5′-GGGXG-3′, wherein X is any nucleotide.

68. The pharmaceutical composition of claim 60, wherein the immunostimulatory nucleic acid is a synthetic nucleic acid.

69. The pharmaceutical composition of claim 60, wherein the immunostimulatory nucleic acid comprises at least one stabilized internucleotide linkage.

70. The pharmaceutical composition of claim 69, wherein the stabilized internucleotide linkage is a phosphorothioate linkage.

71. The pharmaceutical composition of claim 60, wherein the immunostimulatory nucleic acid has a backbone completely made up of stabilized internucleotide linkages.

72. The pharmaceutical composition of claim 60, wherein the immunostimulatory nucleic acid comprises between 6 and 100 nucleotides.

73. The pharmaceutical composition of claim 60, wherein the immunostimulatory nucleic acid comprises between 8 and 40 nucleotides.

74. The pharmaceutical composition of claim 60, wherein the non-allergic inflammatory disease medicament is selected from the group consisting of: 5-aminosalicylate, agents containing 5-aminosalicylate, anti-inflammatory corticosteroids, nonsteroidal anti-inflammatory drugs, vitamin A analogs, vitamin D analogs, retinoids, cytokines, agonists of cytokines, antagonists of cytokines, agonists of cytokine receptors, antagonists of cytokine receptors, cytokine receptor analogs, antibodies specific for cytokines, antibodies specific for cytokine receptors, and immunosuppressive agents.

75. A pharmaceutical composition, comprising: an immunostimulatory nucleic acid in an effective amount for preventing or treating an immune or inflammatory response associated with a non-allergic inflammatory disease, and a pharmaceutically acceptable carrier, wherein the immunostimulatory nucleic acid and pharmaceutically acceptable carrier are prepared in a formulation selected from the group consisting of: a lotion, a cream, an ointment, and a gel.

76. The pharmaceutical composition of claim 75, wherein the non-allergic inflammatory disease is selected from the group consisting of: psoriasis, eczema, allergic contact dermatitis, and latex dermatitis.

77. The pharmaceutical composition of claim 75, wherein the non-allergic inflammatory disease is psoriasis.

78. The pharmaceutical composition of claim 75, wherein the non-allergic inflammatory disease is allergic contact dermatitis.

79. The pharmaceutical composition of claim 75, wherein the non-allergic inflammatory disease is latex dermatitis.

80. The pharmaceutical composition of claim 75, wherein the immunostimulatory nucleic acid is a CpG nucleic acid.

81. The pharmaceutical composition of claim 75, wherein the immunostimulatory nucleic acid is a methylated CpG nucleic acid.

82. The pharmaceutical composition of claim 75, wherein the immunostimulatory nucleic acid is a T-rich nucleic acid.

83. The pharmaceutical composition of claim 75, wherein the immunostimulatory nucleic acid is a poly-G nucleic acid.

84. The pharmaceutical composition of claim 83, wherein the poly-G nucleic acid comprises the formula 5′-X1X2GGGX3X4-3′ wherein each of X1, X2, X3, and X4 is any nucleotide other than G.

85. The pharmaceutical composition of claim 84, wherein the poly-G nucleic acid does not include any of the formulas 5′-GXGGG-3′, 5′-XGGGG-3′, or 5′-GGGXG-3′, wherein X is any nucleotide.

86. The pharmaceutical composition of claim 75, wherein the immunostimulatory nucleic acid is a synthetic nucleic acid.

87. The pharmaceutical composition of claim 75, wherein the immunostimulatory nucleic acid comprises at least one stabilized internucleotide linkage.

88. The pharmaceutical composition of claim 87, wherein the stabilized internucleotide linkage is a phosphorothioate linkage.

89. The pharmaceutical composition of claim 75, wherein the immunostimulatory nucleic acid has a backbone completely made up of stabilized internucleotide linkages.

90. The pharmaceutical composition of claim 75, wherein the immunostimulatory nucleic acid comprises between 6 and 100 nucleotides.

91. The pharmaceutical composition of claim 75, wherein the immunostimulatory nucleic acid comprises between 8 and 40 nucleotides.

92. A method of augmenting Th1-like immune activation induced by an immunostimulatory nucleic acid, comprising: contacting an immune cell with an effective amount of an immunostimulatory nucleic acid to induce Th1-like immune activation; and contacting the immune cell with an inhibitor of cyclooxygenase-2 (COX-2) expression, in an amount effective to augment Th1-like immune activation induced by the immunostimulatory nucleic acid.

93. The method of claim 92, wherein the immunostimulatory nucleic acid is administered to a subject in need of Th1-like immune activation in an effective amount to induce Th1-like immune activation, and wherein the inhibitor of COX-2 expression is administered to the subject in an effective amount to augment Th1-like immune activation induced by the immunostimulatory nucleic acid.

94. A method of augmenting Th1-like immune activation induced by an immunostimulatory nucleic acid, comprising: contacting an immune cell with an effective amount of an immunostimulatory nucleic acid to induce Th1-like immune activation; and contacting the immune cell with an agent that inhibits PGE2 signaling through its receptor, in an amount effective to augment the Th1-like immune activation induced by the immunostimulatory nucleic acid.

95. The method of claim 94, wherein the agent that inhibits PGE2 signaling through its receptor is an antibody that binds specifically to PGE2.

96. The method of claim 94, wherein the immunostimulatory nucleic acid is administered to a subject in need of Th1-like immune activation in an effective amount to induce Th1-like immune activation, and wherein the agent that inhibits PGE2 signaling through its receptor is administered to the subject in an effective amount to augment the Th1-like immune activation.

97. A method of augmenting Th1-like immune activation in a subject, comprising: administering to a subject in need of Th1-like immune activation an effective amount of an immunostimulatory nucleic acid to induce Th1-like immune activation; and administering to the subject an effective amount of a cyclooxygenase inhibitor to inhibit prostaglandin expression, wherein the subject is free of symptoms of asthma or allergy otherwise calling for treatment with immunostimulatory nucleic acid, and wherein Th1-like immune activation induced by administering the immunostimulatory nucleic acid and the cyclooxygenase inhibitor is greater than Th1-like immune activation induced by administering the immunostimulatory nucleic acid alone.

98. The method of claim 97, wherein the prostaglandin is PGE2.

99. The method of claim 97, wherein the cyclooxygenase inhibitor is a nonsteroidal anti-inflammatory drug (NSAID).

100. The method of claim 97, wherein the cyclooxygenase inhibitor is a selective inhibitor of COX-2 catalytic activity.

Description:

RELATED APPLICATION

[0001] This invention claims benefit of United States Provisional Patent Application Serial No. 60/279,642, filed Mar. 29, 2001, the entire contents of which are incorporated herein by reference.

FIELD OF THE INVENTION

[0002] The present invention relates to immunostimulatory nucleic acids and methods of using the immunostimulatory nucleic acids in the treatment of non-allergic inflammation.

BACKGROUND OF THE INVENTION

[0003] Inflammation is an infiltrative type of immune cell-mediated host defense mechanism that, unlike acquired immunity, lacks both antigen specificity and antigen memory. In many respects inflammation is a type of natural or innate immunity, mediated by a combination of certain types of immune cells and secreted products of immune cells. The immune cells principally involved in inflammation include granulocytes (neutrophils, eosinosphils, and basophils), phagocytic cells (monocytes and macrophages), natural killer (NK) cells, and T lymphocytes (T cells). Monocytes and macrophages phagocytose materials foreign to the host and degrade them within lysosomes. These cells also secrete enzymes, reactive oxygen species, and lipid mediators including leukotrienes and prostaglandins, all of which can not only serve to protect the host but also can cause unwanted damage to uninvolved bystander cells. The inflammatory response further includes the recruitment and localization of neutrophils and other inflammatory cells, under the direction of cytokines and chemokines secreted by the monocytes and macrophages. Among the cytokines involved in promoting inflammation are interferon (IFN)-α, IFN-β, IFN-γ, tumor necrosis factor (TNF)-α, TNF-β, interleukin (IL)-1β, IL-6, IL-8, and IL-12. Conversely, anti-inflammatory cytokines are believed to include IL-10. Additional soluble factors released as part of the inflammatory response include certain plasma proteases, including complement; vasoactive kinins, including bradykinin; and clotting and fibrinolytic factors (factor XII and plasmin).

[0004] Allergy represents a special subtype of inflammation, usually characterized by a central role of immunoglobulin E (IgE). The immune cells principally involved in allergy include mast cells, basophils, eosinophils, and monocytes. Allergic responses are sometimes viewed as having separate phases, including acute allergic reaction, late-phase allergic reaction, and chronic allergic inflammation. Chronic allergic inflammation is more like non-allergic inflammation than the acute and late-phase allergic response. Examples of IgE-associated allergic diseases in humans include anaphylaxis, allergic rhinitis (hayfever), allergic asthma, and atopic dermatitis.

[0005] Thus inflammation may be divided broadly into allergic and non-allergic inflammation, whereby a central role of IgE is implicated in at least the acute phase of allergic inflammation. Examples of non-allergic inflammation include psoriasis, inflammatory bowel disease (IBD, including Crohn's disease and ulcerative colitis), and many types of autoimmune disease.

[0006] Two T helper (Th) lymphocyte subsets, Th1 and Th2, are defined by the cytokines they elaborate upon stimulation. Th1 and Th2 cytokines are generally viewed as reciprocally, counter-regulatory cytokines, produced by lymphocytes as well as other immune and non-immune cells, which skew a developing immune response toward either a cell-mediated Th1-type response or a humoral Th2-type response. Th1 cytokines include IFN-γ, IL-2, IL-12, IL-18, and TNF; Th2 cytokines include IL-4, IL-5, IL-10, and IL-13. Thus while many cytokines are classified neither as Th1 nor Th2, T lymphocytes can participate in the initiation and regulation of inflammation through their elaboration of cytokines, including IL-2, IL-4, IL-6, IFN-γ, TNF-α, and transforming growth factor (TGF)-β.

[0007] In addition to its role in promoting inflammation, IL-12 is a key Th1 cytokine secreted by macrophages and antigen-presenting cells (APCs). IL-12 enhances secretion of IFN-γ and proliferation of NK cells, Th1 cells, and cytotoxic T lymphocytes (CTLs). Trinchieri G (1998) Int Rev Immunol 16:365-96. IL-12 signaling occurs through a β 1 2 heterodimeric IL-12 receptor (IL-12R) which, when cross-linked, leads to activation of the kinases Jak2 and Tyk2, as well as to activation and nuclear translocation of signal transduction and activator of transcription (Stat)3 and Stat4, resulting in induction of IFN-γ and TNF.

[0008] In contrast to the proinflammatory Th1 cytokines, the Th2 cytokines IL-10 and IL-4 are believed to be anti-inflammatory cytokines inasmuch as they downregulate macrophage activation and inhibit IL-6 production.

[0009] Diseases involving non-allergic inflammation such as psoriasis, Crohn's disease, and ulcerative colitis are also believed to be caused in part by Th I-mediated immune responses. Consistent with the observation that Th1 and Th2 cytokines are reciprocally counter-regulatory, Th1 cytokines or agents that induce Th1-like immune activation are effective in treating or preventing Th2-mediated allergic inflammatory diseases such as asthma. It would be surprising, by the same reasoning, that Th1 cytokines or agents that induce Th1-like immune activation should be effective in treating or preventing Th1-mediated non-allergic inflammatory diseases.

SUMMARY OF THE INVENTION

[0010] In one aspect the invention provides a method for treating a non-allergic inflammatory disease. The method involves administering to a subject having or at risk of developing a non-allergic inflammatory disease a therapeutically effective amount of an immunostimulatory nucleic acid to treat or prevent the non-allergic inflammatory disease. In a preferred embodiment the therapeutically effective amount of an immunostimulatory nucleic acid reduces or prevents non-allergic inflammation in a tissue of the subject. The non-allergic inflammation is preferably independent of IgE crosslinking, as discussed further below.

[0011] Certain types of tissues may be involved in non-allergic inflammatory disease. According to this and other aspects of the invention, in some embodiments the non-allergic inflammatory disease involves an epithelium. In some embodiments the epithelium involved in the non-allergic inflammatory disease is a mucosal epithelium.

[0012] Certain specific diseases can be treated according to this and other aspects of the invention. In certain preferred embodiments of this and other aspects of the invention, the non-allergic inflammatory disease can include psoriasis, eczema, allergic contact dermatitis, latex dermatitis, and inflammatory bowel disease. As explained further below, allergic contact dermatitis, because it is characterized by an inflammatory response essentially independent of an IgE response, is a non-allergic inflammatory disease. In a preferred embodiment the non-allergic inflammatory disease is psoriasis. In a preferred embodiment the non-allergic inflammatory disease is allergic contact dermatitis. In a preferred embodiment the non-allergic inflammatory disease is latex dermatitis.

[0013] Certain types of immunostimulatory nucleic acid are useful according to this and other aspects of the invention. For example, in certain embodiments the immunostimulatory nucleic acid is a CpG nucleic acid, as will be defined further below. In certain embodiments the immunostimulatory nucleic acid is a methylated CpG nucleic acid. In certain embodiments the immunostimulatory nucleic acid is a T-rich nucleic acid. In certain embodiments the immunostimulatory nucleic acid is a poly-G nucleic acid. In certain embodiments in which the immunostimulatory nucleic acid is a poly-G nucleic acid, the poly-G nucleic acid includes the formula 5′-X 1 X 2 GGGX 3 X 4 -3′ wherein each of X 1 , X 2 , X 3 , and X 4 is any nucleotide other than G. In certain embodiments such poly-G nucleic acids preferably do not include any of the formulas 5′-GXGGG-3′,5′-XGGGG-3′, or 5′-GGGXG-3′, wherein X is any nucleotide. These types of immunostimulatory nucleic acids are also defined further below.

[0014] In preferred embodiments the immunostimulatory nucleic acid of this and other aspects of the invention is a synthetic nucleic acid.

[0015] Also according to preferred embodiments of this and other aspects of the invention, the immunostimulatory nucleic acid comprises at least one stabilized internucleotide linkage. Thus in certain preferred embodiments the at least one stabilized internucleotide linkage is a phosphorothioate linkage. In certain preferred embodiments the at least one stabilized internucleotide linkage is a phosphorodithioate linkage. In certain preferred embodiments the at least one stabilized internucleotide linkage is a p-ethoxy linkage. The immunostimulatory nucleic acid can in some embodiments have a backbone completely made up of stabilized internucleotide linkages, e.g., a completely phosphorothioate backbone.

[0016] Preferably, the T-rich and poly-G nucleic acids are also CpG nucleic acids. In certain embodiments the immunostimulatory nucleic acid comprises a poly-G motif (e.g., 5′-GGGG-3′) and a palindrome. Preferably, the immunostimulatory nucleic acid comprises two poly-G motifs, one 5′ and one 3′ to a centrally located palindrome sequence, with a chimeric backbone (i.e., a backbone that is partially, but not completely, composed of phosphorothioate linkages). In some embodiments, a plurality of immunostimulatory nucleic acids is administered, wherein the plurality comprises a CpG nucleic acid and a T-rich nucleic acid, or a CpG nucleic acid and a poly-G nucleic acid, a T-rich nucleic acid and a poly-G nucleic acid, a combination of different CpG nucleic acids, a combination of different poly-G nucleic acids, or a combination of different T-rich nucleic acids.

[0017] The immunostimulatory nucleic acid may be between 6 and 100 nucleotides long. In certain preferred embodiments, the immunostimulatory nucleic acid comprises between 8 and 40 nucleotides.

[0018] According to this and other aspects of the invention, in some embodiments the immunostimulatory nucleic acid induces IL-12.

[0019] According to this and other aspects of the invention, in some embodiments the immunostimulatory nucleic acid induces IFN-α.

[0020] According to this and other aspects of the invention, in some embodiments the immunostimulatory nucleic acid induces IFN-γ.

[0021] According to this and other aspects of the invention, in some embodiments the immunostimulatory nucleic acid induces IL-10.

[0022] In certain embodiments the method can employ a plurality of immunostimulatory nucleic acids, including a plurality of nucleic acids of a single type, e.g., CpG immunostimulatory nucleic acids, and a plurality of nucleic acids of different types, e.g., CpG and T-rich immunostimulatory nucleic acids. In certain embodiments, a plurality of different types of immunostimulatory nucleic acid motifs can be present either in a single oligonucleotide or in different oligonucleotides.

[0023] Different modes and routes of administration are contemplated. In some embodiments the immunostimulatory nucleic acid is administered locally to damaged epithelium. Alternatively in some embodiments the immunostimulatory nucleic acid is administered locally to intact epithelium. In certain embodiments the immunostimulatory nucleic acid is administered systemically. Preferred routes of administration include oral, parenteral, topical, subcutaneous, and transdermal administration.

[0024] The immunostimulatory nucleic acid may be administered to the subject in conjunction with administering to the subject an anti-inflammatory agent selected from the group consisting of: anti-inflammatory corticosteroids, nonsteroidal anti-inflammatory drugs (NSAIDs), salicylates, cyclooxygenase inhibitors (coxibs), vitamin A analogs, vitamin D analogs, retinoids, cytokines, agonists of cytokines, antagonists of cytokines, agonists of cytokine receptors, antagonists of cytokine receptors, cytokine receptor analogs, antibodies specific for cytokines, antibodies specific for cytokine receptors, and immunosuppressive agents, such as cyclosporine A, FK506, and methotrexate.

[0025] In another aspect the invention provides a method for treating inflammatory bowel disease. The method according to this and other aspects involves administering to a subject having or at risk of developing an inflammatory bowel disease a therapeutically effective amount of an immunostimulatory nucleic acid to treat or prevent the inflammatory bowel disease. In one embodiment of this and other aspects of the invention, the inflammatory bowel disease is ulcerative colitis. In one embodiment the inflammatory bowel disease is Crohn's disease.

[0026] In some embodiments the immunostimulatory nucleic acid is administered locally to damaged mucosal epithelium. Alternatively in some embodiments the immunostimulatory nucleic acid is administered locally to intact mucosal epithelium. In certain embodiments the immunostimulatory nucleic acid is administered systemically. Preferred routes of administration include oral, rectal, topical, and parenteral administration.

[0027] In preferred embodiments the immunostimulatory nucleic acid can be administered to the subject in conjunction with administering to the subject an anti-inflammatory agent selected from the group consisting of 5-aminosalicylate, agents containing 5-aminosalicylate, anti-inflammatory corticosteroids, NSAIDs, coxibs, cytokines, agonists of cytokines, antagonists of cytokines, agonists of cytokine receptors, antagonists of cytokine receptors, cytokine receptor analogs, antibodies specific for cytokines, antibodies specific for cytokine receptors, and immunosuppressive agents, such as cyclosporine A, FK506, and methotrexate.

[0028] A pharmaceutical composition is provided according to another aspect of the invention. The pharmaceutical composition includes an immunostimulatory nucleic acid in an effective amount for preventing or treating an immune or inflammatory response associated with a non-allergic inflammatory disease, a non-allergic inflammatory disease medicament, and a pharmaceutically acceptable carrier.

[0029] In certain embodiments the non-allergic inflammatory disease is selected from the group consisting of: psoriasis, eczema, allergic contact dermatitis, and inflammatory bowel disease. In a preferred embodiment the non-allergic inflammatory disease is psoriasis. In a preferred embodiment the non-allergic inflammatory disease is allergic contact dermatitis. In certain embodiments the non-allergic inflammatory disease is latex dermatitis.

[0030] The non-allergic inflammatory disease medicament may be any of the following: 5-aminosalicylate, agents containing 5-aminosalicylate, anti-inflammatory corticosteroids, NSAIDs, coxibs, vitamin A analogs, vitamin D analogs, retinoids, cytokines, agonists of cytokines, antagonists of cytokines, agonists of cytokine receptors, antagonists of cytokine receptors, cytokine receptor analogs, antibodies specific for cytokines, antibodies specific for cytokine receptors, and immunosuppressive agents, such as cyclosporine A, FK506, and methotrexate.

[0031] In another aspect a pharmaceutical composition suitable for topical administration is provided. The pharmaceutical composition according to this and other aspects of the invention includes an immunostimulatory nucleic acid in an effective amount for preventing or treating an immune response associated with a non-allergic inflammatory disease and a pharmaceutically acceptable carrier, formulated as a lotion, cream, ointment, gel, or transdermal patch.

[0032] In certain embodiments the non-allergic inflammatory disease is selected from the group consisting of: psoriasis, eczema, allergic contact dermatitis, and latex dermatitis. In a preferred embodiment the non-allergic inflammatory disease is psoriasis. In a preferred embodiment the non-allergic inflammatory disease is allergic contact dermatitis. In a preferred embodiment the non-allergic inflammatory disease is latex dermatitis.

[0033] In another aspect the invention provides a method of augmenting Th1-like immune activation induced by an immunostimulatory nucleic acid. The method according to this and other aspects involves contacting an immune cell with an effective amount of an immunostimulatory nucleic acid to induce Th1-like immune activation, and contacting the immune cell with an inhibitor of cyclooxygenase-2 (COX-2) expression, in an amount effective to augment Th1-like immune activation induced by the immunostimulatory nucleic acid.

[0034] In one embodiment the immunostimulatory nucleic acid is administered to a subject in need of Th1-like immune activation in an effective amount to induce Th1-like immune activation, and the inhibitor of COX-2 expression is administered to the subject in an effective amount to augment Th1-like immune activation induced by the immunostimulatory nucleic acid.

[0035] According to yet another aspect of the invention, a method of augmenting Th1-like immune activation induced by an immunostimulatory nucleic acid is provided. The method according to this and other aspects involves contacting an immune cell with an effective amount of an immunostimulatory nucleic acid to induce Th1-like immune activation, and contacting the immune cell with an agent that inhibits prostaglandin E2 (PGE 2 ) signaling through its receptor, in an amount effective to augment the Th1-like immune activation induced by the immunostimulatory nucleic acid.

[0036] In one embodiment the agent that inhibits PGE 2 signaling through its receptor is an antibody that binds specifically to PGE 2 .

[0037] In one embodiment the immunostimulatory nucleic acid is administered to a subject in need of Th1-like immune activation in an effective amount to induce Th1-like immune activation, and the agent that inhibits PGE 2 signaling through its receptor is administered to the subject in an effective amount to augment the Th1-like immune activation.

[0038] In yet another aspect, the invention provides a method of augmenting Th1-like immune activation in a subject. The method according to this and other aspects entails administering to a subject in need of Th1-like immune activation an effective amount of an immunostimulatory nucleic acid to induce Th1-like immune activation, and administering to the subject an effective amount of a cyclooxygenase inhibitor to inhibit prostaglandin expression, wherein the subject is free of symptoms of asthma or allergy otherwise calling for treatment with immunostimulatory nucleic acid, and wherein Th1-like immune activation induced by administering the immunostimulatory nucleic acid and the cyclooxygenase inhibitor is greater than Th1 -like immune activation induced by administering the immunostimulatory nucleic acid alone.

[0039] In a preferred embodiment the prostaglandin is PGE 2 .

[0040] In some embodiments the cyclooxygenase inhibitor is a nonsteroidal anti-inflammatory drug. In some embodiments the cyclooxygenase inhibitor is a selective inhibitor of COX-2 catalytic activity.

BRIEF DESCRIPTION OF THE FIGURES

[0041] FIG. 1 is a pair of bar graphs depicting PGE 2 production from oligodeoxynucleotide (ODN)-stimulated spleen cells (A) and RAW 264.7 macrophages (B), in the presence (+NS-398) or absence of cyclooxygenase 2 (COX-2) inhibitor. Control is media unsupplemented with ODN; ODN 1982 is a control ODN (SEQ ID NO:217); ODN 1826 is a CpG ODN (SEQ ID NO:63).

[0042] FIG. 2 is a trio of Western immunoblot gel images depicting the effect of ODN on COX-2 protein expression in spleen cells (A) and RAW 264.7 macrophage cells (B and C).

[0043] FIG. 3 is a graph depicting the effect of selective COX-2 inhibitor SC-58236 on CpG DNA-induced IFN-γ secretion in vivo.

DETAILED DESCRIPTION OF THE INVENTION

[0044] The present invention provides methods useful for the treatment and prevention of non-allergic inflammatory diseases, including psoriasis, eczema, allergic contact dermatitis, latex dermatitis, and inflammatory bowel disease. These diseases are believed to be caused in part by Th1-mediated immune responses. The methods involve the administration of certain immunostimulatory nucleic acids to subjects that have or are at risk of developing a non-allergic inflammatory disease. Surprisingly, the isolated immunostimulatory nucleic acids useful in the methods for treating and preventing non-allergic inflammatory diseases are known to induce or redirect an immune response toward a Th1-like type of immune response. Since CpG DNA and T-rich oligodeoxynucleotide (ODN) cause Th1-mediated immune activation, it was unexpected that these should be effective in treating these diseases. However, in addition to the Th1 effects, CpG DNA also induces counterregulatory mechanisms, including the generation of IL-10. Redford T W et al. (1998) J Immunol 161:3930-5. Also surprisingly, the isolated immunostimulatory nucleic acids useful in the methods for treating and preventing non-allergic inflammatory diseases are useful when administered systemically to a subject in need of such treatment.

[0045] The present invention also provides methods useful for enhancing a Th1-like immune response to immunostimulatory nucleic acids. It has surprisingly been discovered according to aspects of the present invention that immunostimulatory nucleic acids that induce a Th1-like immune response also induce counter-regulatory molecules, prostaglandins, that may dampen the net Th1 response. The prostaglandins are induced by immunostimulatory nucleic acid-induced up-regulation of expression of prostaglandin synthase, a key enzyme in the synthetic pathway from arachidonic acid to prostaglandin. Thus, inhibition of this pathway and of prostaglandin signaling in the context of immunostimulatory nucleic acids removes the counter-regulatory effect of prostaglandins on Th1-like immune activation.

[0046] Allergy involves the clinically adverse reaction to allergens which reflects the expression of acquired immunologic responsiveness involving allergen-specific antibodies and/or T lymphocytes. Classically, allergy was divided into four types, including type I (immediate hypersensitivity) involving IgE antibodies, and type IV (delayed-type hypersensitivity, DTH) involving sensitized T lymphocytes without any essential role for antibodies. Coombs RRA and Gell PGH (1963) The classification of allergic reactions underlying disease. In: Gell PGH and Coombs RRA, eds. Clinical Aspects of Immunology. Oxford: Blackwell Scientific Publications, pp. 317-37. As used herein, an allergic inflammatory response will refer to IgE-associated immune response that includes the development of a prominent IgE antibody response to an initiating allergen, be the allergen known or unknown. Thus as used herein an allergic inflammatory response corresponds most closely to the classical type I allergic response and does not include the classical type W allergic response (DTH).

[0047] The term “non-allergic inflammatory disease,” as used herein, refers to a disease or disorder of a subject, wherein the disease or disorder is characterized by an inflammatory response essentially independent of an IgE response. By essentially independent of an IgE response is meant that local or systemic levels of IgE, if measured, would not be significantly different from corresponding local or systemic levels in subjects without an inflammatory response. Such non-allergic inflammatory diseases or disorders typically include an inflammatory response to an antigen, which may be known or unknown, that is characterized by infiltration and activation of certain immune cells, including neutrophils, monocytes, macrophages, NK cells, and T cells and by secreted products of those cells, including but not limited to IFN, TNF, IL-1, IL-6, IL-8, and IL-12. The inflammatory response of the non-allergic inflammatory disease may be acute or chronic and it may be intermittent or recurrent. Examples of non-allergic inflammatory diseases include, without limitation, psoriasis, inflammatory bowel disease, eczema, allergic contact dermatitis, latex dermatitis, and autoimmune disorders. In some instances the non-allergic inflammatory disease may encompass chronic allergic inflammation, insofar as this entity is essentially independent of an IgE response.

[0048] The non-allergic inflammatory disease in certain preferred embodiments involves an epithelium. An epithelium is a tissue composed of closely aggregated cells that are in apposition over a large part of their surface and so form a continuous layer of cells covering and defining an external or internal surface. An epithelium may include more than one layer and more than one kind of cell. Certain tissues and organs have specialized forms of epithelium, e.g., simple, stratified and pseudostratified; squamous, cuboidal, columnar, and transitional. Epithelia may also have associated specialized structures and functions, such as microvilli, cilia, and glands. The surface of the skin, or epidermis, is a stratified squamous epithelium. In addition, the epithelium lining the gastrointestinal tract is termed a mucosal epithelium, consisting of an epithelial lining (associated and in communication with mucosal and submucosal glands) overlying a loose connective tissue layer (lamina propria) and a thin layer of smooth muscle (muscularis mucosa). Thus in certain preferred embodiments the non-allergic inflammatory disease involves the skin, and in certain preferred embodiments the non-allergic inflammatory disease involves the mucosa lining the gastrointestinal tract.

[0049] Psoriasis is a chronic inflammatory disease of the skin that affects 1-3% of the Caucasian population worldwide. Barker J N W N (1994) Bailliere's Clin Rheumatol 8:429-37. This complex disease is characterized by alterations in a variety of different cells of the skin. These include epidermal keratinocyte hyperproliferation and altered differentiation indicated by focal parakeratosis (cell nuclei in stratum corneum), aberrant expression of the hyperproliferation-associated keratin pair 6/16 (Stoler A et al. (1988) J Cell Biol 107:427-46; Weiss R A et al. (1984) J Cell Biol 98:1397-1406), involucrin and filaggrin (Bernard B A et al. (1986) Br J Dermatol 114:279-83; Dover R et al. (1987) J Invest Dermatol 89:349-52; Ishida-Yamamoto A et al. (1995) J Invest Dermatol 104:391-5), and integrin adhesion molecules (VLA-3, -5 and -6, α 6 β 4 ) (Hertle M D et al. (1992) J Clin Invest 89:1892-1901; Kellner I et al. (1991) Br J Dermatol 125:211-6). In addition, de novo expression of major histocompatibility complex (MHC) class II and intercellular adhesion molecule-1 (ICAM-1, CD54) by keratinocytes is observed (Barker J N W N et al. (1990) J Clin Invest 85:605-8; Gottlieb A B et al. (1986) J Exp Med 164:1013-28; Griffiths C E M et al. (1989) J Am Acad Dermatol 20:617-29; Nickoloff B J et al. (1990) J Invest Dermatol 94:151S-157S; Veale D et al. (1995) Br J Dermatol 132:32-8). Endothelial cells also are hyperproliferative, resulting in angiogenesis and dilation (Detmar M et al. (1994) J Exp Med 180:1141-6; Goodfield M et al. (1994) Br J Dermatol 131:808-13; Malhotra R et al. (1989) Lab Invest 61:162-8; Mordovtsev V N et al. (1989) Am J Dermatopathol 11:33-42) and express increased levels of ICAM-1, E-selectin (CD62E) and vascular cell adhesion molecule-1 (VCAM-1, CD106) (Das P K et al. (1994) Acta Derm Venereol Suppl 186:21-2) as well as MHC class II (Bjerke J R et al. (1988) Acta Derm Venereol 68:306-11). Finally, a mixed leukocytic infiltrate is seen, composed of activated T lymphocytes which produce inflammatory cytokines (Ramirez-Bosca A et al. (1988) Br J Dermatol 119:587-95; Schlaak J F et al. (1994) J Invest Dermatol 102:145-9), neutrophils within the dermis and forming Munro's microabscesses in the epidermis (Christophers E and Sterry W (1993) Psoriasis. In: Dermatology in General Medicine, T B Fitzpatrick, A Z Eisen, K Wolff, I M Freedberg and K F Austen, eds. (New York: McGraw-Hill, Inc.), pp. 489-514), and an increased number of dermal mast cells (Brody I (1986) Ups J Med Sci 91:1-16; Brody I (1984) J Invest Dermatol 82:460-4; Rothe M J et al. (1990) J Am Acad Dermatol 23:615-24; Schubert C et al. (1985) Arch Dermatol Res 277:352-8; Toruniowa B et al. (1988) Arch Dermatol Res 280:189-93; van de Kerkhof P C et al. (1995) Skin Pharmacol 8:25-9).

[0050] There is strong evidence that psoriasis is characterized by Th1 and proinflammatory cytokines. IL-2 and IFN-γ are predominant within skin lesions, while IL-4 and IL-10 are scant or absent. Uyemura K et al. (1993) J Invest Dermatol 101:701-5; Schlaak J F et al. (1994) J Invest Dermatol 102:145-9. The proinflammatory cytokines IL-1, IL-6, IL-8, and TNF-α are also present in psoriatic lesions. Ohta Y et al. (1991) Arch Dermatol Res 283:351-6; Lemster B H et al. (1995) Clin Exp Immunol 99:148-54; Nickoloff, B J et al. (1991) Am J Pathol 138:129-40; Ettehadi P et al. (1994) Clin Exp Immunol 96:146-51. Intracutaneous secretion of cytokines is thought to mediate some or all of the tissue alterations seen in psoriasis. These cytokines include TNF-α and IL-1 (Kupper T S (1990) J Clin Invest 86:1783-6); IFN-γ (Barker J N W N et al. (1991) J Dermatol Sci 2:106-11; Gottlieb A B et al. (1988) J Exp Med 167:670-5; Livden J K et al. (1989) Arch Dermatol Res 281:392-7); IL-6 (Castells-Rodellas A et al. (1992) Acta Derm Venereol 72:165-8; Grossman R M et al. (1989) Proc Natl Acad Sci USA 86:6367-71; Neuner P et al. (1991) J Invest Dermatol 97:27-33); IL-8 (Barker J N et al. (1991) Am J Pathol 139:869-76), vascular endothelial growth factor/vascular permeability factor (VEGF/VPF) (Detmar M et al. (1994) J Exp Med 180:1141-6), and TGF-α (Elder J T et al. (1989) Science 243:811-4; Gottlieb A B et al. (1988) J Exp Med 167:670-5; Prinz J C et al. (1994) Eur J Immunol 24:593-8).

[0051] Over the past decade, research into the pathophysiology of psoriasis has focused primarily on immunologic mechanisms. Evidence is accumulating that this disease has an immunological basis. However, it has not been convincingly determined if the primary defect that results in psoriasis is an immunologic disorder or resides within the epithelium (Barker J N W N (1994) Bailliere's Clin Rheumatol 8:429-38; Christophers E and Sterry W (1993) Psoriasis. In: Dermatology in General Medicine, T B Fitzpatrick, A Z Eisen, K Wolff, I M Freedberg and K F Austen, eds. (New York: McGraw-Hill, Inc.), pp. 489-514). Abnormal immune regulation is suggested by the frequent association of psoriasis with the expression of certain MHC alleles including HLA B13, B17, Bw57 and Cw6 (Russell T J et al. (1972) N Engl J Med 287:738-40; Tiilikainen A et al. (1980) Br J Dermatol 102:179-84; Watson W et al. (1972) Arch Dermatol 105:197-207; White S H et al. (1972) N Engl J Med 287:740-3), the improvement of psoriatic lesions by treatment with immunosuppressive agents such as cyclosporine A (Ellis C N et al. (1986) JAMA 256:3110-6; Mueller W et al. (1979) N Engl J Med 301:555) and the lymphocyte-specific fusion toxin DAB 389 IL-2 (Gottlieb J L et al. (1995) Nat Med 1:442-7), the possible linkage of a psoriasis susceptibility gene with a gene involved in IL-2 regulation (Tomfohrde J et al. (1994) Science 264:1141-5), and the failure of psoriasis to recur after bone marrow transplantation (Eedy D J et al. (1990) Br Med J 300:908; Jowitt S N et al. (1990) Br Med J 300:1398-9). However, underlying epidermal and/or dermal defects are suggested by altered keratinocyte cell cycle and differentiation (Gelfant S (1982) Cell Tissue Kinet 15:393-7; Weinstein G D et al. (1985) J Invest Dermatol 84:579-83), by aberrant expression of adhesion molecules by keratinocytes and endothelial cells (Das P K et al. (1994) Acta Derm Venereol Suppl 186:21-2; Nickoloff B J et al. (1990) J Invest Dermatol 94:151S-157S; Petzelbauer P et al. (1994) J Invest Dermatol 103:300-5; Veale D et al. (1995) Br J Dermatol 132:32-8; Wakita H et al. (1994) Arch Dermatol 130:457-63), and by the abnormal expression of protooncogenes within keratinocytes (Elder J T et al. (1990) J Invest Dermatol 94:19-25).

[0052] Conventional treatments for psoriasis include topical corticosteroids (hydrocortisone, betamethasone, triamcinolone, fluocinolone acetonide, fluocinonide), tar preparations, ultraviolet light (UVB, 295-310 nm, with or without tar; or UVA, 320-400 nm, with or without psoralen), vitamin A analogs (etretinate, acitretin), retinoids (tazarotene), vitamin D analogs (calcipotriol), and immunosuppressive regimens employing potentially toxic agents cyclosporine or methotrexate. Immunosuppressive agents which dampen cell-mediated immunity, including cyclosporine, methotrexate, and lymphocyte-selective toxins, are effective but often are expensive and/or associated with significant risks related to potential side effects.

[0053] At least with respect to psoriasis, the foregoing agents, both conventional and experimental, are included among what are herein termed non-allergic inflammatory disease medicaments.

[0054] Despite its name, “allergic contact dermatitis” as used herein is a non-allergic inflammatory disease because it involves a cell-mediated, delayed-type hypersensitivity (DTH) reaction rather than an IgE-associated reaction. It is to be distinguished from irritant contact dermatitis which is caused by exposure to substances that directly cause physical, mechanical, or chemical irritation of the skin. Antigens commonly involved in allergic contact dermatitis include plant oleoresins found in poison ivy, poison oak, and poison sumac; certain topical medications, including topical hydrocortisone, topical antibiotics (e.g., neomycin and bacitracin), and benzocaine; nickel in jewelry; fragrances in perfumes, cosmetics, and washing agents; wool alcohols (lanolin); components of rubber (including latex), for example associated with rubber and latex glove use; preservatives (e.g., thimerosal, formaldehyde, quaternium-15); and nail polish. Latex dermatitis, as used herein, refers to delayed-type hypersensitivity involving contact of skin or mucosa with latex. Latex dermatitis occurs commonly but not exclusively in the context of use of latex gloves, for example by health care providers and food service workers. Allergic contact dermatitis in its afferent phase involves presentation of processed antigen by Langerhans cells, professional antigen-presenting cells resident within the dermis, to CD4+T cells. The afferent phase results in the expansion of an antigen-specific T-cell clone that is primed to interact with the triggering antigen upon re-exposure. Upon their encounter with the triggering antigen, sensitized T cells that have migrated to the skin release a cascade of cytokines that leads to inflammation characteristic of allergic contact dermatitis. Conventional medicaments for allergic contact dermatitis include topical corticosteroids, topical antihistamines, and, for severe cases, systemic corticosteroids.

[0055] Inflammatory bowel disease, as used herein, includes Crohn's disease and ulcerative colitis. While the precise causes of Crohn's disease and ulcerative colitis remain uncertain, these are well described diseases with partially overlapping but nonetheless distinct clinical and pathologic features. For a review, see Glickman R M, Inflammatory bowel disease: ulcerative colitis and Crohn's disease, in Harrison's Principles of Internal Medicine, 14th Edition, A S Fauci et al. (eds.), New York, McGraw-Hill, 1998. The estimated prevalence of these diseases in the United States is about 70-150 per 100,000 for ulcerative colitis and 20-40 per 100,000 for Crohn's disease.

[0056] Ulcerative colitis, which involves primarily the colonic mucosa, with rectal involvement in nearly all cases, is a chronic and recurrent disease clinically characterized by bloody diarrhea and abdominal pain. It may be complicated by anemia, dehydration and electrolyte abnormalities, weight loss, extraintestinal manifestations including arthritis, as well as life-threatening dilation and perforation of the colon. Approximately 25 percent of patients require colectomy at some point in their disease. Patients with longstanding ulcerative colitis are also at increased risk of having or developing cancer of the colon. Characteristically, ulcerative colitis most commonly has uniform, continuous, nontransmural involvement of the colon with loss of surface epithelial cells in involved areas.

[0057] Crohn's disease may involve any portion of the gastrointestinal tract, but most commonly it involves the distal small bowel and/or the colon. It too is a chronic disease and, while its symptoms are more variable due to the potential to involve any portion of the gastrointestinal tract, Crohn's disease is more likely than ulcerative colitis to have complications and to require hospitalization. Over two-thirds of patients require surgery at some point in their disease. The bowel inflammation in Crohn's disease characteristically involves the full thickness of the bowel wall. The inflammation extends to involve the mesentery and regional lymph nodes, and this intense inflammatory process results in bowel obstruction in 20 to 30 percent of patients at some point in their disease, as well as fistula and abscess formation in many patients. Also unlike ulcerative colitis, the lesions of Crohn's disease characteristically are discontinuous along the length of the bowel.

[0058] Conventional medical approaches to treatment of inflammatory bowel disease include therapy based on sulfasalazine (AZULFIDINE®, Pharmacia & Upjohn), of which 5-aminosalicylic acid is believed to be the active component, and corticosteroids. Related 5-aminosalicylic acid products used in the treatment of ulcerative colitis include olsalazine (DIPENTUM®, Pharmacia & Upjohn) and mesalamine (ROWASA®, Solvay). Corticosteroids include prednisone and prednisolone. Other agents sometimes used in the treatment of ulcerative colitis include immunosuppressive agents cyclosporine A (SANDIMMUNE® and NEORAL®, Novartis), tacrolimus (FK506, PROGRAF®, Fujisawa), and azathioprine (IMURAN®, Faro). At least with respect to inflammatory bowel disease, these agents, as well as experimental agents mentioned elsewhere herein (other than the immunostimulatory nucleic acids of the invention), are included among what are herein termed non-allergic inflammatory disease medicaments.

[0059] Th1-like immune activation refers to induction of immune response with a preponderance of Th1 character. For example, Th1-like activation may involve induction of lymphocytes to secrete Th1-like cytokines (e.g., IFN-γ, IL-2, IL-12, IL-18, and TNF) and antibodies (e.g., IgG2a in mice). Th1-like immune activation may also involve activation and/or proliferation of NK cells, CTLs, and macrophages.

[0060] A subject in need of Th1-like immune activation is a subject that has or is at risk of developing a disease, disorder, or condition that would benefit from an immune response skewed toward Th1. Such a subject may have or be at risk of having a Th2-mediated disorder that is susceptible to Th1-mediated cross-regulation or suppression. Such disorders include, for example, certain organ-specific autoimmune diseases. Alternatively, such a subject may have or be at risk of having a Th1-deficient state. Such disorders include, for example, tumors, infections with intracellular pathogens, and AIDS. In addition, according to the present invention, such disorders also include non-allergic inflammatory disorders in which further Th1 activation is beneficial in controlling or treating the non-allergic inflammatory disorders.

[0061] An immune cell as used herein refers to a cell belonging to the immune system. Such cells include, but are not restricted to, T- and B-lymphocytes, macrophages, monocytes, neutrophils, NK cells, professional antigen-presenting cells, dendritic cells, and their precursors.

[0062] The combination of immunostimulatory nucleic acids together with NSAIDs gives a surprising degree of synergy in terms of inducing stronger Th1 responses than would have been expected from additive effects. It has been discovered according to the invention that immunostimulatory nucleic acids such as CpG ODN may cause immune cells to produce Th1 counter-regulatory molecules such as PGE 2 through activating the synthesis of COX-2. NSAIDs inhibit COX-2 activity, removing the negative effects of PGE 2 on CpG-induced immunity. As a result, CpG DNA induces a much stronger Th1-like response in the presence of NSAIDs than in their absence. The compounds do not have to be administered at the same time, and often pre-treatment with NSAIDs may be desirable prior to injection with CpG ODN. NSAID therapy may be continued after CpG therapy for several weeks to several months, depending upon the desired duration of Th1 enhancement. The combination of NSAIDs with CpG therapy is compatible with CpG monotherapy, but also immunization or combinations with monoclonal antibodies, chemotherapy, radiation therapy, and other treatments.

[0063] CpG DNA may induce the secretion of Th1 cytokines such as IL-12 and IFN-γ, as well as proinflammatory cytokines including tumor necrosis factor TNF-α, IL-6 and type I IFN. Klinman D M et al. (1996) Proc Natl Acad Sci USA 93:2879-83. In addition, CpG DNA activates NK cells to secrete IFN-γ and enhances their lytic activity. Ballas Z K et al. (1996) J Immunol 157:1840-45; Cowdery J S et al. (1996) J Immunol 156:4570-75; Chace J H et al. (1997) Clin Immunol Immunopathol 84:185-93. These studies demonstrate that CpG DNA is able to induce multiple protein mediators of the immune and inflammatory response.

[0064] Prostaglandins (PGs) are lipid mediators that are also key effectors of acute and chronic inflammation. Needleman P et al. (1997) J Rheumatol 24:6-8; Portanova J P et al. (1996) J Exp Med 184:883-91; Anderson G D et al. (1996) J Clin Invest 97:2672-79; Amin A R et al. (1999) Curr Opin Rheumatol 11:202-209; MacDermott R P (1994) Med Clin North Am 78:1207-31. Moreover, PGs are important regulators of cell-mediated immune responses. For example, PGE 2 is a potent inhibitor of Th1-type T cell responses (Betz M et al. (1991) J Immunol 146:108-13), inhibiting IFN-γ production as well as IL-12 and IL-12 receptor expression (Betz M et al. (1991) J Immunol 146:108-13; Wu C Y et al. (1998) J Immunol 161:2723-30). Exogenous PGE 2 is also a potent inhibitor of macrophage-derived inflammatory mediators, including TNF-α production (Kunkel S L et al. (1988) J Biol Chem 263:5380-84) and nitric oxide production (Corraliza I M et al. (1995) Biochem Biophys Res Commun 206:667-73).

[0065] Prostaglandins are synthesized from arachidonic acid by prostaglandin G/H synthase, also known as PG endoperoxide synthase and cyclooxygenase (COX). Prostaglandin G/H synthase exists in two isoforms, now termed cyclooxygenase-1 (COX-1) and cyclooxygenase-2 (COX-2). COX-1 is constitutively expressed in cultured endothelial cells and vascular smooth muscle cells. COX-2 is inducibly expressed in response to cytokines, growth factors, phorbol esters, lipopolysaccharide, injury and stress. The generation of other products of the arachidonic acid cascade (besides cyclooxygenase-produced metabolites) is inhibited neither by non-selective nor by COX-2 selective NSAIDs.

[0066] There are three broad classes of cyclooxygenase inhibitors: salicylates like aspirin (salicylic acid); nonselective COX inhibitors like indomethacin and other NSAIDs, and selective inhibitors of COX-2 catalytic activity (coxibs).

[0067] NSAIDs include, without limitation, diclofenac, diflunisal, fenoprofen, flurbiprofen, ibuprofen, indomethacin, ketoprofen, ketorolac, naproxen, olsalazine, oxaprozin, piroxicam, sulfasalazine, sulindac, tolmetin, salicylates, coxibs, and nitric oxide (NO)-releasing NSAIDs.

[0068] Coxibs include, but are not limited to, celecoxib (SC-58635); rofecoxib; valdecoxib; etoricoxib; nimesulide; meloxicam; NS-398; L-745,337; SC236; SC-58125; SC-58236; C-phycocyanin; BMS-279652, BMS-279654, and BMS-279655 (Zhu H et al. (2002) Proc Natl Acad Sci USA 99:3932-37), wogonin (5,7-dihydroxy-8-methoxyflavone; Wakabayashi I et al. (2000) Eur J Pharmacol 406:477-81); and nabumetone.

[0069] Inducers of COX-2 expression include TGF-β1 (Sheng H et al. (2000) J Biol Chem 275:6628-35); Ras (Sheng H et al. (1998) J Biol Chem 273:22120-27); IL-1α (Ristimaki A et al. (1994) J Biol Chem 269:11769-75); IL-1β (O'Banion M K et al. (1992) Proc Natl Acad Sci USA 89:4888-92); src oncogene product (Xie W et al. (1991) Proc Natl Acad Sci USA 88:2692-96); peroxynitrite (ONOO ; Migita K et al. (2002) Clin Exp Rheumatol 20:59-62); lipopolysaccharide (Lee S H et al. (1992) J Biol Chem 267:25934-38); epidermal growth factor (EGF, Saha D et al. (1999) Neoplasia 1:508-17); and TNF-α (Diaz A et al. (1998) Exp Cell Res 241:222-29).

[0070] COX-2 expression inhibitors include wogonin (Wakabayashi I et al. (2000) Eur J Pharmacol 406:477-81); anti-TGF-β1 antibody (Sheng H et al. (2000) J Biol Chem 275:6628-35); dexamethasone (Ristimaki A et al. (1994) J Biol Chem 269:11769-75; Ristimaki A et al. (1996) Biochem J 318:325-31); IL-4, IL-10, and IL-13 (Endo T et al. (1996) J Immunol 156:2240-46); and natriuretic peptides (Kiemer A K et al. (2002) Endocrinology 143:846-52).

[0071] At least four subtypes of PGE 2 (E-prostanoid) receptors have been reported. These include EP1, EP2, EP3, and EP4. Stimulation of the EP1 receptor results in activation of phosphatidylinositol hydrolysis and in elevation of intracellular calcium concentration. Funk C D et al. (1993) J Biol Chem 268:26767-72. EP2 and EP4 receptors increase intracellular cAMP concentration through activation of adenylate cyclase. Regan J W et al. (1994) Mol Pharmacol 46:213-20; Bastien L et al. (1994) J Biol Chem 269:11873-77. The EP3 receptor inhibits adenylate cyclase leading to a decrease of cAMP concentration. Furthermore, the EP3 receptor exists as multiple isoforms. Kotani M et al. (1995) Mol Pharmacol 48:869-79; An S et al. (1994) Biochemistry 33:14496-502; Schmid A et al. (1995) J Biochem 228:23-30.

[0072] Agents that inhibit PGE 2 signaling through its receptor include, but are not limited to, antibodies specific for PGE 2 , antibodies specific for the receptors, antisense nucleic acids specific for the receptors, and small molecule receptor antagonists. As used herein, “agents that inhibit PGE 2 signaling through its receptor” does not include cyclooxygenase inhibitors (described above). Polyclonal and monoclonal antibodies have been raised against PGE 2 . Mnich S J et al. (1995) J Immunol 155:4437-44. Antibodies have also been raised against each of the four subtypes of PGE 2 receptors. Morath R et al. 1999) J AM Soc Nephrol 10:1851-60. In addition, a number of EP antagonists have been described, including SC-19220 (EP1), ZM325802 (EP1), AH6809 (EP1 and EP2), and AH23848B (EP4). Sylvia V L et al. (2001) J Steroid Biochem Mol Biol 78:261-74; Santangelo S et al. (2000) J Trauma 48:826-30. AH6809 is 6-isopropoxy-9-oxaxanthene-2-carboxylic acid. AH23848B is [1 alpha(z), 2beta5alpha]-(+/−)-7-[5-[[(1,1′-biphenyl)-4-yl]methoxy]- 2-(4-morpholinyl)-3-oxo-cyclopentyl]-4-heptenoic acid.

[0073] An “immunostimulatory nucleic acid” as used herein is any nucleic acid containing an immunostimulatory motif or backbone that induces a Th1 immune response and/or suppresses a Th2 immune response. Immunostimulatory motifs include, but are not limited to, CpG motifs, poly-G motifs, and T-rich motifs. In one embodiment immunostimulatory motifs include CpG motifs and T-rich motifs. Immunostimulatory backbones include, but are not limited to, phosphate modified backbones, such as phosphorothioate backbones. Immunostimulatory nucleic acids have been described extensively in the prior art and a brief summary of these nucleic acids is presented below.

[0074] The terms “nucleic acid” and “oligonucleotide” are used interchangeably to mean multiple nucleotides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)). As used herein, the terms refer to oligoribonucleotides as well as oligodeoxyribonucleotides. The terms shall also include polynucleosides (i.e., a polynucleotide minus the phosphate) and any other organic base-containing polymer. Nucleic acids include vectors, e.g., plasmids as well as oligonucleotides. Nucleic acid molecules may be obtained from existing nucleic acid sources (e.g., genomic or cDNA), but are preferably synthetic (e.g., produced by oligonucleotide synthesis).

[0075] The terms nucleic acid and oligonucleotide also encompass nucleic acids or oligonucleotides with substitutions or modifications, such as in the bases and/or sugars. For example, they include nucleic acids having backbone sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3′ position and other than a phosphate group at the 5′ position. Thus modified nucleic acids may include a 2′-O-alkylated ribose group. In addition, modified nucleic acids may include sugars such as arabinose instead of ribose. Thus the nucleic acids may be heterogeneous in backbone composition thereby containing any possible combination of polymer units linked together such as peptide-nucleic acids (which have amino acid backbone with nucleic acid bases). In some embodiments, the nucleic acids are homogeneous in backbone composition. Nucleic acids also include substituted purines and pyrimidines such as C-5 propyne-modified bases. Wagner R W et al. (1996) Nat Biotechnol 14:840-4. Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, thymine, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties. Other such modifications are well known to those of skill in the art.

[0076] Exemplary immunostimulatory nucleic acids as those described herein as well as various control nucleic acids include but are not limited to those presented in Table 1. 1

TABLE 1
Oligodeoxynucleotide sequences
SEQ ID NO: OLIGODEOXYNUCLEOTIDE SEQUENCE BACKBONE
1 tctcccagcgtgcgccat s
2 ataatccagcttgaaccaag s
3 ataatcgacgttcaagcaag s
4 taccgcgtgcgaccctct s
5 ggggagggt s
6 ggggagggg s
7 ggtgaggtg s
8 tccatgtzgttcctgatgct o
9 gctaccttagzgtga o
10 tccatgazgttcctgatgct o
11 tccatgacgttcztgatgct o
12 gctagazgttagtgt o
13 agctccatggtgctcactg s
14 ccacgtcgaccctcaggcga s
15 gcacatcgtcccgcagccga s
16 gtcactcgtggtacctcga s
17 gttggatacaggccagactttgttg o
18 gattcaacttgcgctcatcttaggc o
19 accatggacgaactgtttcccctc s
20 accatggacgagctgtttcccctc s
21 accatggacgacctgtttcccctc s
22 accatggacgtactgtttcccctc s
23 accatggacggtctgtttcccctc s
24 accatggacgttctgtttcccctc s
25 ccactcacatctgctgctccacaag o
26 acttctcatagtccctttggtccag o
27 tccatgagcttcctgagtct o
28 gaggaaggigiggaigacgt o
29 gtgaaticgttcicgggict o
30 aaaaaa s
31 cccccc s
32 ctgtca s
33 tcgtag s
34 tcgtgg s
35 cgtcgt s
36 tccatgtcggtcctgagtct sos
37 tccatgccggtcctgagtct sos
38 tccatgacggtcctgagtct sos
39 tccatgtcgatcctgagtct sos
40 tccatgtcgctcctgagtct sos
41 tccatgtcgttcctgagtct sos
42 tccatgacgttcctgagtct sos
43 tccataacgttcctgagtct sos
44 tccatgacgtccctgagtct sos
45 tccatcacgtgcctgagtct sos
46 tccatgctggtcctgagtct sos
47 tccatgtzggtcctgagtct sos
48 ccgcttcctccagatgagctcatgggtttctccaccaag o
49 cttggtggagaaacccatgagctcatctggaggaagcgg o
50 ccccaaagggatgagaagtt o
51 agatagcaaatcggctgacg o
52 ggttcacgtgctcatggctg o
53 tccatgattttcctgatttt o
54 ttgtttttttgtttttttgttttt s
55 ttttttttgtttttttgttttt o
56 tgctgcttttgtgcttttgtgctt s
57 tgctgcttgtgcttttgtgctt o
58 gcattcatcaggcgggcaagaat o
59 taccgagcttcgacgagatttca o
60 gcatgacgttgagct s
61 cacgttgaggggcat s
62 ctgctgagactggag s
63 tccatgacgttcctgacgtt s
64 gcatgagcttgagctga o
65 tcagcgtgcgcc s
66 atgacgttcctgacgtt s
67 ttttggggttttggggtttt s
68 tctaggctttttaggcttcc s
69 tgcattttttaggccaccat s
70 tctcccagcgtgcgtgcgccat s
71 tctcccagcgggcgcat s
72 tctcccagcgagcgccat s
73 tctcccagcgcgcgccat s
74 ggggtgacgttcagggggg sos
75 ggggtccagcgtgcgccatggggg sos
76 ggggtgtcgttcagggggg sos
77 tccatgtcgttcctgtcgtt s
78 tccatagcgttcctagcgtt s
79 tcgtcgctgtctccgcttctt s
80 gcatgacgttgagct sos
81 tctcccagcgtgcgccatat sos
82 tccatgazgttcctgazgtt s
83 gcatgazgttgagct o
84 tccagcgtgcgccata sos
85 tctcccagcgtgcgccat o
86 gcatgtcgttgagct sos
87 tcctgacgttcctgacgtt s
88 gcatgatgttgagct o
89 gcatttcgaggagct o
90 gcatgtagctgagct o
91 tccaggacgttcctagttct o
92 tccaggagcttcctagttct o
93 tccaggatgttcctagttct o
94 tccagtctaggcctagttct o
95 tccagttcgagcctagttct o
96 gcatggcgttgagct sos
97 gcatagcgttgagct sos
98 gcattgcgttgagct sos
99 gcttgcgttgcgttt sos
100 tctcccagcgttgcgccatat sos
101 tctcccagcgtgcgttatat sos
102 tctccctgcgtgcgccatat sos
103 tctgcgtgcgtgcgccatat sos
104 tctcctagcgtgcgccatat sos
105 tctcccagcgtgcgcctttt sos
106 gctandcghhagc o
107 tcctgacgttccc o
108 ggaagacgttaga o
109 tcctgacgttaga o
110 tcagaccagctggtcgggtgttcctga o
111 tcaggaacacccgaccagctggtctga o
112 gctagtcgatagc o
113 gctagtcgctagc o
114 gcttgacgtctagc o
115 gcttgacgtttagc o
116 gcttgacgtcaagc o
117 gctagacgtttagc o
118 tccatgacattcctgatgct o
119 gctagacgtctagc o
120 ggctatgtcgttcctagcc o
121 ggctatgtcgatcctagcc o
122 ctcatgggtttctccaccaag o
123 cttggtggagaaacccatgag o
124 tccatgacgttcctagttct o
125 ccgcttcctccagatgagctcatg o
126 catgagctcatctggaggaagcgg o
127 ccagatgagctcatgggtttctcc o
128 ggagaaacccatgagctcatctgg o
129 agcatcaggaacgacatgga o
130 tccatgacgttcctgacgtt 2ome
131 gcgcgcgcgcgcgcgcgcg o
132 ccggccggccggccggccgg o
133 ttccaatcagccccacccgctctggccccaccctcaccctcca o
134 tggagggtgagggtggggccagagcgggtggggctgattggaa o
135 tcaaatgtgggattttcccatgagtct o
136 agactcatgggaaaatcccacatttga o
137 tgccaagtgctgagtcactaataaaga o
138 tctttattagtgactcagcacttggca o
139 tgcaggaagtccgggttttccccaacccccc o
140 ggggggttggggaaaacccggacttcctgca o
141 ggggactttccgctggggactttccagggggactttcc sos
142 tccatgacgttcctctccatgacgttcctctccatgacgttcctc o
143 gaggaacgtcatggagaggaacgtcatggagaggaacgtcatgga o
144 ataatagagcttcaagcaag s
145 tccatgacgttcctgacgtt s
146 tccatgacgttcctgacgtt sos
147 tccaggactttcctcaggtt s
148 tcttgcgatgctaaaggacgtcacattgcacaatcttaataaggt o
149 accttattaagattgtgcaatgtgacgtcctttagcatcgcaaga o
150 tcctgacgttcctggcggtcctgtcgct o
151 tcctgtcgctcctgtcgct o
152 tcctgacgttgaagt o
153 tcctgtcgttgaagt o
154 tcctggcgttgaagt o
155 tcctgccgttgaagt o
156 tccttacgttgaagt o
157 tcctaacgttgaagt o
158 tcctcacgttgaagt o
159 tcctgacgatgaagt o
160 tcctgacgctgaagt o
161 tcctgacggtgaagt o
162 tcctgacgtagaagt o
163 tcctgacgtcgaagt o
164 tcctgacgtggaagt o
165 tcctgagcttgaagt o
166 gggggacgttggggg o
167 tcctgacgttccttc o
168 tctcccagcgagcgagcgccat s
169 tcctgacgttcccctggcggtcccctgtcgct o
170 tcctgtcgctcctgtcgctcctgtcgct o
171 tcctggcggggaagt o
172 tcctgazgttgaagt o
173 tcztgacgttgaagt o
174 tcctagcgttgaagt o
175 tccagacgttgaagt o
176 tcctgacggggaagt o
177 tcctggcggtgaagt o
178 ggctccggggagggaatttttgtctat o
179 atagacaaaaattccctccccggagcc o
180 tccatgagcttccttgagtct 2ome
181 tcgtcgctgtctccgcttctt so
182 tcgtcgctgtctccgcttctt s2o
183 tcgagacattgcacaatcatctg o
184 cagattgtgcaatgtctcga o
185 tccatgtcgttcctgatgcg o
186 gcgatgtcgttcctgatgct o
187 gcgatgtcgttcctgatgcg o
188 tccatgtcgttccgcgcgcg o
189 tccatgtcgttcctgccgct o
190 tccatgtcgttcctgtagct o
191 gcggcgggcggcgcgcgccc o
192 atcaggaacgtcatgggaagc o
193 tccatgagcttcctgagtct p-ethoxy
194 tcaacgtt p-ethoxy
195 tcaagctt p-ethoxy
196 tcctgtcgttcctgtcgtt s
197 tccatgtcgtttttgtcgtt s
198 tcctgtcgttccttgtcgtt s
199 tccttgtcgttcctgtcgtt s
200 btccattccatgacgttcctgatgcttcca os
201 tcctgtcgttttttgtcgtt s
202 tcgtcgctgtctccgcttctt s
203 tcgtcgctgtctgcccttctt s
204 tcgtcgctgttgtcgtttctt s
205 tcctgtcgttcctgtcgttggaacgacagg o
206 tcctgtcgttcctgtcgtttcaacgtcaggaacgacagga o
207 ggggtctgtcgttttgggggg sos
208 ggggtctgtgcttttgggggg sos
209 tccggccgttgaagt o
210 tccggacggtgaagt o
211 tcccgccgttgaagt o
212 tccagacggtgaagt o
213 tcccgacggtgaagt o
214 tccagagcttgaagt o
215 tccatgtzgttcctgtzgtt s
216 ggggttgacgttttgggggg sos
217 tccaggacttctctcaggtt s
218 tttttttttttttttttttt s
219 tccatgccgttcctgccgtt s
220 tccatggcgggcctggcggg s
221 tccatgacgttcctgccgtt s
222 tccatgacgttcctggcggg s
223 tccatgacgttcctgcgttt s
224 tccatgacggtcctgacggt s
225 tccatgcgtgcgtgcgtttt s
226 tccatgcgttgcgttgcgtt s
227 btccattccattctaggcctgagtcttccat os
228 tccatagcgttcctagcgtt o
229 tccatgtcgttcctgtcgtt o
230 tccatagcgatcctagcgat o
231 tccattgcgttccttgcgtt o
232 tccatagcggtcctagcggt o
233 tccatgattttcctgcagttcctgatttt
234 tccatgacgttcctgcagttcctgacgtt s
235 ggcggcggcggcggcggcgg o
236 tccacgacgttttcgacgtt s
237 tcgtcgttgtcgttgtcgtt s
238 tcgtcgttttgtcgttttgtcgtt s
239 tcgtcgttgtcgttttgtcgtt s
240 gcgtgcgttgtcgttgtcgtt s
241 czggczggczgggczccgg o
242 gcggcgggeggcgcgcgccc s
243 agicccgigaacgiattcac o
244 tgtcgtttgtcgtttgtcgtt s
245 tgtcgttgtcgttgtcgttgtcgtt s
246 tcgtcgtcgtcgtt s
247 tgtcgttgtcgtt s
248 cccccccccccccccccccc s
249 tctagcgtttttagcgttcc sos
250 tgcatcccccaggccaccat s
251 tcgtcgtcgtcgtcgtcgtcgtt sos
252 tcgtcgttgtcgttgtcgtt sos
253 tcgtcgttttgtcgttttgtcgtt sos
254 tcgtcgttgtcgttttgtcgtt sos
255 ggggagggaggaacttcttaaaattcccccagaatgttt o
256 aaacattctgggggaattttaagaagttcctccctcccc o
257 atgtttacttcttaaaattcccccagaatgttt o
258 aaacattctgggggaattttaagaagtaaacat o
259 atgtttactagacaaaattcccccagaatgttt o
260 aaacattctgggggaattttgtctagtaaacat o
261 aaaattgacgttttaaaaaa sos
262 ccccttgacgttttcccccc sos
263 ttttcgttgtttttgtcgtt
264 ctgcagcctgggac o
265 acccgtcgtaattatagtaaaaccc o
266 ggtacctgtggggacattgtg o
267 agczaccgaacgtgagagg o
268 tccatgccgttcctgccgtt o
269 tccatgacggtcctgacggt o
270 tccatgccggtcctgccggt o
271 tccatgcgcgtcctgcgcgt o
272 ctggtctttctggtttttttctgg s
273 tcaggggtggggggaacctt sos
274 tccatgazgttcctagttct o
275 tccatgatgttcctagttct o
276 cccgaagtcatttcctcttaacctgg o
277 ccaggttaagaggaaatgacttcggg o
278 tcctggzggggaagt o
279 gzggzgggzggzgzgzgccc
280 tccatgtgcttcctgatgct o
281 tccatgtccttcctgatgct
282 tccatgtcgttcctagttct
283 tccaagtagttcctagttct o
284 tccatgtagttcctagttct o
285 tcccgcgcgttccgcgcgtt s
286 tcctggcggtcctggcggtt s
287 tcctggaggggaagt o
288 tcctgggggggaagt o
289 tcctggtggggaagt o
290 tcgtcgttttgtcgttttgtcgtt o
291 ctggtctttctggtttttttctgg o
292 tccatgacgttcctgacgtt o
293 tccaggacttctctcaggtt sos
294 tzgtzgttttgtzgttttgtzgtt o
295 btczgtcgttttgtcgttttgtcgttttttt os
296 gctatgacgttccaaggg s
297 tcaacgtt s
298 tccaggactttcctcaggtt o
299 ctctctgtaggcccgcttgg s
300 ctttccgttggacccctggg s
301 gtccgggccaggccaaagtc s
302 gtgcgcgcgagcccgaaatc s
303 tccatgaigttcctgaigtt s
304 aatagtcgccataacaaaac o
305 aatagtcgccatggcggggc o
306 btttttccatgtcgttcctgatgcttttt os
307 tcctgtcgttgaagtttttt o
308 gctagctttagagctttagagctt o
309 tgctgcttcccccccccccc o
310 tcgacgttcccccccccccc o
311 tcgtcgttcccccccccccc o
312 tcgccgttcccccccccccc o
313 tcgtcgatcccccccccccc o
314 tcctgacgttgaagt s
315 tcctgccgttgaagt s
316 tcctgacggtgaagt s
317 tcctgagcttgaagt s
318 tcctggcggggaagt s
319 aaaatctgtgcttttaaaaaa sos
320 gatccagtcacagtgacctggcagaatctggat o
321 gatccagattctgccaggtcactgtgactggat o
322 gatccagtcacagtgactcagcagaatctggat o
323 gatccagattctgctgagtcactgtgactggat o
324 tcgtcgttccccccczcccc o
325 tzgtzgttcccccccccccc o
326 tzgtcgttcccccccccccc o
327 tcgtzgttcccccccccccc o
328 tcgtcgctcccccccccccc o
329 tcgtcggtcccccccccccc o
330 tcggcgttcccccccccccc o
331 ggccttttcccccccccccc o
332 tcgtcgttttgacgttttgtcgtt s
333 tcgtcgttttgacgttttgacgtt s
334 ccgtcgttcccccccccccc o
335 gcgtcgttcccccccccccc o
336 tcgtcattcccccccccccc o
337 acgtcgttcccccccccccc o
338 ctgtcgttcccccccccccc o
339 btttttcgtcgttcccccccccccc os
340 tcgtcgttccccccccccccb o
341 tcgtcgttttgtcgttttgtcgttb o
342 tccagttccttcctcagtct o
343 tzgtcgttttgtcgttttgtcgtt o
344 tcctggaggggaagt s
345 tcctgaaaaggaagt s
346